CN107326046A - A kind of method for improving foreign gene homologous recombination efficiency - Google Patents
A kind of method for improving foreign gene homologous recombination efficiency Download PDFInfo
- Publication number
- CN107326046A CN107326046A CN201610272812.0A CN201610272812A CN107326046A CN 107326046 A CN107326046 A CN 107326046A CN 201610272812 A CN201610272812 A CN 201610272812A CN 107326046 A CN107326046 A CN 107326046A
- Authority
- CN
- China
- Prior art keywords
- homologous recombination
- dna
- mouse
- target gene
- sgrna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
Abstract
The present invention relates to a kind of method that utilization CRISPR technologies improve foreign gene homologous recombination efficiency, the successful Transgenics of homologous recombination repair mechanism pathway are obtained by importing sgRNA, homologous recombination repair template DNA and the cas9 method of cutting efficiency at least 15.4% in target gene group.
Description
Technical field：
Carried out the invention belongs to gene editing field, more particularly to CRISPR/Cas9 systems and homologous recombination repair template
The mutation transformation of foreign gene homologous recombination.
Background technology：
The development of gene sequencing and full-length genome technology, for research gene expression, gene pleiomorphism and study on regulation with
The relevance of specific gene, specific cells function and morbid state proposes major transformation.This for research genome in coding and
The function prediction of non-coding sequence is provided convenience.In recent years, the inscribe zymotechnic of sequence-specific is in the accurate base of model animal
Application in terms of because of editor has been made significant headway, and we have been risen with very big promotion to organism growth and disease research and has been made
With.
Zinc finger nuclease technology (Zinc-fingers) and activating transcription factor sample effector nuclease (TALENs) and
The CRISPR/Cas9 nucleic acid enzyme systems mediated by RNA have all applied to gene editing, prominent required for being introduced in target gene
Become, and then the further function of studying gene has applied to several species.Wherein CRISPR/Cas9 systems and other genomes
Engineering technology relatively possesses following technical advantage：(1) limited without species, targeting accuracy is high, can be achieved to the multiple positions of target gene
Point is knocked out simultaneously；(2) easy to use, expense is lower, and either Zinc finger nuclease technology (Zinc-fingers) or transcription swashs
Factor sample effector nuclease (TALENs) living is required for for the recognition sequence before different target spots change nuclease, these knowledges
The synthesis of other sequence assembles time and effort consuming and costly, but Cas9 albumen does not have specificity, only need to synthesize a sgRNA
It can be achieved with the special sex modification to gene；(3) CRISPR/Cas9 systems only need to change very short RNA sequence and (are no more than
The specific recognition of different loci 100bp) can be just realized, the TALENs code carriers that overlength, height can be avoided to repeat are brought
Complication.
CRISPR clusters are a special repetitive dna sequence families being widely present in bacterium and Archimycetes genome, its
Sequence is by a leader (Leader), multiple short and highly conserved repetitive sequence areas (Repeat) and multiple spacer regions
(Spacer) constitute.Leader is normally at CRISPR clusters upstream, is, rich in the region that AT length is 300~500bp, to be considered as
It is probably the promoter sequence of CRISPR clusters.Repetitive sequence section length is 21~48bp, containing palindromic sequence, can form hair fastener knot
Structure.Separated between repetitive sequence by length for 26~72bp spacer region.Spacer regions are made up of the exogenous DNA captured, class
Like immunological memory, when the exogenous DNA invasion containing same sequence, it can be recognized by bacterium body, and carry out shearing and be allowed to express
Silence, reaches the purpose of protection inherently safe.
The CRISPR/Cas systems having now been found that have three kinds of different types i.e. I types, II types and type III, and they are present in greatly
In about 40% eubacteria being sequenced and 90% archeobacteria being sequenced.The composition of wherein II types is relatively simple, with Cas9 albumen
It is also type most deep in studying at present and guide RNA (sgRNA) constitutes for core.
Pre-crRNA processing is participated individually in by the Cas9 in Cas families in II type systems.Cas9 contains at amino end
HNH2 unique avtive spot in the middle part of the RuvC and protein at end, plays in crRNA is ripe and double-stranded DNA is sheared and makees
With.In addition, while pre-crRNA transcriptions, the complementary trans-activation crRNA (Trans-activating with its repetitive sequence
CrRNA, tracrRNA) also transcription comes out, and Cas9 and double-stranded RNA specificity RNase III nucleases are excited to pre-
CrRNA is processed.After processing is ripe, crRNA, tracrRNA and Cas9 composition complex recognize and are incorporated into crRNA complementations
Sequence, then untie DNA double chain, form R-loop, make crRNA and complementary strand thereof, another chain keeps free single-stranded
State, is then sheared crRNA complementary dna chain by the HNH avtive spots in Cas9, and RuvC avtive spots shear incomplementarity chain,
It is eventually introduced DNA double chain fracture (DSB).CRISPR/Cas9 shearing site is located at the neighbouring PAM in crRNA complementary series downstream
NGG sites in the 5'-N20-NGG-3' characteristic areas in area (Protospacer Adjacent Motif) are it is found that pass through
Artificial constructed simulation crRNA：The single-chain chimeric body guiding RNA (guide RNA) of tracrRNA complexs, you can effective mediation
Identification and cutting of the Cas9 albumen to target spot, after DNA double chain fracture breach (DSB) occurs, cell can start nonhomologous end
Connect (nonhomologous end-joining, NHEJ) and homologous recombination repair mechanism (Homology-directed
Repair, HDR), the DSB ends of fracture can be directly connected to by NHEJ repair mechanisms.Due to will not in this reparation
Homologous templates chain is used, so easily occurring small insertion or deletion mutation in breaking part, frameshift mutation is can frequently result in, makes
The function of gene is destroyed.HDR repair mechanisms are, using homologous chain as template, DSB to be repaired.Due to it is this reparation be with
Homologous chain is as template, so its fidelity is very high, one or more genes are may be inserted into using HDR, can also carry out list
Base is replaced.CRISPR/Cas9 systems have turned into the effective tool of a research gene function at present, can be for deleting, add
Plus, activation or the target gene for suppressing other biological body, CRISPR/Cas9 systems go for any to import sgRNA
Species carry out gene editing, these target genes include people, mouse, zebra fish, bacterium, drosophila, yeast, nematode and crops
Intracellular gene.CRISPR/Cas9 systems can reach to targetting the difference between mutually isogenic different sgRNA, its efficiency
To more than 10, and the homologous recombination repair approach HDR of CRISPR/Cas9 mediations efficiency is usually less than 5.0%, and not
Can seldom reach 10% in homogenic, the cutting efficiency that the sgRNA of different binding sites is designed at target spot be it is different, it is this
Phenomenon is probably that many reasons are caused, such as the secondary structure of sgRNA, sgRNA and DNA combination compounds it is thermally-stabilised
Property and the accessibility of target DNA are relevant.Therefore, sgRNA design has a significant impact to mutation success rate.
The content of the invention：
In order to improve foreign gene homologous recombination efficiency in target gene group, genetically modified mutant is obtained, the present invention is carried
For a kind of method for improving foreign gene homologous recombination efficiency, it is included in target gene group and imports cas9, targets target gene
SgRNA and homologous recombination repair template DNA, wherein the sgRNA mediation Cas9 to target gene group PAM Sequences upstreams
Cutting efficiency is at least 15.4%.SgRNA can target 5 '-NGG-3 ' sequences in any target gene in Cas9 systems, wherein
3 ' end NGG sequences be before between region sequence can be by Cas9 eggs adjacent to motif (protospacer adjacent motif PAM)
White specific recognition is simultaneously cut, and has result of study to show that NGG sequences can also be NAG sequences, once with reference to two solely in Cas9
Vertical nuclease domain will be cut in PAM areas upstream~3bp to genomic DNA, cause DNA double chain to be broken (DSB).
Further technical scheme is that the PAM sequences of the target gene group are NGG or NAG.
Further, the Cas9 is Cas9mRNA or Cas9 albumen.Cas9mRNA the or Cas9 albumen is imported into mesh
Genome efficiency high of the cutting efficiency than being introduced directly into Cas9DNA.
Further, the complementary sequence of sgRNA and target DNA is 17nt-22nt.CRISPR/Ca9 specificity be by
What 5 ' end 20nt of sgRNA sequences DNA sequence dna was determined, Cas9/sgRNA compounds are attached to the preceding 17-20 core with sgRNA
On the double chain DNA sequence that thuja acid matches, with NGG sequence forms exist before between region sequence adjacent to motif (protospacer
Adjacent motif, PAM) follow closely after this target sequence, the mutation efficiency that also 17nt-20nt is mediated is roughly the same,
But 21nt and 22nt efficiency can be substantially reduced.SgRNA 20bp sequences can be tolerated in the experiment in vitro of S.pyogenes systems
Preceding 6 mismatches in row.
Further, the sgRNA and target DNA complementary sequence is 18nt-20nt.
Further, the sgRNA and target DNA complementary sequence is 18nt.
DSB can be by non-homologous end joining (nonhomologous end-joining, NHEJ) signal path or same
Source recombinantal repair mechanism (Homology-directed repair, HDR) is repaired.NHEJ would generally be attached in cleavage site
Short insertion deletion (indels) is closely caused, and can be led distinguished sequence using HDR in the case where providing external source template DNA
Enter to cleavage site.External source template DNA has two kinds of forms：Single stranded DNA (ssDNA), single stranded DNA can be blended into 200nt, be used for
Small sequence is integrated, such as a polypeptide marker is integrated in protein-coding region or by the specific ammonia of protein coding region mutation
Base acid construct disease model is either in non-coding mutation particular sequence to study its function；Long double-stranded DNA (dsDNA) is double
Chain DNA can be built up to homology arm sequence up to a hundred or thousands of.The recovery template of double-stranded DNA can integrate long sequence
Row, marker genes, such as GFP etc. are introduced with excessively this method in DNA specific region.
Generally, the recovery template of target gene includes needing to change or need the DNA sequence dna inserted, and is needing to change
Sequence the right and left add with target gene group identical or so homology arm, the length of left and right homology arm can be with experimental
It is required that be adjusted, but under normal circumstances long double-stranded DNA (homology arm selected by dsDNA recovery templates is typically larger than
500bp, has result of study to show that the probability of non-fixed point insertion, experimental implementation can be reduced as recovery template by injecting cyclic plasmid
In cyclic plasmid can also be linearized after import target gene group and carry out homologous recombination repair；If from single-stranded
DNA (ssDNA) is at least 40bp as recovery template, the length of left and right homology arm, and ssDNA can be and target gene identical
Positive-sense strand either antisense strand.
Further, the homologous recombination repair template DNA is cyclic plasmid or linearisation double-stranded DNA.
Further, the homologous recombination repair template carries out same sense mutation, and the DNA after same sense mutation can reduce quilt
The risk that Cas9 is cut again.
Further, described homologous recombination repair template DNA or so homology arm is at least 500bp.
Further, described homologous recombination repair template DNA or so homology arm is asymmetric.
Further, the homologous recombination repair template DNA is linearisation single stranded DNA.
Further, the homologous recombination repair template carries out same sense mutation.
Further, described homologous recombination repair template DNA or so homology arm is at least 40bp.
Further, described homologous recombination repair template DNA or so homology arm is asymmetric.
CRISPR/Cas9 systems go for any species that can import sgRNA and carry out gene editing, these targets
Gene includes the gene in people, mouse, zebra fish, bacterium, drosophila, yeast, nematode and crop plant cells.So further,
The target gene group is the gene in people, mouse, zebra fish, bacterium, drosophila, yeast, nematode or crop plant cells.
Brief description of the drawings
In order to illustrate more clearly about the embodiment of the present invention or technical scheme of the prior art, below will be to embodiment or existing
There is the accompanying drawing used required in technology description to be briefly described, it should be apparent that, drawings in the following description are only this
Some embodiments of invention, for those of ordinary skill in the art, on the premise of not paying creative work, can be with
Other accompanying drawings are obtained according to these accompanying drawings.
Fig. 1 is CRISPR/Cas9 systemic effect principle schematics.
Fig. 2 is Cas9mRNA and sgRNA expression vector schematic diagrams.
Fig. 3 is the structure schematic diagram of sgRNA in-vitro transcription templates.
Fig. 4 is the qualification result of the embodiment of the present invention 7.
Fig. 5 is the qualification result of the embodiment of the present invention 8.
Fig. 6 is the qualification result of the embodiment of the present invention 9.
Fig. 7 is the qualification result of the embodiment of the present invention 9.
Specific embodiment
Below in conjunction with embodiments of the invention, technical scheme is clearly and completely described, it is clear that
Described embodiment is only a part of embodiment of the invention, rather than whole embodiments.Based on the embodiment in the present invention,
The every other embodiment that those of ordinary skill in the art are obtained under the premise of creative work is not made, belongs to this hair
The scope of bright protection.
The structure of the sgRNA in-vitro transcription templates of embodiment 1
For any one target spot to be targetted, it is necessary to two primers (Fig. 3) be designed and synthesized, wherein one contains successively
For the T7 promoter sequences of in-vitro transcription, the front portion of target spot specific sequence, and sgRNA frame sequences, another
Remainder containing sgRNA frame sequences.There is complementary pairing in 3 ' ends of two primers.Enter performing PCR to primer using this to expand
Increasing can obtain the template DNA for in-vitro transcription.
The Cas9 of embodiment 2 and sgRNA in-vitro transcription
The sgRNA templates of PCR primer form are purified by phenol chloroform and ethanol precipitation, are turned using In vitro
Record T7 kits are transcribed, and are reclaimed by phenol chloroform and isopropanol precipitating.Handled and opened with SP6 using NotI
The pX260 plasmids (the plasmid only one of which NotI restriction enzyme sites, after the polyA sequences in Cas9 downstreams) of promoter sequences,
Use mMESSAGESP6 in-vitro transcription kits carry out in-vitro transcription, and pure by lithium chloride precipitation progress
Change and reclaim.
The sgRNA/Cas9mRNA of embodiment 3 microinjection
Embryonated egg used in microinjection is from the dams with the super row of the male mouse post-coitum of same strain.By embryonated egg before injection
Culture is among KSOM embryo culture mediums.With microinjection TE buffer solutions by for sgRNA, Cas9 and DNA of target gene
Recovery template mixes and is diluted to 12.5ng/ul sgRNA, 25ng/ul Cas9 and 10ng/ul DNA recovery templates.Make
Above-mentioned solution is injected into one cell stage by microinjection syringe needle with Eppendorf transferMan NK2 micro-manipulation devices
Embryonated egg karyon in.The embodiment of the present invention 7 and embodiment 8 inject for Cas9mRNA, embodiment 9 inject for Cas9 eggs
In vain.Embryonated egg after injection is transplanted into false pregnancy ICR dams immediately or after KSOM incubated overnights.By above dams raise in
Under 12 hours illumination rhythm and pace of moving things, under the food gnotobasis sufficient with drinking-water.
The rat mouse genome identification of dna of embodiment 4 is extracted：
A, digestion：After rat or mouse are born about one week, clip 0.5cm mouse toes are put into 1.5mlEP pipes, plus
Enter 500ul lysate ((lysates：100mM Tris (pH8.0), 5mM EDTA (pH8.0), 0.5%SDS, NaCl 1.17g/
100ml；), 0.5ul Proteinase Ks (Proteinase K (Proteinase K)：20mg/ml (is dissolved in pH7.4,20mM Tris and 1mM
In CaCl2,50% glycerol buffer, -20 DEG C of preservations), mix 55 DEG C of water-bath digestion and stay overnight；
B, phenol chloroform：Taking-up EP pipes, overturn mix back and forth, 12000rpm, and centrifugation sucts clear 400ul for 10 minutes to newly
In EP pipes, isometric phenol/chloroform is added, 3min is firmly rocked；12000rpm, is centrifuged 5 minutes.Gentle aspiration supernatant is to one new
1.5mlEP pipes in (would rather inhale less, should not also be drawn onto the phenol or sediment of lower floor).Isometric chloroform is added into supernatant,
Firmly rock 2 minutes；12000rpm, is centrifuged 3 minutes.Supernatant is drawn into another new 1.5mlEP pipes, 1/10 volume is added
The absolute ethyl alcohol of sodium acetate solution and 2.5 times of volumes, shakes up, -20 DEG C of placement about 30min.On 4 DEG C of centrifuges, 12000rpm, from
The heart 10 minutes, removes supernatant, and EP pipes are upside down on blotting paper, to blot ethanol.Use sterile ddH2O, 30ul dissolving DNAs, -20 DEG C
Preserve.
The PCR of embodiment 5 is identified
Forward and reverse PCR primer is separately designed for target spot upstream and downstream about 200~300bp regions.Set up and include following ingredients
50 microlitres of PCR reaction systems：
Amplified reaction is carried out using following cycling condition：
The sequencing analysis of embodiment 6
Sequencing result compare analysis PCR primer sequencing after, result is seen by chromas coloured pictures, if unimodal, directly with
WT sequence alignments (DNAMAN softwares), see WT or homozygote；Coloured picture is rear bimodal, by sectional drawing and WT sequence alignments,
Analyze mutant sequences.
The Cyld point mutation mouse of embodiment 7 builds
Cyld mouse wild-type target gene groups sequence (SEQ ID NO.1)：
ctccttccatgaactccttgtctagcgagaacagattctccttacccttcagcctgacaaagatgc
ccaatactaatggcagcatggctcatagtc
The PAM sequences for purpose genome of square frame mark
Cyld sgRNA primer sequences (SEQ ID NO.2)：
GATCACTAATACGACTCACTATAGGAGGCTGAAGGGTAAGGAGGTTTTAGAGCTAGAAAT
The amino acids of Cyld mouse the 418th are sported A homologous recombination repair template sequence (SEQ ID NO.3) by S
ctccttccatgaactccttgtctagcgagaacagattTcaTGCACtTccGttcagcctgacaaagatgcccaatact
aatggcagcatggctcatagtc
Capitalization is without mutation or same sense mutation base, and recovery template is that single stranded DNA (ssDNA) homology arm left arm is
37bp, homology arm right arm is 49bp.
Cyld murine genes type identification sequence (SEQ ID NO.4)：
GAGATGAAGAAGAGAAACAAGGACAGACGTTATTTAGTCAGTAGGTTTGTAGTACTGTGAGCATACTTG
CAAAGGGATCATGTGCTCAGTTAGACTAGATCTTTTTATTGTTTTTAGAGATACAAGCATATTTAATGTTCTTGAAC
AACTTTTTCTAATTAAGAACAATTTTTCATAGTTGCAGAAGACCCTGCAAAGTCACTTACAGAGATGTCTTCGGACT
TCGGACATTCATCTCCTCCACCGCAGCCTCCTTCCATGAACTCCTTGTCTAGCGAGAACAGATTCCACTCCTTACCC
TTCAGCCTGACAAAGATGCCCAATACTAATGGCAGCATGGCTCATAGTCCACTCTCTCTGTCAGTGCAGTCTGTGAT
GGGGGAGCTGAACAGCACACCTGTCCAGGAGAGTCCACCCTTGCCCATCTCTTCTGGGAATGCACACGGGCTAGAGG
TGGGCTCACTGGCTGAAGTAAAAGAGAACCCCCCGTTCTATGGGGTTATCCGTTGGATTGGCCAGCCACCAGGGCTC
AGTGACGTGCTAGCTGGACTGGAACTGGTAATTTAATTTGGCCAAAAATCTACAACTCTTTTCCTGCAT
In Cyld S418A-F0 generations, are raw 13, and the cas9 albumen that wherein 1# and 8# mouse are mediated by sgRNA is cut, and remaining is
Wild type (WT) mouse, cutting efficiency is about 15.4%, and wherein 8# mouse are the point mutation mouse (Fig. 4) successfully constructed.
The megf6 mouse of embodiment 8 insertion cre large fragments mouse builds
Megf6 mouse wild-type target gene groups sequence (SEQ ID NO.5)
CTGGGACTCTCGGTTGCAGAGAGAGGGAGCGCAAGTGAAATTGGAAAGCTTTAGGGGAAAGTACTGGGAAGCGAGCT
TAGCCTTAAAGGTAGGACCAGGAGCCGGAGAGGGGAGGGGCTGAAGCGGGGCTGGAAGTGGGCTCTCCCTATTGGGA
TTGTCTGGGCGGGGCCGAAGGCGGAACGGGCGTGGCTTGGGCTGGGGGTGGGGCCAAAAGGGGCGGGAGCGGGGTCG
GGAAAGAGGGGGCTGGGGTCGGGCCGGGGGGCGTGCGGCGGGCGGGCCTGACGTCTGCTGCGTCCCGCTCCGAGTTT
GCTCTCCATCACTCCTGGCAAGTGTCTGGCCGCGCCGAACCGAGCGCGAAGGTCTCGGAGGTCCGGGCAACTGTCCC
ATCTGCACCTGCGGGAACCTCGCGCCCCGCACCTGGCGCGACTGGGTTGTGGTGCTCCGCTGTCCTCTGGGGGTATG
GCGCCCGTGAAGACAGCGTCTACTGGCCGTAAGGGCCGCCTGTGAGTCGAAGATCCCAGGACCGAGTGGGAGCGCGA
CGCGCACTATGCCTGTCGGGGTGGAGGCGAGGGCGTCTTGGCGCGTGGTGGCCCTGACGCTGCTGCTGCTCCCCGCC
GTGCCTGCAGCCTCCCAGCCGCTACCCCCGCGCCCGCTGCAGCCGAGCATGTGAGTAGCGCGAGTCGTGAGGCTCCT
GGCGGCGAAGCTGACCCGGACAGAACTCGGGGCTTTGTCCCTGGGGCCACAAACAATGGGCTCTTTGCTTTAACTGA
GGAGGGGATGGTCTAGACCCGGGGTCCCGGACTGGATTTGGTGCCCTCGAGTCTGCCGCAGGGCCCATAGCCTCCGG
GTTCCCGCCCCTGCAGCAAGGGTCCTGCAGACTTAGACGGATGCCGAACTCCGGAGAGGTGAGGAATCCAAGCCCCT
GCGGCGCAGGGTCCAGCTGGGGAGCCAGCTTGGAGGCGGCCGAGAGGAAGCAGCCTGGTCCCACTTCCTCCCCAAGC
TAGTCTCCTGGGGTCCGAGGGCCTGCGCAGGGGCGGGGGTGCCCAGAGGGGGCTGCCAGCACTGTTTTGTGTGTTAA
ACACGTGCGCT
The PAM sequences for purpose genome of square frame mark
Megf6sgRNA primer sequences (SEQ ID NO.6)：
GATCACTAATACGACTCACTATAGGCGACAGGCATAGTGCGCGGTTTTAGAGCTAGAAAT
Megf6 mouse insertion cre large fragment homologous recombination repairs template sequence (SEQ ID NO.7)
CTGGGACTCTCGGTTGCAGAGAGAGGGAGCGCAAGTGAAATTGGAAAGCTTTAGGGGAAAGTACTGGGA
AGCGAGCTTAGCCTTAAAGGTAGGACCAGGAGCCGGAGAGGGGAGGGGCTGAAGCGGGGCTGGAAGTGGGCTCTCCC
TATTGGGATTGTCTGGGCGGGGCCGAAGGCGGAACGGGCGTGGCTTGGGCTGGGGGTGGGGCCAAAAGGGGCGGGAG
CGGGGTCGGGAAAGAGGGGGCTGGGGTCGGGCCGGGGGGCGTGCGGCGGGCGGGCCTGACGTCTGCTGCGTCCCGCT
CCGAGTTTGCTCTCCATCACTCCTGGCAAGTGTCTGGCCGCGCCGAACCGAGCGCGAAGGTCTCGGAGGTCCGGGCA
ACTGTCCCATCTGCACCTGCGGGAACCTCGCGCCCCGCACCTGGCGCGACTGGGTTGTGGTGCTCCGCTGTCCTCTG
GGGGTATGGCGCCCGTGAAGACAGCGTCTACTGGCCGTAAGGGCCGCCTGTGAGTCGAAGATCCCAGGACCGAGTGG
GAGCGCGACCGCGCGCACTATGAAGAAGAGGAAGGTGTCCAATTTACTGACCGTACACCAAAATTTGCCTGCATTAC
CGGTCGATGCAACGAGTGATGAGGTTCGCAAGAACCTGATGGACATGTTCAGGGATCGCCAGGCGTTTTCTGAGCAT
ACCTGGAAAATGCTTCTGTCCGTTTGCCGGTCGTGGGCGGCATGGTGCAAGTTGAATAACCGGAAATGGTTTCCCGC
AGAACCTGAAGATGTTCGCGATTATCTTCTATATCTTCAGGCGCGCGGTCTGGCAGTAAAAACTATCCAGCAACATT
TGGGCCAGCTAAACATGCTTCATCGTCGGTCCGGGCTGCCACGACCAAGTGACAGCAATGCTGTTTCACTGGTTATG
CGGCGGATCCGAAAAGAAAACGTTGATGCCGGTGAACGTGCAAAACAGGCTCTAGCGTTCGAACGCACTGATTTCGA
CCAGGTTCGTTCACTCATGGAAAATAGCGATCGCTGCCAGGATATACGTAATCTGGCATTTCTGGGGATTGCTTATA
ACACCCTGTTACGTATAGCCGAAATTGCCAGGATCAGGGTTAAAGATATCTCACGTACTGACGGTGGGAGAATGTTA
ATCCATATTGGCAGAACGAAAACGCTGGTTAGCACCGCAGGTGTAGAGAAGGCACTTAGCCTGGGGGTAACTAAACT
GGTCGAGCGATGGATTTCCGTCTCTGGTGTAGCTGATGATCCGAATAACTACCTGTTTTGCCGGGTCAGAAAAAATG
GTGTTGCCGCGCCATCTGCCACCAGCCAGCTATCAACTCGCGCCCTGGAAGGGATTTTTGAAGCAACTCATCGATTG
ATTTACGGCGCTAAGGATGACTCTGGTCAGAGATACCTGGCCTGGTCTGGACACAGTGCCCGTGTCGGAGCCGCGCG
AGATATGGCCCGCGCTGGAGTTTCAATACCGGAGATCATGCAAGCTGGTGGCTGGACCAATGTAAATATTGTCATGA
ACTATATCCGTAACCTGGATAGTGAAACAGGGGCAATGGTGCGCCTGCTGGAAGATGGCGATTAGCCTGTCGGGGTG
GAGGCGAGGGCGTCTTGGCGCGTGGTGGCCCTGACGCTGCTGCTGCTCCCCGCCGTGCCTGCAGCCTCCCAGCCGCT
ACCCCCGCGCCCGCTGCAGCCGAGCATGTGAGTAGCGCGAGTCGTGAGGCTCCTGGCGGCGAAGCTGACCCGGACAG
AACTCGGGGCTTTGTCCCTGGGGCCACAAACAATGGGCTCTTTGCTTTAACTGAGGAGGGGATGGTCTAGACCCGGG
GTCCCGGACTGGATTTGGTGCCCTCGAGTCTGCCGCAGGGCCCATAGCCTCCGGGTTCCCGCCCCTGCAGCAAGGGT
CCTGCAGACTTAGACGGATGCCGAACTCCGGAGAGGTGAGGAATCCAAGCCCCTGCGGCGCAGGGTCCAGCTGGGGA
GCCAGCTTGGAGGCGGCCGAGAGGAAGCAGCCTGGTCCCACTTCCTCCCCAAGCTAGTCTCCTGGGGTCCGAGGGCC
TGCGCAGGGGCGGGGGTGCCCAGAGGGGGCTGCCAGCACTGTTTTGTGTGTTAAACACGTGCGCT
The cre sequences knocked between homology arm, recovery template is that double-stranded DNA (dsDNA) homology arm left and right arms are 500bp,
Homologous recombination repair template does not do same sense mutation.
In megf6-cre F0 generations, are raw 7, and the cas9 albumen that wherein 3#4#5# mouse are mediated by sgRNA is cut, and remaining is open country
Raw type (WT) mouse, wherein cutting efficiency 43%, 1# mouse are the cre insertion mouse (Fig. 5) successfully constructed.
Embodiment 9myl4 point mutation rat builds
Myl4 wild-type rat target gene groups sequence (SEQ ID NO.8)：
CCCACGTCCACTGGAGATCCTAAGGCAGCATGCCTCCCAAGAAGCCTGAGCAGA
The PAM sequences for purpose genome of AGACTGCCAAGGCAGCCGCAGCCCCTGCCCCAGCTCCTG square frames mark
Myl4sgRNA primer sequences 1 (SEQ ID NO.9)：
GATCACTAATACGACTCACTATAGGCCTTGGCAGTCTCCTTCTGTTTTAGAGCTAGAAAT
Myl4sgRNA primer sequences 2 (SEQ ID NO.10)：
GATCACTAATACGACTCACTATAGGAGAAGCCTGAGCCCAAGAGTTTTAGAGCTAGAAAT
The amino acids of myl4 rats the 11st are sported K homologous recombination repair template sequence (SEQ ID NO.11) by E：
CCCACGTCCACTGGAGATCCTAAGGCAGCATGCCTCCCAAGAAGCCTGAGCAGA
AGACTGCCAAGGCAGCCGCAGCCCCTGCCCCAGCTCCTG does not carry out same sense mutation, and recovery template is single stranded DNA
(ssDNA) homology arm left arm is 59bp, and homology arm right arm is 39bp.
Myl4 rat genes type identification sequence (SEQ ID NO.12)：
GGAGGACGAACTGGTGACAATAATGAGATGTCAGCTGCACCCTGCTGGTGTCCCTTCCTTTTATAGTCA
GCAGCAGTTGCTCCAGCTCTCACCAGCCCCTCTGTGGGGGCTCCTACCCAGAATAAAAGCAGGGGAAGGCCTTCCAG
TCTCCCATCTTCCTCTCAGGAGCCACCTTTCCTCAGTTTTTAGGTCCCACGTCCACTGGAGATCCTAAGGCAGCATG
CCTCCCAAGAAGCCTGAGCCCAAGAAGGAGACTGCCAAGGCAGCCGCAGCCCCTGCCCCAGCTCCTGCCCCAGCTCC
CGAGCCCCTCAGGGACTCTGCCTTTGATCCCAAGAGTGTGAAGGTAAGTGAAGGCCAGCGCTGACGACAGTCAGGAT
CCTGTTTTTCCTGTTGCAGAGAGATCTATTCTCTCAGGCCAGAGATGAGAGCCATGACCTATAGCC
Myl4RAT E11K F0 give birth to 24 for rat, and wherein 10#13#14#23# is cut by the sgRNA cas9 albumen mediated
Open, 1#2#5#6#15# rats be the point mutation mouse that successfully constructs remaining be wild type (WT) mouse, cutting efficiency is about
37.5% (Fig. 6, Fig. 7).
Sequence table
<110>Shanghai Bang Yao bio tech ltd
<120>A kind of method for improving foreign gene homologous recombination efficiency
<160> 12
<210> 1
<211> 99
<212> DNA
<213> Mus musculus
<400> 1
ctccttccat gaactccttg tctagcgaga acagattcca ctccttaccc ttcagcctga 60
caaagatgcc caatactaat ggcagcatgg ctcatagtc 99
<210> 2
<211> 60
<212> DNA
<213>Artificial sequence
<400> 2
gatcactaat acgactcact ataggaggct gaagggtaag gaggttttag agctagaaat 60
<210> 3
<211> 99
<212> DNA
<213>Artificial sequence
<400> 3
ctccttccat gaactccttg tctagcgaga acagatttca tgcacttccg ttcagcctga 60
caaagatgcc caatactaat ggcagcatgg ctcatagtc 99
<210> 4
<211> 600
<212> DNA
<213> Mus musculus
<400> 4
gagatgaaga agagaaacaa ggacagacgt tatttagtca gtaggtttgt agtactgtga 60
gcatacttgc aaagggatca tgtgctcagt tagactagat ctttttattg tttttagaga 120
tacaagcata tttaatgttc ttgaacaact ttttctaatt aagaacaatt tttcatagtt 180
gcagaagacc ctgcaaagtc acttacagag atgtcttcgg acttcggaca ttcatctcct 240
ccaccgcagc ctccttccat gaactccttg tctagcgaga acagattcca ctccttaccc 300
ttcagcctga caaagatgcc caatactaat ggcagcatgg ctcatagtcc actctctctg 360
tcagtgcagt ctgtgatggg ggagctgaac agcacacctg tccaggagag tccacccttg 420
cccatctctt ctgggaatgc acacgggcta gaggtgggct cactggctga agtaaaagag 480
aaccccccgt tctatggggt tatccgttgg attggccagc caccagggct cagtgacgtg 540
ctagctggac tggaactggt aatttaattt ggccaaaaat ctacaactct tttcctgcat 600
<210> 5
<211> 1092
<212> DNA
<213> Mus musculus
<400> 5
ctgggactct cggttgcaga gagagggagc gcaagtgaaa ttggaaagct ttaggggaaa 60
gtactgggaa gcgagcttag ccttaaaggt aggaccagga gccggagagg ggaggggctg 120
aagcggggct ggaagtgggc tctccctatt gggattgtct gggcggggcc gaaggcggaa 180
cgggcgtggc ttgggctggg ggtggggcca aaaggggcgg gagcggggtc gggaaagagg 240
gggctggggt cgggccgggg ggcgtgcggc gggcgggcct gacgtctgct gcgtcccgct 300
ccgagtttgc tctccatcac tcctggcaag tgtctggccg cgccgaaccg agcgcgaagg 360
tctcggaggt ccgggcaact gtcccatctg cacctgcggg aacctcgcgc cccgcacctg 420
gcgcgactgg gttgtggtgc tccgctgtcc tctgggggta tggcgcccgt gaagacagcg 480
tctactggcc gtaagggccg cctgtgagtc gaagatccca ggaccgagtg ggagcgcgac 540
cgcgcgcact atgcctgtcg gggtggaggc gagggcgtct tggcgcgtgg tggccctgac 600
gctgctgctg ctccccgccg tgcctgcagc ctcccagccg ctacccccgc gcccgctgca 660
gccgagcatg tgagtagcgc gagtcgtgag gctcctggcg gcgaagctga cccggacaga 720
actcggggct ttgtccctgg ggccacaaac aatgggctct ttgctttaac tgaggagggg 780
atggtctaga cccggggtcc cggactggat ttggtgccct cgagtctgcc gcagggccca 840
tagcctccgg gttcccgccc ctgcagcaag ggtcctgcag acttagacgg atgccgaact 900
ccggagaggt gaggaatcca agcccctgcg gcgcagggtc cagctgggga gccagcttgg 960
aggcggccga gaggaagcag cctggtccca cttcctcccc aagctagtct cctggggtcc 1020
gagggcctgc gcaggggcgg gggtgcccag agggggctgc cagcactgtt ttgtgtgtta 1080
aacacgtgcg ct 1092
<210> 6
<211> 60
<212> DNA
<213>Artificial sequence
<400> 6
gatcactaat acgactcact ataggcgaca ggcatagtgc gcggttttag agctagaaat 60
<210> 7
<211> 2136
<212> DNA
<213>Artificial sequence
<400> 7
ctgggactct cggttgcaga gagagggagc gcaagtgaaa ttggaaagct ttaggggaaa 60
gtactgggaa gcgagcttag ccttaaaggt aggaccagga gccggagagg ggaggggctg 120
aagcggggct ggaagtgggc tctccctatt gggattgtct gggcggggcc gaaggcggaa 180
cgggcgtggc ttgggctggg ggtggggcca aaaggggcgg gagcggggtc gggaaagagg 240
gggctggggt cgggccgggg ggcgtgcggc gggcgggcct gacgtctgct gcgtcccgct 300
ccgagtttgc tctccatcac tcctggcaag tgtctggccg cgccgaaccg agcgcgaagg 360
tctcggaggt ccgggcaact gtcccatctg cacctgcggg aacctcgcgc cccgcacctg 420
gcgcgactgg gttgtggtgc tccgctgtcc tctgggggta tggcgcccgt gaagacagcg 480
tctactggcc gtaagggccg cctgtgagtc gaagatccca ggaccgagtg ggagcgcgac 540
cgcgcgcact atgaagaaga ggaaggtgtc caatttactg accgtacacc aaaatttgcc 600
tgcattaccg gtcgatgcaa cgagtgatga ggttcgcaag aacctgatgg acatgttcag 660
ggatcgccag gcgttttctg agcatacctg gaaaatgctt ctgtccgttt gccggtcgtg 720
ggcggcatgg tgcaagttga ataaccggaa atggtttccc gcagaacctg aagatgttcg 780
cgattatctt ctatatcttc aggcgcgcgg tctggcagta aaaactatcc agcaacattt 840
gggccagcta aacatgcttc atcgtcggtc cgggctgcca cgaccaagtg acagcaatgc 900
tgtttcactg gttatgcggc ggatccgaaa agaaaacgtt gatgccggtg aacgtgcaaa 960
acaggctcta gcgttcgaac gcactgattt cgaccaggtt cgttcactca tggaaaatag 1020
cgatcgctgc caggatatac gtaatctggc atttctgggg attgcttata acaccctgtt 1080
acgtatagcc gaaattgcca ggatcagggt taaagatatc tcacgtactg acggtgggag 1140
aatgttaatc catattggca gaacgaaaac gctggttagc accgcaggtg tagagaaggc 1200
acttagcctg ggggtaacta aactggtcga gcgatggatt tccgtctctg gtgtagctga 1260
tgatccgaat aactacctgt tttgccgggt cagaaaaaat ggtgttgccg cgccatctgc 1320
caccagccag ctatcaactc gcgccctgga agggattttt gaagcaactc atcgattgat 1380
ttacggcgct aaggatgact ctggtcagag atacctggcc tggtctggac acagtgcccg 1440
tgtcggagcc gcgcgagata tggcccgcgc tggagtttca ataccggaga tcatgcaagc 1500
tggtggctgg accaatgtaa atattgtcat gaactatatc cgtaacctgg atagtgaaac 1560
aggggcaatg gtgcgcctgc tggaagatgg cgattagcct gtcggggtgg aggcgagggc 1620
gtcttggcgc gtggtggccc tgacgctgct gctgctcccc gccgtgcctg cagcctccca 1680
gccgctaccc ccgcgcccgc tgcagccgag catgtgagta gcgcgagtcg tgaggctcct 1740
ggcggcgaag ctgacccgga cagaactcgg ggctttgtcc ctggggccac aaacaatggg 1800
ctctttgctt taactgagga ggggatggtc tagacccggg gtcccggact ggatttggtg 1860
ccctcgagtc tgccgcaggg cccatagcct ccgggttccc gcccctgcag caagggtcct 1920
gcagacttag acggatgccg aactccggag aggtgaggaa tccaagcccc tgcggcgcag 1980
ggtccagctg gggagccagc ttggaggcgg ccgagaggaa gcagcctggt cccacttcct 2040
ccccaagcta gtctcctggg gtccgagggc ctgcgcaggg gcgggggtgc ccagaggggg 2100
ctgccagcac tgttttgtgt gttaaacacg tgcgct 2136
<210> 8
<211> 99
<212> DNA
<213> Rattus norvegicus
<400> 8
cccacgtcca ctggagatcc taaggcagca tgcctcccaa gaagcctgag cccaagaagg 60
agactgccaa ggcagccgca gcccctgccc cagctcctg 99
<210> 9
<211> 60
<212> DNA
<213>Artificial sequence
<400> 9
gatcactaat acgactcact ataggccttg gcagtctcct tctgttttag agctagaaat 60
<210> 10
<211> 60
<212> DNA
<213>Artificial sequence
<400> 10
gatcactaat acgactcact ataggagaag cctgagccca agagttttag agctagaaat 60
<210> 11
<211> 99
<212> DNA
<213>Artificial sequence
<400> 11
cccacgtcca ctggagatcc taaggcagca tgcctcccaa gaagcctgag cccaagaaga 60
agactgccaa ggcagccgca gcccctgccc cagctcctg 99
<210> 12
<211> 443
<212> DNA
<213> Rattus norvegicus
<400> 12
ggaggacgaa ctggtgacaa taatgagatg tcagctgcac cctgctggtg tcccttcctt 60
ttatagtcag cagcagttgc tccagctctc accagcccct ctgtgggggc tcctacccag 120
aataaaagca ggggaaggcc ttccagtctc ccatcttcct ctcaggagcc acctttcctc 180
agtttttagg tcccacgtcc actggagatc ctaaggcagc atgcctccca agaagcctga 240
gcccaagaag gagactgcca aggcagccgc agcccctgcc ccagctcctg ccccagctcc 300
cgagcccctc agggactctg cctttgatcc caagagtgtg aaggtaagtg aaggccagcg 360
ctgacgacag tcaggatcct gtttttcctg ttgcagagag atctattctc tcaggccaga 420
gatgagagcc atgacctata gcc 443
Claims (22)
1. a kind of method for improving foreign gene homologous recombination efficiency, is included in target gene group and imports cas9, purpose is targetted
The sgRNA and homologous recombination repair template DNA of gene, it is characterised in that the Cas9 of the sgRNA mediations is to target gene group
The cutting efficiency of PAM Sequences upstreams is at least 15.4%.
2. the method as described in claim 1, it is characterised in that the PAM sequences of the target gene group are NGG or NAG.
3. the method as described in claim 1, it is characterised in that the Cas9 is Cas9 mRNA or Cas9 albumen.
4. the method as described in claim 1, it is characterised in that the sgRNA and target DNA complementary sequence is 17nt-
22nt。
5. the method stated such as claim 4, it is characterised in that the sgRNA and target DNA complementary sequence is 18nt-20nt.
6. the method stated such as claim 5, it is characterised in that the sgRNA and target DNA complementary sequence is 18nt.
7. the method as described in any in claim 1 to 6, it is characterised in that the homologous recombination repair template DNA is ring-type
Plasmid or linearisation double-stranded DNA.
8. method as claimed in claim 7, it is characterised in that the homologous recombination repair template carries out same sense mutation.
9. method as claimed in claim 8, it is characterised in that described homologous recombination repair template DNA or so homology arm is at least
500bp。
10. method as claimed in claim 9, it is characterised in that described homologous recombination repair template DNA or so homology arm is not right
Claim.
11. the method as described in any in claim 1 to 6, it is characterised in that the homologous recombination repair template DNA is linear
Change single stranded DNA.
12. method as claimed in claim 11, it is characterised in that the homologous recombination repair template carries out same sense mutation.
13. method as claimed in claim 12, it is characterised in that described homologous recombination repair template DNA or so homology arm is at least
For 40bp.
14. method as claimed in claim 13, it is characterised in that described homologous recombination repair template DNA or so homology arm is not right
Claim.
15. the method as described in any in claim 1 to 6, it is characterised in that the target gene group is people, mouse, zebra
Gene in fish, bacterium, drosophila, yeast, nematode or crop plant cells.
16. method as described in claim 7, it is characterised in that the target gene group be people, mouse, zebra fish, bacterium,
Gene in drosophila, yeast, nematode or crop plant cells.
17. method as described in claim 8, it is characterised in that the target gene group be people, mouse, zebra fish, bacterium,
Gene in drosophila, yeast, nematode or crop plant cells.
18. method as described in claim 9, it is characterised in that the target gene group be people, mouse, zebra fish, bacterium,
Gene in drosophila, yeast, nematode or crop plant cells.
19. method as described in claim 10, it is characterised in that the target gene group is people, mouse, zebra fish, thin
Gene in bacterium, drosophila, yeast, nematode or crop plant cells.
20. method as described in claim 11, it is characterised in that the target gene group is people, mouse, zebra fish, thin
Gene in bacterium, drosophila, yeast, nematode or crop plant cells.
21. method as described in claim 12, it is characterised in that the target gene group is people, mouse, zebra fish, thin
Gene in bacterium, drosophila, yeast, nematode or crop plant cells.
22. method as described in claim 13, it is characterised in that the target gene group is people, mouse, zebra fish, thin
Gene in bacterium, drosophila, yeast, nematode or crop plant cells.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610272812.0A CN107326046A (en) | 2016-04-28 | 2016-04-28 | A kind of method for improving foreign gene homologous recombination efficiency |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610272812.0A CN107326046A (en) | 2016-04-28 | 2016-04-28 | A kind of method for improving foreign gene homologous recombination efficiency |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107326046A true CN107326046A (en) | 2017-11-07 |
Family
ID=60192340
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610272812.0A Pending CN107326046A (en) | 2016-04-28 | 2016-04-28 | A kind of method for improving foreign gene homologous recombination efficiency |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107326046A (en) |
Cited By (31)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| CN108841854A (en) * | 2018-06-11 | 2018-11-20 | 北京市农林科学院 | A method of obtaining carrot mutant |
| CN109266651A (en) * | 2018-10-15 | 2019-01-25 | 广州鼓润医疗科技有限公司 | SgRNA based on CRISPR/Cas9 technical editor's HBB-41/42 deletion mutation site |
| CN109266652A (en) * | 2018-10-15 | 2019-01-25 | 广州鼓润医疗科技有限公司 | SgRNA, carrier and application based on the mutational site CRISPR/Cas9 technical editor HBB-28 |
| CN109868288A (en) * | 2019-03-15 | 2019-06-11 | 张力 | Cas9 transcription templates DNA and Plasmid DNA and in-vitro transcription method for drosophila CRISPR transgenosis |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| CN111088253A (en) * | 2018-10-24 | 2020-05-01 | 广州鼓润医疗科技有限公司 | CRISPR (clustered regularly interspaced short palindromic repeats) single-base donor repair system for HBB-28 thalassemia gene |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| CN111621500A (en) * | 2020-05-29 | 2020-09-04 | 上海市第十人民医院 | Rat model for atrial fibrillation/atrial cardiomyopathy based on MYL4 gene editing and construction method thereof |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| CN114045310A (en) * | 2021-11-02 | 2022-02-15 | 珠海横琴爱姆斯坦生物科技有限公司 | Method for improving gene repair efficiency |
| CN114107292A (en) * | 2020-08-27 | 2022-03-01 | 阿思科力(苏州)生物科技有限公司 | Gene editing system and method for site-specific insertion of foreign gene |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104195177A (en) * | 2014-08-05 | 2014-12-10 | 南京大学 | Method for remarkably improving fish genome editing efficiency |
| CN104968784A (en) * | 2012-10-23 | 2015-10-07 | 基因工具股份有限公司 | Composition for cleaving a target DNA comprising a guide RNA specific for the target DNA and CAS protein-encoding nucleic acid or CAS protein, and use thereof |
| CN105408497A (en) * | 2013-03-15 | 2016-03-16 | 通用医疗公司 | Using truncated guide rnas (tru-grnas) to increase specificity for rna-guided genome editing |
-
2016
- 2016-04-28 CN CN201610272812.0A patent/CN107326046A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104968784A (en) * | 2012-10-23 | 2015-10-07 | 基因工具股份有限公司 | Composition for cleaving a target DNA comprising a guide RNA specific for the target DNA and CAS protein-encoding nucleic acid or CAS protein, and use thereof |
| CN105408497A (en) * | 2013-03-15 | 2016-03-16 | 通用医疗公司 | Using truncated guide rnas (tru-grnas) to increase specificity for rna-guided genome editing |
| CN104195177A (en) * | 2014-08-05 | 2014-12-10 | 南京大学 | Method for remarkably improving fish genome editing efficiency |
Non-Patent Citations (2)
| Title |
|---|
| ZHANG,Y.L, ET AL: "Comparison of non-canonical PAMs for CRISPR/Cas9-mediated DNA cleavage in human cells", 《SCIENTIFIC REPORTS》 * |
| 谢胜松 等: "CRISPR/Cas9系统中sgRNA设计与脱靶效应评估", 《遗传》 * |
Cited By (48)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| CN108841854A (en) * | 2018-06-11 | 2018-11-20 | 北京市农林科学院 | A method of obtaining carrot mutant |
| CN108841854B (en) * | 2018-06-11 | 2021-09-17 | 北京市农林科学院 | Method for obtaining carrot mutant |
| CN109266651A (en) * | 2018-10-15 | 2019-01-25 | 广州鼓润医疗科技有限公司 | SgRNA based on CRISPR/Cas9 technical editor's HBB-41/42 deletion mutation site |
| CN109266652A (en) * | 2018-10-15 | 2019-01-25 | 广州鼓润医疗科技有限公司 | SgRNA, carrier and application based on the mutational site CRISPR/Cas9 technical editor HBB-28 |
| CN111088253A (en) * | 2018-10-24 | 2020-05-01 | 广州鼓润医疗科技有限公司 | CRISPR (clustered regularly interspaced short palindromic repeats) single-base donor repair system for HBB-28 thalassemia gene |
| CN109868288A (en) * | 2019-03-15 | 2019-06-11 | 张力 | Cas9 transcription templates DNA and Plasmid DNA and in-vitro transcription method for drosophila CRISPR transgenosis |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| CN111621500B (en) * | 2020-05-29 | 2023-03-31 | 上海市第十人民医院 | Rat model for atrial fibrillation/atrial cardiomyopathy based on MYL4 gene editing and construction method thereof |
| CN111621500A (en) * | 2020-05-29 | 2020-09-04 | 上海市第十人民医院 | Rat model for atrial fibrillation/atrial cardiomyopathy based on MYL4 gene editing and construction method thereof |
| CN114107292A (en) * | 2020-08-27 | 2022-03-01 | 阿思科力(苏州)生物科技有限公司 | Gene editing system and method for site-specific insertion of foreign gene |
| CN114107292B (en) * | 2020-08-27 | 2024-03-12 | 阿思科力(苏州)生物科技有限公司 | Gene editing system and method for site-directed insertion of exogenous gene |
| CN114045310A (en) * | 2021-11-02 | 2022-02-15 | 珠海横琴爱姆斯坦生物科技有限公司 | Method for improving gene repair efficiency |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107326046A (en) | A kind of method for improving foreign gene homologous recombination efficiency | |
| CN107475300B (en) | Construction method and application of Ifit3-eKO1 gene knockout mouse animal model | |
| CN106701830B (en) | Pig embryo p66 knock-outshcMethod for gene | |
| Bassett et al. | CRISPR/Cas9 mediated genome engineering in Drosophila | |
| CN108410906A (en) | A kind of CRISPR/Cpf1 gene editing methods being applicable in Yu Haiyang shell-fish mitochondrial genomes | |
| CN106834347A (en) | A kind of goat CDK2 gene knockout carriers and its construction method | |
| CN106282231B (en) | Construction method and application of mucopolysaccharide storage disease type II animal model | |
| CN107287245A (en) | A kind of construction method of the Glrx1 Gene Knock-Out Animal Model models based on CRISPR/Cas9 technologies | |
| KR20190139318A (en) | Chimeric Genome Manipulation Molecules and Methods | |
| JP2022520428A (en) | Enzyme with RUVC domain | |
| JP6958917B2 (en) | How to make gene knock-in cells | |
| CN110257435B (en) | Construction method and application of PROM1-KO mouse model | |
| CN110643636B (en) | Megalobrama amblycephala MSTNa & b gene knockout method and application | |
| CN110484549A (en) | Genome targeting modification method | |
| CN105274141A (en) | Transgenic vector for target mutation of primordial germ cells, method for preparing transgenic vector and application thereof | |
| CN117187220A (en) | Adenine deaminase and its use in base editing | |
| KR20230074207A (en) | Systems and methods for translocating cargo nucleotide sequences | |
| CN111876422B (en) | Screening report system capable of being used for enriching CRISPR/Cas9 mediated accurate NHEJ repair cells | |
| Zhang et al. | Crispr/Cas9‐mediated cleavages facilitate homologous recombination during genetic engineering of a large chromosomal region | |
| CN110468132B (en) | sgRNA, transgenic expression vector, expression strain and screening method | |
| Pickett et al. | Efficient genome editing using CRISPR‐Cas‐mediated homology directed repair in the ascidian Ciona robusta | |
| CN114480497B (en) | Construction and application method of ep400 gene knockout zebra fish heart failure model | |
| CN109652459A (en) | A kind of honeybee gene editing method and editor's material based on CRISPR/Cas9 | |
| CN112342215B (en) | sgRNA sequence of targeted knockout channel catfish mstna gene and screening method thereof | |
| CN107881200A (en) | A kind of rapid screening method applied to model animal zebra fish transgenosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20171107 |