CN106282241A - The method obtaining knocking out the Brachydanio rerio of bmp2a gene by CRISPR/Cas9 - Google Patents

The method obtaining knocking out the Brachydanio rerio of bmp2a gene by CRISPR/Cas9 Download PDF

Info

Publication number
CN106282241A
CN106282241A CN201610637401.7A CN201610637401A CN106282241A CN 106282241 A CN106282241 A CN 106282241A CN 201610637401 A CN201610637401 A CN 201610637401A CN 106282241 A CN106282241 A CN 106282241A
Authority
CN
China
Prior art keywords
brachydanio rerio
grna
cas9
sudden change
bmp2a
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610637401.7A
Other languages
Chinese (zh)
Inventor
姜宇
朱国兴
仲兆民
杨健
易利华
徐又佳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wuxi No 2 Peoples Hospital
Original Assignee
Wuxi No 2 Peoples Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wuxi No 2 Peoples Hospital filed Critical Wuxi No 2 Peoples Hospital
Priority to CN201610637401.7A priority Critical patent/CN106282241A/en
Publication of CN106282241A publication Critical patent/CN106282241A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/89—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microinjection
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0276—Knock-out vertebrates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/461—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from fish
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/40—Fish
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Environmental Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses and obtain, by CRISPR/Cas9, the method that knocks out the Brachydanio rerio of bmp2a gene, devise new gRNA sequence, design is BMP2a first between exon and intron, and gRNA sequence is GGAGCCCATCACTAGACTCTTGG, and enzyme action is HinfI.The features such as knock out compared with the technology of gene with tradition, it is little that CRISPR/Cas9 technology has toxicity, and accuracy is high, and efficiency is high, and the success cycle is short；So in theory so that BMP2a gene faster must be knocked.

Description

The method obtaining knocking out the Brachydanio rerio of bmp2a gene by CRISPR/Cas9
Technical field
The method that the present invention relates to obtain knocking out the Brachydanio rerio of bmp2a gene by CRISPR/Cas9.
Background technology
A kind of adaptive immunity defence that CRISPR/Cas9 is antibacterial and archeobacteria is formed during long-term evolution, can It is used for resisting virus and the foreign DNA of invasion.CRISPR/Cas9 system is by by invasion phage and the fragment of plasmid DNA It is incorporated in CRISPR, and utilizes corresponding CRISPR RNAs(crRNAs) instruct the degraded of homologous sequence, thus immunity is provided Property.The operation principle of this system is crRNA(CRISPR-derived RNA) by base pairing and tracrRNA(trans- Activating RNA) combine formed tracrRNA/crRNA complex, this complex guide nuclease Cas9 albumen with The sequence target site of crRNA pairing shears double-stranded DNA.And by engineer's both RNA, formation can be transformed and have and draw Lead the sgRNA(short guide RNA of effect), it is sufficient to guide Cas9 that the fixed point of DNA is cut.Guide as a kind of RNA DsDNA associated proteins, Cas9 effector nuclease is known first unified factor (unifying factor), it is possible to altogether Location RNA, DNA and albumen, thus have huge transformation potentiality.Cas9(Cas9 by albumen Yu nuclease free Nuclease-null) merge, and express suitable sgRNA, any dsDNA sequence can be targeted, and RNA may be connected to The end of sgRNA, does not affect the combination of Cas9.Therefore, Cas9 can bring at any dsDNA sequence any fusion protein and RNA, this is the research of organism and transformation brings great potential.Gene technology is struck, CRISPR/ compared to traditional Talens etc. Cas9 has higher efficiency, more convenient operation, and advantage is as follows:
1, it is only necessary to synthesizing a sgRNA and can be achieved with the modification of the specificity to gene, Cas albumen does not have specificity.
2, the sequence of coding sgRNA is less than 100bp, therefore more simple and convenient than building TALENs and ZFNs.
3, the complication that the TALENs code carrier that shorter sgRNA sequence it also avoid overlength, height repeats brings.
Chinese patent 201510582860.5 discloses one and obtains knocking out Hepcidin-gene by CRISPR/Cas9 technology The preparation method of Brachydanio rerio.So can utilize CRISPR/Cas9 technology, one section of PAM district that design is unique so that in Brachydanio rerio BMP2a gene knocked out by perfection, the most " do not accidentally injure " other genes, form the Brachydanio rerio that the first BMP2a knocks out in the world？
Knock out model animal Brachydanio rerio significant of transgenic as the first BMP2a, BMP2a be regulation and control ferrum main because of Element, is once knocked, i.e. success animal mould becomes the model animal that ferrum transships, and can get rid of anthropic factor intervention, for research ferrum Expression study significant.
Summary of the invention
The technical problem to be solved in the present invention is to provide the Brachydanio rerio obtaining knocking out bmp2a gene by CRISPR/Cas9.
In order to solve above-mentioned technical problem, the present invention provides following technical scheme.
The method being obtained by CRISPR/Cas9 knocking out the Brachydanio rerio of bmp2a gene, is comprised the steps:
(1) devising new gRNA sequence, design is BMP2a first between exon and intron, and gRNA sequence is GGAGCCCATCACTAGACTCTTGG, enzyme action is HinfI；
(2) designing and synthesizing gRNA primer, primer is shown in Table 1:
The primer sequence of table 1 CAS9BMP2a is the P3 of design:
Forward sequence (5’to3’):CCTCTTCAACCTGACCTCCA；
Reverse sequence (5’to 3’):GTCCGTCTGTGGTCCACTTT；
P3:GATCACTAATACGACTCACTATAGGAGCCCATCACTAGACTCTGTTTTAGAGC TAGAAAT；
P4:AAAAGCACCGACTCGGTGCC；
GRNA sequence GGAGCCCATCACTAGACTCTTGG；
(3) primer of design being carried out PCR, PCR system is as follows:
gRNA- plasmid 10 ng；
P3 1 ul(10 pmol)；
P4 1 ul(10 pmol)；
Buffer 10；
dNTP 8；
KOD 0.5；
ddH2O Up to 100 ul；
PCR reaction condition is: 95 DEG C of denaturations 3min, enters three steps circulations (95 DEG C of-20s, 58 DEG C of-20s, 72 DEG C of-20s totally 30 Individual circulation), then 72 DEG C of-10min, finally it is incubated at 16 DEG C；After electrophoresis detection PCR primer, it is purified；
(4) under the conditions of RNA-Free, gRNA being carried out in vitro transcription, system is:
2.5mmol/L NTP 4ul；
10× Reaction Buffer 2ul；
Template DNA 1 1ug(<6ul)；
T7 Enzyme Mix 2ul；
DEPC Water up to 20ul ；
gRNA 12.5(ng/ul)；
Cas9 300(ng/ul)；
Tris-Hcl 0.2ul；
Phenol-red 0.2ul；
DEPC Water up to 2ul ；
37 ° of C of above system, 1 hour reaction is complete, is then purified；
(5) being expelled in single celled zebrafish embryo by the mRNA of aforementioned purification, extract RNA after 4 days, transcription DNA is carried out Order-checking detection；Injection system is as follows:
gRNA 12.5(ng/ul)；
Cas9 300(ng/ul)；
Tris-Hcl 0.2ul；
Phenol-red 0.2ul；
DEPC Water up to 2ul；
After (6) three months after sexual maturity, by the Brachydanio rerio hybridization of the Brachydanio rerio of sudden change with wild type, obtain the heterozygosis of certain probability Son, will carry out RNA extraction and is transcribed into DNA and send order-checking to check whether sudden change after embryo, DNA at this time is also It it is double-strand；Then after cDNA with the 19T carrier finding the Brachydanio rerio of sudden change after order-checking being connected, by it in culture medium Middle ball chart board, after 12-14 hour, the plasmid connected can be grown up with spotwise, after being chosen speckle, obtains It is the DNA of strand, again send order-checking, finally give the sudden change of strand, then cultivated sexual maturity after growing up three months After, by the Brachydanio rerio hybridization of the Brachydanio rerio of sudden change with wild type, check whether sudden change after obtaining embryo, by the Brachydanio rerio of sudden change Support after choosing monoclonal order-checking；
(7), after three months after sexual maturity, the milter that the sudden change of the second filial generation is grown up excises tail again with raun, reflects Fixed, refer to step (6), obtain the Brachydanio rerio copulation again of identical mutation (lacking several base), thus the BMP2a that obtains isozygotying strikes The Brachydanio rerio removed.
Comprise the steps: as the purification process in the present invention one optimal technical scheme, step (3) and step (4)
(A) adding water and the phenol/chloroform/isopropanol that volume is 1:2-3, after mixing, 10,000-15,000 rpm is centrifuged 5min. upper strata moves into new pipe, repeats this step once；
(B) upper strata moves into new pipe, adds 150ul chloroform, centrifugal 5 min；
(C) 1/10 volume 2.5 M sodium acetate and 2.5 volume ethanol ,-70C freezing 30min are added；
(D) centrifugal 10,000-15,000rpm is at 4C 15min；
(E) discard solution and stay precipitation, add 200ul 80% ethanol, centrifugal 5 min, discard solution, use 10-20 l after drying DEPC H2O dissolves.
Knock out compared with the technology of gene with tradition, it is little that CRISPR/Cas9 technology has toxicity, and accuracy is high, and efficiency is high, becomes The features such as the merit cycle is short；So in theory so that BMP2a gene faster must be knocked.
Accompanying drawing explanation
Fig. 1 is the cultivation hybridization figure system of the inventive method.
Detailed description of the invention
Detailed description of the invention
This time in embodiment, primer used is the synthesis of Suzhou Jin Weizhi company.Wild-type zebrafish AB strain, Suzhou University's biological clock research center.
Specific experiment process:
Design gRNA site-PCR-purification-in vitro transcription-purification-microinjection-identified activity-raisings is to the most adult-and wild type Copulation-detection embryo of future generation cuts tail after whether carrying mutational site-raisings-adult and identifies Heterozygous mutants-two heterozygote Copulation obtains Mutants homozygous.
The method being obtained by CRISPR/Cas9 knocking out the Brachydanio rerio of bmp2a gene, is comprised the steps:
(1) devising new gRNA sequence, design is BMP2a first between exon and intron, and gRNA sequence is GGAGCCCATCACTAGACTCTTGG, enzyme action is HinfI；
(2) designing and synthesizing gRNA primer, primer is shown in Table 1:
The primer sequence of table 1 CAS9BMP2a is the P3 of design:
Forward sequence (5’to3’):CCTCTTCAACCTGACCTCCA；
Reverse sequence (5’to 3’):GTCCGTCTGTGGTCCACTTT；
P3:GATCACTAATACGACTCACTATAGGAGCCCATCACTAGACTCTGTTTTAGAGC TAGAAAT；
P4:AAAAGCACCGACTCGGTGCC；
GRNA sequence GGAGCCCATCACTAGACTCTTGG；
(3) primer of design being carried out PCR, PCR system is as follows:
gRNA- plasmid 10 ng；
P3 1 ul(10 pmol)；
P4 1 ul(10 pmol)；
Buffer 10；
dNTP 8；
KOD 0.5；
ddH2O Up to 100 ul；
PCR reaction condition is: 95 DEG C of denaturations 3min, enters three steps circulations (95 DEG C of-20s, 58 DEG C of-20s, 72 DEG C of-20s totally 30 Individual circulation), then 72 DEG C of-10min, finally it is incubated at 16 DEG C；After electrophoresis detection PCR primer, it is purified；
(4) under the conditions of RNA-Free, gRNA being carried out in vitro transcription, system is:
2.5mmol/L NTP 4ul；
10× Reaction Buffer 2ul；
Template DNA 1 1ug(<6ul)；
T7 Enzyme Mix 2ul；
DEPC Water up to 20ul ；
gRNA 12.5(ng/ul)；
Cas9 300(ng/ul)；
Tris-Hcl 0.2ul；
Phenol-red 0.2ul；
DEPC Water up to 2ul ；
37 ° of C of above system, 1 hour reaction is complete, is then purified；
(5) being expelled in single celled zebrafish embryo by the mRNA of aforementioned purification, extract RNA after 4 days, transcription DNA is carried out Order-checking detection；Injection system is as follows:
gRNA 12.5(ng/ul)；
Cas9 300(ng/ul)；
Tris-Hcl 0.2ul；
Phenol-red 0.2ul；
DEPC Water up to 2ul；
After (6) three months after sexual maturity, by the Brachydanio rerio hybridization of the Brachydanio rerio of sudden change with wild type, obtain the heterozygosis of certain probability Son, will carry out RNA extraction and is transcribed into DNA and send order-checking to check whether sudden change after embryo, DNA at this time is also It it is double-strand；Then after cDNA with the 19T carrier finding the Brachydanio rerio of sudden change after order-checking being connected, by it in culture medium Middle ball chart board, after 12-14 hour, the plasmid connected can be grown up with spotwise, after being chosen speckle, obtains It is the DNA of strand, again send order-checking, finally give the sudden change of strand, then cultivated sexual maturity after growing up three months After, by the Brachydanio rerio hybridization of the Brachydanio rerio of sudden change with wild type, check whether sudden change after obtaining embryo, by the Brachydanio rerio of sudden change Support after choosing monoclonal order-checking；
(7), after three months after sexual maturity, the milter that the sudden change of the second filial generation is grown up excises tail again with raun, reflects Fixed, refer to step (6), obtain the Brachydanio rerio copulation again of identical mutation (lacking several base), thus the BMP2a that obtains isozygotying strikes The Brachydanio rerio removed.
Comprise the steps: as the purification process in the present invention one optimal technical scheme, step (3) and step (4)
(A) adding water and the phenol/chloroform/isopropanol that volume is 1:2-3, after mixing, 10,000-15,000 rpm is centrifuged 5min. upper strata moves into new pipe, repeats this step once；
(B) upper strata moves into new pipe, adds 150ul chloroform, centrifugal 5 min；
(C) 1/10 volume 2.5 M sodium acetate and 2.5 volume ethanol ,-70C freezing 30min are added；
(D) centrifugal 10,000-15,000rpm is at 4C 15min；
(E) discard solution and stay precipitation, add 200ul 80% ethanol, centrifugal 5 min, discard solution, use 10-20 l after drying DEPC H2O dissolves.

Claims (2)

1. the method being obtained by CRISPR/Cas9 knocking out the Brachydanio rerio of bmp2a gene, is comprised the steps:
(1) devising new gRNA sequence, design is BMP2a first between exon and intron, and gRNA sequence is GGAGCCCATCACTAGACTCTTGG, enzyme action is HinfI；
(2) designing and synthesizing gRNA primer, primer is shown in Table 1:
The primer sequence of table 1 CAS9BMP2a is the P3 of design:
Forward sequence (5’to3’):CCTCTTCAACCTGACCTCCA；
Reverse sequence (5’to 3’):GTCCGTCTGTGGTCCACTTT；
P3:GATCACTAATACGACTCACTATAGGAGCCCATCACTAGACTCTGTTTTAGAGC TAGAAAT；
P4:AAAAGCACCGACTCGGTGCC；
GRNA sequence GGAGCCCATCACTAGACTCTTGG；
(3) primer of design being carried out PCR, PCR system is as follows:
gRNA- plasmid 10 ng；
P3 1 ul(10 pmol)；
P4 1 ul(10 pmol)；
Buffer 10；
dNTP 8；
KOD 0.5；
ddH2O Up to 100 ul；
PCR reaction condition is: 95 DEG C of denaturations 3min, enters three steps circulations (95 DEG C of-20s, 58 DEG C of-20s, 72 DEG C of-20s totally 30 Individual circulation), then 72 DEG C of-10min, finally it is incubated at 16 DEG C；After electrophoresis detection PCR primer, it is purified；
(4) under the conditions of RNA-Free, gRNA being carried out in vitro transcription, system is:
2.5mmol/L NTP 4ul；
10× Reaction Buffer 2ul；
Template DNA 1 1ug(<6ul)；
T7 Enzyme Mix 2ul；
DEPC Water up to 20ul ；
gRNA 12.5(ng/ul)；
Cas9 300(ng/ul)；
Tris-Hcl 0.2ul；
Phenol-red 0.2ul；
DEPC Water up to 2ul ；
37 ° of C of above system, 1 hour reaction is complete, is then purified；
(5) being expelled in single celled zebrafish embryo by the mRNA of aforementioned purification, extract RNA after 4 days, transcription DNA is carried out Order-checking detection；Injection system is as follows:
gRNA 12.5(ng/ul)；
Cas9 300(ng/ul)；
Tris-Hcl 0.2ul；
Phenol-red 0.2ul；
DEPC Water up to 2ul；
After (6) three months after sexual maturity, by the Brachydanio rerio hybridization of the Brachydanio rerio of sudden change with wild type, obtain the heterozygosis of certain probability Son, will carry out RNA extraction and is transcribed into DNA and send order-checking to check whether sudden change after embryo, DNA at this time is also It it is double-strand；Then after cDNA with the 19T carrier finding the Brachydanio rerio of sudden change after order-checking being connected, by it in culture medium Middle ball chart board, after 12-14 hour, the plasmid connected can be grown up with spotwise, after being chosen speckle, obtains It is the DNA of strand, again send order-checking, finally give the sudden change of strand, then cultivated sexual maturity after growing up three months After, by the Brachydanio rerio hybridization of the Brachydanio rerio of sudden change with wild type, check whether sudden change after obtaining embryo, by the Brachydanio rerio of sudden change Support after choosing monoclonal order-checking；
(7), after three months after sexual maturity, the milter that the sudden change of the second filial generation is grown up excises tail again with raun, reflects Fixed, refer to step (6), obtain the Brachydanio rerio copulation again of identical mutation (lacking several base), thus the BMP2a that obtains isozygotying strikes The Brachydanio rerio removed.
2. the method being obtained by CRISPR/Cas9 knocking out the Brachydanio rerio of bmp2a gene as claimed in claim 1, its feature For；Purification process in step (3) and step (4) comprises the steps:
(A) adding water and the phenol/chloroform/isopropanol that volume is 1:2-3, after mixing, 10,000-15,000 rpm is centrifuged 5min. upper strata moves into new pipe, repeats this step once；
(B) upper strata moves into new pipe, adds 150ul chloroform, centrifugal 5 min；
(C) 1/10 volume 2.5 M sodium acetate and 2.5 volume ethanol ,-70C freezing 30min are added；
(D) centrifugal 10,000-15,000rpm is at 4C 15min；
(E) discard solution and stay precipitation, add 200ul 80% ethanol, centrifugal 5 min, discard solution, use 10-20 l after drying DEPC H2O dissolves.
CN201610637401.7A 2016-08-05 2016-08-05 The method obtaining knocking out the Brachydanio rerio of bmp2a gene by CRISPR/Cas9 Pending CN106282241A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610637401.7A CN106282241A (en) 2016-08-05 2016-08-05 The method obtaining knocking out the Brachydanio rerio of bmp2a gene by CRISPR/Cas9

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610637401.7A CN106282241A (en) 2016-08-05 2016-08-05 The method obtaining knocking out the Brachydanio rerio of bmp2a gene by CRISPR/Cas9

Publications (1)

Publication Number Publication Date
CN106282241A true CN106282241A (en) 2017-01-04

Family

ID=57665155

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610637401.7A Pending CN106282241A (en) 2016-08-05 2016-08-05 The method obtaining knocking out the Brachydanio rerio of bmp2a gene by CRISPR/Cas9

Country Status (1)

Country Link
CN (1) CN106282241A (en)

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107217075A (en) * 2017-06-28 2017-09-29 西安交通大学医学院第附属医院 A kind of method and primer, plasmid and preparation method of structure EPO gene knockout zebra fish animal models
CN108018316A (en) * 2017-12-20 2018-05-11 湖南师范大学 A kind of method of gene knockout selection and breeding rmnd5b Gene Deletion zebra fish
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
CN108707628A (en) * 2018-05-28 2018-10-26 上海海洋大学 The preparation method of zebra fish notch2 gene mutation bodies
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
CN108753833A (en) * 2018-05-28 2018-11-06 上海海洋大学 The preparation method of zebra fish notch3 gene mutation bodies
CN108753834A (en) * 2018-05-28 2018-11-06 上海海洋大学 The preparation method of ddx27 gene delection zebra fish mutant
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
CN109207523A (en) * 2017-06-29 2019-01-15 南京尧顺禹生物科技有限公司 The foundation and application of human obesity's zebra fish model based on UCP1 gene
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005041857A2 (en) * 2003-10-07 2005-05-12 Quark Biotech, Inc. Bone morphogenetic protein (bmp) 2a and uses thereof
CN105274144A (en) * 2015-09-14 2016-01-27 徐又佳 Preparation method of zebrafish with hepcidin gene knocked out by use of CRISPR / Cas9 technology

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005041857A2 (en) * 2003-10-07 2005-05-12 Quark Biotech, Inc. Bone morphogenetic protein (bmp) 2a and uses thereof
CN105274144A (en) * 2015-09-14 2016-01-27 徐又佳 Preparation method of zebrafish with hepcidin gene knocked out by use of CRISPR / Cas9 technology

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
ZHAOMIN ZHONG ET AL: "Targeted disruption of sp7 and myostatin with CRISPR-Cas9 results in severe bone defects and more muscular cells in common carp", 《SCIENTIFIC REPORTS》 *

Cited By (48)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
CN107217075A (en) * 2017-06-28 2017-09-29 西安交通大学医学院第附属医院 A kind of method and primer, plasmid and preparation method of structure EPO gene knockout zebra fish animal models
CN107217075B (en) * 2017-06-28 2021-07-02 西安交通大学医学院第一附属医院 Method for constructing EPO gene knockout zebra fish animal model, primer, plasmid and preparation method
CN109207523A (en) * 2017-06-29 2019-01-15 南京尧顺禹生物科技有限公司 The foundation and application of human obesity's zebra fish model based on UCP1 gene
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
CN108018316A (en) * 2017-12-20 2018-05-11 湖南师范大学 A kind of method of gene knockout selection and breeding rmnd5b Gene Deletion zebra fish
CN108707628B (en) * 2018-05-28 2021-11-23 上海海洋大学 Preparation method of zebra fish notch2 gene mutant
CN108753834A (en) * 2018-05-28 2018-11-06 上海海洋大学 The preparation method of ddx27 gene delection zebra fish mutant
CN108753833A (en) * 2018-05-28 2018-11-06 上海海洋大学 The preparation method of zebra fish notch3 gene mutation bodies
CN108753834B (en) * 2018-05-28 2021-11-23 上海海洋大学 Preparation method of zebra fish mutant with ddx27 gene deletion
CN108707628A (en) * 2018-05-28 2018-10-26 上海海洋大学 The preparation method of zebra fish notch2 gene mutation bodies
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Similar Documents

Publication Publication Date Title
CN106282241A (en) The method obtaining knocking out the Brachydanio rerio of bmp2a gene by CRISPR/Cas9
CN105274144A (en) Preparation method of zebrafish with hepcidin gene knocked out by use of CRISPR / Cas9 technology
CN107475300B (en) Construction method and application of Ifit3-eKO1 gene knockout mouse animal model
CN106318934B (en) Gene complete sequence of carrot β (1,2) xylose transferase and plasmid construction of CRISPR/CAS9 for transfecting dicotyledonous plants
CN106916820B (en) SgRNA and its application of porcine ROSA 26 gene can effectively be edited
CN107326046A (en) A kind of method for improving foreign gene homologous recombination efficiency
CN103343120A (en) Wheat genome site-specific modification method
CN108546716A (en) A kind of genome edit methods
CN104342457A (en) Method for targetedly integrating exogenous gene into target gene
CN106701830A (en) Method for knocking out p66shc gene in pig embryo
CN105821075A (en) Establishment method of caffeine synthetase CRISPR/Cas9 genome editing vector
CN107446922A (en) A kind of gRNA sequences and its application method for knocking out hepcidin gene in human osteoblast cell&#39;s strain
CN104531705A (en) Method for knocking off animal myostatin gene by using CRISPR-Cas9 system
CN105985943A (en) Method for site transformation on plant genome by using non-genetic material
AU2017101108A4 (en) Construction method of animal model of mucopolysaccharidosis type II and use thereof
CN110643636B (en) Megalobrama amblycephala MSTNa &amp; b gene knockout method and application
CN102653756B (en) Directional modification method of specific gene of animal genome and application thereof
CN105274141A (en) Transgenic vector for target mutation of primordial germ cells, method for preparing transgenic vector and application thereof
CN105505879A (en) Method and culture medium for culturing transgenic animal embryonic cells or transgenic animals
CN109402170B (en) Method for establishing fish male sterility model
CN108893495B (en) Construction method of Pdzd7 gene mutation animal model
CN110066805A (en) The method of gene knockout breeding adgrf3b Gene Deletion zebra fish
CN108300738B (en) Preparation method of humanized mouse model with NOD genetic background and neutrophilic granulocyte deletion
CN109652457A (en) A kind of method of gene knockout breeding ALPK2 Gene Deletion zebra fish
CN104212837B (en) Lentiviral vector for expression of human serum albumin and construction method thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20170104

RJ01 Rejection of invention patent application after publication