CN107043787B - A kind of construction method and application that MARF1 rite-directed mutagenesis mouse models are obtained based on CRISPR/Cas9 - Google Patents

A kind of construction method and application that MARF1 rite-directed mutagenesis mouse models are obtained based on CRISPR/Cas9 Download PDF

Info

Publication number
CN107043787B
CN107043787B CN201710355368.3A CN201710355368A CN107043787B CN 107043787 B CN107043787 B CN 107043787B CN 201710355368 A CN201710355368 A CN 201710355368A CN 107043787 B CN107043787 B CN 107043787B
Authority
CN
China
Prior art keywords
marf1
sgrna
mouse
cas9
rite
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201710355368.3A
Other languages
Chinese (zh)
Other versions
CN107043787A (en
Inventor
苏友强
曹广义
李明哲
王昊
时兰英
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Medical University
Original Assignee
Nanjing Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Medical University filed Critical Nanjing Medical University
Priority to CN201710355368.3A priority Critical patent/CN107043787B/en
Publication of CN107043787A publication Critical patent/CN107043787A/en
Application granted granted Critical
Publication of CN107043787B publication Critical patent/CN107043787B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/0004—Screening or testing of compounds for diagnosis of disorders, assessment of conditions, e.g. renal clearance, gastric emptying, testing for diabetes, allergy, rheuma, pancreas functions
    • A61K49/0008—Screening agents using (non-human) animal models or transgenic animal models or chimeric hosts, e.g. Alzheimer disease animal model, transgenic model for heart failure
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Toxicology (AREA)
  • Environmental Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Animal Husbandry (AREA)
  • Epidemiology (AREA)
  • Pathology (AREA)
  • Rheumatology (AREA)
  • Endocrinology (AREA)
  • Urology & Nephrology (AREA)
  • Diabetes (AREA)
  • Public Health (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

A kind of construction method and application that MARF1 rite-directed mutagenesis mouse models are obtained based on CRISPR/Cas9, design the sgRNA sequences in efficient identification specific gene group PAM regions；And Donor DNA are designed in sgRNA sequence basis；By Donor DNA, sgRNA and Cas9 mRNA mixtures obtain founder mouse, and cloning and sequencing to embryonated egg procaryotic injection, embryo transfer, strain identified for genes, and confirmation finally gives genetic mouse catastrophic model.The present invention can be to improving human assistance reproductive technology, prevent and treat female infertility and female reproduction relevant disease, and the effective female contraception medicine of development of new all has important references value, and the healthy reproduction for promoting China or even global women is significant.

Description

A kind of structure side that MARF1 rite-directed mutagenesis mouse models are obtained based on CRISPR/Cas9 Method and application
Technical field
The present invention relates to gene code technical field, and in particular to uses CRISPR/Cas9 gene code technique constructions The methods and applications of MARF1 rite-directed mutagenesis mouse models.
Background technology
MRAF1 proteins. Introductions
Soviet Union etc. is found that the Riken genes of the brand-new albumen of a coding past Unknown Function recently (4921513D23Rik).The mouse for carrying the Gene unit point mutation and gene trap (gene trap) mutation shows together The female sterile of sample and the normal table of male.Further study showed that the immediate cause for causing female sterile is female mice ovum mother Cell can not recover meiosis and discharge immature egg mother cell.Accordingly, the unnamed gene is Marf1 by we (meiosis arrest female 1).Clinically, MARF1 albumen also has great importance.On the basis that we test On, once the crucial extron of maturation of ovum impaired patients gene was sequenced by Chen Zijiang etc., inquired into mankind's maturation of ovum obstacle It is whether related to MARF1 genetic mutations.
MARF1 is a rna binding protein, and RRM (RNA recognition are typically of except possessing the albuminoid Motif) outside, it possesses the domain (domain) of 1 similar ribalgilase (RNase) at N- ends, and 1 is possessed at C- ends newly It is being found, be named as OST (oskar, tudor) or LOTUS (limkain, oskar and tudor domain The and 7 of containing proteins 5) domain.OST/LOTUS domains exist in drosophila protein Oskar and the food in one's mouth In newborn animal protein TDRD5 and 7 (and 7 of tudor domaincontaining proteins 5), and can by speculating Those double-stranded RNAs formed after hybridizing with piRNA are particularly with reference to double-stranded RNA, they are then carried to reproduction cell Inside such as nuage or germ granule privileged site.Oskar and TDRD5,7 determines (germ in drosophila reproduction cell respectively Cell specification) and the meiosis of mouse male sex-cell and retrotransposon silence in play an important role (Su.et.al.PNAS.2012).It is specifically shown in Fig. 1.
MARF1 albumen rite-directed mutagenesises
Protein structure databases NCBI-Structure (https://www.ncbi.nlm.nih.gov/ Structure/cdd/) conservative protein structure domain analogy is carried out, compare NYN and equally conservative XNI, 5 '- EXONUCLEASE, TAQ DNA POLYMERASE, RIBONUCLEASE H, it is found that they possess 4 conservative Asp nucleases Catalytic residue.It is corresponding in turn in the NYN of MARF1 albumen as D178, D215, D246, D272.In protein structure research, the third ammonia Acid is the chiral amino acid that side chain is most short in amino acid.By the way that certain amino acid residue is sported into alanine, investigation can be passed through Therefore whether the function of the mutain is mutated and loses or change, have crucial effect to the protein function so as to position Amino acid residue.Alanine is replaced as, eliminates the active group on side chain, has changed small volume, the first without other functional groups into Base, while the influence to protein structure is smaller.Therefore, the present invention have selected No. 272 sites of mutation, and aspartic acid (D) is prominent It is changed into alanine (A).After MARF1 No. 272 aspartic acids (D) sport alanine (A), it can be used for specifically studying MARF1 NYN domains inactivation after influence to whole MARF1 albumen, further careful research MARF1 albumen lose NYN enzyme activity Property after, to egg mother cell transcribe after mRNA steady-state adjustments influence.Particular sequence, which compares, sees Fig. 2.
CRISPR/Cas9 SYSTEM SUMMARYs
CRISPR (clustered, regularly interspaced, short palindromic repeats) is one The immunologic mechanism of viral DNA or other exogenous DNAs of the kind from bacterial degradation invasion.In bacterium and archeobacteria, CRISPR systems Altogether it is divided into 3 classes, wherein I class and III class need a variety of CRISPR GAP-associated protein GAPs (Cas albumen) to play a role jointly, and II class system System only needs a kind of Cas albumen, and this can be extensively using the condition of providing convenience for it.At present, come from Streptococcus pyogenes CRISPR/Cas9 systems are most widely used.Cas9 albumen (contains two nuclease knots Structure domain, it is single-stranded that DNA two can be respectively cut.Cas9 is combined into compound with crRNA and tracrRNA first, then passes through PAM sequences are combined and invade DNA, form RNA-DNA composite constructions, and then target DNA double-strand is cut, and make DNA double chain Fracture.Because PAM sequential structures are simple (5 '-NGG-3 '), a large amount of target spots can be almost found in all genes, because This is widely used.It is thin that CRISPR/Cas9 technologies have been successfully applied to plant, bacterium, yeast, fish and mammal Born of the same parents, it is current most efficient genome editing technique.CrRNA and tracrRNA are transformed by genetic engineering means, will It links together to obtain sgRNA (single guide RNA).RNA after fusion has the vigor similar with wild type rna, But because structure is simplified, it is more convenient researcher and uses.It is specifically shown in Fig. 3.
The content of the invention
The technical problem of solution：The present invention provides a kind of based on CRISPR/Cas9 acquisition MARF1 rite-directed mutagenesis mouse models Construction method and application, in the research of the horizontal gene M ARF1 albumen for carrying out egg mother cell predominant expression of animal.Especially may be used To probe into when point mutation occurs, whether NYN domains can lose work, how to regulate and control Growth of Oocytes development to MARF1 During 3 key links-" acquisition of Meiotic resumption ability ", " mRNA post-transcriptional controls " and " retrotransposon sinks It is silent " expansion more in-depth study.Present invention contemplates that MARF1 NYN domain action principles can be disclosed first, and will be deeply Disclose the key mechanism that regulation and control Growth of Oocytes is reached maturity.This prevents and treats female acyesis to improving human assistance reproductive technology Infertility and female reproduction relevant disease, and the effective female contraception medicine of development of new all have important references value, to promoting The healthy reproduction for entering China or even global women is significant.
Technical scheme：A kind of construction method that MARF1 rite-directed mutagenesis mouse models are obtained based on CRISPR/Cas9, including Following steps：1st step：The sgRNA sequences in the efficient identification specific gene group PAM regions of design, the sgRNA sequences such as SEQ Shown in ID NO.1；And Donor DNA, the Donor DNA sequence dnas SEQ ID NO.2 institutes are designed in sgRNA sequence basis Show；2nd step：By Donor DNA, sgRNA and Cas9 mRNA mixtures are to embryonated egg procaryotic injection, embryo transfer, strain gene Identification, obtains founder mouse, and cloning and sequencing, confirms the genetic mouse mutation of MARF1-D272A point mutation finally given Model.
What above-mentioned construction method obtained obtains MARF1 rite-directed mutagenesises mouse model in screening contraception based on CRISPR/Cas9 Application in medicine.
What above-mentioned construction method obtained obtains MARF1 rite-directed mutagenesises mouse model in screening preventing and treating based on CRISPR/Cas9 Application in female infertility or female genital disorders medicine.
The kit of MARF1 rite-directed mutagenesis mouse models is obtained, contains the sgRNA as shown in SEQ ID NO.1.
Donor DNA sequence dna of the mentioned reagent box shown in also containing SEQ ID NO.2.
Mentioned reagent box also contains Cas9 mRNA.
The specific building process of transgene mouse model is as follows：
1st, the structure of CRISPR-Cas system elements
In UCSC websites, MARF1 genomic dna sequence is downloaded.Intohttp://crispr.mit.edu/Website, it is defeated Enter CDS sequences and search available sgRNA, 250bp is selected before and after MARF1-D272A point mutation position.Build px330- SgRNA plasmids, and sgRNA in-vitro transcription templates are prepared, in-vitro transcription obtains sgRNA.Carry out Cas9 mRNA in-vitro transcriptions.
2nd, MARF1-sgRNA efficiency and Cas9 mRNA quality testings
Close up after making mouse superfecundation with public mouse, examine bolt, obtain more embryonated eggs.Prepare sgRNA and Cas9 mRNA Mixture.By PCR, clone, sequencing, to determine the detection of sgRNA cleavage sites.
3rd, Donor DNA design, the procaryotic injection of MARF1 point mutation mouse and embryo transfer
Donor DNA are designed according to sgRNA cleavage sites, synthesize ssDNA.Prepare donor DNA, sgRNA and Cas9 MRNA mixtures, procaryotic injection, embryo transfer.
4th, the genotype identification of MARF1 point mutation mouse
Newborn small son is numbered, and clip part toe extraction genomic DNA.By PCR, clone, sequencing, to determine to be It is no that there occurs the accurate restructuring of MARF1-D272A point mutation.It is final to establish the small of MARF1-D272A point mutation in mouse genome Mouse model, the head of birth is on behalf of founder mouse；Each founder will be considered as an independent strain and be bred, right Each founder strains are cut toe, the secondary PCR identifications for cutting tail first, and clone respectively and verification is sequenced.MARF1 272 asparagus fern amino acid mutations of albumen NYN domains are alanine, the amino acid sequence such as SEQ ID after the mutation Shown in NO.1.
Beneficial effect：(1) structure provided by the invention that MARF1 rite-directed mutagenesis mouse models are obtained based on CRISPR/Cas9 Construction method, facilitate the multi-functional MARF1 of research in actual applications in terms of mouse propagation develops especially Oocyte Development Mechanism of action, and the model can stablize passage.(2) mankind's ovum it is rare and by Medical Ethics limited can not easily as experiment Object, " genetic modification mouse " are the important models for studying mankind's ovum.Research, production of the present invention for clinical female acyesis disease Preceding diagnosis, the third generation " test-tube baby " PGD (preimplantation genetic diagnosis), that is, gene is examined before transplanting The disconnected, progress of auxiliary procreation technology and the exploitation of contraceptive provide the effective research platform that can stablize heredity.
Brief description of the drawings
Fig. 1 .MARF1-NYN conservative domain site sequences compare figure.
Fig. 2 .MARF1-NYN conservative domain site sequences compare figure.
Fig. 3 .CRISPR-Cas9 SYSTEM SUMMARY figures.
Fig. 4 .MARF1-272-sgRNA-F1, MARF1-272-sgRNA-F2 are in genome shear efficiency figure.
Fig. 5 .MARF1-272 rite-directed mutagenesis Donor DNA sequence dnas, MARF1-272-sgRNA-F1, MARF1-272- SgRNA-F2 is in the position of genome and corresponding PAM regions, and corresponding same sense mutation schematic diagram.
Fig. 6 .MARF1-D272A rite-directed mutagenesis mouse identification-PCR and StyI cleavage maps.
Fig. 7 .MARF1-D272A rite-directed mutagenesises mouse identification-sequencer map.
Identification-PCR and StyI cleavage maps after Fig. 8 .MARF1-D272A rite-directed mutagenesis cloned mouses.
Identification-sequencer map after Fig. 9 .MARF1-D272A rite-directed mutagenesis cloned mouses.
Figure 10 .MARF1 point mutation female mice egg mother cells and normal cell comparison diagram.
Figure 11 .MARF1 point mutation oocyte of mouse and normal cell Testing index comparison diagram, a left side for every group of data in figure Side data post is normal cell, and right side data post is point mutation cell.
Embodiment
The experiment material needed in this experiment is specially：
Q5 High-fidelity 2XMaster Mix(NEB,M0492S)
2×Taq PCR Master Mix with loading dye(TIANGEN,KT201)
mMESSAGE mMACHINE T7 ULTRA kit(Ambion,AM1345)
MEGAshortscript TM T7ULTRA kit(Ambion,AM1354)
plasmid miniprep plus purification kit(genemark,Dp01-plus/Dp01-plus- 300)
Embodiment 1
A kind of construction method and application that MARF1 rite-directed mutagenesis mouse models are obtained based on CRISPR/Cas9, with reference to Specific embodiment, the present invention is expanded on further.
The structure of 1.1 CRISPR-Cas system elements
1.1.1 it is used for the design of the sgRNA sequences of gene knock-in
(1) enter UCSC websites, download MARF1 genomic dna sequence, with SnapGene software editing sequences.
(2) enter NCBI websites, according to gene information in sequence annotated exon, introne, promoter, coded sequence (coding sequence, CDS) feature.
(3) enterhttp://crispr.mit.edu/Website, input CDS sequences are searched available sgRNA, surrounded The front and rear selection 250bp in MARF1-D272A point mutation position.
(4) score value provided according to website selects sgRNA, and fraction is higher to represent that its effect of missing the target is lower, and sgRNA's is special Property is better.Also to consider positions of the sgRNA on CDS simultaneously, use NCBI domain architecture Retrieval instruments predict which important feature domain the albumen of gene C DS codings has, and ensure that sgRNA is located at domain as far as possible Before.
1.1.2 px330-sgRNA plasmid constructions
(1) U6 promoters are carried on px330 plasmids, downstream close to 20 base-pairs (base pair, bp) sgRNA, its It is the about 80bp general frame sequences of sgRNA afterwards.By original plasmid with after the single endonuclease digestions of Bbs I can be used for build new plasmid.
(2) oligodeoxynucleotide (DNA oligo, 5 ' → 3 ') is synthesized
sg-F：CACC-agtgatcttaggcaccggca
sg-R：AAAC-tgccggtgcctaagatcact
T7-sg-F：TAATACGACTCACTATAGGGagtgatcttaggcaccggca
T7-sg-R：AAAAGCACCGACTCGGTGCC
(3) oligo annealing (Anneal)
Mix, 37 DEG C of 30min in PCR instrument；95℃ 5min；0.1 DEG C/s is cooled to 25 DEG C
(4) fragment after annealing is connected to carrier
Mix, react at room temperature 3h, 6 μ L of conversion to E. coli competent, coated plate
(5) bacterium is chosen after 16h, adds 200 μ L 2 × YT culture mediums (Amp+) shake bacterium 2h, bacterium solution PCR
Mix, PCR reactions：95 DEG C of thermal startings, 58 DEG C of annealing, extend 15s, 35 × Cycles.
(6) 1% Ago-Gel is run, the positive bacterium of PCR identifications selects 3 to send sequencing, and sequencing primer is U6 promoter.
(7) the correct bacterium solution of sequencing result is small shakes upgrading grain for selection.
1.1.3 the preparation of sgRNA in-vitro transcriptions template
(1) DNA fragmentation (about 120bp) of high-fidelity enzyme PCR amplification codings sgRNA sequences, every sgRNA are identical with 2 pipes System
Mix, PCR reactions：98 DEG C of thermal startings, 58 DEG C of annealing, extend 12s, 35 × Cycles.
(2) match somebody with somebody 1% Ago-Gel, run glue, cut bright band size 120bp or so blob of viscose, useGel Extraction kits reclaim DNA.
A. blob of viscose is weighed, and 100mg is estimated as 100 μ L, adds the Buffer QG of 3 times of colloid products.
B.65 DEG C baking oven places 10min until blob of viscose melts.
C. the isopropanol of 1 times of colloid product is added, overturns and mixes.
D. mixture is transferred to adsorption column, 13000rpm centrifugation 1min, abandons filtrate.
E. 500 μ L Buffer QG, 13000rpm centrifugation 1min are added, abandon filtrate.
F. 750 μ L Buffer PE, 13000rpm centrifugation 1min are added, abandon filtrate.
G. repeat step f.
H. blank pipe centrifugation 2min.
I. adsorption column is transferred to clean 1.5mL imports centrifuge tube, uncap drying 5min in RNA super-clean benches.
J. the RNase-free ddH of 30 μ L, 65 DEG C of preheatings are added to adsorbed film center2O, it is stored at room temperature 5min.
K.13000rpm 2min elutions are centrifuged, 2 μ L is suctioned out and surveys concentration (DNA50).
1.1.4 sgRNA in-vitro transcription
(1) (complete) to use MEGAshortscript in RNA super-clean benches belowTMT7 transcript reagent boxes, with external Responsive transcription system
Mix, 37 DEG C of reaction 4h.
(2) 0.5 μ L TURBO DNase are added, are mixed, 37 DEG C of reaction 15min.
(3) system is transferred to 0.6mL tubules, adds 125 μ L RNase-free ddH2O and 15 μ L Ammonium Acetate Stop Solution, mix.
(4) isometric lower floor's phenol chloroform is added, overturns and mixes 10min, room temperature 12000rpm centrifugations 10min.
(5) upper strata aqueous phase is transferred to new pipe, adds isometric chloroform, overturned and mix 10min, room temperature 12000rpm centrifugations 10min。
(6) upper strata aqueous phase is transferred to new pipe, adds 2 times of volume absolute ethyl alcohols, mixed, -20 DEG C of placement 30min.
(7) 2% Ago-Gel is matched somebody with somebody, with RNase-free ddH2O matches somebody with somebody 75% ethanol, 4 DEG C of centrifuges of precooling.
(8) 4 DEG C of 12000rpm centrifuge 15min.
(9) supernatant is abandoned, rinses a precipitation with the ethanol of 500 μ L 75%, 4 DEG C of 12000rpm centrifuge 5min.
(10) most supernatant is abandoned, drying to the edge of precipitation of being uncapped in RNA platforms tends to be transparent.
(11) precipitation size is regarded, adds 50~80 μ L RNase-free ddH2O dissolves, and places 2~3min on ice.
(12) mix, stay 3 μ L, remaining 6 μ L/ pipes packing, freeze in -80 DEG C of refrigerators.
(13) concentration (ssDNA33) is surveyed, records 260/280 (2.0~2.2 be normal).
(14) take 1 μ L to run 2% Ago-Gel, 130V 8min, check whether band brightness is consistent with concentration, and band is big It is small whether in 100bp or so.
1.1.5 Cas9 mRNA in-vitro transcriptions
(1) single endonuclease digestion pSpCas9 (BB) (pX330；Addgene plasmid ID:42230) plasmid, as in-vitro transcription Template
Mix, 37 DEG C of reactions are overnight.
(2) match somebody with somebody 1% Ago-Gel, run glue, blob of viscose where cutting linearisation DNA, useGel Extraction kits reclaim.
(3) mMESSAGE is usedT7 transcript reagent box in-vitro transcription Cas9 mRNA.
(1. being completed below in RNA super-clean benches) matches somebody with somebody external responsive transcription system
Mix, 37 DEG C of reaction 2h.
2. adding 1 μ L TURBO DNase, mix, 37 DEG C of reaction 15min.
3. with addition of the reaction system of polyA tails
Mix, suction out 2.5 μ L and preserve on ice.
4. adding 4 μ L E-PAP Mix, mix, 37 DEG C of reaction 30min, be put on ice.
5. adding 10 μ L Ammonium Acetate Stop Solution, mix.
6. phenol chloroform method carries out RNA purifying, step is same as 1.1.4 (4)~(10).
7. depending on precipitating size, Nuclease-free water dissolvings are added, place 2~3min on ice.
8. mixing, 1.5 μ L are taken to survey concentration (RNA40), 260/280 2.0 or so is normal, and remaining mRNA is temporarily put in ice On.
9. mRNA is diluted into about 1 μ g/ μ L according to concentration is measured, takes 1 μ L and add 2.5 μ L before polyA tails to run 2% fine jade Sepharose, should have obvious bright band under normal circumstances plus before polyA tails, add the band after polyA tails should it is bigger (may slightly mould Paste, does not influence to use).
10. if concentration, the cementing fruit of race are normal, often pipe dispenses 1 μ g, freezes rapidly in -80 DEG C of refrigerators, obtains Cas9 mRNA。
1.2 MARF1-sgRNA efficiency and Cas9 mRNA quality testings
In once testing, it can determine that efficient sgRNA detects Cas9 mRNA quality with 1, it is also possible to high quality Cas9 mRNA detect 1 sgRNA efficiency.
1.2.1 the acquisition of mouse fertilized egg
Embryo for Efficiency testing is typically derived from BDF1 Strains of Mouse, and it is inbred strais C57BL/6J and DBA/2 mouse The first generation filial generation that post-coitum is cultivated, sexal maturity in 6~8 weeks.The mouse used is raised in no-special pathogen (specific-pathogen-free,SPF)。
(1) 0d, 13:00, capture the week old BDF1 female mices of 8 weeks or so, intraperitoneal injection 50U/mL (about 60 μ L) pregnant horse blood Clear promoting sexual gland hormone (pregnant mare ' s serum gonadotropin, PMSG), imitates endogenous follicle-stimulating hormone The promotion maturation of ovum effect of (follicle-stimulating hormone, FSH).
(2) 2d, 13:00, PMSG BDF1 female mices, intraperitoneal injection 50U/ml (about 70 μ L) human chorionic were injected in crawl Promoting sexual gland hormone (human chorionic gonadotropin, hCG), imitate luteotropin (luteinizing Hormone, LH) induced ovulation effect.And every female mice is individually mated with 1 BDF1 public affairs mouse and mated.
(3) G1 Embryo Culture drops are done：35mm Petri culture dishes bottom, about 20 μ L/ drops, proper alignment, is finally used Mineral oil seal liquid level, 37 DEG C, 5%CO2Balanced overnight in incubator.
(4) 3d, 8:00, check female mice whether there is vaginal plug (the secretion vestige that public mouse post-coitum leaves), if any then taking out Mouse room.
(5) CZB Embryo Culture drops are done, 37 DEG C, 5%CO215min is at least balanced in incubator.
(6) cervical dislocation puts to death female mice：Mouse is placed on the brandreth of mouse cage, its fore paw is caught steel wire above Bar, its neck (after skull) is tightly pushed down, while level stretches afterbody backward, makes its disconnected neck.
(7) mouse back of execution is put in Enamel jar upward, sprays mouse back with 75% alcohol immediately, subtract as far as possible The pollution of few mouse hair.
(8) mouse back skin is pinched, an osculum is cut off in Zhong Xiaqu with surgery scissors, firmly catches the skin cut off Skin, skin of back is set to open completely to head and afterbody stretching, hair also leaves interior tissue completely.
(9) open notacoria with ophthalmic tweezers and sharp scissors, white adipose tissue picked up with tweezers, lightly uterus, Fallopian tubal, ovary and fat pad integrally pull out body cavity, and the uterus below ovary is clamped with tweezers, with scissors close to fallopian tubal A hole is pierced on mesometrium, cuts off mesometrium, then ovary is separated with fallopian tubal with scissors (ensures the complete of fallopian tubal Property), finally cut close to the uterus of fallopian tubal, fallopian tubal is put into HCZB manipulation in vitro liquid.
(10) ampulla that fallopian tubal expands is punctured with the needle point of syringe under anatomical lens, obtains cumulus cell parcel Embryonated egg group.
(11) all agglomerates are collected, in 0.1% hyaluronidase after 37 DEG C of 3~5min of digestion, embryonated egg is thin with ovarian cumulus Born of the same parents separate.
(12) calcination glass capillary draws pin and broken needle, about 150~200 μm of internal diameter, assembling on the flame of alcolhol burner Mouth suction pipe.Ovum is moved with mouth suction pipe, the embryonated egg separated washes 6 times in HCZB drops, washes away the cumulus cell of residual and transparent Matter acid enzyme.
(13) embryonated egg is moved into CZB drops and washes 3 times, 37 DEG C, 5%CO2Recover in incubator.
1.2.2 sgRNA and Cas9 mRNA mixtures are prepared
Mixture is prepared in RNA platforms.The Cas9 mRNA and 50ng/ μ L that mixture for detection efficiency is 100ng/ μ L SgRNA.General injection need to prepare 5 μ L mixtures
Cas9 mRNA 500ng
sgRNA 250ng
ddH2O is mended to 5 μ L
4 DEG C of 10000rpm centrifuge 10min, and procaryotic injection is into about 20 pieces of embryonated eggs.
1.2.3 the detection of sgRNA cleavage sites
A. the cracking of embryo
(1) embryonated egg is cultivated 3 days in G1 nutrient solutions, is developed to after blastaea and embryo is moved into 5 μ L G1 cracking with mouth suction pipe In liquid.
(2) 95 DEG C of 20min cracking embryo's released dnas in PCR instrument.
(3) 5 μ L G2 solution are added, mixes, pcr template can be used as.
B.PCR is expanded
(1) with the high primer of NCBI Primer-BLAST tool designs specificity, PCR primer is mouse gene group DNA The upper 500bp comprising sgRNA sites or so fragment, sgRNA sites should try one's best in fragment center.
(2) primer specificity is tested with common mouse gene group DNA, thermograde PCR is to obtain the optimal annealing of primer Temperature.
(3) first round PCR reacts
Mix, PCR reactions：94 DEG C of thermal startings, extend 36s, 30 × Cycles.
(4) second wheel PCR reactions, each sample match somebody with somebody 2 pipe same systems；Simultaneously with 2 pipes with wild type (wild type, WT) mouse gene group DNA is the system of template
Mix, PCR reactions：95 DEG C of thermal startings, extend 36s, 35 × Cycles.
(5) match somebody with somebody 1% Ago-Gel, run glue, cut the correct blob of viscose of band, reclaimed using DNA purifying QIAquick Gel Extraction Kits DNA。
1. blob of viscose is weighed, 100mg is estimated as 100 μ L, adds the Buffer PC of equimultiple colloid product.
2. 65 DEG C of baking ovens place about 10min until blob of viscose melts.
3. equilibrium adsorption post：500 μ L Buffer BL, 13000rpm centrifugation 1min are added, abandon filtrate.
4. sol solutionses are added in adsorption column, 5min is stored at room temperature, 13000rpm centrifugation 1min, abandons filtrate.
5. adding 600 μ L Buffer PW, 13000rpm centrifugation 1min, filtrate is abandoned.
6. repeat step is 5..
7. blank pipe centrifuges 2min.
8. adsorption column is transferred into clean 1.5mL centrifuge tubes, uncap drying 5min in super-clean bench.
9. adding the Buffer EB of 30 μ L, 65 DEG C of preheatings to adsorbed film center, 5min is stored at room temperature.
10. 13000rpm centrifugation 2min elutions, suction out 1.7 μ L and survey concentration (DNA50).
C. glue returns the T7 digestions experiment of product
(1) annealing reaction system is matched somebody with somebody
250~300ng of glue reclaim product DNA
NEB Buffer 2 1.5μL
ddH2O is mended to 14.5 μ L
Mix, denaturation, annealing reaction in PCR instrument：95 DEG C of 5min, 0.1 DEG C/s slow coolings are to 25 DEG C, 25 DEG C of 10min.
(2) 2% Ago-Gel is matched somebody with somebody.
(3) 0.5 μ L T7 restriction endonucleases I are added to DNA annealing systems, mixed, 37 DEG C of 15~17min of reaction in PCR instrument.
(4) 10 × Loading Buffer are rapidly added, are mixed, 135V voltages run glue 30min, result are checked, if removed There is obvious band less than normal outside about 500bp master tapes, and WT is without then illustrating the piece that mutation is contained in virgin rubber recovery product Section, corresponding sgRNA may have cutting to cause to be mutated.
D. sequencing vector is connected
(1) positive glue is tested into T7 digestions and returns fragment connection sequencing vector, there are two kinds of commercial vectors can use.
a.pLB vector
1. match somebody with somebody end-filling reaction system
Mix, 20 DEG C of 5min, 70 DEG C of 5min in PCR instrument, it is of short duration on ice.
2. match somebody with somebody coupled reaction system
The μ L of filling-in product 4
pLB vector 0.5μL
T4Ligase 0.5μL
Mix, room temperature places 10min, all to E. coli competent, coated plate.
b.Zero Cloning
With coupled reaction system
Glue reclaim product 25ng
T5 Zero Cloning Vector 1μL
ddH2O is mended to 4 μ L
Mix, room temperature places 15min, is totally converted to E. coli competent, coated plate.
(2) bacterium is chosen after 16h, adds 200 μ L 2 × YT culture mediums (Amp+) shake bacterium 2h, bacterium solution PCR
Mix, PCR reactions：95 DEG C of thermal startings, extend 36s, 35 × Cycles.
(3) 1% Ago-Gel is run, the positive bacterium of PCR identifications selects 8 to send sequencing, and sequencing primer is T7 promoter. Result is checked, the result comprising insertion/deletion (insertion/deletion, indel) mutation accounts for the proportional representation of sum Corresponding sgRNA efficiency.
(4) for the sample of T7 digestion negatives, glue is directly returned into fragment and send sequencing, checks the peak figure of sequencing, if All it is single peak before sgRNA cleavage sites, and starts to ending have set peak in sgRNA vicinity, then the glue returns product The fragment (false negative is tested in T7 digestions) of mutation is may included, is attached the presence that sequencing vector confirms mutation.
1.3 Donor DNA design and the procaryotic injection of MARF1 point mutation mouse
1.3.1 Donor DNA design
It is by sgRNA1 PAM regions 5 ' between extreme direction 3-4bp centered on cutting position, respectively to 5 ' extreme direction 65bp Left side homology arm, 3 ' extreme direction 65bp is right side homology arm, orders single-stranded ssDNA (raw work, Shanghai China).The single-stranded ssDNA Purity have to using HPLC purify.
MARF1-272-sgRNA-1, MARF1-272-sgRNA-2 cutting efficiency, which compare, sees Fig. 4.
MARF1-272donor DNA design collection of illustrative plates is shown in Fig. 5.
1.3.2 donor DNA, sgRNA and Cas9 mRNA mixtures are prepared
Mixture is prepared in RNA platforms.The Cas9 mRNA and 50ng/ μ L that mixture for detection efficiency is 100ng/ μ L SgRNA, 100ng/ μ L donor DNA.General injection need to prepare 5 μ L mixtures
4 DEG C of 10000rpm centrifuge 10min, and kytoplasm is injected in about embryonated egg.
1.3.3 procaryotic injection
The acquisition of embryonated egg, and procaryotic injection have described, and ibid, see sgRNA efficiency and Cas9 mRNA quality testings.
1.3.4 embryo transfer
A, the preparation of public mouse is ligatured
(1) 6-8 week old public affairs mouse are anaesthetized by 100ml/kg dosage after weighing, mouse is fixed in back of the body position, and 75% ethanol, which applies, to be put on the skin Sterile surgical cutting part, to prevent hair contamination of incision.
(2) row cuts off lower abdomen skin about 1.3cm in front of the genitals, work about 1cm otch, with soaking 75% second The gauze of alcohol is wiped over cutting part to clear up hair.
(3) peritonaeum is cut, carries out bladder positioning.There is a pipeline traveling per side is all visible, left side is gently clamped with tweezers Pipeline, lifting part makes surgical field of view high-visible, determines that it is vas deferens.
(4) vas deferens is pinched into tweezers it is U-shaped, it is another that tweezers are heated on alcolhol burner, scalded between 2 ligation points disconnected defeated Spermaduct, the vas deferens of ligation is put into and carries out opposite side ligation again in vivo.
(5) after the operation of both sides, with art mouth inside and outside the suture of 0-5 sutures.Mouse is put on 37 DEG C of thermostatic platforms directly To revival.Post operation Mouse feeder determines whether operation succeeds after 2 weeks.
(6) experimental raising：1-2 dams and vasectomy mouse are mated into raising, secondary morning carries out vaginal plug inspection. The dams for having vaginal plug can make smear of bolt, and sperm has been seen whether under microscope.Also it can cultivate to next day and take fallopian tubal inspection Whether two cell stages are had.If sperm or there are two cell stages then the ligation of public mouse is unsuccessful.
B, the preparation of acceptor mouse
(1) while the ICR or CD-1 of heat are selected and the public mouse of ligation mates.
(2) m seq checks whether donor mouse and acceptor mouse see bolt, is used for embryo transfer on the day of seeing bolt or after 2.5.
C, common oviduct transplantation
(1) operating theater instruments, suture of sterilization etc. are got out.
(2) implement the anesthesia of 1.25% avertin solution to mouse by 200ml/kg dosage after weighing, cut off mouse back Hair, it is about concordant with last 1 rib to locate in backbone side 1cm after 75% alcohol disinfecting, skin is cut off, with tweezers along notch bluntness Integumentary musculature is separated, ovary, fallopian tubal and uterus are gently pulled out with tweezers, clamps partial fat, is placed on the skin of mouse behind.
(3) embryonated egg survived after sucking 20 pieces of injections with transplanting pin, suction order are:M16 nutrient solution ＆ Kong Qis ＆M16 is trained Nutrient solution ＆ air ＆ embryonated eggs, in the case where ensureing that embryo is fully entrained, the soakage of nutrient solution is reduced as far as possible.
(4) mouse is placed under anatomical lens, fat pad is pinched with small size haemostatic clamp, the film of ovary will be wrapped up with ophthalmology tweezers An osculum is torn, exposes fimbriae tubae portion, insertion moves ovum pin, embryonated egg is blown into fallopian tubal, ampulla of uterine tube has bright Aobvious bubble shows to transplant successfully.
(5) fat pad, ovary, uterus and fallopian tubal are sent back to abdominal cavity, peritoneal suture and skin incision in the lump with blunt tweezers, The acceptor mouse transplanted is placed to be transplanted in barrier environment after 10min recovers on warm platform and raised.
(6) mouse after transplanting makes marks, and indicates transplant time, family name, embryo's quantity.Date of birth is indicated after farrowing Phase and birth quantity, the survival condition of the young baby of observation birth daily.
1.4.MARF1 the genotype identification of point mutation mouse
After RNA injects embryonated egg and is transplanted in false pregnancy dams fallopian tubal, general 19~20 days fertility mouse.Mouse is born After 6 days, separated between its toe, toe can be cut and make numbering mark, cut the extracting that tail point fritter tissues are used for genomic DNA.
1.4.1 the phenol chloroform of genomic DNA
(1) clip tissue is put into centrifuge tube, adds the rat-tail lysate that 300 μ L contain Proteinase K, 65 DEG C of cracking are overnight.
(2) 300 μ L phenol chloroforms are added, overturns and mixes 10min, room temperature 12000rpm centrifugations 10min.
(3) carefully draw supernatant and move to new pipe, add the absolute ethyl alcohol of two volumes, it is visible cotton-shaped heavy to overturn mixing Form sediment, 4 DEG C of 12000rpm centrifuge 5min.
(4) supernatant is abandoned, adds the ethanol of 500 μ L 70% rinsing precipitation, 4 DEG C of 12000rpm centrifuge 5min.
(5) most supernatant is abandoned, super-clean bench dries up 5min to bottom precipitation bleach, depending on precipitating size, 65 DEG C of preheatings of addition ddH2O。
(6) room temperature, which places 5min, makes DNA fully dissolve.
(7) overturn and mix, suction out 2 μ L and survey concentration (DNA50).
1.4.2 the PCR amplifications comprising prediction mutational site fragment
(1) primer used is identical with during sgRNA Efficiency testings, and each DNA sample regards primer efficiency and prepares 2~3 pipes Reaction system
(2) glue reclaim, the same 3.2.3B. of step (5).
1.4.3 the direct StyI digestions experiment of Genomic PCR products and sequencing confirm
(1) the direct StyI digestions experiment of PCR primer：
(2) 37 degree, water-bath, digestion 3h, electrophoresis.
(3) PCR primer direct Sequencing.
Due to the change of rite-directed mutagenesis, in the event of accurate restructuring, it will one restriction enzyme site StyI of increase.Wild type Mouse can not then be cut open.The mouse that the present invention is born, #1 can be by StyI digestions, but #2, #3, #4, #5 cannot It is digested.See Fig. 6 in detail.Accurate restructuring occurs in order to further confirm that, sequencing is it can be found that the point mutation position meeting of restructuring Appearance one is significant bimodal.And the mouse of wild type is not in then bimodal.The mouse that the present invention is born, #1 have bimodal, but # 2, #3, #4, #5 be not bimodal.See Fig. 7 in detail.
1.4.4 StyI digestions experiment and sequencing confirm after PCR primer clone
After PCR primer is by QIANGEN kit glue reclaims, connected with PLB vector kits, clone, choose bacterium, Monoclonal, bacterium solution PCR is, filters out positive bacteria.On the one hand, PCR primer is directly used into StyI digestions, electrophoresis, monoclonal bacterial strain L5, L9 can be by StyI digestions, but monoclonal bacterial strain L1, L2, L3, L4, L6, L7, L8 cannot be shown in Fig. 8 by StyI digestions. On the other hand, monoclonal positive bacteria is sent into company's sequencing, sequencing result is shown in Fig. 9.
The application infertile as genetic model research female is stablized of 1.5 MARF1 point mutation mouse
1.5.1 MARF1 point mutation female mice is infertile, and egg mother cell is unable to normal development
As shown in Figure 10.MARF1 point mutation oocyte of mouse is arrested in germ-vesicle (GV) period, it is impossible to recovers subtrahend Division, it is impossible to normal mature.It is infertile to further result in female.
1.5.2 MARF1 point mutation oocyte of mouse series Testing index RNA significantly rises
As shown in figure 11.Substantial amounts of Testing index RNA significantly rises in MARF1 point mutation oocyte of mouse, and normal Substantial amounts of Testing index RNA maintains reduced levels in egg mother cell.These can be pre-natal diagnosis, the third generation " test-tube baby " PGD (preimplantation genetic diagnosis), that is, transplant before gene diagnosis, the progress of auxiliary procreation technology with And the exploitation of contraceptive provides the effective research platform that can stablize heredity.
SEQUENCE LISTING
<110>Nanjing Medical University
<120>A kind of construction method and application that MARF1 rite-directed mutagenesis mouse models are obtained based on CRISPR/Cas9
<130>
<160> 10
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence
<400> 1
agtgatctta ggcaccggca 20
<210> 2
<211> 130
<212> DNA
<213>Artificial sequence
<400> 2
atgcttgtat ttttcctttc agctgctgtc aattttgcct tggaactcag tgatcttagg 60
catcggcacg gtttccacat cattttggta cataaaaacc aggcctctga agccttgtta 120
catcatgcta 130
<210> 3
<211> 24
<212> DNA
<213>Artificial sequence
<400> 3
caccagtgat cttaggcacc ggca 24
<210> 4
<211> 24
<212> DNA
<213>Artificial sequence
<400> 4
aaactgccgg tgcctaagat cact 24
<210> 5
<211> 40
<212> DNA
<213>Artificial sequence
<400> 5
taatacgact cactataggg agtgatctta ggcaccggca 40
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence
<400> 6
aaaagcaccg actcggtgcc 20
<210> 7
<211> 24
<212> DNA
<213>Artificial sequence
<400> 7
caccagtgat cttaggcacc ggca 24
<210> 8
<211> 24
<212> DNA
<213>Artificial sequence
<400> 8
aaactgccgg tgcctaagat cact 24
<210> 9
<211> 20
<212> DNA
<213>Artificial sequence
<400> 9
tgtgattgcc ctgtcatgct 20
<210> 10
<211> 20
<212> DNA
<213>Artificial sequence
<400> 10
agagaggctc aaaaggctgc 20

Claims (5)

1. a kind of construction method that MARF1 rite-directed mutagenesis mouse models are obtained based on CRISPR/Cas9, its feature include following step Suddenly：
1st step：The sgRNA sequences in the efficient identification specific gene group PAM regions of design, the sgRNA sequences such as SEQ ID Shown in NO.1；And Donor DNA are designed in sgRNA sequence basis, shown in the Donor DNA sequence dnas SEQ ID NO.2；
2nd step：By Donor DNA, sgRNA and Cas9 mRNA mixtures are to embryonated egg procaryotic injection, embryo transfer, strain base Because of identification, founder mouse, and cloning and sequencing are obtained, the genetic mouse for the MARF1-D272A point mutation for confirming to finally give is dashed forward Varying model.
Exist 2. what construction method described in claim 1 obtained obtains MARF1 rite-directed mutagenesis mouse models based on CRISPR/Cas9 Screen the application in contraceptive.
Exist 3. what construction method described in claim 1 obtained obtains MARF1 rite-directed mutagenesis mouse models based on CRISPR/Cas9 Application in screening preventing and treating female infertility medicine.
4. obtain the kit of MARF1 rite-directed mutagenesis mouse models, it is characterised in that contain the Donor shown in SEQ ID NO.2 DNA sequence dna and the sgRNA as shown in SEQ ID NO.1.
5. kit according to claim 4, it is characterised in that also containing Cas9 mRNA.
CN201710355368.3A 2017-05-19 2017-05-19 A kind of construction method and application that MARF1 rite-directed mutagenesis mouse models are obtained based on CRISPR/Cas9 Expired - Fee Related CN107043787B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710355368.3A CN107043787B (en) 2017-05-19 2017-05-19 A kind of construction method and application that MARF1 rite-directed mutagenesis mouse models are obtained based on CRISPR/Cas9

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710355368.3A CN107043787B (en) 2017-05-19 2017-05-19 A kind of construction method and application that MARF1 rite-directed mutagenesis mouse models are obtained based on CRISPR/Cas9

Publications (2)

Publication Number Publication Date
CN107043787A CN107043787A (en) 2017-08-15
CN107043787B true CN107043787B (en) 2017-12-26

Family

ID=59547089

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710355368.3A Expired - Fee Related CN107043787B (en) 2017-05-19 2017-05-19 A kind of construction method and application that MARF1 rite-directed mutagenesis mouse models are obtained based on CRISPR/Cas9

Country Status (1)

Country Link
CN (1) CN107043787B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109266680B (en) * 2018-10-17 2020-09-25 江苏集萃药康生物科技有限公司 Method for preparing CKO/KI animal model by using Cas9 technology

Families Citing this family (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US20150044192A1 (en) 2013-08-09 2015-02-12 President And Fellows Of Harvard College Methods for identifying a target site of a cas9 nuclease
US9359599B2 (en) 2013-08-22 2016-06-07 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US9340799B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College MRNA-sensing switchable gRNAs
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US9388430B2 (en) 2013-09-06 2016-07-12 President And Fellows Of Harvard College Cas9-recombinase fusion proteins and uses thereof
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
EP3177718B1 (en) 2014-07-30 2022-03-16 President and Fellows of Harvard College Cas9 proteins including ligand-dependent inteins
EP3365356B1 (en) 2015-10-23 2023-06-28 President and Fellows of Harvard College Nucleobase editors and uses thereof
GB2568182A (en) 2016-08-03 2019-05-08 Harvard College Adenosine nucleobase editors and uses thereof
AU2017308889B2 (en) 2016-08-09 2023-11-09 President And Fellows Of Harvard College Programmable Cas9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
KR102622411B1 (en) 2016-10-14 2024-01-10 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 AAV delivery of nucleobase editor
WO2018119359A1 (en) 2016-12-23 2018-06-28 President And Fellows Of Harvard College Editing of ccr5 receptor gene to protect against hiv infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
WO2018165629A1 (en) 2017-03-10 2018-09-13 President And Fellows Of Harvard College Cytosine to guanine base editor
EP3601562A1 (en) 2017-03-23 2020-02-05 President and Fellows of Harvard College Nucleobase editors comprising nucleic acid programmable dna binding proteins
WO2018209320A1 (en) 2017-05-12 2018-11-15 President And Fellows Of Harvard College Aptazyme-embedded guide rnas for use with crispr-cas9 in genome editing and transcriptional activation
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
EP3676376A2 (en) 2017-08-30 2020-07-08 President and Fellows of Harvard College High efficiency base editors comprising gam
CN107475300B (en) * 2017-09-18 2020-04-21 上海市同济医院 Construction method and application of Ifit3-eKO1 gene knockout mouse animal model
KR20200121782A (en) 2017-10-16 2020-10-26 더 브로드 인스티튜트, 인코퍼레이티드 Uses of adenosine base editor
CN108410876B (en) * 2018-03-26 2021-08-31 浙江中医药大学 Method for constructing spontaneous anemia mouse model with leukocytosis and thrombocytosis
BR112021018606A2 (en) 2019-03-19 2021-11-23 Harvard College Methods and compositions for editing nucleotide sequences
DE112021002672T5 (en) 2020-05-08 2023-04-13 President And Fellows Of Harvard College METHODS AND COMPOSITIONS FOR EDIT BOTH STRANDS SIMULTANEOUSLY OF A DOUBLE STRANDED NUCLEOTIDE TARGET SEQUENCE

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9970001B2 (en) * 2014-06-05 2018-05-15 Sangamo Therapeutics, Inc. Methods and compositions for nuclease design
WO2016176191A1 (en) * 2015-04-27 2016-11-03 The Trustees Of The University Of Pennsylvania Dual aav vector system for crispr/cas9 mediated correction of human disease
CN105296518A (en) * 2015-12-01 2016-02-03 中国农业大学 Homologous arm vector construction method used for CRISPR/Cas 9 technology

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109266680B (en) * 2018-10-17 2020-09-25 江苏集萃药康生物科技有限公司 Method for preparing CKO/KI animal model by using Cas9 technology

Also Published As

Publication number Publication date
CN107043787A (en) 2017-08-15

Similar Documents

Publication Publication Date Title
CN107043787B (en) A kind of construction method and application that MARF1 rite-directed mutagenesis mouse models are obtained based on CRISPR/Cas9
CN108660161B (en) Method for preparing chimeric gene-free knockout animal based on CRISPR/Cas9 technology
CN109777837A (en) A method of the systemic knock-out mice model of lethal gene is constructed using CRISPR/Cas9 system
CN106119284A (en) A kind of product for building immunodeficient animals model and application thereof
CN107937345A (en) A kind of fibroblastic method of pig for preparing while knocking out CD163 genes and CD13 genes
CN113957093B (en) System for site-directed modification of pAPN gene and application thereof
CN113604504A (en) Composition for site-directed modification of pAPN gene 16 exon and application thereof
JP2023116719A (en) Disease model pig exhibiting stable phenotype, and production method thereof
Sarvari et al. A technique for facile and precise transfer of mouse embryos
Nicholls Let's make a mommoth
CN117487855A (en) Methods for improving swine health by targeted inactivation of CD163
CN109811009A (en) A method of lethal gene function is analyzed using CRISPR/Cas9 system building knock-out mice model
JPH04504352A (en) Method for introducing exogenous DNA into animal somatic cells and reproductive cells
CN113549637B (en) SNP locus of mouse PHEX gene and application thereof
Ghassemi et al. Pipeline for the generation of gene knockout mice using dual sgRNA CRISPR/Cas9-mediated gene editing
CN113549638A (en) Method for constructing mouse model of X-linked rickets with low blood phosphorus
CN110129320B (en) Method for obtaining gene editing sheep and sgRNA and Oligo DNA special for same
CN107937439B (en) Application of gene and construction method of animal model
CN109777828A (en) A kind of genetic modification animal model preparation method based on IVF Yu CRISPR/Cas9 gene editing technology
Huang et al. Generation of cynomolgus monkey fetuses with intracytoplasmic sperm injection based on the MII-stage oocytes acquired by personalized superovulation protocol
JP2966016B2 (en) Transgenic rat and method for producing the same
CN110438155A (en) Modify composition, application, cell and the preparation method of gene editing pig of the 561st amino acids of CD163 gene
CN113615638B (en) Construction method and application of precocious sexual animal model
CN114875074B (en) Method for improving polyclonal rabbit antibody production
CN111808859B (en) gRNA of WAS gene and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20171226

Termination date: 20210519

CF01 Termination of patent right due to non-payment of annual fee