CN106367435B - A kind of method that rice miRNA orientation knocks out - Google Patents

A kind of method that rice miRNA orientation knocks out Download PDF

Info

Publication number
CN106367435B
CN106367435B CN201610807153.6A CN201610807153A CN106367435B CN 106367435 B CN106367435 B CN 106367435B CN 201610807153 A CN201610807153 A CN 201610807153A CN 106367435 B CN106367435 B CN 106367435B
Authority
CN
China
Prior art keywords
rice
mirna
cas9
grna
carrier
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201610807153.6A
Other languages
Chinese (zh)
Other versions
CN106367435A (en
Inventor
周建平
张勇
郑雪莲
唐旭
程燕
邓科君
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Chengdu Jigu Gene Technology Co ltd
Original Assignee
University of Electronic Science and Technology of China
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Electronic Science and Technology of China filed Critical University of Electronic Science and Technology of China
Priority to CN201610807153.6A priority Critical patent/CN106367435B/en
Publication of CN106367435A publication Critical patent/CN106367435A/en
Application granted granted Critical
Publication of CN106367435B publication Critical patent/CN106367435B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00—Vectors comprising a targeting moiety
    • C12N2810/10—Vectors comprising a non-peptidic targeting moiety

Abstract

The invention belongs to field of plant genetic project technology, and in particular to a kind of method that rice miRNA orientation knocks out.The technical problem to be solved by the present invention is to be directed modification Mirnas of plant site providing method and detection means.The invention discloses the method obtained in rice micoRNA mutant, concrete operations are as follows: knocking out single miRNA using CRISPR-Cas9 method, knock out multiple miRNAs or knock out the large fragment of miRNA.The method of the present invention is suitable for the initiative and screening of rice miRNA orientation knockout mutations body.

Description

A kind of method that rice miRNA orientation knocks out
Technical field
The invention belongs to field of plant genetic project technology, and in particular to a kind of method that rice miRNA orientation knocks out.
Background technique
MiRNA (microRNA) is that one kind is prevalent in eucaryote, and length is about the non-of 19~24 nucleotide Tiny RNA is encoded, is encoded by endogenous miR-96 gene, rna plymerase ii transcription generates.It mainly passes through shear degradation, inhibits to turn over It translates and chromosome remolds the expression that modes such as (methylations) regulate and control its target gene mRNA.MiRNA is raw in plant Long development, metabolism, epigenetic, abiotic stress response etc. play an important role.
The method of tradition research miRNA function mainly has: (1) inhibiting its target gene by transgene expression miRNA The indirect method of function studies the function of miRNA.But since miRNA often regulates and controls multiple mesh with identical or different function Gene is marked, therefore this method is only capable of the function of reflection part miRNA.(2) by target gene analog (Target Mimicry, TM) or short series connection target analog (Short Tandem Target Mimic, STTM) interferes (closing) miRNA, so as to The influence that reflection target gene derepresses, studies the function of miRNA.But the mode is lower to the jamming effectiveness of many miRNAs, Even fully inactive situation.Therefore the method for finding more suitably research miRNA function has a very important significance.
The conventional method for illustrating gene function depends on the initiative of genetic mutant, such as physics and chemistry behavior, T-DNA Or transposon tagging insertion mutation etc..But these methods are time-consuming and laborious, and blindness is larger, in miRNA functional study very not It is easy to accomplish, it is primarily due to miRNA very small (21bp or so), mutant is difficult to obtain.
Clustered regularly interspaced short palindromic repeats/CRISPR- Associated 9 (CRISPR-Cas9) technology grows up at the beginning of 2013, is after first generation genome editing technique- Zinc finger nuclease (zinc finger nucleases, ZFN) and second generation genome editing technique-class activating transcription factor effect It answers and grows up after object nuclease (transcription activator-like effector nucleases, TALEN) Completely new third generation genome editing technique.A kind of acquired immune system that it is mainly based upon bacterium is transformed, with ZFN, TALEN are simple compared to there is production, at low cost, act on efficient advantage.The working principle of CRISPR-Cas9 is crRNA (CRISPR-derived RNA) is combined by base pairing and tracrRNA (trans-activating RNA) and is formed TracrRNA/crRNA compound, this compound guide nuclease Cas9 albumen in the sequence target site shearing matched with crRNA Double-stranded DNA.And by both RNA of engineer, sgRNA (the single guide to be formed with guiding function can be transformed RNA), it is sufficient to Cas9 be guided to cut the fixed point of DNA.Currently, CRISPR-Cas9 technology be not only successfully applied to animal, The directed modification of microbial genome, and Successful utilization is in arabidopsis, tobacco, rice, and the plant genes such as wheat and corn are prominent In variant initiative.
Summary of the invention
The technical problem to be solved by the present invention is to provide a kind of efficient method for initiative rice miRNA mutant.
The technical solution that the present invention solves above-mentioned technical problem provides a kind of method that rice miRNA orientation knocks out, and uses This method can get rice miRNA mutant.Steps of the method are: in rice, knocked out using CRISPR-Cas9 method single A miRNA, multiple miRNAs are knocked out or knock out the large fragment of miRNA.
Specifically, the method includes the following steps:
A, the carrier that building knocks out single miRNA, knocks out multiple miRNAs or knock out the large fragment of miRNA；
B, CRISPR-Cas9 carrier rice transformation callus, the screening acquisition rice miRNA obtained step a is mutated Body.
Specifically, carrier framework described in step a is pZHY988, the core space between the left and right boundary carrier T-DNA Domain includes following elements: hygromycin gene expression element, Cas9 Expression element and gRNA transcriptional units；
When knocking out single miRNA, gRNA transcriptional units are 1 gRNA transcriptional elements, are identified near target miRNA The site PAM；When knocking out multiple miRNAs, the gRNA transcriptional elements that gRNA transcriptional units are 2 or more are connected, and are identified respectively The site PAM near different target miRNA；For the same miRNA large fragment knock out when, gRNA transcriptional units be 2 The series connection of gRNA transcriptional elements identifies the nearest site PAM in the two sides target miRNA respectively；The position PAM that gRNA transcriptional elements are identified Point is 5 '-NX- NGG-3 ', N indicate any one of A, G, C and T, x=20；
The gRNA transcriptional elements include rice U6 promoter, ccdB and gRNA (guide RNA) scaffold, U6 Respectively there is I restriction enzyme site of Bsa at terminator, ccdB segment both ends, have the nucleotide sequence as described in SEQ ID No.1, In When carrier construction, with I digestion carrier framework of Bsa, access for target miRNA sgRNA (single-guide RNA, individually Guide RNA).
Wherein, Cas9 Expression element includes maize ubiquitin Ubiquitin-1 promoter Ubi, Cas9 protein gene and Re Xiu Gram sub- HSP of protein termination.
Wherein, hygromycin Expression element includes cauliflower mosaic virus promoter 35S, hygromycin gene Hygromycin, cauliflower mosaic virus terminator 35ST.
Wherein, in step b, the method that uses for the screening of the knockout mutations body of single miRNA and multiple miRNAs for The method that PCR-SSCP single-strand conformation polymorphism and sequencing combine；The screening of the large fragment knockout mutations body of miRNA is adopted Method is PCR- agarose electrophoresis and the method that sequencing combines.
Further, in step a, for rice Os miR528 gene, the knockout carrier for single miRNA is constructed Nucleus between the left and right boundary pMIR528-1, carrier T-DNA includes hygromycin Expression element, Cas9 Expression element and GRNA transcriptional units, gRNA transcriptional units have the nucleotide sequence as described in SEQ ID No.2.
Further, in step a, for rice Os miR397 gene family member OsmiR397a and OsmiR97b, structure The carrier pZJP028 for knocking out two miRNAs is built, the nucleus between the left and right boundary carrier T-DNA includes hygromycin table Up to element, Cas9 Expression element and gRNA transcriptional units, gRNA transcriptional units have the nucleotides sequence as described in SEQ ID No.3 Column.
Further, in step a, for rice Os miR408 gene, the large fragment knockout carrier of miRNA is constructed Nucleus between the left and right boundary pZJP025, carrier T-DNA includes hygromycin Expression element, Cas9 Expression element and gRNA Transcriptional units, gRNA transcriptional units have the nucleotide sequence as described in SEQ ID No.4.
Specifically, converting Rice Callus in step b using the fixed conversion of mediated by agriculture bacillus.
The present invention also provides CRISPR-Cas9 methods to obtain the purposes in rice micoRNA mutant.
Realization rice miRNA orientation of the present invention knocks out and detection method, is to utilize the substantially former of CRISPR-Cas9 What reason carried out.The basic principle is under guide RNA and Cas9 nuclease collective effect, on target gene miRNA precursor Double-strand target site is sheared, then passes through itself DNA repair function of cell, final to realize target in target gene miRNA precursor Random scarce and/or insertion on site.In CRISPR/Cas9 genome editor's system, CRISPR/Cas9 is to genome target sequence The specificity cutting of column depends on guide RNA (guided RNA, gRNA, by trans-activation crRNA tracrRNA and short The palindrome repeats the fused single guide RNA single strand of RNA crRNA) in the ribonucleoprotein that is formed of crRNA and Cas9 albumen it is multiple Close PAM (protospacer adjacent motif) and its adjacent 20bp on object identification target sequence or so specific target Sequence (protospacer).
In the multiple genes for being directed to a gene family, multiple miRNAs while the strategy deleted can be used.It is certain at When the precursor of ripe miRNAs is nearby difficult to find the suitable site PAM or consider wholly or largely to knock out precursor miRNA, just The site PAM for needing to consider to choose the two sides miRNA far point, the strategy for leading to large fragment deletion is knocked out with double site.
Beneficial effects of the present invention: mutant preparation method sequencing easy to operate of the invention, adjustable point are knocked out, Knockout rate is high；In T0 detected in single plant, saltant type accounting reaches 90% or more.This method is suitable for rice miRNA Directed modification mutant initiative.
Detailed description of the invention
Fig. 1 pZHY988 carrier core cell schematics
Wherein, " 35S " is cauliflower mosaic virus promoter, and " Hygromycin " is hygromycin gene, and " Ubi " is jade Rice ubiquitin promoter, " Cas9 " are Cas9 protein gene, and " U6 " is rice U6 promoter, and " ccdB " is that expression product can inhibit general The gene of logical E.coli growth, " gRNA scaffold " are that crRNA and tracRNA is fused into a chimeric RNA chain, " 35ST " is 35S terminator, and " HSP " is heat shock protein terminator, and " U6T " is rice U6 terminator.
Fig. 2 PCR-SSCP screens OsmiR528-01 knockout mutations body
Wherein, " M " indicates that marker, " WT " indicate skeleton carrier conversion T0 for plant, and " 1~34 " indicates that Cas9 orientation is repaired Adorn OsmiR528 stable conversion T0 single plant number.
The mutational site Fig. 3 OsmiR528 pcr amplification product sequencing result figure
Wherein, " WT " indicates wildtype gene sequence, and "-" indicates that the sequence for deleting mutation has occurred, and "+" expression has occurred The digital representation of the sequence of insertion mutation, "-/+" back is deleted or the quantity of the nucleotide of insertion, and " # " indicates mutant single plant Number, " △ " indicate the sequence of base mutation, and " Reference " indicates the DNA sequence of wild type OsmiR528 gene in the position Column, the expression mutant single plant number of other digital numbers, " Locus 1,2 " indicates mutant OsmiR528 gene at two The DNA sequence dna of the position on homologue, black underscore are the guide sgRNA in the site OsmiR528.
Fig. 4 OsmiR397a and OsmiR397b double site knockout mutations carrier pZJP028 schematic diagram
Wherein, " 35S " is cauliflower mosaic virus promoter, and " Hygromycin " is hygromycin gene, and " Ubi " is jade Rice ubiquitin promoter, " Cas9 " be Cas9 protein gene, " U6 " be rice U6 promoter, " gRNA scaffold " be crRNA and TracRNA is fused into a chimeric RNA chain, and " 35ST " is 35S terminator, and " HSP " is heat shock protein terminator, " U6T " For rice U6 terminator, " OsmiR397a " is that the guide sgRNA, OsmiR397b in the site OsmiR397a are the site OsmiR397b Guide sgRNA.
Fig. 5 PCR-SSCP screens pZJP028 double site knockout mutations body
Wherein, a is that the PCR-SSCP in the site OsmiR397a-gRNA1 is screened, and b is the site OsmiR397b-gRNA1 PCR-SSCP screening." M " indicates that marker, " WT " indicate skeleton carrier conversion T0 for plant, and digital " 2-1 ... 25-4 " is indicated Cas9 directed modification OsmiR397 gene loci stable conversion T0 single plant number.From the point of view of Fig. 5, in 17 single plants, 12 single plants (i.e. 2-1,7-1,8-1,13-1,15-1,16-1,20-1,21-1,22-1,23-1,24-1,24-2) has successfully deletion/insertion prominent Become.
Fig. 6 OsmiR408 large fragment deletion is mutated double site knockout mutations carrier pZJP025 schematic diagram
Wherein, " 35S " is cauliflower mosaic virus promoter, and " Hygromycin " is hygromycin gene, and " Ubi " is jade Rice ubiquitin promoter, " Cas9 " be Cas9 protein gene, " U6 " be rice U6 promoter, " gRNA scaffold " be crRNA and TracRNA is fused into a chimeric RNA chain, and " 35ST " is 35S terminator, and " HSP " is heat shock protein terminator, " U6T " For rice U6 terminator, " OsmiR408-sgRNA1, OsmiR408-sgRNA2 " are the guide that OsmiR408 deletes site sgRNAs。
Fig. 7 OsmiR408 large fragment deletion is mutated pcr amplification product agarose electrophoresis testing result figure
Wherein, " WT " indicates skeleton carrier conversion T0 for plant, the subsequent horizontal line of pZJP025 and digital representation Cas9 orientation Modify OsmiR408 gene loci stable conversion T0 single plant number.From the point of view of Fig. 7, in 10 single plants, there is pZJP025-01-01, 6 plants of pZJP025-02-01, pZJP025-03-01, pZJP025-04-01, pZJP025-09-02, pZJP025-10-01 have greatly Fragment deletion.
Specific embodiment
Embodiment 1 carries out the initiative of single miRNA mutant using the method for the present invention (by taking rice Os miR528 as an example)
1, the vector construction of CRISPR-Cas9-miRNA mutant
(1) design of primers
To the identification of target site and regular design primer is sheared according to CRISPR/Cas9.Before rice Os amiR528 Body genome sequence (GenBank number:GQ419957.2), design primer OsmiR528-sgRNA1-F:5 '- gtgtGAAGGGGCATGCAGAGGAGC-3'；OsmiR528-sgRNA1-R:5'-aaacGCTCCTCTGCA TGCCCCTTC- 3’。
(2) primer annealing
The upstream and downstream primer of each target site is diluted 10 times, 10 μ L is respectively taken, 98 DEG C, is denaturalized 5min, natural cooling, annealing 20 times of product dilution stand-by.
(3) digestion, glue recycling, connection
Skeleton carrier used in testing is pZHY988 (Fig. 1), is constructed by this laboratory, building process are as follows: close first At (Ying Jun Bioisystech Co., Ltd synthesizes by Shanghai) basic segment pZHY998-01:SbfI-Cas9 orf-Hsp terminator- BamH I and I-OsU6 promoter-Bsa of pZHY998-02:BamH, I-ccdB unit-Bsa, I-sgRNA skeleton unit-Hsp are whole Only son-Sac I；Carry out endonuclease reaction: I+BamH of A:Sbf, I I+Sac of digestion pZHY998-01, B:BamH, I digestion respectively again I+Sac of pZHY998-02, C:Sbf, I digestion carrier pTX172；Then recovery purifying digestion products, three segments are connected with T4DNA Enzyme is attached reaction.
Its core cell of pZHY988 is the Cas9 protein expression element of maize ubiquitin (Ubiquitin-1) promoter starting, The gRNA clone of rice U6 promoter starting and transcriptional units (include I-ccdB-Bsa of Bsa Unit I, i.e., in ccdB gene Two sides include that two BsaI restriction enzyme sites can be used for loading corresponding target site after carrying out single endonuclease digestion to carrier) (there is such as SEQ Nucleotide sequence described in ID No.1).Skeleton carrier further include: the left and right border sequence of T-DNA, carrier include cauliflower flower The hygromycin gene (Hyg) of leaf disease virus promoter (CaMV35S) starting.The hygromycin gene expression element sequence and matter The corresponding hygromycin gene expression element sequence of grain pTX172 is consistent (referring to document Tang X etc., A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants.Molecular Plant 9 (7): 1088-1091), the Cas9 Expression element sequence is corresponding to plasmid pTX172 Cas9 Expression element sequence it is consistent (referring to document Tang X etc., A Single Transcript CRISPR-Cas9System For Efficient Genome Editing in Plants.Molecular Plant 9 (7): 1088-1091).
PZHY988 carries out single endonuclease digestion, the foundation of digestion system and digestion conditioned reference Thermo Scientific with BsaI Company's restriction enzyme specification carries out.Specific digestion system is as follows: 10 × Fast digest buffer, 5 μ L, plasmid DNA or 10 μ l of PCR product (1~1.5 μ g), restriction enzyme 1 μ L, ddH2O complements to 50 μ L.
37 DEG C of constant incubators react 2h, and 6 × loading bufer of 10 μ L is added after reaction, and 1% agarose is solidifying Gel electrophoresis, gel extraction.Glue recovery method is according to AXYGEN AxyPrepTMDNA Gel Extraction Kit method carries out.
Annealed product by the digestion recovery product (large fragment) of pZHY988 respectively with each target site is attached, even The foundation of junctor system and condition of contact are carried out with reference to New England Biolabs company's T 4DNA ligase specification, specifically Linked system is as follows: 10 × T4DNA connection enzyme reaction buffer solution, 2 μ L, T4DNA ligase, 1 μ L, pZHY988 digestion products, 5 μ L, Annealed product 5 μ L, ddH2O supplies 20 μ L.
(4) Escherichia coli convert
1) connection product converts bacillus coli DH 5 alpha competence.
Bacillus coli DH 5 alpha competence is the preparation method is as follows: picking bacillus coli DH 5 alpha monoclonal, in LB liquid medium Middle carry out activation culture.Prepare 1.5M MgCl2, weigh 3.0495g MgCl2·6H2O, ddH2O is settled to 10mL.It prepares Solution A weighs 0.098955g MnCl2·4H2O (10mM), 0.277450g CaCl2(50mM), 0.097615g 2- Morpholino b acid (10mM) Yu Shiliang ddH2It is dissolved in O, 7.5mL glycerol is then added, finally uses ddH2O complements to 50mL.It takes 1mL activates bacterium solution in 50mL liquid LB (MgCl containing 15mM2) in, 37 DEG C of shaking table cultures to OD600=0.6~0.85, 1500rpm-3000rpm centrifugation, collects thallus.Supernatant is abandoned, the Solution A that 3mL frost is added is resuspended, and places on ice 20min.It is dispensed into the centrifuge tube of 1.5mL with the amount of every 50 μ L of pipe, liquid nitrogen flash freezer, -80 DEG C of preservations.
2) bacillus coli DH 5 alpha conversion operation step:
Competence is placed in and is slowly melted on ice, 5-10 μ L connection product or 1 μ g plasmid is added, places 20min on ice.42 DEG C heat shock 1min, places 1-2min on ice.350 μ L liquid LB are added, mix well, 37 DEG C of shake culture 45min.12000rpm It is centrifuged 1min, removes 200 μ L supernatants, remaining 200 μ L bacterium solutions are resuspended.The bacterium solution of resuspension is all coated on containing corresponding antibiotic On the LB plate of (50mg/L Kan), 18~22h is cultivated in 37 DEG C of inversions.
(5) bacterium colony PCR
With the monoclonal on sterilizing toothpick picking LB plate, in 50 μ L ddH2It is rinsed in O water, using this bacterium solution as template Carry out PCR amplification.Using 25uL system, system is as follows: 10 × PCR Buffer 2.5 μ L, dNTP 0.5 μ L, OsmiR528- 0.5 0.5 Μ L, Taq DNA enzyme of μ L, ZY065RB (5 '-ttctaataaacgctcttttctct-3 ') of sgRNA1-F 0.2 μ L, Template 1 μ L, ddH2O 19.8μL.PCR program are as follows: 94 DEG C, 5min → (94 DEG C, 30s → 56 DEG C, 30s → 72 DEG C, 10-60s) 32 → 72 DEG C of circulations, 5min → 10 DEG C, 5min；(Taq DNA enzyme, dNTP etc. are public purchased from Tiangeng biology Department).
After PCR, 5 μ 6 × bromophenol blues of L are added, are detected by agarose gel electrophoresis.
(6) it is sequence verification that plasmid, which extracts,
Bacterium colony PCR is verified into correct monoclonal, bacterium is shaken in the LB of Yu Hanyou 50mg/LKan, extracts the plasmid in bacterium solution, The extraction of Plasmid DNA is carried out according to AXYGEN AxyPrepTM Plasmid Miniprep Kit specification.The plasmid of extraction is sent Qing Ke Biotechnology Co., Ltd carries out sequence verification.And plasmid is named as pMIR528-1.
2, Agrobacterium tumefaciens mediated rice transformation
(1) Agrobacterium tumefaciems EHA105 competence preparation method
The preparation of Agrobacterium tumefaciems EHA105 competence need to carry out under cryogenic, and the specific method is as follows:
Sterilizing toothpick picking Agrobacterium tumefaciems EHA105 bacterial strain monoclonal in 10mL LB liquid medium (50mg/LKan, In 50mg/LRif), 28 DEG C of constant-temperature table 36~48h of shake culture, activated strains.Bacterium solution after taking 2mL to activate is in 100mL LB It is expanded culture in fluid nutrient medium (50mg/LKan, 50mg/LRif), 28 DEG C of constant-temperature table shake cultures to OD600=0.7 Left and right.30min is placed on ice, and 4 DEG C, 6000rpm is centrifuged 10min, collects thallus.The 20mM of 1mL pre-cooling and sterilizing is added CaCl2Resuspended bacterium solution.Resuspended bacterium solution is dispensed with the amount of every 100 μ L of pipe into 1.5mL centrifuge tube, liquid nitrogen flash freezer, -80 DEG C of preservations It is spare.
(2) Agrobacterium tumefaciens transformation
By the plasmid DNA transformation Agrobacterium tumefaciems EHA105 competence of extraction, specific method for transformation is as follows: by competence It is placed in and slowly melts on ice, 0.5~1 μ g Plasmid DNA is added into the competence after thawing, it is soft to mix, it places on ice 30min.3) liquid nitrogen flash freezer 5min, 37 DEG C of incubations 5min, ice bath 2min.LB, 200rpm, the 28 DEG C of concussion trainings of 800 μ L liquid are added Support 2~3h.6000rpm is centrifuged 2min, collects thallus, removes 600 μ L supernatants, 200 μ L of residue resuspension, and be spread evenly across containing On the LB plate of 50mg/L Kan and 50mg/L Rif.28 DEG C, it is inverted 36~48h of dark culture.
(3) Agrobacterium tumefaciens mediated rice transformation
Agrobacterium mediation converted rice is with reference to document Toki S, et al.Early infection of scutellum tissue with Agrobacterium allows high-speed transformation of rice.The Plant Journal, 2006,47 (6): method disclosed in 969-976..The genetic transformation step of rice is specific as follows, and (following operation is equal Aseptically carry out):
Rice (OryzasativaLcv.Nipponbare) mature seed is peeled and is sterilized；The seed sterilized is inoculated in the N- containing 0.4% gellan gum Above 6-D solid medium, 32 DEG C continuous illumination culture 1~5 day；The seed of culture will by Agrobacterium-medialed transformation method CRISPR-Cas9 expression plasmid pMIR528-1 is transferred in rice, and transformed rice paddy seed connects in induction Selective agar medium Continue 32 DEG C illumination cultivation 2 weeks；The callus that proliferation generates is transferred in RE-III culture medium；The immature plant generated from callus Strain is transferred to the generation that root is induced in HF culture medium.Resistance regrowth to be obtained it is long to 15cm or so when, clear water cleans root Culture medium transplants the hot-house culture into Nutrition Soil.
3, rice regeneration seedling transgenic positive detects
(1) rice seedlings extracting genome DNA
Rice seedlings DNA, which is extracted, uses CTAB method, specific steps are as follows:
CTAB extracting solution preheats in 65 DEG C of water-baths.The 0.2g that draws materials is put into mortar, and liquid nitrogen flash freezer is added, grinds rapidly At powdered, it is transferred in EP pipe.The CTAB extracting solution of 600 μ L preheating is added, during which 65 DEG C of 30~50min of water-bath are mixed well. 600 μ L chloroforms are added: isoamyl alcohol (24 ︰ 1) is sufficiently mixed by inversion, 4 DEG C, and 12000rpm is centrifuged 10min.Take supernatant, the bodies such as addition Long-pending isopropanol precipitating, -20 DEG C of precipitating 30min~2h.Room temperature, 10000rpm are centrifuged 10min, collect precipitating.Remove supernatant, 75% Ethyl alcohol rinsing, 10000rpm are centrifuged 2min.Supernatant, natural air drying or blowing drying DNA being removed, being until can't smell ethyl alcohol taste Only, 10~20min is generally waited.30~50 μ L ddH are added2O dissolving DNA saves in -20 DEG C of refrigerators stand-by.
(2) rice seedlings transgenic positive detects
The detection of rice seedlings transgenic positive uses PCR method.With the upstream primer TX067- of maize ubiquitin promoter The downstream primer ZY295-Cas9-HP-2:5 '-of ZmUbi-F:5 '-CATATGCAGCAGCTATATGTGGA-3 ' and Cas9 albumen TCTTCTCACCAGGGAGCTGAGCA-3 ' carries out PCR amplification, expanding fragment length 838bp.PCR amplification system and reaction interval Sequence is the same.
4, PCR-SSCP mutant detects
Since mature miRNA only has 20bp or so, it is difficult to find suitable restriction enzyme site when designing target site, So being difficult that the detection of mutant can be carried out by PCR-RFLP.Therefore, experiment uses single-strand conformation polymorphism SSCP (single Strand conformation polymorphism, SSCP) carry out mutant preliminary screening.PCR amplification target patch first PCR product, is then denaturalized by section, and the preliminary screening of mutant is carried out by polyacrylamide gel electrophoresis.If target site It mutates, when being denaturalized into single stranded DNA, the solid for being different from normal DNA can be formed during polyacrylamide gel electrophoresis Conformation forms different bands to influence its mobility.Specific steps are as follows:
(1) CRISPR-Cas9 action site PCR amplification and PCR product denaturation
It will test acquired bottom positive plant primer OsmiR528-SSCP-F:5 '-CACCAATGGATGCATCAGCAG- 3 ' carry out PCR amplification with OsmiR528-SSCP-R:5 '-TGAGAGTTTGGTGCAATAACAG-3 ', and expanding fragment length is 298bp.PCR amplification system and response procedures are the same.
It takes 5 μ LPCR products to be added in 5 μ L SSCP denaturants, mixes well, 95 DEG C of denaturation 5min；It is fast after denaturation Speed is put into ice chest, cooling 10min.
(2) production of polyacrylamide gel
15%PAGE (29 ︰ 1) glue preparation method is as follows: 21mL Acr/Bis (29 ︰ 1) sol solution, 150 μ L10%Aps, and 10 μ L TEMED, quickly stirs and evenly mixs, the perfusion for glue.Acrylamide Acr, methylene diacrylamide Bis, ammonium persulfate Aps AMRESCO company is purchased from tetramethylethylenediamine TEMED.
(3) SSCP electrophoresis
After being gelled admittedly, under the conditions of 4 DEG C, 45mA constant current electrophoresis prerunning 20min or so.It is then turned off power supply, respectively Take 5 μ L denatured samples loading in order.Then at 4 DEG C, 45mA constant current electrophoresis 4-5h.
(4) dyeing and observation of PAGE glue
Glue is unloaded, is rinsed with water 2~3 times；Dyeing: AgNO is added3Dye liquor is placed in shaking table dyeing 10min；Colour developing: NaOH is added Color developing agent is placed in shaking table colour developing 5min or so, until seeing clear band；Dyeing terminates, and is rinsed with water immediately, terminates reaction.It sees It examines: glue is laid in above lamp box, observe, take pictures.
SSCP result (Fig. 2) shows that other than No. 34 single plants, each single plant and wild type have notable difference, shows CRISPR-Cas9 system can carry out efficiently and directionally modification to OsmiR528, to obtain mutant.
5, knockout mutations body sequence verification
By SSCP obtain with wild type discrepant single plant primer OsmiR528-SSCP-F and OsmiR528-SSCP- R carries out PCR amplification, and PCR amplification system and response procedures are the same.PCR product is recycled and carries out TA clone, TA cloning vector used For pMD19-T, operation sequence is according to kit specification.Positive colony is delivered into the sequencing of Chengdu Qing Ke biotech firm.Sequencing knot Fruit (Fig. 3) shows that in addition to No. 34 single plants, remaining single plant has mutation, and mutation efficiency has reached 93%, shows CRISPR-Cas9 system System can carry out efficiently and directionally knockout to OsmiR528.
Embodiment 2 carried out using the method for the present invention multiple miRNA mutant initiative (with rice Os miR397a and For OsmiR97b)
1, the vector construction of CRISPR-Cas9-miRNAs mutant
(1) OsmiR397a and OsmiR397b double site knockout carrier construction method
There are two member, OsmiR397a (GenBank number:AP014962:28489785 ... for OsmiR397 family And OsmiR97b (GenBank number:XM_015769221) 28489898).In order to obtain OsmiR397 knockout mutations body, The double site knockout mutations carrier for constructing an OsmiR397a and OsmiR97b while knocking out.According to OsmiR397a and The precursor sequence of OsmiR97b is designed and synthesized containing OsmiR397a-sgRNA1, gRNA scaffold, U6 terminator, U6 starting Son, OsmiR397b-sgRNA1 sequence OsmiR397a-gRNA1-OsmiR397b-gRNA1-F and OsmiR397a-gRNA1- OsmiR397b-gRNA1-R (transfers to Shanghai Ying Jun Bioisystech Co., Ltd to synthesize).OsmiR397a-gRNA1- OsmiR397b-gRNA1-F:
gtgtGAGTGCAGCGTTGATGAACAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT TATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCTAGACCCAGCTTTCTTGTACAAAGTTGGCATTACTG CGAGCTCAAACTATCAGTGTTTGACAGGATATATTGGCGAGGATCCGCGGATCATGAACCAACGGCCTGGCTGTATT TGGTGGTTGTGTAGGGAGATGGGGAGAAGAAAAGCCCGATTCTCTTCGCTGTGATGGGCTGGATGCATGCGGGGGAG CGGGAGGCCCAAGTACGTGCACGGTGAGCGGCCCACAGGGCGAGTGTGAGCGCGAGAGGCGGGAGGAACAGTTTAGT ACCACATTGCCCAGCTAACTCGAACGCGACCAACTTATAAACCCGCGCGCTGTCGCTTGTGTGTGCAGCGTTGATGA ACCTGC
OsmiR397a-gRNA1-OsmiR397b-gRNA1-R:
aaaGCAGGTTCATCAACGCTGCACACACAAGCGACAGCGCGCGGGTTTATAAGTTGGTCGCGTTCGAG TTAGCTGGGCAATGTGGTACTAAACTGTTCCTCCCGCCTCTCGCGCTCACACTCGCCCTGTGGGCCGCTCACCGTGC ACGTACTTGGGCCTCCCGCTCCCCCGCATGCATCCAGCCCATCACAGCGAAGAGAATCGGGCTTTTCTTCTCCCCAT CTCCCTACACAACCACCAAATACAGCCAGGCCGTTGGTTCATGATCCGCGGATCCTCGCCAATATATCCTGTCAAAC ACTGATAGTTTGAGCTCGCAGTAATGCCAACTTTGTACAAGAAAGCTGGGTCTAGAAAAAAAGCACCGACTCGGTGC CACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACTTGTTCATCAACGCTG CACTC
It is attached after two DNA sequence dna annealing with the BsaI digestion recovery product (large fragment) of pZHY988.Then it carries out Conversion, bacterium colony PCR, upgrading grain, sequencing (method is with embodiment 1).
It is expanded by twice PCR, Single cell fusion PCR, by two targets of OsmiR397a-gRNA1 and OsmiR397b-gRNA1 Site is loaded on pZHY988, the pZJP028 (Fig. 4) of OsmiR397a and OsmiR397b for constructing while knocking out.
After the completion of vector construction, conversion Agrobacterium, rice transformation, the detection of rice regeneration seedling transgenic positive and implementation Corresponding part is identical in example 1.
2, PCR-SSCP mutant detects
It will test obtained positive plant primer OsmiR397a-SSCP-F:5 '-respectively GCAGCTGTAGTACAGTAGTAC-3 ', OsmiR397a-SSCP-R:5 '-TTCTAACCATAACTGAGT TGCT-3 ' and OsmiR397b-SSCP-F:5 '-GCAGCTACACACGCACAAGCA-3 ', OsmiR397b-SSCP-R:5 '- GGATATGGATATGGATTGTGT-3 ' carries out PCR amplification.PCR amplification system and response procedures are the same.Hereafter the step of and reality It applies identical in example 1.
SSCP result (Fig. 5) shows that each single plant and wild type have notable difference, shows that CRISPR-Cas9 system can be same When knockout is oriented to OsmiR397a and OsmiR397b double site, to obtain double-mutant.From the point of view of Fig. 5,17 lists In strain, 12 single plants (i.e. 2-1,7-1,8-1,13-1,15-1,16-1,20-1,21-1,22-1,23-1,24-1,24-2) have prominent Become.
3, knockout mutations body sequence verification
It chooses SSCP and the discrepant part single plant of wild type in Fig. 5 and uses primer OsmiR397a-SSCP-F respectively, OsmiR397a-SSCP-R and OsmiR397b-SSCP-F, OsmiR397b-SSCP- carry out PCR amplification, PCR amplification system and anti- Answer program the same.PCR product is recycled and carries out TA clone, TA cloning vector used is pMD19-T, and operation sequence is according to kit Specification.Some positive clone is delivered into the sequencing of Chengdu Qing Ke biotech firm.Sequencing result is shown: in selected single plant Two sites OsmiR397a and OsmiR397b produce mutation, show that CRISPR-Cas9 system can simultaneously carry out miRNA Orientation knocks out, while obtaining multimutation body.
Embodiment 3 using the method for the present invention carry out miRNA large fragment deletion mutant initiative (be with rice Os miR408 Example)
1, the vector construction of CRISPR-Cas9-miRNAs mutant
(1) OsmiR408-sgRNA1 and OsmiR408-sgRNA2 double site knockout carrier construction method
Consider wholly or largely to knock out precursor miRNA or is difficult to find properly near certain maturation miRNA precursors The site PAM when, it is necessary to consider to formulate the strategy of large fragment deletion using double site knockout.
According to the precursor sequence of OsmiR408, designs and synthesizes and opened containing sgRNA1, gRNA scaffold, U6 terminator, U6 Mover, the sequence OsmiR408-gRNA1-gRNA2-F and OsmiR408-gRNA1-gRNA2-R of sgRNA2 (transfer to Shanghai English fine horse Bioisystech Co., Ltd's synthesis).
OsmiR408-gRNA1-gRNA2-F:
gtgtGATGAGGCAGAGCATGGGATGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT TATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCTAGACCCAGCTTTCTTGTACAAAGTTGGCATTACTG CGAGCTCAAACTATCAGTGTTTGACAGGATATATTGGCGAGGATCCGCGGATCATGAACCAACGGCCTGGCTGTATT TGGTGGTTGTGTAGGGAGATGGGGAGAAGAAAAGCCCGATTCTCTTCGCTGTGATGGGCTGGATGCATGCGGGGGAG CGGGAGGCCCAAGTACGTGCACGGTGAGCGGCCCACAGGGCGAGTGTGAGCGCGAGAGGCGGGAGGAACAGTTTAGT ACCACATTGCCCAGCTAACTCGAACGCGACCAACTTATAAACCCGCGCGCTGTCGCTTGTGTGGAAGAGGCAGTGCA GGGGA
OsmiR408-gRNA1-gRNA2-R:
cccaTCCCCTGCACTGCCTCTTCCACACAAGCGACAGCGCGCGGGTTTATAAGTTGGTCGCGTTCGAG TTAGCTGGGCAATGTGGTACTAAACTGTTCCTCCCGCCTCTCGCGCTCACACTCGCCCTGTGGGCCGCTCACCGTGC ACGTACTTGGGCCTCCCGCTCCCCCGCATGCATCCAGCCCATCACAGCGAAGAGAATCGGGCTTTTCTTCTCCCCAT CTCCCTACACAACCACCAAATACAGCCAGGCCGTTGGTTCATGATCCGCGGATCCTCGCCAATATATCCTGTCAAAC ACTGATAGTTTGAGCTCGCAGTAATGCCAACTTTGTACAAGAAAGCTGGGTCTAGAAAAAAAGCACCGACTCGGTGC CACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACCATCCCATGCTCTGCC TCATC
Hereafter method is the same as double site knockout carrier construction method in embodiment 2.
The correct OsmiR408-sgRNA1 and OsmiR408-sgRNA2 double site knockout carrier of acquisition is named as PZJP025 (Fig. 6), conversion Agrobacterium, rice transformation, the detection of rice regeneration seedling transgenic positive and embodiment 1 hereafter In corresponding part it is identical.
2, the detection of large fragment deletion mutant
It will test obtained positive plant primer Osa-miR408-SSCP-F1:5 '-respectively Atcttgacgatgatggcgttg-3 ', Osa-miR408-SSCP-R1:5 '-AGAGAGAGAGAGAGAGGTGTG-3 ' is carried out PCR amplification.PCR amplification system and response procedures are the same.Hereafter the step of, is in the same manner as in Example 1.
As a result (such as Fig. 7) show 10 single plants in, have 6 single plants (pZJP025-01-01, pZJP025-02-01, PZJP025-03-01, pZJP025-04-01, pZJP025-09-02, pZJP025-10-01) band containing small fragment, that is, have big Fragment deletion.Show to knock out the efficient orientation for carrying out large fragment using CRISPR-Cas9 system, to obtain large fragment Deletion mutant.Corresponding band is recycled and is sequenced, as a result further demonstrating CRISPR-Cas9 system can be efficiently right The orientation that miRNA carries out large fragment knocks out, to obtain the deletion mutant of miRNA large fragment.

Claims (2)

1. the miRNAs for rice Os miR397 gene family member OsmiR397a and OsmiR397bmiRNA orients knockout side Method, it is characterised in that: multiple miRNAs are knocked out using CRISPR-Cas9 method in rice, are included the following steps:
A, load of the building for the multiple miRNAs of knockout of rice Os miR397 gene family member OsmiR397a and OsmiR97b Body pZJP028；The skeleton of the carrier is pZHY988, and the nucleus between the left and right boundary carrier T-DNA includes following elements: Hygromycin gene expression element, Cas9 Expression element and gRNA transcriptional units；
When knocking out multiple miRNAs, the gRNA transcriptional elements that gRNA transcriptional units are 2 or more are connected, and identification is different respectively The site PAM near target miRNA；The site PAM that gRNA transcriptional elements are identified is 5 '-NX- NGG-3 ', N indicate A, G, C and Any one of T, x=20；
The gRNA transcriptional elements include rice U6 promoter, ccdB and gRNA scaffold, U6 terminator, ccdB piece Respectively there is I restriction enzyme site of Bsa at section both ends, and nucleotide sequence is as shown in SEQ ID No.1, in carrier construction, with I enzyme of Bsa Carrier framework is cut, access is directed to the sgRNA of target miRNA；The nucleotide sequence of the gRNA transcriptional units such as SEQ ID No.3 institute Show；
The Cas9 Expression element includes maize ubiquitin Ubiquitin-1 promoter Ubi, Cas9 protein gene and heat shock protein Terminator HSP；
The hygromycin Expression element includes cauliflower mosaic virus promoter 35S, hygromycin gene Hygromycin, flower coconut palm Cauliflower mosaic virus terminator 35ST；
B, CRISPR-Cas9 carrier rice transformation callus, the screening acquisition rice miRNA mutant obtained step a.
2. the method as described in claim 1, it is characterised in that: in step b, method that the screening of knockout mutations body uses for The method that PCR-SSCP single-strand conformation polymorphism and sequencing combine.
CN201610807153.6A 2016-09-07 2016-09-07 A kind of method that rice miRNA orientation knocks out Active CN106367435B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610807153.6A CN106367435B (en) 2016-09-07 2016-09-07 A kind of method that rice miRNA orientation knocks out

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610807153.6A CN106367435B (en) 2016-09-07 2016-09-07 A kind of method that rice miRNA orientation knocks out

Publications (2)

Publication Number Publication Date
CN106367435A CN106367435A (en) 2017-02-01
CN106367435B true CN106367435B (en) 2019-11-08

Family

ID=57899435

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610807153.6A Active CN106367435B (en) 2016-09-07 2016-09-07 A kind of method that rice miRNA orientation knocks out

Country Status (1)

Country Link
CN (1) CN106367435B (en)

Families Citing this family (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013066438A2 (en) 2011-07-22 2013-05-10 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US9163284B2 (en) 2013-08-09 2015-10-20 President And Fellows Of Harvard College Methods for identifying a target site of a Cas9 nuclease
US9359599B2 (en) 2013-08-22 2016-06-07 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US9228207B2 (en) 2013-09-06 2016-01-05 President And Fellows Of Harvard College Switchable gRNAs comprising aptamers
US9322037B2 (en) 2013-09-06 2016-04-26 President And Fellows Of Harvard College Cas9-FokI fusion proteins and uses thereof
US20150165054A1 (en) 2013-12-12 2015-06-18 President And Fellows Of Harvard College Methods for correcting caspase-9 point mutations
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
EP3365357B1 (en) 2015-10-23 2024-02-14 President and Fellows of Harvard College Evolved cas9 proteins for gene editing
AU2017306676B2 (en) 2016-08-03 2024-02-22 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
AU2017308889B2 (en) 2016-08-09 2023-11-09 President And Fellows Of Harvard College Programmable Cas9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
SG11201903089RA (en) 2016-10-14 2019-05-30 Harvard College Aav delivery of nucleobase editors
WO2018119359A1 (en) 2016-12-23 2018-06-28 President And Fellows Of Harvard College Editing of ccr5 receptor gene to protect against hiv infection
WO2018165504A1 (en) 2017-03-09 2018-09-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
IL306092A (en) 2017-03-23 2023-11-01 Harvard College Nucleobase editors comprising nucleic acid programmable dna binding proteins
WO2018209320A1 (en) 2017-05-12 2018-11-15 President And Fellows Of Harvard College Aptazyme-embedded guide rnas for use with crispr-cas9 in genome editing and transcriptional activation
JP2020534795A (en) 2017-07-28 2020-12-03 プレジデント アンド フェローズ オブ ハーバード カレッジ Methods and Compositions for Evolving Base Editing Factors Using Phage-Supported Continuous Evolution (PACE)
WO2019139645A2 (en) 2017-08-30 2019-07-18 President And Fellows Of Harvard College High efficiency base editors comprising gam
KR102510576B1 (en) 2017-09-19 2023-03-14 트로픽 바이오사이언시즈 유케이 리미티드 Specific modification of non-coding RNA molecules in plants to silence gene expression
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
JP2022526908A (en) 2019-03-19 2022-05-27 ザ ブロード インスティテュート，インコーポレーテッド Editing Methods and Compositions for Editing Nucleotide Sequences
CN112852805B (en) * 2019-11-28 2024-02-09 电子科技大学 Preparation method of rice miRNA homozygous lethal mutant
CN113493786B (en) * 2020-04-07 2023-05-23 电子科技大学 Method for blocking or weakening expression of OsMIR3979 in rice to improve rice seed shape
CN113493787B (en) * 2020-04-08 2023-07-28 电子科技大学 Method for blocking or weakening expression of rice OsMIR7695 to improve seed shape
AU2021267940A1 (en) 2020-05-08 2022-12-08 President And Fellows Of Harvard College Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105647962A (en) * 2016-02-15 2016-06-08 浙江大学 Gene editing method for knocking out rice MIRNA393b stem-loop sequences with application of CRISPR(clustered regulatory interspersed short palindromic repeat)-Cas9 system

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105647962A (en) * 2016-02-15 2016-06-08 浙江大学 Gene editing method for knocking out rice MIRNA393b stem-loop sequences with application of CRISPR(clustered regulatory interspersed short palindromic repeat)-Cas9 system

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CRIPSR/Cas9介导的基因编辑技术研究进展;李聪等;《生物工程学报》;20151125;第31卷(第11期);第1531-1542页 *
Effective screen of CRISPR/cas9-induced mutants in rice by single-strand conformation polymorphism;Xuelian Zheng等;《Plant cell Rep》;20160323;第35卷;第1545-1554页 *
快速构建多重sgRNA载体利用CRISPR/Cas9技术敲除拟南芥IAA2基因;刘丁源等;《遗传》;20160831;第38卷(第8期);第756-764页 *

Also Published As

Publication number Publication date
CN106367435A (en) 2017-02-01

Similar Documents

Publication Publication Date Title
CN106367435B (en) A kind of method that rice miRNA orientation knocks out
Malzahn et al. Application of CRISPR-Cas12a temperature sensitivity for improved genome editing in rice, maize, and Arabidopsis
CN104846010B (en) A kind of method for deleting transgenic paddy rice riddled basins
CN105821075B (en) A kind of construction method of tea tree CaMTL5 CRISPR/Cas9 genome editor's carriers
Feng et al. Efficient targeted genome modification in maize using CRISPR/Cas9 system
CN105132451B (en) A kind of single transcriptional units directed modification skeleton carrier of CRISPR/Cas9 and its application
WO2017028768A1 (en) Method for obtaining glyphosate-resistant rice by site-directed nucleotide substitution
Yan et al. Efficient multiplex mutagenesis by RNA-guided Cas9 and its use in the characterization of regulatory elements in the AGAMOUS gene
CN107099533A (en) A kind of sgRNA targeting sequencings of special target pig IGFBP3 genes and application
CN107893080A (en) A kind of sgRNA for targetting rat Inhba genes and its application
CN105177038A (en) CRISPR/Cas9 system for efficiently editing plant gene groups in fixed-point mode
CN108034671B (en) Plasmid vector and method for establishing plant population by using same
CN102432679B (en) Rice extensin OsPEX1 and application thereof
CN111979264B (en) Construction method and application of PDS gene editing system of macleaya cordata based on CRISPR/Cas9 system
Lange et al. Molecular analysis of transgene and vector backbone integration into the barley genome following Agrobacterium-mediated transformation
CN114008203A (en) Methods and compositions for generating dominant alleles using genome editing
CA2494570A1 (en) Seed-specific gene promoters and uses thereof
CN113512547B (en) Rubber tree ubiquitin gene promoter proHbUBI1 and cloning and application thereof
CN111961679B (en) Nucleotide sequence of macleaya cordata phytoene dehydrogenase gene and application
Wang et al. Targeted mutagenesis in hexaploid bread wheat using the TALEN and CRISPR/Cas systems
CN116855529B (en) Application of OsbHLH186 gene in improving rice grain type
CN107227303A (en) A kind of application of OsGA3ox1 genes in rice male-sterile plants system formulates
CN113493786B (en) Method for blocking or weakening expression of OsMIR3979 in rice to improve rice seed shape
CN111909956B (en) Method for blocking or weakening OsNAC092 gene expression of rice to improve drought resistance of rice
CN112852805B (en) Preparation method of rice miRNA homozygous lethal mutant

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right

Effective date of registration: 20220524

Address after: No.7, 6th floor, block C, building 7, Tianfu Xingu, No.399, Fucheng Avenue West, Chengdu hi tech Zone, China (Sichuan) pilot Free Trade Zone, Chengdu, Sichuan 610000

Patentee after: Chengdu Kaixin Jigu enterprise management partnership (L.P.)

Address before: 611731, No. 2006, West Avenue, Chengdu hi tech Zone (West District, Sichuan)

Patentee before: University of Electronic Science and Technology of China

TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20221108

Address after: No.23, 3rd floor, block B, building 1, no.1480, North Tianfu Avenue, Chengdu hi tech Zone, China (Sichuan) pilot Free Trade Zone, Chengdu, Sichuan 610000

Patentee after: Chengdu Jigu Gene Technology Co.,Ltd.

Address before: No.7, 6th floor, block C, building 7, Tianfu Xingu, No.399, Fucheng Avenue West, Chengdu hi tech Zone, China (Sichuan) pilot Free Trade Zone, Chengdu, Sichuan 610000

Patentee before: Chengdu Kaixin Jigu enterprise management partnership (L.P.)

TR01 Transfer of patent right