CN105132451B - A kind of single transcriptional units directed modification skeleton carrier of CRISPR/Cas9 and its application - Google Patents
A kind of single transcriptional units directed modification skeleton carrier of CRISPR/Cas9 and its application Download PDFInfo
- Publication number
- CN105132451B CN105132451B CN201510397341.1A CN201510397341A CN105132451B CN 105132451 B CN105132451 B CN 105132451B CN 201510397341 A CN201510397341 A CN 201510397341A CN 105132451 B CN105132451 B CN 105132451B
- Authority
- CN
- China
- Prior art keywords
- cas9
- grna
- ribozyme
- transcriptional units
- crispr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention belongs to gene engineering technology fields, and in particular to a kind of single transcriptional units directed modification skeleton carrier of CRISPR/Cas9 and its application.The technical problem to be solved by the present invention is existing CRISPR/Cas9 genome editor system species versatility is low and is difficult to realize the collaboration of Cas9 protein expression and gRNA transcription.The technical scheme is that the building single transcriptional units skeleton carrier of CRISPR/Cas9, the transcription of Cas9 and guide RNA core cell are regulated and controled by a promoter.The present invention also provides construct the method for the special sex modification Cas9-gRNA recombinant vector of target site using the single transcriptional units skeleton carrier of CRISPR/Cas9.The present invention provides a kind of efficient single transcriptional units skeleton carriers of CRISPR/Cas9, the collaboration transcription that can effectively realize Cas9 the and gRNA unit based on the driving of Pol II type promoter, carries out simple, quick, efficient genome for a variety of eucaryotes and orients genetic modification.
Description
Technical field
The invention belongs to gene engineering technology fields, and in particular to a kind of single transcriptional units orientation of CRISPR/Cas9 is repaired
Adorn skeleton carrier and its application.
Background technique
In recent years, with the propulsion of mode animal and plant genome project and perfect, the needle of related gene manipulation technology
Sequence specific nuclease (zinc-finger nuclease, ZFN are constructed to genome target site；transcription
activator-like effectors nuclease,TALEN；clustered regularly interspaced short
Palindromic repeats/CRISPR-associated protein-9, CRISPR/Cas9), in target organism genome
Specific site causes DSB, and in vivo under the effect of source DNA repair system, it is different types of fixed that target gene group may be implemented
To genetic modification.
In CRISPR/Cas9 genome editor's system, specificity cutting master of the CRISPR/Cas9 to genome target sequence
It will be dependent in guide RNA (guided RNA, gRNA) (tracrRNA and the fused single guide RNA single strand of crRNA)
PAM (the protospacer adjacent on ribonucleoprotein complexes identification target sequence that crRNA and Cas9 albumen are formed
Motif, preceding region sequence is adjacent to motif) (feature that 5 '-NGG-3 ' are exactly PAM) and its adjacent 20bp or so specific target sequence
It arranges (protospacer).It needs to construct the expression vector containing Cas9 albumen and gRNA unit in experimental implementation, passes through multiplicity
Conversion scheme, carries out Cas9 protein expression and the transcription of gRNA unit in target biological cell, and then Cas9 albumen and gRNA
Ribonucleoprotein complexes identification, combination, shearing target organism genome specific site, source DNA repairs way in the cell later
Diameter effect is lower to realize different types of orientation genetic modification.
In CRISPR/Cas9 genome editor's system used at present, Cas9 and gRNA be implemented in respectively independent transcription,
In expression unit: Cas9 protein expression unit is successively made of Pol II type promoter, Cas9 ORF, terminator, wherein Cas9
ORF needs to merge NLS sequence；GRNA transcriptional units successively (are mostly opened using the transcription of the tiny RNAs such as U6, U3 by Pol type III promoter
Mover), gRNA unit (tracrRNA+crRNA that Hwang etc. 2013 is mostly used to deliver fusion gRNA unit), Poly T terminate
Son is constituted.Cas9 protein expression and gRNA transcriptional units can construct respectively carries out cotransformation in two separate carriers, can also
To be converted on single carrier as two separate unit buildings.Wherein: the expression of Cas9 albumen can be according to conversion mesh
It is suitable for Pol II type promoter that target characteristic and requirement of experiment, which are selected, be such as often used in zooblast CMV, hsP70, SV40 and
Promoters such as common CaMV35S, ZmUb1, AtUb10 etc. in plant；GRNA transcriptional units generally according to conversion target, use
The tiny RNAs transcripting promoter such as special U6, U3 in target gene group.
But in above CRISPR/Cas9 genome editor's system, Cas9 protein expression unit and gRNA independently turns
There are inherent shortcomings for the design of record unit, it is difficult to realize the concertedness of Cas9 protein expression and gRNA transcription.Simultaneously as gRNA
The transcription of unit is basic to rely on the Pol type III promoters such as species Preference strong U6, U3, needs to sieve for different target biology
Specific Pol type III tiny RNA transcripting promoter is selected, and is difficult to realize Space-time speciality and inducible transcription regulation, greatly
Limit working efficiency and application range of the CRISPR/Cas9 in genome directed modification.
Summary of the invention
The technical problem to be solved by the present invention is existing CRISPR/Cas9 genome editor's system is difficult to realize Cas9 egg
The concertedness of white expression and gRNA transcription；Need to screen specific tiny RNA transcripting promoter for different target biology；It is difficult to realize
Space-time speciality and inducible transcription regulation.
The technical scheme is that the single transcriptional units skeleton carrier of CRISPR/Cas9, is regulated and controled by a promoter
The transcription of Cas9 and guide RNA core cell.
Specifically, from 5 ' to the 3 ' direction of core cell is followed successively by Cas9 ORF-Poly A-RZ cleavage
Site-gRNA cloning scaffold-RZ cleavage site-RZ, and gRNA cloning scaffold is at least
One, be RZ cleavage site between gRNA cloning scaffold；Wherein, Cas9 ORF, that is, Cas9 encoding histone
Frame, RZ cleavage site, that is, ribozyme identify cleavage site, and gRNA cloning scaffold (being abbreviated as gRNA CS) is i.e.
GRNA clone and transcriptional units, RZ, that is, ribozyme holoenzyme RiboZyme.
Specifically, RNA clone and transcriptional units are 1~5.
Specifically, Cas9 encoding histone frame also includes nuclear localization signal NLS sequence, have as shown in Seq ID No.1
Amino acid sequence.
Specifically, the nucleotide sequence of Cas9 encoding histone frame is as shown in Seq ID No.2.
Specifically, gRNA clone and transcriptional units, have the nucleotide sequence as shown in Seq ID No.3.
Specifically, also having merged BsaI-ccdB-BsaI unit at 5 ' ends of gRNA clone and transcriptional units, have after fusion
Just like nucleotide sequence shown in Seq ID No.4.
Specifically, the ribozyme identification cleavage site of the ribozyme holoenzyme and corresponding identification cooperates in the following manner to be made
With:
(a) replaced, lacked or added one or several nucleosides to the nucleotide sequence of ribozyme identification cleavage site
Acid, and still identified and cut by ribozyme holoenzyme；
Or (b) ribozyme holoenzyme is replaced, while corresponding replacement ribozyme identifies cleavage site, replaced ribozyme identification
Ribozyme holoenzyme identification after cleavage site is replaced is cut.
Specifically, the ribozyme holoenzyme is hammerhead ribozyme, I class introne, RNaseP, hairpin ribozymes, fourth type liver
Scorching ribozyme or VS ribozyme.
Specifically, ribozyme holoenzyme is hammerhead ribozyme, coding nucleotide has the sequence as shown in Seq ID No.6.
Specifically, the ribozyme identification cleavage site is identified by hammerhead ribozyme and cuts that (a) has such as Seq ID
Nucleotide sequence shown in No.5；
Either by replacing, lacking or add one or several nucleotide in the nucleotide sequence of (b) described in (a),
And it remains to be identified by hammerhead ribozyme and cut.
Specifically, the Cas9-poly A-RZ cleavage site-gRNA cloning scaffold-RZ
Cleavage site-RZ has the nucleotide sequence as shown in Seq ID No.7.
Specifically, the promoter is II type promoter of Pol.
Specifically, the II type promoter of Pol is that cauliflower mosaic virus 35 S promoter CaMV35S, corn Ubi1 are opened
Mover ZmUbi1, arabidopsis Ubi10 promoter AtUbi10, cytomegalovirus CMV, Heat shock protein 70 promoter hsP70 or monkey are empty
Steep 0 promoter SV40 of virus-4.
The present invention also provides the preparation methods for being directed to the special sex modification Cas9-gRNA recombinant vector of target site, including
Following steps:
A, the region with PAM feature is analyzed in clear particular organisms genome target region of DNA domain, and PAM structure 5 ' is selected to hold
Adjacent 15~30bpDNA sequence is as specific target sequence；
B, it according to selected specific target sequence, is respectively synthesized with 5 '-CGGA-NXThe positive oligonucleotides of -3 ' features
Chain and have 5 '-AAAC-NXThe reverse oligonucleotide chain of -3 ' features, N indicate any one of A, G, C, T, and X is integer, and 14
≤ X≤30, wherein the N in the forward direction oligonucleotide chainXWith the N in reverse oligonucleotideXWith reverse complemental feature；Pass through
Annealing obtains complementary oligonucleotide double-stranded segment；
C, the complementary oligonucleotide obtained the single transcriptional units skeleton carrier of CRISPR/Cas9 and step b is double
Chain segment mixes, and BsaI restriction endonuclease and T4 DNA ligase, setting " 37 DEG C of -16 DEG C of digestion connections " is added in reaction system simultaneously
Circular response is obtained for the special sex modification Cas9-gRNA recombinant vector of target site.
Specifically, specific target sequence length is 18~21bp in step a.
Preferably, specific target sequence length is 20bp in step a.
Preferably, 18≤X≤21 in step b.
Preferably, it obtains identifying cleavage site (RZ cleavage by ribozyme using fusion DNA vaccine amplification strategy in step c
Site) the multiple gRNA transcriptional units cascade amplification products being spaced are recycled anti-by " connection of BsaI digestion-T4 DNA ligase "
The mode answered replaces BsaI-ccdB-BsaI unit, this more gRNA transcriptional units is cloned into gRNA clone and transcriptional units, is obtained
To the recombinant vector that can be directed to multiple target sites and be specifically modified.
Core of the invention unit (Cas9 ORF-Poly A-RZ cleavage site-gRNA cloning
Scaffold-RZ cleavage site-RZ) it can be needed for specific transformed into host organisms and experiment, it is connected to any Pol
After II type promoter, by the transcription of different promoters starting Cas9-gRNA unit (such as: be often used in zooblast CMV,
Promoters such as common CaMV35S, ZmUb1, AtUb10 etc. in hsP70, SV40 and plant), realize that the shearing of Cas9-gRNA is multiple
Zoarium assembling.
In the present invention, it is based on the single transcriptional units skeleton carrier of CRISPR/Cas9, completes to construct specific Cas9-gRNA table
After being converted up to carrier, under the conditions of active somatic cell, II promoter of Pol drives " Cas9-Poly A-RZ site-gRNA
Cloning scaffold-RZ site-RZ " as a whole transcribe to obtain single-stranded primary transcription sheet by transcriptional units.It is acted in RZ
Under, self cleavage originally occurs at two RZ site respectively for single primary transcription, respectively obtains complete Cas9 protein expression frame mRNA
(A containing Poly) and gRNA transcriptional units.In cell system, Cas9 protein expression frame mRNA (A containing Poly) further progress
Translation obtains Cas9 albumen, and combines with existing gRNA unit and form functional Cas9-gRNA recombiner unit progress gene
Group target site orientation shearing.
In the present invention, complete guide RNA is by capableing of 18~21bp RNA segment of combination complementary with the target fragments
The BsaI-ccdB-BsaI unit replaced in skeleton carrier gRNA clone and transcriptional units forms；RNA clone and transcriptional units
Sequence is constant: not including the sequence such as Seq ID No.3 of BsaI-ccdB-BsaI unit；Including BsaI-ccdB-BsaI unit
Sequence such as Seq ID No.4) the skeleton RNA segment successively by can combine the site protospacer guide gRNA,
The chimeric functional r NA for forming similar hairpin structure of tracrRNA, crRNA, the skeleton RNA segment can be with Cas9 nuclease knot
It closes.
For specific target gene, (5 '-N behind the site gRNA are determinedX-NGG-3'；N indicates any in A, G, C, T
Kind, X is integer, and 14≤X≤30 (18,19,20,21 be accepted value)), it is carried according to the Cas9-gRNA recombination provided in invention
Body construction method follows the gRNA specific target sequence (protospacer) " connection of BsaI digestion-T4 DNA ligase " of design
The mode of ring reaction, replacement BsaI-ccdB-BsaI unit are cloned into gRNA clone and transcriptional units, obtain specific functional
Cas9-gRNA recombinant vector.
In the present invention, BsaI-ccdB-BsaI unit is merged at the 5 ' ends that gRNA clones transcription frame unit, has been acted on
It is as the single transcriptional units skeleton carrier of multiple cloning sites digestion CRISPR/Cas9, to clone target gRAN specific target
Sequence (protospacer).BsaI-ccdB-BsaI unit can be replaced with can introduce notch on skeleton carrier of the present invention
Limitation restriction endonuclease, and accordingly modify gRAN specific target sequence cloning site, can effectively realize in key of the invention
Hold.
In the present invention, the BsaI-ccdB-BsaI unit of 637bp has been merged by holding in gRNA transcriptional expression frame 5 '.
BsaI-ccdB-BsaI unit, the clone for the specific target sequence (protospacer) with identification target gene.Pass through
The synergistic effect of BsaI restriction endonuclease and T4 DNA ligase, can it is quick, be efficiently completed the specific Cas9-gRNA table of target site
Up to carrier.In building sex modification Cas9-gRNA recombinant vector special for target site, specific complementary oligonucleotide double-strand
The BsaI-ccdB-BsaI unit of 637bp in skeleton carrier is substituted, is carried into the single transcriptional units skeleton of CRISPR/Cas9
Body.
It, can be by converting large intestine during constructing the Cas9-gRNA expression vector of target site specific sequence modification
Bacillus, recombinant clone of the bacteria screening pressure screening containing correct Cas9-gRNA expression vector, and bacterium colony PCR, plasmid enzyme can be used
Cut, the modes such as sequencing are identified, clearly to obtain the Cas9-gRNA weight for purpose biological genome directed modification
Group expression vector.
Ribozyme holoenzyme (RZ) used in core cell of the present invention and its ribozyme of corresponding identification identify cleavage site
(RZ cleavage site) needs are used cooperatively, but can have different versions, such as: 1) can retain the RZ in the present invention
Element, but replace, lack or add one or several to the nucleotide sequence of the RZ cleavage site in the present invention
A nucleotide identify it can still by the RZ element in the present invention and cut；2) the hammerhead shape core in the present invention can be replaced
The RZ element of enzyme (hammerhead ribozyme) be other kinds of ribozyme (such as: I class introne, RNaseP, hairpin core
Enzyme, hepatitis D ribozyme or VS ribozyme), and the RZ cleavage site in the corresponding replacement present invention, allow to be replaced
Ribozyme afterwards identifies cutting.These variations do not affect core of the invention content, it may be assumed that by Cas9 encoding histone frame sequence
(Cas9 ORF) and gRNA are cloned and transcriptional units are by that can be identified that the ribozyme of cutting identifies cleavage by specific ribozyme (RZ)
Point (RZ cleavage site) is connected as single transcriptional units, realizes that Cas9 ORF and gRNA transcriptional units can be by any
The collaboration transcription of Pol II type promoter.
Strategy is expanded using fusion DNA vaccine, it is available by ribozyme identification cleavage site (RZ cleavage site) interval
Multiple gRNA transcriptional units cascade amplification products, by way of " connection of BsaI digestion-T4 DNA ligase " circular response,
BsaI-ccdB-BsaI unit is replaced, this more gRNA transcriptional units can be cloned into gRNA clone and transcriptional units, obtaining can
The Cas9-gRNA1-gRNA2- ...-gRNAx recombinant vector (Fig. 5) specifically modified for multiple target sites.
In the present invention, by a variety of method for transformation of plasm, particle gun and mediated by agriculture bacillus, it will construct according to the present invention
Cas9-gRNA recombinant vector be transferred to plant cell, make transformed cells while there is Cas9 nuclease protein and for specific base
Because of the gRNA unit of group target sequence；Under Cas9 nuclease protein and gRNA unit collective effect, to specific gene group target
Sequence DNA double-strand is oriented shearing；And then source DNA is repaired under approach effect in the cell, realizes target sequence NHEJ
(nonhomologous end joining, non-homologous end joining) or HR (homologous recombination, it is homologous
Recombination) directed modification result.The single transcriptional units skeleton carrier of CRISPR/Cas9 of the present invention in plant in application,
It can be used and carry out plant transformants screening including resistant genes such as kanamycins, hygromycin, basta, it is careful by positive transformants
Born of the same parents or tissue (such as protoplast or callus) differentiation and regeneration, obtain and plant come the regeneration for including target site directed modification
Strain.
Beneficial effects of the present invention: the present invention provides a kind of efficient single transcriptional units skeletons of CRISPR/Cas9 to carry
Body can effectively realize the collaboration transcription of the Cas9 and gRNA unit based on the driving of Pol II type promoter, for a variety of eukaryons
Biology carries out simple, quick, efficient genome and orients genetic modification.In skeleton carrier of the present invention, opened in Pol II type
Under mover driving, Cas9 nuclease protein expression cassette and gRNA transcriptional expression frame are in same transcriptional units, and transcribe in gRNA
Expression cassette 5 ' holds the BsaI-ccdB-BsaI unit for having merged 637bp, passes through the collaboration of BsaI restriction endonuclease and T4 DNA ligase
Effect, can it is quick, be efficiently completed the specific Cas9-gRNA expression vector of target site.Cas9 nuclease protein expression cassette with
The strategy that gRNA transcriptional expression frame is transcribed by unique Pol II type promoter regulation, can effectively realize Cas9 nuclease protein and
The coordinate expression of gRNA transcriptional units improves the orientation shear efficiency of CRSIPR/Cas9 system.It is logical by using related animals and plants
With Pol II type promoter (common Ca MV35S, ZmUbi1 promoter in common CMV and plant in such as zooblast),
It is possible to prevente effectively from the problem of being needed in different plant species using the tiny RNAs transcripting promoter such as species specificity U6, U3, is greatly opened up
The application range of the genome orientation genetic modification based on CRSIPR/Cas9 system is opened up.Meanwhile passing through further different groups
The use for knitting specificity and inducing expression promoter can effectively realize that tissue specificity and the orientation heredity of inducible genes group are repaired
Decorations.
Detailed description of the invention
The single transcriptional units structure and working principle schematic diagram of CRISPR/Cas9 designed in Fig. 1 present invention；Pol II
Promoter:Pol II type promoter；Cas9 ORF:Cas9 encoding histone frame；RZ cleavage site:RZ identification shearing position
Point；GRNA cloning scaffold:gRNA clone and transcriptional units；Transcription: transcription；Translation: it turns over
It translates；Cas9protein:Cas9 albumen；Cleavage: shearing；
In Fig. 2 present invention in embodiment 2~5, for specific rice endogenous gene site, specifically constructs and use
The single transcriptional units expression vector schematic diagram of CRISPR/Cas9.Wherein: specifically used Pol II type promoter is cauliflower flower
Mosaic virus 35S promoter (CaMV 35S promoter)；In different case study on implementation, gRNA clone and transcriptional units include can be with
18~21bp guide RNA unit of specific bond target site.
Fig. 3 be based on the present invention in the single transcriptional units skeleton carrier of CRISPR/Cas9, to rice endogenous gene OsYSA,
The rite-directed mutagenesis testing result figure of OsPDS, OSMPK2, OsROC5.Wherein, No. 1 swimming lane is that the PCR amplification of corresponding paddy gene produces
Object, 2, No. 3 swimming lanes are respectively the PCR amplification to different paddy gene wild types and CRISPR/Cas9 expression vector converting material
Product is through corresponding restriction enzyme digestion products (Fig. 3 a:OsYSA-gRNA1:SfiI；Fig. 3 b:OsYSA-gRNA2:EcoNI；Fig. 3 c:
OsPDS-gRNA2:HindIII；Fig. 3 d:OsMPK2-gRNA:MscI；Fig. 3 e:OsROC5-gRNA:AhdI)；
Fig. 4 is directed to different rice endogenous genes, is corresponded to based on the single transcriptional units skeleton carrier building of CRISPR/Cas9
Cas9-gRNA expression vector after rice transformation protoplast, carries out PCR product cloning and sequencing for directed modification target site
As a result.Wherein, WT indicates wildtype gene sequence, and M1, M2 respectively indicate two independent directed modifications as a result, "-" indicates to occur
The sequence of mutation is deleted, "+" indicates that the sequence of insertion mutation has occurred, and the digital representation of "-/+" back is deleted or insertion
The quantity of nucleotide.
The multiple gRNA transcriptional units series connection schematic diagrames of Fig. 5.
Fig. 6 is directed to two different locis of rice endogenous gene OsYSA, the single transcription of CRISPR/Cas9 for constructing and using
Unit expression vector schematic diagram.Wherein: specifically used Pol II type promoter is cauliflower mosaic virus 35 S promoter
(CaMV 35Spromoter)；OsYSA-gRNA1 and OsYSA-gRNA2 clone and transcriptional units separately include can be with specific bond
18~21bp guide RNA unit of target site.
Fig. 7 is based on the single transcriptional units skeleton carrier of CRISPR/Cas9 in the present invention, to rice endogenous gene OsYSA's
Two different locis carry out rite-directed mutagenesis testing result figure simultaneously.Wherein, No. 1 swimming lane is that corresponding OsYSA gene PCR amplification produces
Object, 2, No. 3 swimming lanes are the directed modification result (SfiI digestion resistance band) of OsYSA-gRNA1 induction, and 4, No. 5 swimming lanes are
The directed modification result (EcoNI digestion resistance band) of OsYSA-gRNA2 induction.
Fig. 8 is directed to rice endogenous gene OsYSA polygenic locus, is carried based on the single transcriptional units skeleton of CRISPR/Cas9
Body constructs polygenic locus and knocks out Cas9-gRNA expression vector, after rice transformation protoplast, for directed modification target site
Carry out PCR product cloning and sequencing result.Wherein, WT indicates wildtype gene sequence, and "-" indicates that the sequence for deleting mutation has occurred
Column, "+" indicate that the sequence of insertion mutation has occurred, and the digital representation of "-/+" back is deleted or the quantity of the nucleotide of insertion.
Specific embodiment
The building of the single transcriptional units skeleton carrier of 1 CRISPR/Cas9 of embodiment
The present invention designs a kind of single transcriptional units skeleton carrier of the CRISPR/Cas9 for genome project, core
Unit (can be carried by Pol II type promoter by the single transcriptional units skeleton of AscI, SbfI double digestion basis CRISPR/Cas9
The scheme of body realizes the replacement of different Pol II type promoters), Cas9 encoding histone frame (sequence containing NLS), Poly A sequence,
Ribozyme recognition site (RZ cleavage site), gRNA clone and transcriptional units (including BsaI-ccdB-BsaI unit), core
Enzyme recognition site (RZ cleavage site), ribozyme (holoenzyme) (RiboZyme) are successively constituted.The single transcription of CRISPR/Cas9
Cellular construction and working principle are shown in Fig. 1.
Optionally, skeleton carrier further include: the left and right border sequence of T-DNA, Pol II promoter drive " Cas9-
The single transcription of poly A-RZ cleavage site-gRNA cloning scaffold-RZ cleavage site-RZ " is single
Member is between the left and right boundary the T-DNA；It further include that hygromycin gene expression is single between the left and right border sequence of T-DNA
First (successively constituent element are as follows: 2 × CaMV35S promoter-hygromycin phosphotransferase ORF-CaMV
poly A"；It can be real by the scheme of the single transcriptional units skeleton carrier of AvrII, PacI double digestion basis CRISPR/Cas9
The replacement of existing different resistant gene ORF) it is used as plant transformants selection markers.
It is of the present invention in order to realize quick, the efficient building of specific gene group target Cas9-gRNA expression vector
The single transcriptional units skeleton carrier of CRISPR/Cas9 incorporates the BsaI- of 637bp at 5 ' ends of gRNA transcriptional expression unit
CcdB-BsaI unit is based on this layout strategy, during succeeding target Cas9-gRNA expression vector establishment, it is only necessary to construct
It is complementary that the single transcriptional units skeleton carrier of CRISPR/Cas9 of the present invention, the specific target sequence of annealing are mixed in system
Oligonucleotides double-stranded segment, BsaI restriction endonuclease and T4 DNA ligase, and " 37 DEG C of -16 DEG C of digestion connections " circular response is set,
Effective building of specific Cas9-gRNA expression vector can be realized.The carrier can be using normal in existing molecule clone technology
Rule mode constructs, can be with it should be noted simultaneously that said elements sequence is the unique portion of the backbone plasmid vector
Including general structure possessed by some conventional carriers, it is not repeated in the present invention.
Based on streptococcus pyogenes (Streptococcus pyogenes) Cas9 nuclease protein encoding gene
(Streptococcus pyogenes Cas9, SpCas9) is carried out codon optimization (3 ' end addition NLS signal), artificial synthesized
The complete ORF sequence of Cas9 nuclease protein encoding gene (including the NLS of 3 ' sections), DNA sequence dna is as shown in Seq ID No.2.Into
One step obtains other 3 basic units: a, frag-A (Poly A+ ribozyme recognition site: Seq ID by artificial synthesized mode
Shown in No.8)；B, frag-B (BsaI-ccdB-BsaI unit: shown in Seq ID No.9)；C, frag-B (gRNA transcriptional units+
Ribozyme recognition site+ribozyme holoenzyme: shown in Seq ID No.10).By fusion DNA vaccine mode, successively by Cas9 nuclease protein
ORF, frag-A, frag-B, frag-C are merged, and hold addition SbfI, SacI limitation in fusion DNA vaccine product 5 ', 3 ' respectively
Restriction enzyme site obtains 5013bp assembling unit.It is directed to carrier framework pTC097 (Cermak T, Starker CG, Voytas respectively
DF.Efficient design and assembly of custom TALENs using the Golden Gate
Platform.Methods Molecular Biology, 2005,1239:133-59.) and the progress of 5013bp assembling unit
SbfI, SacI double digestion recycle target fragment, are attached, convert, carry out sequencing confirmation for the positive colony of screening, complete
At the single transcriptional units skeleton carrier construction work of CRISPR/Cas9.
Embodiment 2, the heredity of the fixed point of rice endogenous gene OsYSA based on the single transcriptional units system of CRISPR/Cas9
Modification
1, rice Os YSA gene target gRNA design and the building of Cas9-gRNA recombinant expression carrier
It is reference sequences according to rice Os YSA sequence (NCBI NM001057140), respectively according to 365bp-387bp
(CCGCTTCGGCCGAGGTGGCGCGC, underscore are PAM structure) and 571bp-593bp
(CCTCATGAAGGTGCTCGTCGCGG, underscore are PAM structure) region, design OsYSA-gRNA1, OsYSA-gRNA2 (table
1)。
1 rice Os YSA gene gRNA of table design, synthesis and detection information
According to the site OsYSA-gRNA1, OsYSA-gRNA2 nucleic acid sequence of design, artificial synthesized corresponding forward and reverse widow
Nucleotide chain, particular sequence is following, and (capitalization base sequence represents the sequence that PAM structure is removed in the site gRNA of design；Small letter
Base sequence represents the cohesive end sequence complementary with skeleton carrier):
OsYSA-gRNA1-F:cggaGCGCGCCACCTCGGCCGAAG
OsYSA-gRNA1-R:aaacCTTCGGCCGAGGTGGCGCGC
OsYSA-gRNA2-F:cggaCCGCGACGAGCACCTTCATG
OsYSA-gRNA2-R:aaacCATGAAGGTGCTCGTCGCGG
OsYSA-gRNA1-F/R and OsYSA-gRNA-2-F/R equal proportion is mixed respectively, boiling water bath 10min, then certainly
So cooling annealing forms the double-stranded DNA with cohesive end, the Insert Fragment as building recombinant vector.In 200uL PCR pipe
The single transcription skeleton carrier of middle addition CRISPR/Cas9, viscous end Insert Fragment, BsaI restriction endonuclease, T4 DNA ligase, setting
" 37 DEG C of -16 DEG C of digestion connections " 10 circular responses take reaction product to carry out large intestine after 80 DEG C of processing inactivate inscribes and ligase
Agrobacterium-transformation.Positive transformant is identified by kanamycin resistance screening, bacterium colony PCR and digestion, eventually by through sequence verification
Corresponding Cas9-gRNA expression vector is obtained, pTX171::OsYSA-gRNA1, pTX171::OsYSA-gRNA2 are respectively designated as.
2, pTX171::OsYSA-gRNA1, pTX171::OsYSA-gRNA2 expression vector are converted in rice protoplast
Separating rice OryzasativaLcv.Nipponbare protoplast, be based on PEG method, respectively carry out pTX171::OsYSA-gRNA1,
The rice protoplast of pTX171::OsYSA-gRNA2 expression vector converts.Rice protoplast converts detailed process with reference to text
Offer 1:Sheen, J.Signal transduction in maize and Arabidopsis mesophyll
Protoplasts.Plant Physiology (2001) and document 2:Zahng, Y.et al.Transcription
activator-like effector nucleases enable efficient plant genome
Experimental method disclosed in engineering.Plant Physiology (2013).
3, rice Os YSA gene orientation genetic modification result detection
Rice protoplast conversion after, 25 DEG C dark culture 48 hours, collect transformed cells, CTAB method extract rice it is primary
Plastid genome DNA, using the DNA as template, carry out PCR amplification and restriction enzyme verifying analysis (OsYSA-gRNA1,
OsYSA-gRNA2 respectively corresponds SfiI, EcoNI and carries out digestion detection), specific method bibliography: Zhang, Y.et
al.Transcription activator-like effector nucleases enable efficient plant
Experimental method disclosed in genome engineering.Plant Physiology (2013).Experiment analysis results see Fig. 3 a,
3b and Fig. 4.The result shows that at the site OsYSA-gRNA1, OsYSA-gRNA2, rice endogenous sequence is oriented by Fig. 3 a, 3b
Shearing mutation, with the mutation efficiency that software calculates is respectively 28.9%, 34.8% according to band intensity；For No. 3 in Fig. 3 a, 3b
Swimming lane restriction enzyme resistance band is recycled, and carries out TA clone and sequencing, and sequencing result is shown in that Fig. 4, sequencing result show
Base mutation has occurred in the site OsYSA-gRNA1, OsYSA-gRNA2.
Embodiment 3, the heredity of the fixed point of rice endogenous gene OsPDS based on the single transcriptional units system of CRISPR/Cas9
Modification
1, rice Os PDS gene target gRNA design and pCas9-gRNA expression vector establishment
It is reference sequences according to rice Os PDS sequence (NCBI NM001055721), according to 1290bp-1312bp
(GTTGGTCTTTGCTCCTGCAGAGG, underscore is PAM structure) and region, it designs OsPDS-gRNA2 (table 2).
2 rice Os PDS gene gRNA of table design, synthesis and detection information
According to the site the OsPDS-gRNA2 nucleic acid sequence of design, artificial synthesized corresponding forward and reverse oligonucleotide chain, tool
Body sequence is following, and (capitalization base sequence represents the sequence that PAM structure is removed in the site gRNA of design；Small letter base sequence represents
The cohesive end sequence complementary with skeleton carrier):
OsPDS-gRNA2-F:cggaGTTGGTCTTTGCTCCTGCAG
OsPDS-gRNA2-R:aaacCTGCAGGAGCAAAGACCAAC
OsPDS-gRNA2-F/R equal proportion is mixed respectively, boiling water bath 10min, then Temperature fall is annealed, and formation has
The double-stranded DNA of cohesive end, the Insert Fragment as building recombinant vector.It is mono- that CRISPR/Cas9 is added in 200uL PCR pipe
One transcription skeleton carrier, viscous end Insert Fragment, BsaI restriction endonuclease, T4 DNA ligase, setting " 37 DEG C of -16 DEG C of digestion connections "
10 circular responses take reaction product to carry out Escherichia coli conversion after 80 DEG C of processing inactivate inscribes and ligase.By card, that is mould
Positive transformant is identified in plain resistance screening, bacterium colony PCR and digestion, obtains corresponding Cas9-gRNA table eventually by through sequence verification
Up to carrier, it is named as pTX171::OsPDS-gRNA2.
2, pTX171::OsPDS-gRNA2 expression vector is converted in rice protoplast
Separating rice OryzasativaLcv.Nipponbare protoplast is based on PEG method, carries out pTX171::OsPDS-gRNA2 expression vector
Rice protoplast conversion.Rice protoplast converts detailed process bibliography 1:Sheen, J.Signal
transduction in maize and Arabidopsis mesophyll protoplasts.Plant Physiology
(2001) and document 2:Zhang, Y.et al.Transcription activator-like effector nucleases
It is tested disclosed in enable efficient plant genome engineering.Plant Physiology (2013)
Method.
3, rice Os PDS gene orientation genetic modification result detection
Rice protoplast conversion after, 25 DEG C dark culture 48 hours, collect transformed cells, CTAB method extract rice it is primary
Plastid genome DNA, using the DNA as template, (OsPDS-gRNA2 is corresponding for progress PCR amplification and restriction enzyme verifying analysis
HindIII carries out digestion detection), specific method bibliography: Zahng, Y.et al.Transcription activator-
like effector nucleases enable efficient plant genome engineering.Plant
Experimental method disclosed in Physiology (2013).Experiment analysis results are shown in Fig. 3 c and Fig. 4.Fig. 3 c is the result shows that in OsPDS-
At the site gRNA2, orientation shearing mutation is had occurred in rice endogenous sequence, is with the mutation efficiency that software calculates according to band intensity
11.1%；It is recycled for No. 3 swimming lane restriction enzyme resistance bands in Fig. 3 c, and carries out TA clone and sequencing, sequencing result is shown in
Fig. 4, sequencing result show that base mutation has occurred in the site OsPDS-gRNA2.
Embodiment 4, the heredity of the fixed point of rice endogenous gene OsMPK2 based on the single transcriptional units system of CRISPR/Cas9
Modification
1, rice Os MPK2 gene target gRNA design and Cas9-gRNA expression vector establishment
It is reference sequences according to rice Os MPK2 sequence (NCBI NM001067563), according to 65bp-86bp (GCG
GCGGCCATGGCCATCACGG, underscore is PAM structure) and region, it designs OsMPK2-gRNA (table 3).
3 rice Os MPK2 gene gRNA of table design, synthesis and detection information
According to the site the OsMPK2-gRNA nucleic acid sequence of design, artificial synthesized corresponding forward and reverse oligonucleotide chain, tool
Body sequence is following, and (capitalization base sequence represents the sequence that PAM structure is removed in the site gRNA of design；Small letter base sequence represents
The cohesive end sequence complementary with skeleton carrier):
OsMPK2-gRNA-F:cggaGCGGCGGCCATGGCCATCA
OsMPK2-gRNA-R:aaacTGATGGCCATGGCCGCCGC
OsMPK2-gRNA-F/R equal proportion is mixed respectively, boiling water bath 10min, then Temperature fall is annealed, and formation has
The double-stranded DNA of cohesive end, the Insert Fragment as building recombinant vector.It is mono- that CRISPR/Cas9 is added in 200uL PCR pipe
One transcription skeleton carrier, viscous end Insert Fragment, BsaI restriction endonuclease, T4 DNA ligase, setting " 37 DEG C of -16 DEG C of digestion connections "
10 circular responses take reaction product to carry out Escherichia coli conversion after 80 DEG C of processing inactivate inscribes and ligase.By card, that is mould
Positive transformant is identified in plain resistance screening, bacterium colony PCR and digestion, obtains corresponding Cas9-gRNA table eventually by through sequence verification
Up to carrier, it is named as pTX171::OsMPK2-gRNA.
2, pTX171::OsMPK2-gRNA expression vector is converted in rice protoplast
Separating rice OryzasativaLcv.Nipponbare protoplast is based on PEG method, carries out pTX171::OsMPK2-gRNA expression vector
Rice protoplast conversion.Rice protoplast converts detailed process bibliography 1:Sheen, J.Signal
transduction in maize and Arabidopsis mesophyll protoplasts.Plant Physiology
(2001) and document 2:Zhang, Y.et al.Transcription activator-like effector nucleases
It is tested disclosed in enable efficient plant genome engineering.Plant Physiology (2013)
Method.
3, rice Os MPK2 gene orientation genetic modification result detection
Rice protoplast conversion after, 25 DEG C dark culture 48 hours, collect transformed cells, CTAB method extract rice it is primary
Plastid genome DNA, using the DNA as template, (OsMPK2-gRNA is corresponding for progress PCR amplification and restriction enzyme verifying analysis
MscI carries out digestion detection), specific method bibliography: Zahng, Y.et al.Transcription activator-like
effector nucleases enable efficient plant genome engineering.Plant Physiology
(2013) experimental method disclosed in.Experiment analysis results are shown in Fig. 3 d and Fig. 4: Fig. 3 d the result shows that in the site OsMPK2-gRNA
Orientation shearing mutation has occurred in place, rice endogenous sequence, is 10.5% according to the mutation efficiency that band intensity software calculates；Needle
No. 3 swimming lane restriction enzyme resistance bands in Fig. 3 d are recycled, and carry out TA clone and sequencing, sequencing result is shown in Fig. 4, sequencing knot
Fruit shows that base mutation has occurred in the site OsMPK2-gRNA.
Embodiment 5, the heredity of the fixed point of rice endogenous gene OsROC5 based on the single transcriptional units system of CRISPR/Cas9
Modification
1, rice Os ROC5 gene target gRNA design and Cas9-gRNA expression vector establishment
It is reference sequences according to rice Os ROC5 sequence (NCBI NM001054253), according to 647bp-669bp
(GCGGAGAACGACAGCCGGTCGGG, underscore is PAM structure) and region, it designs OsROC5-gRNA (table 4).
4 rice Os ROC5 gene gRNA of table design, synthesis and detection information
According to the site the OsROC5-gRNA nucleic acid sequence of design, artificial synthesized corresponding forward and reverse oligonucleotide chain, tool
Body sequence is following, and (capitalization base sequence represents the sequence that PAM structure is removed in the site gRNA of design；Small letter base sequence represents
The cohesive end sequence complementary with skeleton carrier):
OsROC5-gRNA-F:cggaGCGGAGAACGACAGCCGGTC
OsROC5-gRNA-R:aaacGACCGGCTGTCGTTCTCCGC
OsROC5-gRNA-F/R equal proportion is mixed respectively, boiling water bath 10min, then Temperature fall is annealed, and formation has
The double-stranded DNA of cohesive end, the Insert Fragment as building recombinant vector.It is mono- that CRISPR/Cas9 is added in 200uL PCR pipe
One transcription skeleton carrier, viscous end Insert Fragment, BsaI restriction endonuclease, T4 DNA ligase, setting " 37 DEG C of -16 DEG C of digestion connections "
10 circular responses take reaction product to carry out Escherichia coli conversion after 80 DEG C of processing inactivate inscribes and ligase.By card, that is mould
Positive transformant is identified in plain resistance screening, bacterium colony PCR and digestion, obtains corresponding Cas9-gRNA table eventually by through sequence verification
Up to carrier, it is named as pTX171::OsROC5-gRNA.
2, pTX171::OsROC5-gRNA expression vector is converted in rice protoplast
Separating rice OryzasativaLcv.Nipponbare protoplast is based on PEG method, carries out pTX171::OsROC5-gRNA expression vector
Rice protoplast conversion.Rice protoplast converts detailed process bibliography 1:Sheen, J.Signal
transduction in maize and Arabidopsis mesophyll protoplasts.Plant Physiology
(2001) and document 2:Zhang, Y.et al.Transcription activator-like effector nucleases
It is tested disclosed in enable efficient plant genome engineering.Plant Physiology (2013)
Method.
3, rice Os ROC5 gene orientation genetic modification result detection
Rice protoplast conversion after, 25 DEG C dark culture 48 hours, collect transformed cells, CTAB method extract rice it is primary
Plastid genome DNA, using the DNA as template, (OsROC5-gRNA is corresponding for progress PCR amplification and restriction enzyme verifying analysis
AhdI carries out digestion detection), specific method bibliography: Zahng, Y.et al.Transcription activator-like
effector nucleases enable efficient plant genome engineering.Plant Physiology
(2013) experimental method disclosed in.Experiment analysis results are shown in Fig. 3 e and Fig. 4.Fig. 3 e is the result shows that in the site OsROC5-gRNA
Orientation shearing mutation has occurred in place, rice endogenous sequence, is 26.7% according to the mutation efficiency that band intensity software calculates；Needle
No. 3 swimming lane restriction enzyme resistance bands in Fig. 3 e are recycled, and carry out TA clone and sequencing, sequencing result is shown in Fig. 4, sequencing knot
Fruit shows that base mutation has occurred in the site OsROC5-gRNA.
Embodiment 6, the rice endogenous gene OsYSA multidigit point based on the single transcriptional units system of CRISPR/Cas9 are simultaneously
Pinpoint genetic modification
1, rice Os YSA gene multidigit point target gRNA design and the building of Cas9-gRNA recombinant expression carrier
It is reference sequences according to rice Os YSA sequence (NCBI NM001057140), respectively according to 365bp-387bp
(CCGCTTCGGCCGAGGTGGCGCGC, underscore are PAM structure) and 571bp-593bp
(CCTCATGAAGGTGCTCGTCGCGG, underscore are PAM structure) region, design OsYSA-gRNA1, OsYSA-gRNA2 (table
5)。
5 rice Os YSA gene gRNA of table design, synthesis and detection information
According to the site OsYSA-gRNA1, OsYSA-gRNA2 nucleic acid sequence of design, artificial synthesized corresponding forward and reverse widow
Nucleotide chain, particular sequence is following, and (capitalization base sequence represents the sequence that PAM structure is removed in the site gRNA of design；Small letter
Base sequence represents the cohesive end sequence complementary with skeleton carrier):
OsYSA-gRNA1-F:cggaGCGCGCCACCTCGGCCGAAG
OsYSA-gRNA1-R:aaacCTTCGGCCGAGGTGGCGCGC
OsYSA-gRNA2-F:cggaCCGCGACGAGCACCTTCATG
OsYSA-gRNA2-R:aaacCATGAAGGTGCTCGTCGCGG
OsYSA-gRNA1-F/R and OsYSA-gRNA-2-F/R difference equal proportion is mixed, boiling water bath 10min, then certainly
So cooling annealing forms the double-stranded DNA with cohesive end, the Insert Fragment as building recombinant vector.In 200uL PCR pipe
The single transcription skeleton carrier (Fig. 5) of middle addition CRISPR/Cas9, two viscous end Insert Fragments, BsaI restriction endonuclease, T4 DNA connect
Enzyme is connect, 10 circular responses of setting " 37 DEG C of -16 DEG C of digestion connections ", after 80 DEG C of processing inactivate inscribes and ligase, negating should be produced
Object carries out Escherichia coli conversion.Positive transformant is identified by kanamycin resistance screening, bacterium colony PCR and digestion, eventually by
Corresponding Cas9-gRNA expression vector is obtained through sequence verification, is named as pTX171::OsYSA-gRNA1-gRNA2 (Fig. 6).
2, pTX171::OsYSA-gRNA1-gRNA2 expression vector is converted in rice protoplast
Separating rice OryzasativaLcv.Nipponbare protoplast is based on PEG method, carries out pTX171::OsYSA-gRNA1-gRNA2 respectively
The rice protoplast of expression vector converts.Rice protoplast converts detailed process bibliography 1:Sheen, J.Signal
transduction in maize and Arabidopsis mesophyll protoplasts.Plant Physiology
(2001) and document 2:Zhang, Y.et al.Transcription activator-like effector nucleases
It is tested disclosed in enable efficient plant genome engineering.Plant Physiology (2013)
Method.
3, rice Os YSA gene multidigit point orients the detection of genetic modification result simultaneously
Rice protoplast conversion after, 25 DEG C dark culture 48 hours, collect transformed cells, CTAB method extract rice it is primary
Plastid genome DNA, using the DNA as template, carry out PCR amplification and restriction enzyme verifying analysis (OsYSA-gRNA1,
OsYSA-gRNA2 respectively corresponds SfiI, EcoNI and carries out digestion detection), specific method bibliography: Zahng, Y.et
al.Transcription activator-like effector nucleases enable efficient plant
Experimental method disclosed in genome engineering.Plant Physiology (2013).Experiment analysis results see Fig. 7,
Fig. 8.For Fig. 7 the result shows that at the site OsYSA-gRNA1, OsYSA-gRNA2, it is prominent that orientation shearing has occurred in rice endogenous sequence
Become；It is recycled respectively for resistance band in Fig. 7 swimming lane 2,3 and 4,5, and carries out TA clone and sequencing, sequencing result is shown in figure
8, sequencing result shows to be mutated in the site OsYSA-gRNA1, OsYSA-gRNA2.
Claims (9)
- The single transcriptional units skeleton carrier of 1.CRISPR/Cas9, Cas9 and guide RNA core cell are regulated and controled by a promoter Transcription, the promoter be II type promoter of Pol, from 5 ' to the 3 ' direction of core cell is followed successively by Cas9 ORF- Poly A-RZ cleavage site-gRNA cloning scaffold-RZ cleavage site-RZ, and gRNA Cloning scaffold is at least one, is RZ cleavage site between gRNA cloning scaffold；Wherein, Cas9ORF, that is, Cas9 encoding histone frame, RZ cleavage site, that is, ribozyme identify cleavage site, gRNA cloning Scaffold, that is, gRNA clone and transcriptional units, RZ, that is, ribozyme holoenzyme.
- 2. skeleton carrier as described in claim 1, it is characterised in that: gRNA is cloned and transcriptional units are 1~5.
- 3. skeleton carrier as described in claim 1, it is characterised in that: Cas9 encoding histone frame also includes nuclear localization signal NLS Sequence has the amino acid sequence as shown in Seq ID No.1.
- 4. skeleton carrier as claimed in claim 1, it is characterised in that: gRNA clone and transcriptional units have as in Seq ID No.3 Shown in nucleotide sequence.
- 5. skeleton carrier as claimed in claim 1, it is characterised in that: the ribozyme of the ribozyme holoenzyme and corresponding identification identifies cutting Site is used cooperatively in the following manner:Ribozyme holoenzyme is replaced, while corresponding replacement ribozyme identifies cleavage site, and replaced ribozyme identifies cleavage Ribozyme holoenzyme identification after point is replaced is cut.
- 6. skeleton carrier as claimed in claim 5, it is characterised in that: the ribozyme holoenzyme is hammerhead ribozyme, coding Nucleotide sequence sequence as shown in Seq ID No.6.
- 7. skeleton carrier as claimed in claim 6, it is characterised in that: the ribozyme identification cleavage site is by hammerhead ribozyme Identification cutting, nucleotide sequence is as shown in Seq ID No.5.
- 8. skeleton carrier as described in claim 1, it is characterised in that: the Cas9ORF-poly A-RZ cleavage Site-gRNA cloning scaffold-RZ cleavage site-RZ has the nucleotides sequence as shown in Seq ID No.7 Column.
- 9. skeleton carrier as described in any one of claims 1 to 8, it is characterised in that: the II type promoter of Pol is flower coconut palm It is dish mosaic virus 35 S promoter CaMV35S, corn Ubi1 promoter ZmUbi1, arabidopsis Ubi10 promoter AtUbi10, big and small Cellular virus CMV, Heat shock protein 70 promoter hsP70 or 40 promoter SV40 of vacuolating virus of monkey.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510397341.1A CN105132451B (en) | 2015-07-08 | 2015-07-08 | A kind of single transcriptional units directed modification skeleton carrier of CRISPR/Cas9 and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510397341.1A CN105132451B (en) | 2015-07-08 | 2015-07-08 | A kind of single transcriptional units directed modification skeleton carrier of CRISPR/Cas9 and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105132451A CN105132451A (en) | 2015-12-09 |
| CN105132451B true CN105132451B (en) | 2019-07-23 |
Family
ID=54718019
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510397341.1A Active CN105132451B (en) | 2015-07-08 | 2015-07-08 | A kind of single transcriptional units directed modification skeleton carrier of CRISPR/Cas9 and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105132451B (en) |
Families Citing this family (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US20150044192A1 (en) | 2013-08-09 | 2015-02-12 | President And Fellows Of Harvard College | Methods for identifying a target site of a cas9 nuclease |
| US9359599B2 (en) | 2013-08-22 | 2016-06-07 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US9340799B2 (en) | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | MRNA-sensing switchable gRNAs |
| US9388430B2 (en) | 2013-09-06 | 2016-07-12 | President And Fellows Of Harvard College | Cas9-recombinase fusion proteins and uses thereof |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| EP3177718B1 (en) | 2014-07-30 | 2022-03-16 | President and Fellows of Harvard College | Cas9 proteins including ligand-dependent inteins |
| EP3365356B1 (en) | 2015-10-23 | 2023-06-28 | President and Fellows of Harvard College | Nucleobase editors and uses thereof |
| CN105349575B (en) * | 2015-12-14 | 2019-06-25 | 电子科技大学 | A kind of building of rice RNAi skeleton carrier and application based on artificial tasiRNA approach |
| GB2568182A (en) | 2016-08-03 | 2019-05-08 | Harvard College | Adenosine nucleobase editors and uses thereof |
| AU2017308889B2 (en) | 2016-08-09 | 2023-11-09 | President And Fellows Of Harvard College | Programmable Cas9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| KR102622411B1 (en) | 2016-10-14 | 2024-01-10 | 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 | AAV delivery of nucleobase editor |
| WO2018119359A1 (en) | 2016-12-23 | 2018-06-28 | President And Fellows Of Harvard College | Editing of ccr5 receptor gene to protect against hiv infection |
| AU2018208463A1 (en) | 2017-01-10 | 2019-08-01 | Christina Care Gene Editing Institute, Inc. | Methods for in vitro site-directed mutagenesis using gene editing technologies |
| CN107012164B (en) * | 2017-01-11 | 2023-03-03 | 电子科技大学 | CRISPR/Cpf1 plant genome directed modification functional unit, vector containing functional unit and application of functional unit |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| WO2018165629A1 (en) | 2017-03-10 | 2018-09-13 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| EP3601562A1 (en) | 2017-03-23 | 2020-02-05 | President and Fellows of Harvard College | Nucleobase editors comprising nucleic acid programmable dna binding proteins |
| WO2018209320A1 (en) | 2017-05-12 | 2018-11-15 | President And Fellows Of Harvard College | Aptazyme-embedded guide rnas for use with crispr-cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| EP3676376A2 (en) | 2017-08-30 | 2020-07-08 | President and Fellows of Harvard College | High efficiency base editors comprising gam |
| KR20200121782A (en) | 2017-10-16 | 2020-10-26 | 더 브로드 인스티튜트, 인코퍼레이티드 | Uses of adenosine base editor |
| CN111057717B (en) * | 2018-10-16 | 2022-12-23 | 青岛华大基因研究院 | Method for rapidly preparing gRNA expression vector capable of being directly used and application thereof |
| CN110607320B (en) * | 2018-11-23 | 2023-05-12 | 电子科技大学 | Plant genome directional base editing framework vector and application thereof |
| BR112021018606A2 (en) | 2019-03-19 | 2021-11-23 | Harvard College | Methods and compositions for editing nucleotide sequences |
| DE112021002672T5 (en) | 2020-05-08 | 2023-04-13 | President And Fellows Of Harvard College | METHODS AND COMPOSITIONS FOR EDIT BOTH STRANDS SIMULTANEOUSLY OF A DOUBLE STRANDED NUCLEOTIDE TARGET SEQUENCE |
| CN114540406B (en) * | 2020-11-26 | 2023-09-29 | 电子科技大学 | Genome editing expression frame, vector and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103981215A (en) * | 2014-05-23 | 2014-08-13 | 安徽省农业科学院水稻研究所 | Backbone plasmid carrier for genetic engineering and application thereof |
| WO2015004241A2 (en) * | 2013-07-10 | 2015-01-15 | Novartis Ag | Multiple proteases deficient filamentous fungal cells and methods of use thereof |
| CN104745626A (en) * | 2014-12-19 | 2015-07-01 | 中国航天员科研训练中心 | Rapid construction method and applications of conditional gene knockout animal model |
| CN106852157A (en) * | 2014-06-16 | 2017-06-13 | 约翰斯·霍普金斯大学 | Composition and method for expressing guide CRISPR RNA using H1 promoters |
-
2015
- 2015-07-08 CN CN201510397341.1A patent/CN105132451B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015004241A2 (en) * | 2013-07-10 | 2015-01-15 | Novartis Ag | Multiple proteases deficient filamentous fungal cells and methods of use thereof |
| CN103981215A (en) * | 2014-05-23 | 2014-08-13 | 安徽省农业科学院水稻研究所 | Backbone plasmid carrier for genetic engineering and application thereof |
| CN106852157A (en) * | 2014-06-16 | 2017-06-13 | 约翰斯·霍普金斯大学 | Composition and method for expressing guide CRISPR RNA using H1 promoters |
| CN104745626A (en) * | 2014-12-19 | 2015-07-01 | 中国航天员科研训练中心 | Rapid construction method and applications of conditional gene knockout animal model |
Non-Patent Citations (1)
| Title |
|---|
| Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing;Yangbin Gao et al.;《Journal of Integrative Plant Biology》;20140306;第56卷(第4期);摘要，第343页左栏第1段至第347页右栏第3段，图3 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105132451A (en) | 2015-12-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105132451B (en) | A kind of single transcriptional units directed modification skeleton carrier of CRISPR/Cas9 and its application | |
| Mao et al. | Gene editing in plants: progress and challenges | |
| Jacobs et al. | Targeted genome modifications in soybean with CRISPR/Cas9 | |
| Castel et al. | Optimization of T-DNA architecture for Cas9-mediated mutagenesis in Arabidopsis | |
| Ma et al. | CRISPR/Cas9 platforms for genome editing in plants: developments and applications | |
| Luo et al. | Applications of CRISPR/Cas9 technology for targeted mutagenesis, gene replacement and stacking of genes in higher plants | |
| Jia et al. | Targeted genome editing of sweet orange using Cas9/sgRNA | |
| CN107012164A (en) | CRISPR/Cpf1 Plant Genome directed modifications functional unit, the carrier comprising the functional unit and its application | |
| CN105112435B (en) | The building and application of plant polygenes knockout carrier | |
| Hou et al. | An open-source system for in planta gene stacking by Bxb1 and Cre recombinases | |
| CN109136248B (en) | Multi-target editing vector and construction method and application thereof | |
| Kumar et al. | Transgene repeats in aspen: molecular characterisation suggests simultaneous integration of independent T-DNAs into receptive hotspots in the host genome | |
| CN107667171A (en) | Fungal gene group modification system and application method | |
| CN104846010A (en) | Method for deleting selection marker gene of transgenic rice | |
| Hsu et al. | Application of Cas12a and nCas9-activation-induced cytidine deaminase for genome editing and as a non-sexual strategy to generate homozygous/multiplex edited plants in the allotetraploid genome of tobacco | |
| CN110157726A (en) | The method of Plant Genome fixed point replacement | |
| CN108034671B (en) | Plasmid vector and method for establishing plant population by using same | |
| CN110607320B (en) | Plant genome directional base editing framework vector and application thereof | |
| CN110747187B (en) | Cas12a protein for identifying TTTV and TTV double-PAM sites, plant genome directed editing vector and method | |
| Lin et al. | Genome editing in plants with MAD7 nuclease | |
| CN103981215A (en) | Backbone plasmid carrier for genetic engineering and application thereof | |
| WO2018098935A1 (en) | Vector for plant genome site-directed base substitution | |
| CN111902541A (en) | Method for increasing expression level of nucleic acid molecule of interest in cell | |
| CN104450745A (en) | Method for acquiring specific rice gene mutant and application thereof | |
| CN113846075A (en) | MAD7-NLS fusion protein, nucleic acid construct for site-directed editing of plant genome and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |