CN104894163A

CN104894163A - Preparation method and application of GGTA1 and iGb3S double-gene knockout non-human mammals

Info

Publication number: CN104894163A
Application number: CN201510122581.0A
Authority: CN
Inventors: 徐丽明; 邵安良; 范昌发
Original assignee: National Institutes for Food and Drug Control
Current assignee: National Institutes for Food and Drug Control
Priority date: 2015-03-19
Filing date: 2015-03-19
Publication date: 2015-09-09
Anticipated expiration: 2035-03-19
Also published as: CN104894163B

Abstract

The invention relates to the field of making gene knockout animal models, in particular to a preparation method and application of GGTA1 and iGb3S double-gene knockout non-human mammals. The preparation method comprises the steps of constructing targeting vectors, transferring the targeting vectors into embryonic cells, infusing reconstructed embryonic cells into surrogacy animal embryos, transplanting the surrogacy animal embryos into pseudopregnancy animal bodies to be mated with normal animals, carrying out gene type verification on obtained chimera animals, screening positive gene knockout chimera animals with genes successfully knocked out, further mating the chimera animals with wild animals to obtain F1-generation heterozygote, obtaining GGTA1 homozygote animals and iGb3S homozygote animals with both two chromosomes removed after F1-generation heterozygote mating, mating the GGTA1 homozygote animals with the iGb3S homozygote animals, screening double-gene knockout homozygote animals with GGTA1 and iGb3S lacked at the same time, and obtaining a gene knockout animal population through establishment.

Description

The method of the dual-gene non-human mammal knocked out of a kind of GGTA1 of preparation and iGb3S and application

Technical field

The present invention relates to the field making Gene Knock-Out Animal Model model, specifically, relate to method and the application of the dual-gene non-human mammal knocked out of a kind of GGTA1 of preparation and iGb3S.

Background technology

The biogenic material be made up of mammalian extracellular matrix has because of it timbering material etc. that good biocompatibility is widely used in the trauma repair of surgery, tissue reconstruction and organizational project.Xenogeneic organ also becomes in solution organ transplantation already for one of potential approach of organ famine.But animal derived biomaterial or Xenogeneic organ's organizations directly affect security and the validity of this kind of materials'use in the immunological problem that human body brings.The biggest obstacle of xenotransplant is activating complement system after being combined for organ heterologous antigen natural antibody in recipient's body, attack Hyperacute immunological rejection (the Hyperacute rejection produced for organ, HAR), the several minutes of its time of origin after xenotransplantation to a few hours, for organ at short notice generating function exhaustion make graft failure.Though animal derived biomaterial is through the process of various removal antigen, be difficult to thoroughly remove all heterologous antigens, residual antigen remains and causes Chronic immune rejection and immunotoxicity and the important factor that affects wound healing.

Existing research display heterologous antigen α-galactosyl antigen (α-1,3-galactosyle, α-Gal) is the main target antigen in animal derived biomaterial or xenotransplant Hyperacute immunological rejection.α-Gal is cell surface secretor type glycoprotein containing poly lactose amine core end residue or glycolipid, is extensively present in pig and other lower animal body.α-Gal is mainly by α-1,3 galactosyltransferases (α 1,3-galactosyltransferase, α-1,3GT, or GGTA1) and different globoside synthetic enzyme (isoglobotriosylceramide synthase or isogloboside 3synthase, iGb3S) regulation and control.Due to human body and man like ape, old century monkey galactoside transferase gene have 2 bases dislocation variations and do not express Gal antigen, but there is the human natural antibodies (accounting for the 1-3% of total serum sphaeroprotein) of high titre in human serum, therefore can cause Hyperacute immunological rejection and the reaction of chronic immunotoxicity when human body accepts biomaterial or the xenotransplant containing Gal antigen.There is the human natural antibodies in research confirmer serum both to react with the Gal antigen (glycoprotein) of GGTA1 catalysis, also react with the Gal antigen (glycolipid fat) of iGb3S catalysis.

Just having by building GGTA1 knock out mice as far back as the nineties in the world, studying the immunological response that α-Gal is relevant, inquire into not containing construction process and the feasibility of the cloned animal of Gal antigen.As far back as 1996, RG Tearle etc. reported the successful making method of GGTA1 gene knock-out mice model, started to have report to use GGTA1 gene knock-out mice model to study similarity and the amynologic characteristic thereof of itself and people institute induction of antibodies afterwards.The reports such as Chiang TR, GGTA1 the gene anti-Gal antibody of inducing after pounding out mouse immune and the affinity that α-Gal is combined are similar with the anti-Gal antibody of people, are the Hyperacute immunological rejections can inducing Gal antigen positive heterotropic heart sticking patch.The reports such as Chong A, GGTA1 knock out mice can induce natural anti alpha-Gal IgM and IgG, and presents interdependence enhancing in age in week; The human natural antibodies reaction of T-cell interdependence can be observed after allogeneic or xenogenesis sticking patch are transplanted.These research promptings GGTA1 gene knock-out mice model has responsive reactivity to the immunotoxicity that Gal antigen remains induction.

The conquering method of the Hyperacute immunological rejection that α-Gal antigen causes and Chronic immune toxicity obtains further investigation.Many laboratories have employed diverse ways and process for organ or cell, wherein the most extensive with the research of ferment treatment method, physical chemistry partition method and the method such as crosslinking and genetic modification.At the beginning of 2000, investigators start the research of GGTA1 gene knock-out pig; the even research of GGTA1 gene knockout ox; expect directly to obtain from GGTA1 gene knock-out pig or ox the tissue or organ that there is no Gal antigen, to avoid the immunological rejection of animal derived biomaterial and xenogenesis organ transplantation.The reports such as Dai Y and Lai L, they use nuclear transfer technique successful incubation to go out GGTA1 gene knock-out pig (GT/KO pig).The biomaterial in experimental study display GGTA1 gene knock-out pig source significantly can alleviate the hyperacute rejection of Gal antigen induction.

The domestic research about GGTA1 Gene Knock-Out Animal Model model also achieves certain achievement, Dai Yifan and Lai Liangxue professor is the scholar reporting GGTA1 gene knockout heterozygosis pigling in the world the earliest.They successively successfully construct the model of GGTA1 gene knock-out pig at home after coming back home, and obtain homozygote.But the research about iGb3S Gene Knock-Out Animal Model is domestic has no report.

Studies have found that, the mouse of GGTA1 gene knockout or pig be express alpha-Gal antigen still, still can observe the immunological rejection in later stage.Have the iGb3 of not expression activity in the histoorgan studying confirmer in addition, point out by the iGb3 of iGb3S transferase gene transcription containing galactosyl lipoprotein may be animal tissues, organ or animal derived material transplant the another kind of exogenous antigen causing heteroimmunity rejection when the human body.The research of Milland etc. is presented in GGTA1 Gene Knock-Out Animal Model body still expresses low-level but the Gal antigen of significance.GGTA1 knock out mice expresses iGb3S mRNA, the more important thing is Gal α (1,3) the Gal antigen-reactive of the antibody that GGTA1 knock out mice is originated and the fatty skeleton that iGb3S synthesizes.Gal α (1,3) the Gal glycolipid fat antigen of this result of study prompting iGb3S synthesis may be the major cause causing heteroplastic transplantation Chronic immune rejection.Therefore, although Milland etc. think that GGTA1 Gene Knock-Out Animal Model avoids Acute immune rejection reaction, the Gal antigen that fat connects is the root of heteroplastic transplantation later stage Chronic immune rejection.Scholar is had to begin one's study the immune response of iGb3 mediation and the immunological changes of iGb3S defect model animal.

Therefore, GGTA1 and iGb3S Double knockout mice model will be further investigation and the immunoreactive tool evaluating the mediation of Gal antigen.But GGTA1 and iGb3S Double knockout mice is domestic, the world is not all also reported.For shortcomings and deficiencies of the prior art, special proposition the present invention.

Summary of the invention

Primary goal of the invention of the present invention is the method proposing the dual-gene non-human mammal knocked out of a kind of GGTA1 of preparation and iGb3S.

Second goal of the invention of the present invention is the application proposing the dual-gene non-human mammal knocked out of this GGTA1 and iGb3S.

In order to realize object of the present invention, the technical scheme of employing is:

Prepare a method for the dual-gene non-human mammal knocked out of GGTA1 and iGb3S, comprise the following steps:

(1) build targeting vector: from genomic dna, be separated GGTA1 and iGb3S gene respectively, obtain homology arm through the amplification of long-chain PCR method, build GGTA1 targeting vector and iGb3S targeting vector with antibiotic resistance genes compound;

(2) GGTA1 targeting vector is transferred to embryonic cell, reconstituted embryo fetus cells is injected foster animal embryo, is transplanted in pseudo pregnant animal body, with intact animal mating; Genotype checking is carried out to the chimeric animal obtained, the chimeric animal that the positive gene of screening-gene successful knockout knocks out; Further with wild type animal mating, obtain the F1 generation heterozygote of GGTA1;

(3) iGB3S targeting vector is transferred to embryonic cell, reconstituted embryo fetus cells is injected foster animal embryo, is transplanted in pseudo pregnant animal body, with intact animal mating; Genotype checking is carried out to the chimeric animal obtained, the chimeric animal that the positive gene of screening-gene successful knockout knocks out; Further with wild type animal mating, obtain the F1 generation heterozygote of iGB3S;

(4) post-coitum between the F1 generation heterozygote of GGTA1 and the F1 generation heterozygote of iGB3S is obtained two karyomit(e)s all by GGTA1 and the iGb3S homozygous animals picked out;

(5) again GGTA1 and iGB3S homozygous animals is carried out mating, what screening GGTA1 and iGb3S lacked simultaneously dual-genely knocks out homozygous animals, and to build be obtain Gene Knock-Out Animal Model population.

First optimal technical scheme of the present invention is: non-human mammal is mouse, further preferred C57BL mouse.

Second optimal technical scheme of the present invention is: GGTA1 gene knockout is functional catalytic domain the 9th exon knocking out GGTA1 gene, and its nucleotide sequence is as shown in SEQ NO ID:1; IGb3S gene knockout is functional catalytic domain the 5th exon knocking out iGb3S gene, and its nucleotide sequence is as shown in SEQ NO ID:2.

3rd optimal technical scheme of the present invention is: described GGTA1 targeting vector contains 5` homology arm, resistance antibiotic resistance gene NeoR-PA and 3` homology arm, replaces the 9th exon respectively with NeoR-PA; Described iGb3S targeting vector contains 5` homology arm, resistance antibiotic resistance gene NeoR-PA and 3` homology arm, replaces the 5th exon respectively with NeoR-PA.

4th optimal technical scheme of the present invention is: the resistance antibiotic resistance gene NeoR-PA 5` end built for GGTA1 targeting vector and the homology arm sequence of 3` end take from 5` end and the 3` end of GGTA1 gene the 9th exon on mouse Article 2 karyomit(e), are respectively 4.123kb and 7.343kb; The resistance antibiotic resistance gene NeoR-PA 5` end built for iGb3S targeting vector and the homology arm sequence of 3` end take from 5` end and the 3` end of iGb3S gene the 5th exon on mouse Article 4 karyomit(e), are respectively 8.3kb and 9.1kb.

5th optimal technical scheme of the present invention is:

The construction step of GGTA1 targeting vector is:

(1) from normal C57BL/6J mouse isolation of genomic DNA, amplification the 9th exon 5 ' holds C1 fragment, A fragment and 3 ' end B fragment, C2 fragment, is connected respectively to pBlunt carrier;

(2) enzyme is cut qualification, checking order A and B fragment correct and being connected to pL452 carrier successively obtains pL452-GGTA1-A-B, meanwhile, will be connected on pDTA-Down carrier after C1, C2 segment composition correct for order-checking by Overlap PCR;

(3) cut by the correct pL452-GGTA1-A-B EcoRV enzyme of connection, pL452-AB cuts out 2885bp, 2930bp two band, and reclaim object Segment A-NeoR-B, the BAC bacterium that electricity turns containing pBCTG is recombinated; Bacterium colony PCR detects A-NeoR-B fragment restructuring BAC, and qualification amplified band is correct;

(4) linearization process of pDTA-down-GGTA1-C, namely EcoRV enzyme cuts process pDTA-Down-GGTA1-C, reclaims object band, and electricity turns the BAC bacterium of the GGTA1 of the NeoR that recombinated; PDTA-GGTA1-C saves GGTA1-NeoR BAC (AmpR+KanR); PCR Testing and appraisal is carried out to the bacterium colony after C rescue, restructuring is correctly cloned and increases, digestion verification after Stbl3 purifying;

The construction step of iGb3S targeting vector is:

(1) from normal C57BL/6J mouse isolation of genomic DNA, amplification the 5th exon 5 ' holds C1 fragment, A fragment and 3 ' end B fragment, C2 fragment, is connected respectively to pBlunt carrier;

(2) enzyme is cut qualification, checking order A and B fragment correct and being connected to pL452 carrier successively obtains pL452-iGb3S-A-B, meanwhile, will be connected on pDTA-Down carrier after C1, C2 segment composition correct for order-checking by Overlap PCR;

(3) cut by the correct pL452-iGb3S-A-B EcoRV enzyme of connection, pL452-AB cuts out 2880bp, 2885bp two band, and reclaim object Segment A-NeoR-B, the BAC bacterium that electricity turns containing pBCTG is recombinated; Bacterium colony PCR detects A-NeoR-B fragment restructuring BAC, and qualification amplified band is correct;

(4) linearization process of pDTA-down-iGb3S-C, namely EcoRV enzyme cuts process pDTA-Down-iGb3S-C, reclaims object band, and electricity turns the BAC bacterium of the iGb3S of the NeoR that recombinated; PDTA-iGb3S-C saves iGb3S-NeoR BAC (AmpR+KanR); PCR Testing and appraisal is carried out to the bacterium colony after C rescue, restructuring is correctly cloned and increases, digestion verification after Stbl3 purifying.

6th optimal technical scheme of the present invention is: step (2) comprises the following steps: prepare sterile male mouse and the female mouse of false pregnancy; Super ovulation; Results zygote; The preparation of target DNA; Target DNA is imported zygote; The transplanting of zygote; Head builds the detection of target DNA integration in mouse; Mouse germline is picked out by cross breeding gene.

The invention still further relates to from the sperm of dual-gene knock-out animal, ovum, zygote, embryo, filial generation, tissue or cell.

The invention still further relates to the dual-gene non-human mammal that knocks out or go out the application in the tumour immunity research and appraisa of biogenic material, xenotransplant area research and evaluation and the mediation of Gal antigen of the sperm of animal, ovum, zygote, embryo, filial generation, tissue or cell from clpp gene; Described biogenic material comprises animal derived or takes from human body, and described animal derived biomaterial do not comprise primate; The kind of described animal derived biomaterial comprises various tissues, internal organs and the derivative thereof taken from animal body, or by the various materials organized or prepared by internal organs; Described primate refers in particular to Gu century monkey, baboon.Described application is included in the application in the research of immunological investigation, immunotoxicology, heteroimmunity rejection and mechanism thereof, tumor immunology research and safety evaluation; Described safety evaluation comprises the safety evaluations of xenotransplant before clinical trial such as biogenic material, GGTA1 gene knock-out pig, ox.

Targeting vector picks out the total length 694bp that sequence fragment is GGTA1 the 9th exon, and its nucleotide sequence is as SEQ NO ID:1:

20430G TACATTGAGC ATTACTTAGA AGACTTTCTG

20461GAGTCTGCTG ACATGTACTT CATGGTTGGC CATCGGGTCA TATTTTACGT CATGATAGAC

20521GACACCTCCC GGATGCCTGT CGTGCACCTG AACCCTCTAC ATTCCTTACA AGTCTTTGAG

20581ATCAGGTCTG AGAAGAGGTG GCAGGATATC AGCATGATGC GCATGAAGAC CATTGGGGAG

20641CACATCCTGG CCCACATCCA GCACGAGGTC GACTTCCTCT TCTGCATGGA CGTGGATCAA

20701GTCTTTCAAG ACAACTTCGG GGTGGAAACT CTGGGCCAGC TGGTAGCACA GCTCCAGGCC

20761TGGTGGTACA AGGCCAGTCC CGAGAAGTTC ACCTATGAGA GGCGGGAACT GTCGGCCGCG

20821TACATTCCAT TCGGAGAGGG GGATTTTTAC TACCACGCGG CCATTTTTGG AGGAACGCCT

20881ACTCACATTC TCAACCTCAC CAGGGAGTGC TTTAAGGGGA TCCTCCAGGA CAAGAAACAT

20941GACATAGAAG CCCAGTGGCA TGATGAGAGC CACCTCAACA AATACTTCCT TTTCAACAAA

21001CCCACTAAAA TCCTATCTCC AGAGTATTGC TGGGACTATC AGATAGGCCT GCCTTCAGAT

21061ATTAAAAGTG TCAAGGTAGC TTGGCAGACA AAAGAGTATA ATTTGGTTAG AAATAATGTC

21121TGA

Targeting vector picks out the total length 687bp that sequence fragment is iGb3S the 5th exon, and its nucleotides sequence is classified as SEQ NO ID:2:

7728GTA CCTGGAGAAG

7741TACCTGGAAC ACTTCCTGGT ATCGGCAGAG CAGCACTTCA TGGTCGGCCA GAACGTGGTG

7801TACTATGTGT TTACGGATCG CCCGGAAGCA GTGCCCTATG TGGCTCTAGG CCAGGGTCGC

7861CTGCTGCGGG CAAAACCCGT GCAGCGAGAG AGGCGCTGGC AGGACGTGTC CATGGCACGC

7921ATGCCCACGC TACACGAGGC TCTGGGAGGG CAGCTGGGCC AAGAAGCTGA CTTTGTGTTC

7981TGCCTGGACG TGGACCAGTA CTTCACCGGT AACTTCGGGC CTGAGGTGCT GGCAGATTTG

8041GTGGCACAGC TGCACGCCTG GCACTACCGC TGGCCGCGGT GGCTGCTGCC CTACGAGAGG

8101GACAAGCGAT CGGCTGCTGC GCTGTCGTTA AGCGAAGGCG ATTTCTACTA CCACGCTGCG

8161GTGTTTGGCG GCAGTGTGGC TGCACTGCTC AAGCTGACGG CCCACTGTGC GACTGGCCAA

8221CAGCTGGACC ATAAGCGCGG CATTGAGGCA CTCTGGCACG ACGAAAGCCA CCTTAACAAG

8281TTCTTCTGGC TGAACAAGCC CACCAAGCTG CTGTCGCCTG AGTTCTGCTG GGCAGAGGAA

8341ATTATCTGGA GGAGAGAGAT CCATCACCCA CGCCTGCTCT GGGCACCCAA GGAATATACG

8401CTGGTGCGAA ACTAG

Below technical scheme of the present invention is made further explanation.

The present invention relates to a kind of method making dual-gene knock-out animal model, and this animal model is at the immunological investigation of multiple biogenic material (animal derived, take from human body), heteroplasm or organ; The immunological rejection of Gal antigen mediation and the research of mechanism thereof; Purposes in the preclinical safety evaluation of animal tissues, organ or animal derived biomaterial (as immunological evaluation, transplanting or implant experiment etc.); The tumor immunology research of Gal antigen mediation; And cell, tissue, organ and the purposes of embryo in above-mentioned field to be derived by this animal pattern.

Animal model of the present invention has been picked out functional catalytic domain the 5th exon of functional catalytic domain the 9th exon of GGTA1 gene and iGb3S gene artificially.Make use of bacterial artificial chromosome homologous recombination technique, with antibiotic resistance genes be attached to 5` end (upstream) and 3` and hold the homology arm in (downstream) to be formed targeting vector, functional catalytic domain the 9th exon of replacement GGTA1 gene and functional catalytic domain the 5th exon of iGb3S gene.The approach implementing this invention mainly comprises targeting vector structure, reconstituted embryo fetus cells clone and blastaea microinjection.First from the genomic dna of C57BL mouse, be separated GGTA1 gene and iGb3S gene respectively, obtain homology arm through the amplification of long-chain PCR method, then build targeting vector with antibiotic resistance genes compound; From the embryo of C57BL mouse, be separated embryonic cell, the electricity for targeting vector after short-term expansion cultivation turns, screening, acquisition positive embryos cell clone; Through micro-injection method, reconstituted embryo fetus cells is injected mouse embryo, be then transplanted in false pregnancy mouse body; Obtain blackspot shape allophenic mice; Further with the mating of wild-type C57BL mouse, obtain F1 generation heterozygote; Molecular biology method is utilized to carry out genotype checking to the F1 generation hybrid mice obtained, the hybrid mice that the positive gene of screening-gene successful knockout knocks out; Between F1 generation heterozygote, post-coitum obtains two karyomit(e)s all by the homozygote mouse of picking out; After Southern Blot method carries out genotype identification, the heterozygote of GGTA1 and iGb3S or homozygote carry out the homozygote mouse that cross breeding obtains the dual-gene disappearance of GGTA1 and iGb3S, and building is obtain Gene Knock-Out Animal Model population.On this basis, the cell of this animal model, organ and embryo can be obtained further.

Concrete, the present invention proposes a kind of making method eliminating functional catalytic domain the 9th exon of GGTA1 and iGb3S gene and the rodents Gene Knock-Out Animal Model of the 5th exon from mouse genome.The present invention's GGTA1 full length gene used is about 16.2kb, and gene order is selected from C57BL/6J mouse the 2nd chromogene group DNA.GGTA1 gene contains 9 exons, and its functional catalytic domain is positioned at the 9th exon.The GGTA1 gene targeting carrier length built is 18.966kb, as Figure 1-1, containing 5` (upstream) homology arm (4.123kb), NeoR-PA (7.343kb) and 3` (downstream) homology arm (7.5kb).The 9th exon is replaced with NeoR-PA.The present invention's iGb3S full length gene used is about 10kb, and gene order is selected from C57BL/6J mouse the 4th chromogene group DNA.IGb3S gene contains 5 exons, and its functional catalytic domain is positioned at the 5th exon.The iGb3S gene targeting carrier length built is 25.2kb, as shown in Figure 1-2, containing 5` (upstream) homology arm (8.3kb), NeoR-PA (7.343bp) and 3` (downstream) homology arm (9.1kb).The 5th exon is replaced with NeoR-PA.

In the present invention, GGTA1 targeting vector designs different (the document 1:The Journal of Biological Chemistry from bibliographical information, Vol.270, No.37:21437 – 21440,1995), Fig. 2-1a is that target practice site schematic diagram reported by document 1.Fig. 2-1b shows 9 exons of GGTA1 gene.The target practice site of document 1 is positioned at the longest extron of GGTA1 gene, i.e. the 5` end of the 9th exon, by inserting pgkNeo, and stops coding before setting and stops translating of Neo and the 9th exon.Containing genomic dna 5`-in the both sides of NeoR holds homology arm 11kb and 3-to hold homology arm 0.9kb; Document 2 (Transplantation.61 (1): 13-19, January 15,1996): GGTA1 knock out mice targeting vector target practice site is the 8th and the 9th exon, replaces with NeoR.

Different from bibliographical information of iGb3S targeting vector design in the present invention: document Normal development and function of invariant natural killer T cells in mice with isoglobotrihexosylceramide (iGb3) deficiency (PNAS, 2007, 104 (14) 5977-5982) utilize Cre-to mediate loxP-NeoR select box (PGK-gb2-neomycin selection cassette (neo) symbolize loxP sequences) reject the 5th exon, NeoR sequence is taken off after having recombinated, its schematic diagram is as shown in Fig. 2-2.Be topmost wild type gene site (WT locus), containing 1 ~ 5 exon (Exon1-5); The antibiotic resistance genes (neo, PGK-gb2-neomycin selection cassette) inserted instead of exon 5` and part 3` terminal sequence; Targeting vector comprises upstream homology arm (containing 2 ~ 4 exons), antibiotic resistance genes sequence and downstream homology arm; Neo sequence (recombined locus) is taken off after having recombinated.

Comprised the following steps by the process of microinjection (Microinjection) producer gene knock-out animal: prepare sterile male mouse and the female mouse of false pregnancy; Super ovulation; Results zygote; The preparation of reconstituted embryo fetus cells; Embryonic cell positive for restructuring is imported zygote; The transplanting of zygote; The acquisition of allophenic mice, further with wild-type mice mating, obtains hybrid mice (head builds mouse); Head builds the detection of recombinant DNA integration in mouse (Founder); Mouse germline is picked out by cross breeding gene.

The head that the present invention obtains builds mouse and has new phenotype.General vital signs are normal, grow normal.Due to the dual-gene rejecting animal model of GGTA1 and iGb3S, there is not been reported, and its phenotypic characteristic needs to be observed further.

Adopt following scheme mating to build to be: for female chimeras mouse (Fig. 7) then with normal male mouse mating, select age in week at 10 weeks, there is mating experience, healthy and strong C57BL mouse mating with it.Start inspection after living together 1 week to become pregnant situation, if find conceived raising separately by female mouse, until produce.If be Male chimeras body mouse, then select more than 8 weeks, healthy and strong female mouse mating with it.Detect find gene pick out can in offspring genetic stability, litter size amount and normal mouse are as good as, and generally can successfully feed, rare eat son etc. maternal instinct bad phenomenon.

Gene level phenotypic evaluation adopts RT-PCR identification method.Protein level phenotypic evaluation adopts alpha-Gal ELISA to suppress method, utilizes its specific antibody to carry out the detection of alpha-Gal antigen presentation.Because the expression of alpha-Gal antigen is regulated and controled, so the disappearance of these two genetic expressions will cause the minimizing of alpha-Gal antigen presentation by GGTA1 and iGb3S.Alpha-Gal ELISA suppresses method to adopt the specific antibody M86 of alpha-Gal antigen, first with M86 and the alpha-Gal antigen-reactive in tissue, then carries out the unreacted residue antibody of centrifugation; Residue antibody is measured by 96 orifice plates by alpha-Gal/BSA solid phase antigen bag, calculates the expression amount with the alpha-Gal antigen of tissue reaction with this.The life cycle of GGTA1/iGb3S dual-gene rejecting animal and wild type animal, without significant difference, have no the report that life cycle is different.In the present invention, the life cycle that head builds mouse has no shortening phenomenon, and general state is normal.

The present invention relates to the method making Gene Knock-Out Animal Model model, and the purposes of this animal model in the research, preclinical safety evaluation (as immunological evaluation, implanting experiment etc.) of the immunological investigation of multiple biogenic material (animal derived, take from human body), heteroplasm or organ, immunological rejection and mechanism thereof; And the cell to be derived by this animal pattern, tissue, organ and embryo and the purposes in above-mentioned field thereof.

This animal model has been picked out functional catalytic domain the 9th exon of GGTA1 and iGb3S gene and the 5th exon artificially.At present, be showed no the report of GGTA1/iGb3S dual-gene rejecting animal both at home and abroad, also nobody's research is used as a kind of tool and method of animal derived biomaterial safety evaluation and quality control, or Xenogeneic organ, tissue transplantation (as deriving from GGTA1 gene knock-out pig, ox) appraisal and study.In addition, the characteristic also having many research and utilization α-Gal that human body can be induced to surpass acute immune reaction uses it for the immunotherapy of tumour, as autologous tumor vaccine: by autologous tumor cell as blood tumor cell, solid tumor cytolemma, with neuraminic acid acid anhydride enzyme, uridine diphosphate galactose and restructuring GGTA1 Dual culture.The present invention utilizes homologous recombination technique and embryonic stem cell technologies to build the GGTA1/iGb3S dual-gene rejecting mouse of genetic stability, can be used for the research of immunological investigation that animal tissues's Gal antigen is correlated with and immunological rejection mechanism; The immunotoxicology research of animal derived biomaterial, Regeneration and Repair medical research; Also can be used for the immunological investigation of cancer therapy simultaneously.

Accompanying drawing illustrates:

Fig. 1-1.GGTA1 gene targeting site schematic diagram, has marked and has spliced with full genome the site that involved enzyme cuts site and recombination checking probe;

Fig. 1-2 .iGb3S gene targeting site schematic diagram, has marked and has spliced with full genome the site that involved enzyme cuts site and recombination checking probe;

Fig. 2-1. background technology Literature report target practice site schematic diagram;

Fig. 2-2. background technology Literature report target practice site schematic diagram;

The electrophorogram of Fig. 3-1. targeting vector pDTA-GGTA1-A-B-C and pDTA-iGb3S-A-B-C digestion verification;

The electrophorogram of Fig. 3-2. targeting vector pDTA-GGTA1-A-B-C and pDTA-iGb3S-A-B-C digestion verification;

Fig. 4-1. targeting vector pDTA-GGTA1-A-B-C and pDTA-iGb3S-A-B-C plasmid carry greatly the electrophorogram of rear digestion verification;

Fig. 4-2. targeting vector pDTA-GGTA1-A-B-C and pDTA-iGb3S-A-B-C plasmid carry greatly the electrophorogram of rear digestion verification;

Fig. 5-1. is for plasmid pDTA-GGTA1-A-B-C restructuring ES cell is through the Southern Blot confirmation positive colony electrophorogram of probe 1;

Fig. 5-2. is for plasmid pDTA-iGb3S-A-B-C restructuring ES cell is through the Southern Blot confirmation positive colony electrophorogram of probe 1;

Fig. 6-1. plasmid pDTA-GGTA1-A-B-C restructuring ES cell confirms positive colony electrophorogram through the Southern Blot of probe 2;

Fig. 6-2. plasmid pDTA-iGb3S-A-B-C restructuring ES cell confirms positive colony electrophorogram through the Southern Blot of probe 2;

Fig. 7-1.GGTA1 allophenic mice photo; Fig. 7-2.iGb3S allophenic mice photo;

Fig. 8-1.GGTA1 hybrid mice photo; Fig. 8-2.iGb3S hybrid mice photo;

Fig. 9-1.GGTA1 hybrid mice genotype identification High fidelity PCR design of primers figure;

Fig. 9-2.iGb3S hybrid mice genotype identification High fidelity PCR design of primers figure;

Figure 10-1.GGTA1 hybrid mice genotype identification high-fidelity PC electrophorogram;

Figure 10-2.iGb3S hybrid mice genotype identification high-fidelity PC electrophorogram;

Figure 11-1.GGTA1 homozygote mouse photo; Figure 11-2.iGb3S homozygote mouse photo;

Figure 12-1. rejects the electrophorogram of GGTA1 genetic homozygous murine genes type qualification high-fidelity PCR amplification gene fragment;

Figure 12-2. rejects the electrophorogram of iGb3S genetic homozygous murine genes type qualification high-fidelity PCR amplification gene fragment;

Figure 13-1. rejects the schematic diagram of the Southern blot screening strategy of GGTA1 gene;

Figure 13-2. rejects the schematic diagram of iGb3S gene Southern blot screening strategy;

Figure 14-1. genomic dna is schemed through the Southern Blot of GGTA15 ' Probe1 (probe 1) and 3 ' Probe2 (probe 2); Upper figure is probe 1; Figure below is probe 2;

Figure 14-2. genomic dna is schemed through the Southern Blot of iGb3S 5 ' Probe1 (probe 1) and 3 ' Probe2 (probe 2); A, b are respectively probe 1 and probe 2;

The dual-gene electrophorogram knocking out hybrid mice genomic dna and detect through GGTA1 High fidelity PCR of Figure 15-1.GGTA1/iGb3S;

The dual-gene electrophorogram knocking out hybrid mice genomic dna and detect through iGb3S High fidelity PCR of Figure 15-2.GGTA1/iGb3S;

Figure 16 .GGTA1 and iGb3S homozygote and the dual-gene mrna expression detected result figure knocking out hybrid mice; A is the expression of GGTA1 gene knockout homozygote mouse GGTA1 gene; B is the expression of iGb3S gene knockout homozygote mouse iGb3S gene; C is GGTA1/iGb3S and the dual-gene expression knocking out hybrid mice iGb3S gene; D is GGTA1/iGb3S and the dual-gene expression knocking out hybrid mice GGTA1 gene.

Figure 17. the present invention makes the schematic flow sheet of Gene Knock-Out Animal Model model;

The specific embodiment of the present invention is only limitted to explain further and the present invention is described, does not limit Composition of contents of the present invention.

Embodiment

Embodiment 1

1, the structure of targeting vector

1.1 are separated GGTA1 and iGb3S genomic dna respectively from normal C57BL/6J mouse, then adopt PCR method to increase respectively the 9th exon the 5th exon 5 ' end C1, A and 3 ' end B, C2 fragment.

GGTA1 target practice site schematic diagram is as Figure 1-1: gene order is selected from C57BL/6J mouse the 2nd chromogene group DNA (GRCm38.p1C57BL/6J, NCBI Reference Sequence:NC_000068.7).Reject Gene Partial and be positioned at exon 9, its length is that the 9th exon catalytic domain total length 694bp adds the 246bp that 5` (upstream) holds, and whole length is 940bp.The present invention's targeting vector length used is 18.966kb (Fig. 1-1).

GGTA1 clones the primer sequence of A fragment as shown in SEQ NO ID:3 and SEQ NO ID:4;

The nucleotides sequence of SEQ NO ID:3 is classified as: cgatGGTACCGATATCCGAGACCGCATAGTAAG;

The nucleotides sequence of SEQ NO ID:4 is classified as: cgatGAATTCCATATGTCGATGCCTGCCACACTG;

IGb3S target practice site schematic diagram is as shown in Figure 1-2: gene order is selected from C57BL/6J mouse the 4th chromogene group DNA (GRCm38.p1C57BL/6J, NCBI Reference Sequence:NC_000070.6).Reject Gene Partial and be positioned at exon 5, its length is that the 5th exon catalytic domain total length 687bp adds the 255bp that 5` (upstream) holds, and whole length is 942bp.The present invention's targeting vector length used is 25.2kb (Fig. 1-2).

IGb3S clones the primer sequence of A fragment as shown in SEQ NO ID:5 and SEQ NO ID:6;

The nucleotides sequence of SEQ NO ID:5 is classified as: CGATGGTACCGATATCACAGAATCTTTCTCTGTTTTC;

The nucleotides sequence of SEQ NO ID:6 is classified as: CGATGAATTCCATATGCAGGGTTTCTCTGTGTAGCC;

Amplification system and condition as shown in table 1:

Table 1:

GGTA1 clones the primer sequence of B fragment as shown in SEQ NO ID:7 and SEQ NO ID:8;

The nucleotides sequence of SEQ NO ID:7 is classified as: cgatGGATCCCATATGCTTCAAATTGTGATGGAAACTTGA

The nucleotides sequence of SEQ NO ID:8 is classified as: cgatGCGGCCGCGATATCAGCTTTTACAGACTGATGG

IGb3S clones the primer sequence of B fragment as shown in SEQ NO ID:9 and SEQ NO ID:10;

The nucleotides sequence of SEQ NO ID:9 is classified as: CGATGGATCCCATATGCAGCCCTTCCCTGGCCAAGC

The nucleotides sequence of SEQ NO ID:10 is classified as: CGATGCGGCCGCGATATCCTGGTCACAGGAATGGCTTCA

Amplification system and condition as shown in table 2:

Table 2:

Wherein the primer of GGTA1 cloned sequence A and fragment B is as shown in table 3:

Table 3:

Wherein the primer of iGb3S cloned sequence A and fragment B is as shown in table 4:

Table 4:

GGTA1 clones the primer sequence of C1 fragment as shown in SEQ NO ID:19 and SEQ NO ID:20;

The nucleotides sequence of SEQ NO ID:19 is classified as: cgatCTCGAGATAATCACAAGCAAAGTGTCTGG

The nucleotides sequence of SEQ NO ID:20 is classified as:

CTATTAGGAGGATTGTTTACTTGATATCAGAAGAAGTACCAACACC

IGb3S clones the primer sequence of C1 fragment as shown in SEQ NO ID:21 and SEQ NO ID:22;

The nucleotides sequence of SEQ NO ID:21 is classified as: CGATCTCGAGGTGGATGTCTCAGTGTGCGAA

The nucleotides sequence of SEQ NO ID:22 is classified as:

TACCGCAGACGGTGGATATCATTGACAGTCACTGAGCAA

Amplification system and condition as shown in table 5:

Table 5:

GGTA1 clones the primer sequence of C2 fragment as shown in SEQ NO ID:23 and SEQ NO ID:24;

The nucleotides sequence of SEQ NO ID:23 is classified as:

GGTGTTGGTACTTCTTCTGATATCAAGTAAACAATCCTCCTAATAG

The nucleotides sequence of SEQ NO ID:24 is classified as: cgatGCGGCCGCGAACACAAATGCCAGCCCAG

IGb3S clones the primer sequence of C2 fragment as shown in SEQ NO ID:25 and SEQ NO ID:26;

The nucleotides sequence of SEQ NO ID:25 is classified as: TTGCTCAGTGACTGTCAATGATATCCACCGTCTGCGGTA

The nucleotides sequence of SEQ NO ID:26 is classified as: CGATGCGGCCGCCTATCGAGTGGTTATTCTCAGGG

Amplification system and condition as shown in table 6:

Table 6:

Wherein the primer of GGTA1 cloned sequence C1 and C2 is as shown in table 7:

Table 7:

Wherein the primer of iGb3S cloned sequence C1 and C2 is as shown in table 8:

Table 8:

1.2 are connected to pBlunt carrier:

1.2.1 respectively enzyme cut qualification, check order A and B fragment correct and be connected to pL452 carrier successively, obtain pL452-GGTA1-A-B and pL452-iGb3S-A-B.

1.2.2 respectively by Overlap PCR, correct C1, C2 segment composition of order-checking is connected on pDTA-Down carrier, obtains

PDTA-Down-GGTA1-C and pDTA-Down-iGb3S-C.

1.2.3 respectively correct pL452-GGTA1-A-B and the pL452-iGb3S-A-B EcoRV enzyme of connection is cut, reclaim object Segment A-NeoR-B.

A-Neo-B fragment the forward primer of A fragment and the reverse primer of B fragment is added with EcoRV restriction enzyme site, so can scale off with EcoRV by pL452-AB.

Object Segment A-NeoR-B electricity BAC the bacterium proceeded to containing pBCTG is recombinated by 1.3 respectively:

Respectively the A-Neo-B fragment scaled off is reclaimed purifying, the method then transformed by electricity is transferred to inside the BAC bacterium containing pBCTG.

1.4 carry out bacterium colony PCR respectively detects A-NeoR-B fragment restructuring BAC, and qualification amplified band is correct:

Design suitable detection primer at A and B fragment two ends respectively, detect the sequence of primer as shown in table 9,10; Verify that whether restructuring is correct by the PCR at AB two ends.

Table 9:

Table 10:

The linearization process of 1.5pDTA-down-GGTA1-C and pDTA-Down-iGb3S-C:

EcoRV enzyme cutting other places reason pDTA-down-GGTA1-C and pDTA-Down-iGb3S-C, makes its linearizing, reclaims object band, and then is transferred to respectively in the BAC bacterium of the NeoR that recombinated by linearizing band by the method that electricity transforms.

1.6pDTA-GGTA1-C saves GGTA1-NeoR BAC (AmpR+KanR)): pDTA-iGb3S-C saves iGb3S-NeoR BAC

(AmpR+KanR)：

After inside the BAC bacterium that after linearizing, electricity forwards the GGTA1 of the NeoR that recombinated to, by the mode of homologous recombination, A-Neo-B fragment is saved on pDTA-down-C;

After inside the BAC bacterium that after linearizing, electricity forwards the iGb3S of the NeoR that recombinated to, by the mode of homologous recombination, A-Neo-B fragment is saved on pDTA-down-C.

1.7 carry out PCR Testing and appraisal to the bacterium colony after C rescue respectively, and restructuring correctly cloned and increase, at C1 and C2 two ends, design is suitable

Detect primer, verify that whether restructuring is correct by PCR, the correct bacterium colony of restructuring is shaken bacterium incubated overnight.

The sequence detecting primer is as shown in table 11:

Table 11-1:

Table 11-2:

After transforming Stbl3 competent cell, digestion verification as shown in Figure 3.

Enzyme is cut and is detected pDTA-GGTA1-A-B-C: as shown in figure 3-1;

MfeI：1705bp+2104bp+3582bp+5249bp+6326bp；

HindIII+EcoRI：555bp+1129bp+6547bp+10735bp；

ScaI+NheI：229bp+588bp+1827bp+2798bp+3665bp+4128bp+5731bp。

Enzyme is cut and is detected pDTA-iGb3S-A-B-C: as shown in figure 3-2;

BgllI：740bp+2354bp+4252bp+5015bp+12389bp；

NheI：90bp+930bp+9890bp+13840bp；

SpeI：2850bp+3880bp+7110bp+10910bp。

1.8GGTA1 enzyme cuts correct clone through order-checking qualification, confirms that sequence correct plasmid increases through order-checking.

Sequence correct plasmid sample carry greatly rear enzyme cut detect pDTA-GGTA1-A-B-C the results are shown in Figure 4-1.

Targeting vector pDTA-GGTA1-A-B-C No. 1 plasmid is carried greatly rear enzyme and is cut detection:

MfeI：1705bp+2104bp+3582bp+5249bp+6326bp；

HindIII+EcoRI：555bp+1129bp+6547bp+10735bp；

ScaI+NheI：229bp+588bp+1827bp+2798bp+3665bp+4128bp+5731bp。

Enzyme is cut correct clone to be used for linearization for enzyme restriction electricity and to turn embryonic stem cell (AscI).

IGb3S enzyme cuts correct clone through order-checking qualification, confirms that sequence correct plasmid increases through order-checking.

Sequence correct plasmid sample carry greatly rear enzyme cut detect pDTA-iGb3S-A-B-C the results are shown in Figure 4-2.

Targeting vector pDTA-iGb3S-A-B-C No. 1 plasmid is carried greatly rear enzyme and is cut detection:

BgllI：740bp+2354bp+4252bp+5015bp+12389bp；

NheI：90bp+930bp+9890bp+13840bp；

SpeI：2850bp+3880bp+7110bp+10910bp。

2, the restructuring of embryonic cell

Respectively linearizing recombinant DNA is turned mode homologous recombination by electricity and enter embryonic stem cell, then screened by G418, screen out the embryonic stem cell of not recombinating, the clone that picking is remaining, carry out PCR and Southern screening, finally choose correct clone and inject.

Detailed step is:

By transfection C57BL/6ES cell after large upgrading grain pDTA-GGTA1-A-B-C linearizing, screened by G418, select 400 clone's probes 1 and screen, Fig. 1 is shown in the design of probe, and sequence is in Table 12-1.The probe 1 (Probe1) of rejecting GGTA1 is positioned at the outside that 5` holds homology arm, the restriction enzyme site of NdeI is introduced at A fragment 3` end, therefore, the size that wild-type and mutant enzyme cut rear probe mark is different, determine whether to recombinate successfully with this, and confirm that restructuring is special, but not radom insertion.The positive colony screening of restructuring ES cell is carried out with probe 1.As shown in fig. 5-1.The positive colony selected is carried out multiple sieve with probe 2 again.The probe 2 (Probe2) of rejecting GGTA1 is positioned at the inner side that 3` holds homology arm, what wild-type and mutant enzyme cut rear probe 2 mark the results are shown in Figure 6-1, confirms that the positive colony that filters out of probe 1 is confirmed correct being injected by the blastaea being used for mouse embryo by probe 2.

By transfection C57BL/6ES cell after large upgrading grain pDTA-iGb3S-A-B-C linearizing, screened by G418, select 200 clone's probes 1 and screen, Fig. 1 is shown in the design of probe, and sequence is in Table 12-2.The probe 1 (Probe1) of rejecting iGb3S is positioned at the outside that 5` holds homology arm, the restriction enzyme site of NdeI is introduced at A fragment 3 ' end, therefore, wild-type and mutant enzyme cut varying in size of rear probe mark, determine whether to recombinate successfully with this, and confirm that restructuring is special, but not radom insertion.The positive colony screening of restructuring ES cell is carried out with probe 1.As shown in Fig. 5-2.The probe 1 (Probe1) of rejecting iGb3S is positioned at the outside that 5` holds homology arm, the restriction enzyme site of NdeI is introduced at A fragment 3 ' end, therefore, the size that wild-type and mutant enzyme cut rear probe mark is 25.2kb and 11.3kb respectively, determine whether to recombinate successfully with this, and confirm that restructuring is special, but not radom insertion.The positive colony selected is carried out multiple sieve with the probe 2 of rejecting iGb3S again.The probe 2 (Probe2) of rejecting iGb3S is positioned at the inner side that 3` holds homology arm, and the size that wild-type and mutant enzyme cut rear probe 2 mark is that these positive colonies of 25.2kb and 12.3kb will be used for the blastaea injection of mouse embryo respectively, and result as in fig. 6-2.

The nucleotide sequence of probe 1 and probe 2 is as shown in table 12:

Table 12-1:

Table 12-2:

3, the blastaea injection of reconstituted embryo fetus cells

By microinjection (Microinjection) the producer gene knock-out animal of blastaea, its main process comprises the following steps:

The 3.1 sterile male mouse of preparation and the female mouse of false pregnancy

3.1.1 preparation is anaesthetized: select 7 week age male mouse to weigh and through abdominal injection 0.7% Nembutal sodium solution.

3.1.2 make arrangements for surgery apparatus: ophthalmic tweezers 3, eye scissors 1, Shearing shears 1, spirit lamp, one, alcohol watering can, three-edged needle, suture line, sterilized filter paper sheet (diameter about 15cm).

3.1.3 male mouse ligation: will anaesthetize male mouse belly apart from sexual organ 2cm place's cropping, after 70% alcohol swab cleaning disinfection, opening skin layer and muscle layer respectively, testis liparitosis pull-out testis is clamped with ophthalmic tweezers, epididymis, vas deferens, choose vas deferens middle portion, with suture line, vas deferens and capillary vessel are tightened, 1cm place, interval tightens again, cut with the simple middle portion that suture line is tightened, the ligation operation of side completes, with the same manner other side of ligation again, both sides complete clamps liparitosis with tweezers and is sent back to abdominal cavity, suture muscles layer and skin layer, after recovery, single cage is raised.

3.1.4 Anabiosis after operation: ligation completed raising after two weeks, mates mating with heat mouse in 6 week age, raises separately after examining bolt next day, within 15th, whether confirms gestation afterwards, checks ligation success or not.

Female mouse prepares false pregnancy:

3.1.5 heat mouse selects: select proestrum and heat mouse, tissue characterization is vagina crack, is organized as incarnadine to pink colour, more moistening, and many wrinkles in length and breadth all appear in vagina dorsal lip and abdomen lip.

3.1.6 the male mouse mating with ligation: will select the male mouse mating of heat mouse 1:1 ligation, secondary daily test bolt, single cage is raised for subsequent use, see that bolt same day is 0.5 day, common oviduct transplantation is with seeing bolt 0.5 day false pregnancy mouse, and uterine transplantation is with seeing bolt 2.5 days false pregnancy mouse.

3.2 surpass ovulation

3.2.1 hormone prepares: with 0.9% normal saline dilution pregnant mare serum (PMSG) and Human ChorionicGo-nadotropin (hCG), and domestic hormone dilution is 10IU/0.1ml, and the dilution of import hormone is 5IU/0.1ml.

3.2.2 injection of hormone: prepare female mouse in 4 ~ 6 week age, 48 hours, interval, every only difference abdominal injection PMSG and hCG 10IU.Mates mating, secondary daily test bolt after hCG injection with the male mouse of strain sexual maturity, single cage is raised for subsequent use, sees that bolt same day is 0.5 day, puts to death female mouse and gather blastaea after 3.5 days.

3.3 gather blastaea

3.3.1 nutrient solution prepares: M2 nutrient solution is put into 37 DEG C of water-bath incubations, and KSOM nutrient solution and 1mg/ml Unidasa make cultivation drop in Bechtop, is put into 37 DEG C of CO2gas incubator incubations for subsequent use.

3.3.2 animal is dissected: cervical dislocation is put to death and seen bolt 3.5 days female mouse, and after 70% alcohol swab sterilize wiping belly, open abdominal cavity, get its uterus, being put into incubation has in the 35mm culture dish of 1ml M2 nutrient solution.

3.3.3 embryo collection: getting protokaryon embryo is be put into by uterine tube in 300 μ l Unidasa drops, under stereomicroscope, find magnum tubae uterinae, punctured with 1ml syringe needle, release ovocyte group, examined under a microscope after 3 ~ 4 minutes, granulosa cell around ovocyte digests, just can collect ovocyte, be put into KSOM after washes clean and cultivate drop, be put in CO2gas incubator for subsequent use.Getting blastaea is be put in uterus in 60mm culture dish, draws M2 nutrient solution, under stereomicroscope with 1ml syringe, syringe needle is inserted one end, uterus, rinse uterus, and collect blastaea under mirror, be put into after washes clean KSOM cultivate drop, be put in CO2gas incubator cultivate for subsequent use.

The embryonic cell of restructuring is imported blastaea by 3.4

Blastaea microinjection: do elliptical-shaped inject with M2 nutrient solution on 60mm culture dish and drip, covers paraffin oil, under culture dish being put into micrurgy instrument mirror, get 30 blastaeas be put into injection drip in, then draw stem cell add injection drip in, adjustment micro objective, under suitable multiple, adjustment entry needle, sucks 50 ~ 100 stem cells, under mirror, finds blastaea, ovum pin is held in operation, fixing blastaea, 10 ~ 15 embryonic cells are expelled in 1 segmentation cavity by operation entry needle, complete injection.A collection of blastaea is put back to KSOM and is cultivated in drop after having injected, cultivate, recover the blastaea of select after 30 minutes and carry out uterine transplantation in CO2gas incubator.

The transplanting of 3.5 zygotes

Blastaea is transplanted: the dorsomeson place of false pregnancy mouse back distance afterbody 3 ~ 4cm is by hair, skin layer is cut off with after 70% alcohol swab cleaning disinfection, find ovary position again, cut off muscle layer, ovary, uterine tube and uterus are taken out, fix with mosquito forceps, 8 blastaeas are drawn under stereomicroscope, simultaneously by fixing ovary, under oviducal false pregnancy mouse is put into microscope, find uterus and the few position of oviductal junction blood vessel, stinging an osculum with 1ml syringe needle, inserting there being the suction oviduct bead of blastaea, embryo is blown into, transplants opposite side with the same manner.Postoperative skin suture layer, after animal revives, single cage is raised, and waits the zygote implantation of reconstituted embryo fetus cells to be implanted, becoming pregnant of female mouse.

4, mating, breed with building and be

By ES cell (the C57BL/6ES cell GGTA1 of above-mentioned acquisition ^-/-) positive colony injects the zygote of C57BL/6 mouse (black) through microinjection technique, then be implanted into the intrauterine of the female mouse of replace-conceive (Balb/C, white), obtains allophenic mice (black piebald).Chi-meric mice confirms: produce son in transplanting after 17 days, and record produces quantum count, has been confirmed whether Chi-meric mice at 10 ~ 15 days according to hair color.Embryonic cell derives from C57BL/6, black; False pregnancy mouse Balb/C is white, so obtain the piebald allophenic mice of black splotch, photo is as shown in Fig. 7 (wherein Fig. 7-1 is the allophenic mice of rejecting GGTA1 gene, and Fig. 7-2 is for rejecting the allophenic mice of iGb3S gene); Mouse germline is picked out by cross breeding gene.

Adopt following scheme mating to build to be: for the then male mouse mating with wild-type of female chimeras mouse, select age in week at 10 weeks, there is mating experience, healthy and strong C57BL/6 mouse mating with it.Start to check Pregnancy after living together 1 week, if find conceived raising separately by female mouse, until produce.If be Male chimeras body mouse, then select more than 8 weeks, the healthy and strong female mouse of wild-type C57BL/6 mating with it, obtain F1 generation hybrid mice, photo is as shown in Fig. 8 (wherein Fig. 8-1 is the hybrid mice of rejecting GGTA1 gene, and Fig. 8-2 is for rejecting the hybrid mice of iGb3S gene).F1 generation hybrid mice again with wild-type C57BL/6 mating, screening homozygote mouse.Utilize the heterozygote of GGTA1 and iGb3S or homozygote to carry out cross breeding, screening GGTA1 and the iGb3S dual-gene homozygote mouse knocked out, and carry out conservation and build and be.

5, genotype identification

5.1 the detection of object recombinant DNA integration in heterozygote and homozygote mouse:

Respectively from the tail point tissue extraction DNA of knockout animal (hybrid mice, Fig. 8), carry out genotypic qualification by the Partial Fragment of high-fidelity PCR amplification gene.Design of primers for genotype identification is shown in Fig. 9, and primer sequence is in table 13, and its PCR condition is in table 14.

Table 13-1. primer sequence

Table 13-2. primer sequence

Table 14. PCR condition:

WT-F/WT-R Neo-F/WT-R

The electrophorogram of GGTA1 model mouse pcr amplification gene fragment is as shown in Figure 10-1, and Figure 10-1 left hand view is GGTA1-WT-F/WT-R High fidelity PCR electrophorogram; Wherein, be 189bp by the fragment of GGTA1-WT-F/WT-R pairing primer amplification, represent wild-type; Figure 10-1 right part of flg is GGTA1-Neo-F/WT-R High fidelity PCR electrophorogram; Matching the fragment of primer amplification by GGTA1-Neo-F/WT-R is 302bp, represents recombinant type.Show acquisition 5 heterozygote clones in Figure 10,10,13,2,3, No. 4 is positive colony.

The electrophorogram of iGb3S model mouse pcr amplification gene fragment is as shown in Figure 10-2, and Figure 10-2 (a) is iGb3S-WT-F/WT-R High fidelity PCR electrophorogram; Wherein matching the fragment of primer amplification by iGb3S-WT-F/WT-R is 173bp; Figure 10-2 (b) is iGb3S-Neo-F/WT-R High fidelity PCR electrophorogram, and be show acquisition 3 heterozygotes in 276bp, Figure 10-2 to clone by the fragment of iGb3S-Neo-F/WT-R pairing primer amplification, 2,3, No. 7 is positive colony.

Batch homozygote mouse is obtained respectively through repeatedly breeding.(wherein Figure 11-1 is the homozygote mouse of rejecting GGTA1 gene to homozygote mouse photo such as Figure 11, Figure 11-2 is for rejecting the homozygote mouse of iGb3S gene) shown in, by the F1 hybrid mice of GGTA1 and the mating of F1 hybrid mice, obtain the F2 homozygote mouse of GGTA1; By the F1 hybrid mice of iGb3S and the mating of F1 hybrid mice, obtain the F2 homozygote mouse of iGb3S; Again the F2 homozygote mouse of the F2 homozygote mouse of GGTA1 and iGb3S is carried out cross breeding, obtain GGTA1 and iGb3S Double knockout mice; Or the F1 hybrid mice of GGTA1 and the F1 hybrid mice of iGb3S are carried out cross breeding, screening GGTA1 and iGb3S Double knockout mice homozygote mouse.Within 20 weeks, be showed no obvious physiological situation after GGTA1, iGb3S and GGTA1 and the birth of iGb3S Double knockout mice homozygote mouse abnormal, grow, grow and ingest, movable etc. all normal.Observation more of a specified duration is also underway.

Homozygous genotype identification adopts high-fidelity PCR amplification method (its primer and PCR condition are with table 13 and table 14), the electrophorogram of its pcr amplification gene fragment is as shown in Figure 12 (wherein Figure 12-1 is the electrophorogram of rejecting GGTA1 gene, and Figure 12-2 is for rejecting the electrophorogram of iGb3S gene).

After homozygote High fidelity PCR genotype screening, carry out Southern Blot qualification with probe 1 and probe 2, confirm the exactness and the stability that knock out gene.(wherein Figure 13-1 is the schematic diagram of the Southern blot screening strategy of rejecting GGTA1 gene to schematic diagram such as Figure 13 of Southern blot screening strategy, Figure 13-2 is the schematic diagram of rejecting iGb3S gene Southern blot screening strategy), the site of 5`-Probe1 and 3`-Probe 2 has wherein been indicated with short-term.The design of primers of shown probe 1 and probe 2 is with table 12; The southern restriction enzyme site introducing two ends outside loxP site is respectively held at 5` end and 3`, cut with NdeI digestive ferment respectively, detect gene knockout homozygote mouse (Mut/Mut) by the southern blot of 5`-Probe and 3`-Probe and only can produce saltant type band, hybrid mice (Mut/WT) can produce wild-type and saltant type band, and the wild-type mice that gene does not knock out (WT/WT) only can produce wild type band.The size of each band is in table 15.

The Southern blot of table 15-1. GGTA1 detects the size of gene fragment

	Probe	WT/WT	Mut/WT	Mut/Mut
					Ndel	5`-Probe 1	16.2kb	5.7kb/16.2kb	5.7kb
Ndel	3`-Probe 2	16.2kb	9.5kb/16.2kb	9.5kb

The Southern blot of table 15-2. iGb3S detects the size of gene fragment

	Probe	WT/WT	Mut/WT	Mut/Mut
					Ndel	5`-Probe 1	25.2kb	25.2kb/11.3kb	11.3kb
Ndel	3`-Probe 2	25.2kb	25.2kb/12.3kb	12.3kb

southern Blot adds up to detection 6 mouse (each 2 of homozygote, heterozygote and wild-type), extracts mouse coda gene group DNA.As Figure 14, (14-1 is the probe 1 (top) of GGTA1 and the detected result of probe 2 (bottom) to its Southern Blot qualification result respectively; A, b of 14-2 are respectively the detected result of iGb3S probe 1, probe 2) shown in, confirm that homozygote mouse has obtained stable heredity.

The High fidelity PCR detected result of GGTA1 and iGb3S Double knockout mice heterozygote is shown in Figure 15, confirms the existence of the one-sided chromosomal variation of GGTA1 and iGb3S.

6, phenotypic evaluation

GGTA1 and the iGb3S Double knockout mice that the present invention obtains has new phenotype.General vital signs are normal, grow normal.Because GGTA1 and iGb3S dual-gene rejecting animal model business has no report, its phenotypic characteristic needs to be observed further.

Model mice gene expression dose phenotypic evaluation adopts the RT-PCR identification method of mrna expression.Get GGTA1 and iGb3S homozygote and the dual-gene multiple organs and tissues knocking out hybrid mice, comprise liver, lung, kidney, spleen, heart, the expression carrying out mRNA measures.RT-PCR the primer is in table 16; Its detected result is shown in that (wherein scheme a is the result that GGTA1KO mice organs organizes GGTA1mRNA to Figure 16; Figure b is the result that iGb3S KO mice organs organizes iGb3S mRNA; Figure c is the dual-gene the result picking out hybrid mice organs and tissues iGb3S mRNA of GGTA1 KO and iGb3S KO; Figure d is the dual-gene the result picking out hybrid mice organs and tissues GGTA1mRNA of GGTA1 KO and iGb3S KO), GGTA1 and iGb3S pounds out separately the expression that mouse loses corresponding mRNA completely; The hybrid mice of dual-gene rejecting significantly reduces the expression of GGTA1 and iGb3S mRNA.

Model mice protein expression level phenotypic evaluation adopts alpha-Gal ELISA to suppress method to carry out the detection of alpha-Gal antigen presentation.The expression of alpha-Gal antigen is regulated and controled by GGTA1 and iGb3S, and the disappearance of GGTA1 and iGb3S genetic expression will cause remarkable minimizing or the completely dissolve of alpha-Gal antigen presentation.Alpha-Gal ELISA suppresses method to adopt the specific antibody M86 of alpha-Gal antigen, first reacts with M86 and the alpha-Gal antigen in tissue, then carries out the unreacted residue antibody of centrifugation; Residue antibody is measured by 96 orifice plates by alpha-Gal/BSA solid phase antigen bag, calculates the expression amount with the alpha-Gal antigen of tissue reaction with this.Its detected result in table 17, GGTA1 with iGb3S gene pick out the alpha-Gal antigen of homozygote mouse expression amount comparatively wild-type mice (WT) compare and all significantly reduce.GGTA1 is the major regulatory gene of alpha-Gal, and therefore picking out of GGTA1 gene makes the expression of alpha-Gal reduce 52% ~ 94%; And the independent genetically deficient of iGb3S makes the expression of alpha-Gal reduce 8.8% ~ 46.6%; GGTA1 and iGb3S is dual-gene picks out hybrid mice, compares the expression significantly reducing Gal antigen compared with wild-type mice.GGTA1 and iGb3S be dual-gene to be picked out homozygote mouse and almost will eliminate the expression of alpha-Gal antigen completely, and this will prove this scientific phenomena in the world first.

The RT-PCR primer sequence of table 16-1:GGTA1

The RT-PCR primer sequence of table 16-2:iGb3S

The detection of expression result of table 17-1:GGTA1KO homozygote mouse alpha-Gal antigen

The detection of expression result of table 17-2:iGb3S KO model homozygote mouse alpha-Gal antigen

The detection of expression result of table 17-3:GGTA1/iGb3S Double knockout mice heterozygote alpha-Gal antigen

Alpha-Gal expresses	Liver	Kidney	Spleen	Lungs	Heart
						decrease rate(％WT)	52.4	60.1	71.2	59.4	48.3

7, gene picks out the life cycle of animal

The life cycle of GGTA1/iGb3S Double knockout mice and wild type animal, without significant difference, have no the report that life cycle is different.In the present invention, the dual-gene life cycle knocking out gene knockout mice of GGTA1/iGb3S there is not yet shortening phenomenon, and general state is normal.

Claims

1. prepare a method for the dual-gene non-human mammal knocked out of GGTA1 and iGb3S, it is characterized in that, comprise the following steps:

2. the method for the dual-gene non-human mammal knocked out of preparation GGTA1 and iGb3S according to claim 1, it is characterized in that, described non-human mammal is mouse, further preferred C57BL mouse.

3. the method for the dual-gene non-human mammal knocked out of preparation GGTA1 and iGb3S according to claim 1, it is characterized in that, described GGTA1 gene knockout is functional catalytic domain the 9th exon knocking out GGTA1 gene, and its nucleotide sequence is as shown in SEQ NO ID:1; Described iGb3S gene knockout is functional catalytic domain the 5th exon knocking out iGb3S gene, and its nucleotide sequence is as shown in SEQ NO ID:2.

4. the method for the dual-gene non-human mammal knocked out of preparation GGTA1 and iGb3S according to claim 1, it is characterized in that, described GGTA1 targeting vector contains 5` homology arm, resistance antibiotic resistance gene NeoR-PA and 3` homology arm, replaces the 9th exon respectively with NeoR-PA; Described iGb3S targeting vector contains 5` homology arm, resistance antibiotic resistance gene NeoR-PA and 3` homology arm, replaces the 5th exon respectively with NeoR-PA.

5. preparation GGTA1 and iGb3S according to claim 1 dual-gene knock out non-human mammal, filial generation, embryo or cell method, it is characterized in that, the resistance antibiotic resistance gene NeoR-PA 5` end built for GGTA1 targeting vector and the homology arm sequence of 3` end take from 5` end and the 3` end of GGTA1 gene the 9th exon on mouse Article 2 karyomit(e), are respectively 4.123kb and 7.343kb; The resistance antibiotic resistance gene NeoR-PA 5` end built for iGb3S targeting vector and the homology arm sequence of 3` end take from 5` end and the 3` end of iGb3S gene the 5th exon on mouse Article 4 karyomit(e), are respectively 8.3kb and 9.1kb.

6. the method for the dual-gene non-human mammal knocked out of preparation GGTA1 and iGb3S according to claim 2, is characterized in that, the step building targeting vector is:

Wherein, the construction step of GGTA1 targeting vector is:

The construction step of iGb3S targeting vector is:

(2) enzyme is cut qualification, checking order A and B fragment correct and being connected to pL452 carrier successively obtains pL452-iGb3S-A-B, meanwhile, will be connected on pDTA-Down carrier after C1, C2 segment composition correct for order-checking by OverlapPCR;

7. preparation GGTA1 and iGb3S according to claim 1 dual-gene knock out nonmammalian, filial generation, embryo or cell method, it is characterized in that, step (2) comprises the following steps: prepare sterile male mouse and the female mouse of false pregnancy; Super ovulation; Results zygote; The preparation of target DNA; Target DNA is imported zygote; The transplanting of zygote; Head builds the detection of target DNA integration in mouse; Mouse germline is picked out by cross breeding gene.

8. the sperm from dual-gene knock-out animal according to claim 1, ovum, zygote, embryo, filial generation, tissue or cell.

9. the application of the dual-gene non-human mammal that knocks out as claimed in claim 1 or the application in biogenic material of sperm as claimed in claim 8, ovum, zygote, embryo, filial generation, tissue or cell and the tumour immunity in the mediation of α-Gal antigen; Described biogenic material comprises animal derived or takes from human body, and described animal derived biomaterial do not comprise primate; The kind of described animal derived biomaterial comprises various tissues, internal organs and the derivative thereof taken from animal body, or by the various materials organized or prepared by internal organs; Described primate is Gu century monkey, baboon preferably.

10. application according to claim 9, it is characterized in that, described application is included in the application in immunological investigation, immunotoxicology research, the Regulation Mechanism research of α-Gal antigen presentation, the research of heteroplastic immunological rejection and mechanism thereof, safety evaluation; Described immunological investigation comprises the heterogenous animal tissue of α-Gal antigen mediation, the research of organ or animal derived biomaterial and tumour immunity; Described safety evaluation comprises biogenic material, the immunological evaluation of the safety evaluation of preferred animal derived biomaterial before clinical and experimental study and GGTA1 gene knock-out pig, Niu Deng animal tissues, organ transplantation.