CN108441520B

CN108441520B - Gene conditional knockout method constructed by using CRISPR/Cas9 system

Info

Publication number: CN108441520B
Application number: CN201810300747.7A
Authority: CN
Inventors: 任文燕; 戴红霞; 武龙飞; 张文胜
Original assignee: Suzhou University
Current assignee: Suzhou University
Priority date: 2018-04-04
Filing date: 2018-04-04
Publication date: 2020-07-31
Anticipated expiration: 2038-04-04
Also published as: CN108441520A

Abstract

The invention relates to a gene conditional knockout method constructed by using a CRISPR/Cas9 system, which comprises the steps of selecting L oxP-antibiotic-L oxP and FRT-antibiotic-FRT-L oxP sequences at the left side and the right side of a region to be knocked out respectively, selecting left and right homologous arms at the upper and lower streams of the region to be knocked out, amplifying, purifying, digesting, connecting and converting to obtain a left targeting plasmid and a right targeting plasmid, sequentially introducing Cas9 plasmids, knockout region left or right targeting plasmids and corresponding gRNA expression plasmids into target cells or simultaneously introducing the plasmids into the target cells, screening by using antibiotics after transfection to screen target cells simultaneously inserted with the left and right targeting sequences, respectively inducing Cre-L oxP and F L P-FRT mediated homologous recombination by using 4-OHT and introducing loxp sites at the left side and the right side of the region to be knocked out respectively, and inducing Cre-L oxP mediated homologous recombination by using 4-OHT to obtain a clone of a target fragment to be knocked out.

Description

Gene conditional knockout method constructed by using CRISPR/Cas9 system

Technical Field

The invention relates to the technical field of gene knockout, in particular to a conditional gene knockout method constructed by using CRISPR/Cas9 and Cre-L oxP systems.

Background

Gene knockout technology is an irreplaceable component in the construction of transgenic animals. The expression of the gene has temporal and spatial specificity, and gene editing in a mode of knocking out and replacing key genes in vivo often causes the death of animal embryos and hinders the functional research of the genes. The advent of conditional knock-out methods has solved the above-mentioned problems by allowing expression or deletion of a target gene to occur at a particular stage of animal development or in a particular tissue organ. The conditional gene knockout technology is used as a new generation gene knockout technology, can realize the specific expression of genes in space and time, and has obvious advantages and wide application prospect compared with constitutive gene knockout.

The traditional gene conditional knockout method utilizes recombinase recognition sites with site specificity inserted at two ends of a target knockout sequence to obtain an invalid allele by deletion or inversion of sequences at two sides under the induction of a recombinase. Thus, recombinase-mediated conditional knockdown becomes a valuable tool for studying gene function in specific cell types and different developmental stages. However, this conditional knockout technique requires a lot of time and effort in constructing a vector, and not only the techniques such as BAC cloning and gene recombination are used, but also methods such as long-fragment PCR and Northern are required for genotyping, and the knockout efficiency is relatively low.

The Cre recombinase is a relatively stable protein and can act under different tissues and different physiological conditions of organisms, so that the coding gene of the Cre recombinase can be placed under the control of a tissue and organ specific promoter, the recombinase is induced to be expressed under different cells, tissues and organs of the organisms and different developmental stages or different physiological conditions, and further acts, the Cre recombinase is a 34bp long DNA sequence, and comprises two 13bp inverted repeat sequences and an 8bp core sequence.

The gene conditional knockout technology based on Cre/loxP system needs two steps: (1) introducing loxP sequence into the genome of the cell, constructing a targeting vector and screening homologous recombination cells. (2) Target gene editing is achieved by Cre-mediated recombination. The Cre/loxP system can recognize loxP sites by Cre recombinase at cellular level to excise target genes, can simultaneously hybridize transgenic animals containing loxP with Cre transgenic animals at individual level to obtain target gene conditional knockout animals, or can place Cre genes under the control of inducible promoters to excise genes between the loxP sites by inducing and expressing the Cre recombinase (induced gene knockout), thereby realizing the knockout of the target genes at specific time or in specific tissues. The gene conditional knockout cell or transgenic animal constructed by the Cre/loxP system avoids embryo lethal effect caused by complete knockout of certain genes, and is widely applied to the fields of immunology, animal disease model construction, disease-related gene function identification and the like.

Although the Cre/loxP system is well established in theory, there are still deficiencies and limitations in practical applications:

(1) conditional gene knockout by Cre/loxP technology firstly constructs a targeting vector, amplifies a homology arm with the length of about 4-5kb, and simultaneously needs BAC cloning and gene recombination technology. The loxP fragment is targeted and introduced into the cell genome, the probability of homologous recombination in the step is extremely low, and the cells which are successfully targeted can be identified by complex screening work such as long-fragment PCR and Northern hybridization. Therefore, this step requires much time and effort, and is a rate-limiting step for conditional gene knockout using the Cre/loxP system.

(2) Cre enzyme has certain potential toxicity after being expressed in mammals as an exogenous recombinase, and can cause the problems of abnormal cell proliferation, DNA mismatching, chromosome deletion and the like.

(3) The Cre/loxP system has the cutting efficiency of about 70 percent, a small amount of knocked-out genes in target organs or tissues are not knocked out, and the target genes which are not knocked out can be expressed in a trace amount in specific organs or tissues.

The CRISPR/Cas9 technology is a novel gene editing technology and is an important tool for animal genetic modification and gene function research. The CRISPR/Cas9 technology mainly functions through the nuclease Cas9, and Cas9 can cleave a target gene under the guidance of sgRNA (guide RNA) chemically synthesized or vector expressed, resulting in target gene double-stranded DNA break. DNA damage can initiate the repair mechanism in cells, one is Non-homologous end joining (NHEJ) with low fidelity, and this repair mechanism is very prone to errors, resulting in deletion or insertion of bases after repair, thereby causing frame shift mutation, and finally achieving the purpose of gene knockout. The second DNA break repair pathway is homology-mediated repair (HR), and this repair mechanism based on homologous recombination has high fidelity but low occurrence probability, and can greatly improve the efficiency of homologous recombination after the DNA is cut by the target nuclease under the condition of providing an exogenous repair template. The RNA-DNA recognition mechanism of the CRISPR-Cas9 system provides a simple and powerful tool for genome engineering research, and the other important advantage of the system is that the Cas9 protein can simultaneously target a plurality of genome sites under the guide of a plurality of different gRNAs, and the high-efficiency genome editing function of the CRISPR-Cas system is applied to a plurality of organisms including monkeys, pigs, rats, caenorhabditis elegans, plants and bacteria.

In conclusion, the traditional recombinase-mediated conditional gene knockout method adopts gene recombination under natural conditions, and the recombination efficiency is low. According to the traditional Cre/loxP system, loxP sites are inserted into a genome, the homologous arms are long, the efficiency of homologous recombination is low, and the efficiency of conditional gene knockout is greatly influenced.

Disclosure of Invention

In order to solve the technical problems, the invention aims to provide a conditional gene knockout method constructed based on a CRISPR/Cas9 system, which simplifies and accelerates the conditional gene knockout process, and greatly improves the efficiency and convenience of the traditional conditional gene knockout.

The invention provides a conditional gene knockout method constructed by using a CRISPR/Cas9 system, which comprises the following steps:

(1) constructing a target gene left targeting plasmid and a target gene right targeting plasmid:

respectively selecting L oxP-antibiotic-L oxP sequence insertion sites and FRT-antibiotic-FRT-L oxP sequence insertion sites on the left side and the right side of a knockout region, respectively selecting 500bp-1kb left and right homologous arms on the upstream and downstream of the insertion sites, amplifying the left and right homologous arms by a PCR method, purifying, and respectively inserting the left arm fragment and the right arm fragment into L oxP-antibiotic-L oxP or FRT-antibiotic-FRT-L oxP targeting plasmids by restriction enzyme digestion, connection, transformation and other steps to obtain left targeting plasmids and right targeting plasmids;

(2) designing a first gRNA corresponding to a left targeted plasmid and/or a second gRNA corresponding to a right targeted plasmid through a website http:// criprpr. mit. edu: 8079/;

(3) transferring the Cas9 plasmid, the first gRNA expression plasmid and the left targeting plasmid into a target cell at the same time, screening by using antibiotics after transfection for 48-72 hours, and screening a target cell with a biallelic gene introduced into a L oxP-antibiotic-L oxP fragment by a PCR genotype identification method after treatment for 5-9 days;

(4) treating target cells of the biallelic gene introduced L oxP-antibiotic-L oxP fragment with 4-hydroxy tamoxifen (4-OHT) for 3-6 days to induce Cre-L oxP mediated homologous recombination, so that only L oxP sites remain in the L oxP-antibiotic-L oxP fragment, and obtaining target cells of L oxP biallelic gene introduction;

(5) transferring the Cas9 plasmid, the second gRNA expression plasmid and the right targeting plasmid into target cells introduced by the L oxP double alleles obtained in the step (4) at the same time, performing cell selection by using antibiotics after transfecting for 24-72 hours, and screening the target cells introduced by inserting the FRT-antibiotic-FRT-L oxP fragment double alleles after selecting for 5-9 days;

(6) treating the cells obtained in the step (5) with adriamycin (Doxycycline) for 3-6 days to induce F L P-FRT mediated homologous recombination, screening target cells subjected to FRT-L oxP double allele targeted introduction in the right side of the region to be knocked out, wherein two sides of the region to be knocked out are surrounded by L oxP, and the target cells are referred to as Floxed cells for short;

(7) and (3) treating the cells treated in the step (6) with 4-hydroxy tamoxifen for 3-6 days, and inducing Cre-L oxP mediated homologous recombination to knock out the target gene.

Further, in step (1), the knockout region is a DNA fragment such as a regulatory region (promoter, enhancer, etc.) of the target gene, noncoding RNA, or a intergenic region of the target gene.

Further, in step (1), the left arm was digested with KpnI and EcoRI restriction enzymes, and the right arm was digested with BamHI and SacII.

Further, in step (1), high fidelity DNA polymerase such AS Phusion DNA polymerase (M0530S, NEB), FastPfu DNA polymerase (AS221-01, all-round gold) or Vent DNA polymerase is used for amplification.

Further, in step (1), purification is performed using a DNA purification kit such as AxyPrep PCR purification kit or OMEGA gel recovery kit.

Further, in step (2), the first gRNA or the second gRNA is designed using the website address http:// criprpr.mit.edu: 8079/gRNA bioinformatics.

Further, in step (3), the target cell is a mammalian cell, such as a mouse embryonic stem cell, a human embryonic stem cell, Hela, 293T, or the like.

Further, in steps (3) to (7), the screening method is to pick up a single colony and amplify it in a 96-well plate, followed by genotyping.

Further, in steps (1), (3), (4), (5) and (6), the antibiotic is neomycin, hygromycin or puromycin the antibiotic in step (3) is identical to the antibiotic in the L oxP-antibiotic-L oxP sequence and the antibiotic in step (5) is identical to the antibiotic in the FRT-antibiotic-FRT-L oxP sequence.

Further, the concentration of neomycin (G418) was 200. mu.g/m L-300. mu.g/m L.

Further, the concentration of hygromycin is 50-1000. mu.g/ml.

Further, the concentration of puromycin is 1 to 10. mu.g/ml.

Further, in the step (6), the concentration of doxorubicin was 0.8. mu.g/m L-1.2. mu.g/m L.

Further, in step (4) and step (7), the concentration of 4-hydroxytamoxifen is 0.8 μ M to 1.2 μ M.

By the scheme, the invention at least has the following advantages:

according to the invention, CRISPR/Cas9 technology is used for mediating homologous recombination, and recombinase recognition sites are inserted into a genome region, so that the gene recombination efficiency is improved, and the time and labor cost are saved.

The invention overcomes the defects of long homologous arm, low efficiency of homologous recombination and low efficiency of conditional gene knockout of the traditional Cre/loxP system in the gene knockout process. Through CRISPR/Cas9 mediated homology directed repair, loxP site elements can be inserted around a target genome region only by designing a short homology arm, and conditional knockout clones of several genes can be generated through a simple method.

The CRISPR/Cas9 technology can mediate higher homologous recombination efficiency in the human embryonic stem cell, thereby greatly improving the success rate of L oxP locus targeted introduction of a knockout region and providing convenient conditions for researching the regulation function of key genes in the human embryonic stem cell.

The foregoing description is only an overview of the technical solutions of the present invention, and in order to make the technical solutions of the present invention more clearly understood and to implement them in accordance with the contents of the description, the following detailed description is given with reference to the preferred embodiments of the present invention and the accompanying drawings.

Drawings

FIG. 1 is a schematic flow chart of the gene conditional knockout method constructed by using CRISPR/Cas9 system (antibiotic using neomycin);

FIG. 2 is a map of the targeting vector L N L and FNF L used in examples 1 and 2 of the present invention;

FIG. 3 shows the results of example 1 of the present inventionEedA gene knockout scheme;

FIG. 4 shows the genotype identification of the Eed knockout clone in example 1 of the present invention;

FIG. 5 shows the sequencing result of the Eed knockout clone in example 1 of the present invention;

FIG. 6 shows the sequencing results of the SRCAP knockout clone in example 2 of the present invention.

Detailed Description

The following detailed description of embodiments of the present invention is provided in connection with the accompanying drawings and examples. The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.

In the following examples of the invention, neomycin was selected for both the antibiotics in the L oxP-antibiotic-L oxP sequence and in the FRT-antibiotic-FRT-L oxP sequence, and thus were abbreviated as L N L and FNF L, respectively.

Example 1

The embodiment provides a method for selectively knocking out Eed gene (target gene) in mouse embryonic stem cells (target cells), which specifically comprises the following steps:

(1) the Eed gene left targeting plasmid is constructed by selecting L N L sequence to be inserted into a proper position at the upstream of No.2 exon of Eed gene, selecting left and right homologous arms in the range of 500bp to 1kb respectively at the upstream and downstream of the position, amplifying L N L sequence to be inserted into the left and right homologous arms of the position by using high-fidelity Phusion DNA polymerase (M0530S, NEB), purifying by using an AxyPrep PCR purification kit, digesting PCR products by using Kpn I and EcoRI restriction enzymes at the left arm, digesting by using BamH I and Sac II at the right arm, inserting into a plasmid containing L N L sequence, and constructing the target gene left targeting plasmid.

(2) A gRNA corresponding to a target gene left targeting plasmid is designed by using a website address http:// criprpr. mit. edu:8079/gRNA bioinformatics website, the nucleotide sequence of the gRNA is shown as SEQ ID No.1-SEQ ID No. 2. Eed-L N L targeting gRNA-1: GGCTTCACTCTAACGACTGT (SEQ ID No.1), Eed-L N L targeting gRNA-2: AGTCGTTAGAGTGAAGCCCA (SEQ ID No. 2). The specific construction method comprises the steps of firstly synthesizing new primers according to the sequence of a protective base, an identification site, an enzyme cutting site, an sgRNA and a U6 promoter primer, then using a PG L3 vector as a template to amplify a target gene containing a U6 promoter and the sgRNA, finally purifying and connecting a PCR product after enzyme digestion with a PG L3-U6-2 sgRNA-puro vector which is subjected to the same enzyme digestion to obtain a gRNA expression vector.

(3) Eed left targeting plasmid is integrated into genome, Cas9 plasmid, expression plasmid of gRNA constructed in step (2) and target gene left targeting plasmid are transferred into target cell simultaneously, cell selection is carried out with L G418 with the concentration of 250 mug/m 48 hours after transfection, single colony is picked up and amplified in 96-well plate for subsequent genotyping after 6 days of G418 selection, cells successfully inserted with target gene left targeting plasmid are selected, embryonic stem cell culture conditions are 37 ℃, 5% carbon dioxide incubator culture conditions are

(4) And Cre enzyme-mediated cell homologous recombination, namely treating the cells in which the target plasmid on the left side of the target gene is successfully inserted by 4-OHT (H7904, Sigma) with the concentration of 1 mu M for 5 days, inducing Cre-L oxP-mediated homologous recombination, picking individual colonies for PCR genotyping, and confirming that the loxp site is successfully inserted on the left side of the target gene.

(5) Eed right targeting plasmid is constructed by selecting FNF L sequence to be inserted into a right position of a target gene, selecting left and right homologous arms of the range of 500bp to 1kb respectively at the upper and lower reaches of the right position, amplifying the left and right homologous arms of the FNF L sequence to be inserted into the position by using high-fidelity Phusion DNA polymerase (M0530S, NEB), purifying by using an AxyPrep PCR purification kit, digesting PCR products by using Kpn I and EcoRI restriction enzymes at the left arm, digesting the right arm by using BamH I and Sac II, inserting the right arm into a plasmid containing the FNF L sequence, and constructing Eed right targeting plasmid.

(6) A gRNA corresponding to a right targeting plasmid of a target gene is designed by utilizing a website address http:// crispr. mit. edu:8079/gRNA bioinformatics website, the nucleotide sequence of the gRNA is shown as SEQ ID No.3-SEQ ID No.4, Eed-FNF L targeting gRNA-1: TGTGTAAAGGCCGGCTTACC (SEQ ID No.3), Eed-FNF L targeting gRNA-2: AGGCCGGCTTACCAGGCACG (SEQ ID No. 4).

(7) Eed right targeting plasmid is integrated into genome, Cas9 plasmid, expression plasmid of gRNA constructed in step (6) and Eed right targeting plasmid are transferred into target cells of target gene left side successfully inserted into loxp site at the same time, cell selection is carried out 48 hours after transfection with G418 with concentration of 250 mug/m L, after 6 days of G418 selection, single colony is picked and amplified in 96-well plate for subsequent genotyping, and cells of target gene left and right targeting plasmid are selected successfully inserted.

(8) And (3) F L IP enzyme mediated cell homologous recombination, namely treating the cells successfully inserted with the left and right targeting plasmids of the target gene in the step (7) by doxycycline (doxycycline) for 5 days, inducing F L P-FRT mediated homologous recombination, selecting an individual colony for PCR genotype identification, and confirming that the loxp site is successfully inserted into both the left side and the right side of the Eed gene.

(9) And Cre enzyme mediated cell homologous recombination, namely treating cells with the left side and the right side of a target gene successfully inserted into loxP sites by 4-OHT with the concentration of 1 mu M for 5 days, inducing Cre-L oxP mediated homologous recombination, selecting an individual colony for PCR genotyping, and successfully knocking out Eed gene in the embryonic stem cells of mice.

Example 2

The embodiment provides a method for conditionally knocking out an SRCAP gene (target gene) in a mouse embryonic stem cell (target cell), which specifically comprises the following steps:

(1) constructing L N L targeting plasmid on the left side of SRCAP gene knockout region, selecting No. 5-8 exon of SRCAP gene as target knockout region, using upstream position of No.5 exon as L N L insertion site, firstly using mouse genome as template, using Pusion high-fidelity DNA polymerase to amplify left and right homologous arms with size of 500bp to 1kb on upstream and downstream of insertion site, then using AxyPrep PCR purification kit to purify, then using Kpn I and EcoRI restriction enzyme to digest left arm PCR purified product, using BamH I and Sac II to digest right arm, then connecting two homologous arms to L N L vector in turn to obtain L N L plasmid on the left side of target knockout region.

(2) Designing gRNA-1 corresponding to a target plasmid on the left side of a target knockout area of the SRCAP gene by using a website address http:// criprpr.mit.edu: 8079/gRNA bioinformatics website: AGGTAGTATCCCTAAGTAGT (SEQ ID No.5), sgRNA-2: ATCTCTTAGCCAACTACTTA (SEQ ID No. 6).

(3) And (3) integrating a target plasmid L N L box at the left side of the target knockout region into a genome, namely simultaneously electrically transferring a Cas9 plasmid, the expression plasmid of the gRNA constructed in the step (2) and the L N L target plasmid into a target cell, carrying out transfection for 48 hours, then carrying out screening by using G418 with the concentration of 250 mug/m L, culturing the embryonic stem cell in an incubator at 37 ℃ and containing 5% of carbon dioxide, keeping certain humidity, and after 6 days of G418 selection, picking out a single colony and amplifying the single colony in a 96-well plate for subsequent genotype identification, and obtaining a cell with a biallelic gene targeted-introduced L N L sequence in the genome.

(4) Cre enzyme-mediated homologous recombination of cells obtained by screening in step (3) with 4-OHT (Sigma, H7904) at a concentration of 1. mu.M for 5 days, culturing the cells in an incubator at 37 ℃ and containing 5% carbon dioxide under a certain humidity to induce Cre-L oxP-mediated homologous recombination, and selecting a single colony for PCR genotyping to confirm the L oxP biallel gene insertion on the cell genome.

(5) Deletion of drug resistance against neomycin trap the L N L trap-deleted cells obtained in step (4) were expanded in two portions, one portion was treated with G418 at a concentration of 250. mu.g/m L for 3 days, the other portion was not medicated, cell death by the medicated treatment was observed, L N L trap in the cells was confirmed to be deleted, and non-medicated cells were used for the subsequent experiments.

(6) The right FNF L targeting plasmid of the target knockout region is constructed, wherein a FNF L sequence to-be-inserted site is selected at the downstream position of No.8 exon of a target gene SRCAP, firstly, a mouse genome is used as a template, a Pusion high-fidelity DNA polymerase (M0530S, NEB) is used for amplifying left and right homologous arms with the size of 500bp to 1kb at the upstream and downstream positions of the inserted site, then, an AxyPrepPCR purification kit is used for purification, then, a FNI and EcoRI restriction endonuclease are used for digesting a PCR purified product of the left arm, a BamHI and SacII are used for digesting the right arm, and then, the two homologous arms are sequentially connected to a FNF L vector to obtain the right FNF L plasmid of the target SRCAP target knockout region.

(7) Designing gRNA-1 corresponding to a right targeting plasmid of a knockout region of an SRCAP gene by using a website address http:// criprp. mit. edu:8079/gRNA bioinformatics website: GAGCTCAAGCCGCAGTTCGC (SEQ ID No.7) and gRNA-2: AGTGGGGATCCTGCGAACTG (SEQ ID No.8), thereby constructing a sgRNA expression plasmid.

(8) And (3) integrating the right targeting plasmid FNF L of the target knockout region into the genome, simultaneously transferring the Cas9 plasmid, the gRNA expression plasmid constructed in the step (7) and the FNF L targeting plasmid constructed in the step (6) into target cells successfully inserted into a L oxP site at the left side of the target knockout region, carrying out cell screening by using G418 with the concentration of 250 mug/m L48 hours after transfection, picking up a single colony and amplifying the colony in a 96-well plate for subsequent genotype identification after 6 days of G418 selection, and selecting the cells successfully inserted with the right targeting plasmid FNF L sequence on the genome.

(9) F L IP enzyme mediated cell homologous recombination, namely treating cells successfully inserted with FNF L sequence at the right side of a target knockout region in the step (8) by doxycycline (doxycycline), inducing F L P-FRT mediated homologous recombination, selecting separate colonies for PCR genotype identification, and confirming that the FNF L capture box lacks a FRT site and a L oxP site, wherein the upstream and the downstream of the genome of the target knockout region (SRCAP gene exon 5) respectively contain a L oxP site.

(10) And (3) Cre enzyme mediated cell homologous recombination, namely treating the cells with L oxP sites on the left and right sides of the target knockout region obtained in the step (9) by using 1 mu M4-OHT for 5 days to induce Cre-L oxP mediated homologous recombination, selecting an individual colony for PCR genotype identification, and confirming that 5 # to 8 # exons of the SRCAP gene in the embryonic stem cells of the mice are successfully knocked out.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, it should be noted that, for those skilled in the art, many modifications and variations can be made without departing from the technical principle of the present invention, and these modifications and variations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Suzhou university

<120> Gene conditional knockout method constructed by using CRISPR/Cas9 system

<160>8

<170>SIPOSequenceListing 1.0

<210>1

<211>20

<212>DNA

<213> (Artificial sequence)

<400>1

ggcttcactc taacgactgt 20

<210>2

<211>20

<212>DNA

<213> (Artificial sequence)

<400>2

agtcgttaga gtgaagccca 20

<210>3

<211>20

<212>DNA

<213> (Artificial sequence)

<400>3

tgtgtaaagg ccggcttacc 20

<210>4

<211>20

<212>DNA

<213> (Artificial sequence)

<400>4

aggccggctt accaggcacg 20

<210>5

<211>20

<212>DNA

<213> (Artificial sequence)

<400>5

aggtagtatc cctaagtagt 20

<210>6

<211>20

<212>DNA

<213> (Artificial sequence)

<400>6

atctcttagc caactactta 20

<210>7

<211>20

<212>DNA

<213> (Artificial sequence)

<400>7

gagctcaagc cgcagttcgc 20

<210>8

<211>20

<212>DNA

<213> (Artificial sequence)

<400>8

agtggggatc ctgcgaactg 20

Claims

1. A conditional gene knockout method constructed by using a CRISPR/Cas9 system comprises the following steps:

selecting L oxP-antibiotic-L oxP sequence insertion sites and FRT-antibiotic-FRT-L oxP sequence insertion sites on the left side and the right side of a knockout region of a target gene respectively, then selecting 500bp-1kb left and right homologous arms on the upper and lower streams of the insertion sites respectively, amplifying the left and right homologous arms through PCR, purifying, carrying out enzyme digestion, connection and transformation, and then respectively inserting the left arm fragment and the right arm fragment into L oxP-antibiotic-L oxP plasmids and FRT-antibiotic-FRT-L oxP plasmids so as to obtain left targeting plasmids and right targeting plasmids, wherein the knockout region is a regulation region of the target gene, a non-coding RNA (ribonucleic acid) or a gene spacer region on the target gene;

(2) constructing a first gRNA corresponding to the left targeting plasmid and a second gRNA corresponding to the right targeting plasmid;

(3) transferring the Cas9 plasmid, the first gRNA expression plasmid and the left targeting plasmid into a target cell at the same time, performing cell selection by using antibiotics 48-72 hours after transfection, and screening a target cell with a biallelic gene introduced into a L oxP-antibiotic-L oxP fragment by a PCR genotype identification method after 5-9 days of selection;

(4) treating the target cells with the biallelic gene introduced L oxP-antibiotic-L oxP segment with 4-hydroxy tamoxifen for 3-6 days to induce Cre-L oxP mediated homologous recombination to obtain cells with L oxP biallelic gene insertion;

(5) transferring the Cas9 plasmid, the second gRNA expression plasmid and the right targeting plasmid into the L oxP double allele inserted cell obtained in the step (4) at the same time, performing cell selection by using antibiotics after transfecting for 24-72 hours, and screening the target cell with the FRT-antibiotic-FRT-L oxP fragment double allele inserted after selecting for 5-9 days;

(6) treating the target cell with the FRT-antibiotic-FRT-L oxP fragment double allele insert with adriamycin for 3-6 days to induce F L P-FRT mediated homologous recombination, and screening out the target cell with the right FRT-L oxP double allele insert in the region to be knocked out;

(7) and (3) treating the target cells with right FRT-L oxP double allele insertion by using 4-hydroxy tamoxifen for 3-6 days, and inducing Cre-L oxP mediated homologous recombination to knock out the target gene.

2. The method of claim 1, wherein: in step (1), amplification is performed using high fidelity Phusion DNA polymerase, FastPfu DNA polymerase or Vent DNA polymerase.

3. The method of claim 1, wherein: in step (3), the cell of interest is a mammalian cell.

4. The method of claim 1, wherein: in the steps (1), (3), (4), (5) and (6), the antibiotic is neomycin, hygromycin or puromycin.

5. The method of claim 4, wherein the neomycin is present in a concentration of from 200 μ g/m L to 300 μ g/m L.

6. The method of claim 4, wherein: the concentration of hygromycin is 50-1000 mug/ml.

7. The method of claim 4, wherein: the concentration of the puromycin is 1-10 mug/ml.

8. The method according to claim 1, wherein the concentration of doxorubicin in step (6) is from 0.8 μ g/m L to 1.2 μ g/m L.

9. The method of claim 1, wherein: in the step (4) and the step (7), the concentration of the 4-hydroxy tamoxifen is 0.8 mu M to 1.2 mu M.