CN105219768B - Transformation of soybean event SHZD32 01 and its detection method - Google Patents

Abstract

The invention discloses DNA molecular unique in a kind of soybean plant strain comprising transformation of soybean event SHZD32 01 and seed and transformation of soybean event SHZD32 01, present invention also proposes the detection method of the specific DNA molecular；The transformation of soybean event SHZD32 01 contains at least one nucleic acid molecules included in following nucleic acid sequence：SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3、SEQ ID NO:4、SEQ ID NO:9 and its fully-complementary sequence；The detection method comprises the following steps：1) biased sample includes DNA and primer；2) nucleic acid amplification reaction is carried out, produces amplified production；3) amplified production is detected, the amplified production includes SEQ ID NO.1 or SEQ ID NO.2.The soybean strain of the present invention contains the transformation of soybean events of SHZD32 01, show very strong glyphosate tolerant, contribute to the control to weeds, transformation of soybean event SHZD32 01 DNA detections for the transformation of soybean event SHZD32 01 in identification sample and have exceptional values applied to the soybean breeder containing the DNA.

Description

Transformation of soybean event SHZD32-01 and its detection method

Technical field

The present invention is the transformation event of the soybean new on one, is referred to as SHZD32-01.The event is sweet to herbicide grass Phosphine (Glyphoste) shows stronger tolerance.The invention further relates to the plant portion relevant with transformation event SHZD32-01 Point, seed and products thereof.The present invention proposes the unique DNA moleculars of transformation event SHZD32-01 and proposes that plant part extracts The detection method of SHZD32-01 specific DNA moleculars in thing or seed extract.

Background technology

Soybean (Glycince max) is important industrial crops.Soybean is an important agronomy to the patience of herbicide Character, the particularly patience to glyphosate herbicidal.Glyphosate (N-phosphonomethylglycine) is a kind of plant thing The broad-spectrum herbicide of kind, it is that the product agriculture of Monsanto Company's production reaches the main component in (Roundup.RTM.) herbicide, is A kind of safety-type herbicide of half-life short in the environment.When glyphosate is sprayed in plant surface, glyphosate can systematically enter Enter whole plant.The phytotoxicity of glyphosate is due to its suppression to shikimic acid pathway, and shikimic acid is aromatic amino acid The precursor of synthesis, glyphosate can suppress the synthesis of 5- enolpyruvylshikimates -3- phosphate synthases (EPSPS) in plant.

The patience of glyphosate can be by obtaining to the relatively low mutant of glyphosate affinity, and this mutant is sweet in grass Remained able in the presence of phosphine show metabolic activity (U.S.Pat.Nos.5,633,435,5,094,945,4,535,060 and 6, 040,497).Cell can be also assigned by degraded (U.S.Pat.No.5,463,175) of the enzyme in plant tissue to glyphosate To the tolerance of glyphosate.These genes be used to produce glyphosate tolerant genetically modified crops, therefore can be effective using glyphosate Ground controls weeds without being caused damage to crop.Glyphosate-tolerant gene engineering have been used to corn (U.S.Pat.No.5,554, 798), wheat (U.S.Pat.No.6,689,880), cotton (U.S.Pat.No.6,740,488), soybean (WO 9200377) and The crops such as rape (US Patent Appl.20040018518).Glyphosate tolerant transgenosis and resistance to other herbicide transgenosis, such as Bar genes, (Toki el al., 1992；Thompson et al., 1987, herbicide-resistant glufosinate-ammonium) and useful selection Mark or evaluation mark, useful phenotype is provided for screening using with the chain of other economical characters.

The expression of foreign gene is influenceed by it in chromosome position, because the insertion point of foreign gene is different, conversion Body surface is existing widely different, therefore to screen substantial amounts of transformant to identify the conversion thing of introducing foreign gene optimized expression Part.Have been observed that the expression of quiding gene has large range of change in different tissues in different transformation events It is different., such as also can be different in the correlated expression of different transgenes in plant tissues there is also different spatial and temporal expression profiles, therefore Need to filter out the transformation event that a transgene expression level meets commercial applications from thousands of transformant.One Transformant with preferable expression and pattern, the transgenosis can be imported other something lost by the conventional method of sexual hybridization Pass in background, filial generation can keep the trait expression of former transformant foreign transgenes.The strategy may insure target gene Reliably expressed in a large amount of improved seeds for adapting to local growth.

Detecting special transformation event can be by identifying whether sexual hybrids plant or seed contain transgenosis, separately Outside, the method for detecting special transformation event is necessary to the regulation before being listed in accordance with approval and requirement, while is advantageous to carry out The food packing and storage of genetically modified crops.Using any nucleic acid detection method, such as PCR (PCR) or Polynucleotide is utilized The DNA hybridization method of probe can be detected whether containing transgenosis.These detection methods typically all pay close attention to conventional transgenosis Element, such as promoter, terminator, marker gene etc., but for distinguishing that different transformation events is invalid, especially with same The transformation event of one DNA vector is even more to analyze, except the chromosomal DNA sequence (side DNA) near non-intrusive transgenosis It is known.Such as Windels et al. 1999 herbicide-resistant genetically engineered soybean 40-3-2 has been used across insertion gene and The pair of primers of flanking sequence carries out the detection of transformation event, includes the sequence of insertion gene primer specific, another Individual primer includes flanking sequence (U.S. Patent No.：6,893,826；6,825,400；6,740,488；6,733,974 and 6, 689,880；6,900,014 and 6,818,807).

The present invention is on glyphosate tolerant soybean transformation event SHZD32-01 and special included in these soybean plant strains DNA molecular, these DNA moleculars to identify the plant from SHZD32-01, offspring and plant tissue are useful.

The content of the invention

It is by one that the present invention, which provides a kind of transformation of soybean event SHZD32-01 and its detection method, soybean SHZD32-01, Soybean culture kind is derived, and has the tolerance to glyphosate herbicidal, while provide and come from transformation event to detection SHZD32-01 plant and its offspring and organize useful soy bean DNA molecule.

The present invention proposes the transformation of soybean event of a new glyphosate tolerant for being named as SHZD32-01, and contains The event plant part, seed and by plant, plant part, seed and product and Lai product.

The present invention proposes a kind of new DNA molecular contained in the soya cells genome containing event SHZD32-01, This new DNA molecular in sample can be identified with a variety of methods.

The DNA molecular of a restructuring is proposed in the present invention, is present in the transformation of soybean event SHZD32-01, including Following given SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3、SEQ ID NO:4、SEQ ID NO:9 and should SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3、SEQ ID NO:4 and SEQ ID NO:In 9 fully-complementary sequences At least one nucleotide sequence.

Described recombinant DNA molecules, including nucleic acid sequence SEQ ID NO:1.

Described recombinant DNA molecules, including nucleic acid sequence SEQ ID NO:2.

Described recombinant DNA molecules, including nucleic acid sequence SEQ ID NO:3.

Described recombinant DNA molecules, including nucleic acid sequence SEQ ID NO:4.

Described recombinant DNA molecules, including nucleic acid sequence SEQ ID NO:9.

Described recombinant DNA molecules, including nucleic acid sequence SEQ ID NO:1 and SEQ ID NO:2.

Described recombinant DNA molecules, including nucleic acid sequence SEQ ID NO:3 and SEQ ID NO:4.

Described recombinant DNA molecules, recombinant DNA molecules described here come from transformation of soybean event SHZD320-01, bag The SHZD32-01 of event containing transformation of soybean representative seed specimen is stored in China typical culture collection center (China Center for Type Culture Collection, CCTCC), address：Wuhan, China Wuhan University, preservation date：2015 On August 18, deposit number is CCTCC NO:P201513；The Classification And Nomenclature of the preservation biomaterial is：Glycine cultivation is big Beans kind soybean SHZD32-01Glycine max (L) Merr..

Described recombinant DNA molecules, recombinant DNA molecules described here are present in soybean plant strain, soybean plant cell, soybean In seed, soybean plant strain part or commodity product(s).

A kind of DNA primer or probe proposed in the present invention includes sufficiently long continuous nucleotide sequence and comes from SEQ ID NO:9 or its complementary series, primer or probe described here are to diagnose transformation event SHZD32-01, DNA described here Primer and probe can be under stringent hybridization condition with including given SEQ ID NO:1-4 and SEQ ID NO:One in 9 The DNA molecular hybridization of nucleotide sequence, and can not be under stringent hybridization condition with not including given SEQ ID NO:1-4 and SEQ ID NO:The DNA molecular hybridization of a nucleotide sequence in 9.

First DNA molecular and different from first DNA molecular that a pair of DNA moleculars proposed by the present invention are included Each of two DNA moleculars, described here first DNA molecular and second DNA molecular are sufficiently long continuous comprising one section Nucleotide sequence come from SEQ ID NO:9, or the sequence with its complete complementary, as DNA primer and transformation event SHZD32- 01 DNA is used for the amplified production that amplified reaction produces transformation of soybean event SHZD32-01 in diagnostic sample together.

Method, the side existing for transformation event SHZD32-01 DNA molecular in a kind of detection sample proposed by the present invention Method includes：A) DNA of above-mentioned sample is made to be in contact with the DNA probe in claim 11；B) visit above-mentioned sample and above-mentioned DNA Pin is placed under stringent hybridization condition；C) hybridisation events of above-mentioned DNA probe and DNA molecular in above-mentioned sample are detected, above-mentioned DNA is visited Pin hybridizes with above-mentioned DNA molecular, illustrates transformation of soybean event SHZD32-01 DNA molecular in above-mentioned sample be present.

Method, the side existing for transformation event SHZD32-01 DNA molecular in a kind of detection sample proposed by the present invention Method includes：A) DNA of above-mentioned sample is made to be in contact with this in claim 12 to DNA molecular；B) amplified reaction generation is carried out Contain given SEQ ID 1-4 and SEQ ID NO:9 and its fully-complementary sequence in a nucleotide sequence amplified production； C) the DNA cloning product in above-mentioned reaction is detected, has amplified production in above-mentioned reaction, illustrates transformation of soybean be present in above-mentioned sample Event SHZD32-01 DNA molecular.

A kind of DNA detection kits proposed by the present invention include pair of primers or at least one DNA probe, and a) this is right here DNA primer includes at least one DNA molecular and comes from SEQ ID comprising sufficiently long continuous nucleotide sequence:9 or its complete complementary Sequence, here this can produce the amplified fragments for diagnosing transformation event SNZD32-01 to DNA primer；B) at least one DNA is visited Pin is diagnosis transformation event SHZD32-01.

The present invention proposes the soybean that a kind of field planting contains SHZD32-01, miscellaneous with glyphosate herbicidal processing in field Grass and the soybean plant strain control weeds in field growth containing SHZD32-01.

The technical scheme is that：

A kind of transformation of soybean event SHZD32-01 recombinant DNA molecules, it is characterised in that including SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3、SEQ ID NO:4、SEQ ID NO:9 and its fully-complementary sequence at least one nucleic acid sequence Row.

Described transformation of soybean event SHZD32-01 recombinant DNA molecules, it is characterised in that including nucleic acid sequence SEQ ID NO:1。

Described transformation of soybean event SHZD32-01 recombinant DNA molecules, it is characterised in that including nucleic acid sequence SEQ ID NO:2。

Described transformation of soybean event SHZD32-01 recombinant DNA molecules, it is characterised in that including nucleic acid sequence SEQ ID NO:3。

Described transformation of soybean event SHZD32-01 recombinant DNA molecules, it is characterised in that including nucleic acid sequence SEQ ID NO:4。

Described transformation of soybean event SHZD32-01 recombinant DNA molecules, it is characterised in that including nucleic acid sequence SEQ ID NO:9。

Described transformation of soybean event SHZD32-01 recombinant DNA molecules, it is characterised in that including nucleic acid sequence SEQ ID NO:1 and SEQ ID NO:2.

Described transformation of soybean event SHZD32-01 recombinant DNA molecules, it is characterised in that including nucleic acid sequence SEQ ID NO:3 and SEQ ID NO:4.

Described transformation of soybean event SHZD32-01 recombinant DNA molecules, it is characterised in that the recombinant DNA molecules come Preserved from transformation of soybean event SHZD320-01, the representative seed specimen comprising the transformation of soybean event SHZD320-01 In China typical culture collection center, deposit number is CCTCC NO:P201513.

Described transformation of soybean event SHZD32-01 recombinant DNA molecules, it is characterised in that the recombinant DNA molecules are deposited In soybean plant strain, soybean plant cell, soya seeds, soybean plant strain part or commodity product(s).

A kind of DNA primer or probe, it is characterised in that come from SEQ ID comprising sufficiently long continuous nucleotide sequence NO:9 or its complementary series, the DNA primer or probe are to diagnose the transformation of soybean event SHZD32-01, the DNA Primer and probe can be under stringent hybridization condition with including given SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO: 3、SEQ ID NO:4 and SEQ ID NO:The DNA molecular hybridization of a nucleotide sequence in 9, and can not be in stringent hybridization condition Down with not including given SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3、SEQ ID NO:4 and SEQ ID NO: The DNA molecular hybridization of a nucleotide sequence in 9.

A pair of DNA moleculars, it is characterised in that include first DNA molecular and second different from first DNA molecular DNA molecular, described first DNA molecular and each self-contained one section of sufficiently long continuous nucleotides sequence of second DNA molecular Row come from SEQ ID NO:9, or the sequence with its complete complementary, as DNA primer and the transformation of soybean event SHZD32-01 Recombinant DNA molecules together be used for amplified reaction produce diagnostic sample described in transformation of soybean event SHZD32-01 amplification production Thing.

The method of the recombinant DNA molecules of the transformation of soybean event SHZD32-01, its feature in a kind of detection sample be present It is, methods described includes：A) DNA of the sample is made to be in contact with described DNA probe；B) above-mentioned sample and described is made DNA probe is placed under stringent hybridization condition；C) hybridisation events of the DNA probe and DNA molecular in above-mentioned sample are detected, if institute The DNA molecular for stating DNA probe and above-mentioned sample hybridizes, then illustrates there is transformation of soybean event SHZD32-01's in the sample Recombinant DNA molecules.

The method of the recombinant DNA molecules of the transformation of soybean event SHZD32-01, its feature in a kind of detection sample be present It is, methods described includes：A) DNA of the sample is made to be in contact with a pair of described DNA moleculars；B) amplified reaction production is carried out Life contains given SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3、SEQ ID NO:4 and SEQ ID NO:9 Hes The amplified production of a nucleotide sequence in its fully-complementary sequence；C) the DNA cloning product in above-mentioned reaction is detected, if above-mentioned anti- There is amplified production in answering, then illustrate the recombinant DNA molecules of the transformation of soybean event SHZD32-01 in the sample be present.

A kind of DNA detection kits, it is characterised in that a) described including a pair of DNA primers or at least one DNA probe A pair of DNA primers include at least one DNA molecular and come from SEQ ID comprising sufficiently long continuous nucleotide sequence:9 or its is complete Complementary series, this can produce the amplified fragments for diagnosing the transformation of soybean event SNZD32-01 to DNA primer；B) at least one Individual DNA probe is the diagnosis transformation of soybean event SHZD32-01.

The present invention proposes that is named the transformation of soybean event in SHZD32-01, has to herbicide glyphosate fine Tolerance, the representational Seed Deposit of its offspring is in China typical culture collection center (CCTCC), deposit number CCTCC NO:P201513.The present invention is it is also proposed that the DNA molecular relevant with transformation event SHZD32-01 and these DNA newly The application method of molecule.The present invention is it is also proposed that transformation of soybean event SHZD32-01 seed, offspring, plant part, cell and business Product product.The present invention is it is also proposed that the method for transformation of soybean event SHZD32-01 application method and production GM Roundup-Ready soyabean.

The present invention proposes the recombinant DNA molecules relevant with transformation of soybean event SHZD32-01.These recombinant DNA molecules bags Containing the genomic DNA region for representing transformation event SHZD32-01 transgenosis insertion flanking sequence, and/or transgenosis insert region, And/or the flanking sequence of the land between the insertion of any one transgenosis and flanking sequence.The invention also provides as drawing Existing for the diagnosis transformation event SHZD32-01 that thing and probe use DNA molecular and diagnosis transformation of soybean event SHZD32-01 Amplified production.Also disclose that the soybean plant strain for including these molecules, plant cell, plant part, commodity product(s), offspring and kind Son.

The present invention proposes the method and reagent that the DNA for detecting transformation event SHZD32-01 exists and/or is not present Box, the present invention propose that detection SHZD32-01 method is by mixing, allowing from transformation event with primer sets by sample DNA SHZD32-01 genomic DNA carries out the DNA amplification piece that nucleic acid amplification reaction produces diagnosis transformation of soybean event SHZD32-01 Section, carry out nucleic acid amplification reaction and produce the DNA product of amplification, and the DNA of detection amplification exists and/or is not present.This hair Bright to it is also proposed a kind of detection SHZD32-01 method be to contact sample DNA with probe, is turned in hybridization reaction from soybean Change event SHZD32-01 DNA can with there is specific DNA molecular hybridization to transformation event SHZD32-01, carry out hybridization reaction, The hybridization of detection probe and DNA molecular.The method and constituent that kit includes in the present invention come from transformation event to detection SHZD32-01 DNA presence is useful.

The present invention proposes transformation of soybean event SHZD32-01 soybean plant strain, seed, plant cell, Progeny plants, plant Part, or from plant, plant cell, or seed commodity product(s).The present invention is it is also proposed that soybean plant strain, seed, plant are thin Born of the same parents, plant part, or commodity product(s) contain recombinant DNA molecules and contain the SEQ ID provided:1-4 and SEQ ID NO:9 is mutual with its A nucleotide sequence in complementary series.The present invention is it is also proposed that soybean plant strain, seed, plant cell, Progeny plants, plant part, Or contain transformation of soybean event SHZD32-01 and comprising recombinant DNA molecules from the commodity product(s) with plant or seed, in DNA It can be produced including SEQ ID in amplified reaction:1,SEQ ID:2 amplified production.

Another aspect of the present invention is the method using the soybean plant strain control weeds containing SHZD32-01, its side in field Method includes the soya seeds that field planting contains transformation event SHZD32-01, and the representational Seed Deposit is in Chinese allusion quotation Type culture collection (CCTCC), its numbering is CCTCC NO:P201513.Allow above-mentioned seed to sprout and utilize effective grass Sweet phosphine application dosage handles the growth that above-mentioned plant controls the weeds in field.

According to another aspect of the invention, it is proposed that the method for production glyphosate tolerant soybean comprises the following steps：(a) with one Glyphosate tolerant soybean parent containing transformation event SHZD32-01, enters with the parent soybean of second no glyphosate tolerant Row hybridization, produce the Progeny plants of homozygosis；(b) Progeny plants of glyphosate tolerant are screened.It can be described as in detail, the present invention proposes logical It is with the glyphosate tolerant soybean containing transformation event SHZD32-01 to cross sexual hybridization and produce glyphosate tolerant plant and the method for seed Seed is produced with second soybean material hybridization, these seeds is planted and obtains Progeny plants, handling these offsprings with glyphosate plants Strain, screening obtain the Progeny plants of resistance glyphosate.Method also includes, and allows these Progeny plants filtered out to carry out selfing generation pure The second generation Progeny plants of conjunction, and therefrom select the plant of resistance glyphosate.Method is also including with the Progeny plants filtered out and separately An outer soybean plant strain (material) carries out sexual hybridization and produces seed, plants these seeds and obtains second generation Progeny plants, with grass Sweet phosphine handles these second generation Progeny plants, and screening obtains the second generation Progeny plants of resistance glyphosate.Generation proposed by the present invention Glyphosate tolerant plant and the method for seed, kind is produced by being selfed the glyphosate tolerant soybean containing transformation event SHZD32-01 Son, plant these seeds and obtain Progeny plants, handle these Progeny plants with glyphosate, the offspring that selection obtains glyphosate tolerant plants Strain.Breeding method can include the parent with the parental plant containing transformation event SHZD32-01 and second also glyphosate tolerant Soybean hybridizes, and that is found in each parent screens resistance to grass with glyphosate tolerant phenotype in genetically chain DNA molecular marker Sweet phosphine offspring.

One aspect of the invention is plant or the seed for proposing to come from transformation of soybean event SHZD32-01, or from plant The structure and detection method of transgenosis/genome land domain dna in the product of thing part or seed.The DNA molecular bag of proposition Include SEQ ID NO containing at least one be selected from:1 and SEQ ID NO:2 transgenosis/genome land, and its complementary series. Land molecule is across the region that soya cells genome is inserted into comprising allogeneic dna sequence DNA and the soybean of the flanking sequence of insertion point Genomic DNA.This combines region sequence and on the one hand is defined as including nucleotides SEQ ID NO respectively:9 824-844 or 3994- 4014 positions.Another aspect of the present invention, land can also be defined as one comprising flanking gene group and transgenic part or Multiple sequences, such as following nucleotide sequence SEQ ID NO provided:804-844 in 9,774-844,824-864,824- 894,774-894,3974-4014,3944-4014,3994-4034,3996-4014,3996-4066, or 3946-4066.This A little sequences and the Plants and Seeds comprising these sequences form another aspect of the present invention.

The present invention proposes a new DNA molecular for coming from transformation of soybean event SHZD32-01, includes transgenosis/gene The SEQ ID NO.3 in group region, or its complementary series.Comprising SEQ ID NO.3 for originally in the genome of soybean plant strain and seed The one side of invention, SEQ ID NO.3 further include complete SEQ ID NO.1.

An according to another aspect of the invention, it is proposed that DNA molecular SEQ ID for including transgenosis/genome area NO.4, or its complementary series, the DNA molecular are new DNA moleculars specific to transformation of soybean event SHZD32-01.Soybean is planted It is another aspect of the present invention that strain and seed, which include SEQ ID NO.4,.SEQ ID NO.4 further include complete SEQ ID NO.2。

From SEQ ID NO.3 or SEQ ID NO.4, or SEQ ID NO.9 any nucleotide primer pair, or it is mutual with it The sequence of benefit, when the derived tissues for NDA amplified reactions identification transformation of soybean event SHZD32-01, respectively comprising SEQ Any portion of amplifications of ID NO.1 or SEQ ID NO.2 or SEQ ID NO.9 are another aspect of the invention.It is specific at one Primer pair can be made up of primer A (SEQ ID NO.5) and primer D (SEQ ID NO.8) in embodiment.

Another aspect of the present invention is soybean plant strain, or seed, or comes from plant or the product of seed includes conversion thing Part SHZD32-01, the isolated genes group DNA from soybean plant strain, or seed, or product, caused extension increasing sequence include SEQ ID NO.1 and SEQ ID NO.2.

Yet another aspect of the present invention is soybean plant strain, or seed, or the product from plant or seed includes conversion Event SHZD32-01, the genomic DNA separated from soybean plant strain, or seed, or product caused amplification in amplified reaction Sequence, the use of DNA primer molecule is SEQ ID NO.5 and SEQ ID NO.6 in this DNA cloning method.

Another aspect of the present invention is soybean plant strain, or seed, or product, or the commodity bundle from plant or seed is containing turning Change event SHZD32-01, soybean plant strain, or seed, or the genomic DNA of product are separated, amplification is produced using DNA cloning method Fragment, primer molecule SEQ ID NO.7 and SEQ ID NO.8 are used in DNA cloning method herein.Product or commodity can be with Comprising, do not limit, food or feed product, or comprising containing the following of transformation event SHZD32-01 from one or more Product：Lecithin, aliphatic acid, glycerine, sterol, edible oil, degreasing dregs of beans, soy food product include degreasing and baking soybean dietary, Soya-bean milk bean curd, soy meal, textured soybean protein, and soybean fiber.

According to another aspect of the invention, it is proposed that transformation of soybean event SHZD32-01 specific DNAs are present in detection sample Method.This method includes：(a) biased sample includes DNA and primer；(b) nucleic acid amplification reaction is carried out, produces amplified production； (c) amplified production is detected, amplified production here includes SEQ ID NO.1 or SEQ ID NO.2.Divided using DNA primer is contained It is the another of the present invention that the kit of son, which is used to DNA amplification reaction produce the amplification comprising SEQ ID NO.1 or SEQ ID NO.2, Aspect.

According to another aspect of the invention, it is proposed that transformation of soybean event SHZD32-01 specific DNAs are present in detection sample Method.This method includes：(a) biased sample include DNA with can under stringent hybridization condition with transformation event SHZD32-01 Genomic DNA hybridized and can not be under this condition with compareing soybean plant strain DNA hybridization；(b) it is in sample and probe Under strict hybridization conditions；(c) detection probe and transformation event SHZD32-01DNA hybridisation events, probe described here include SEQ ID NO.1 or SEQ ID NO.2.Sample can include progeny seed, plant, or include transformation event SHZD32-01's Plant part, or it is any from the following products containing transformation event SHZD32-01：Lecithin, aliphatic acid, glycerine, sterol, food With oil, degreasing dregs of beans, soy food product includes degreasing and toasts soybean dietary, soya-bean milk bean curd, soy meal, soy protein concentrate, greatly Beans protein isolate, hydrolyzed vegetable protein, textured soybean protein and soybean fiber.The DNA probe sequence that detection kit includes It is the another of the present invention that row, which include one containing the DNA sequence dna identical or complementary with SEQ ID NO.1 or SEQ ID NO.2 sequences, Aspect.The DNA molecular that kit includes includes SEQ ID NO.18, SEQ ID NO.19, or SEQ ID NO.20, or they Complementary series, and one aspect of the present invention.

It is described in detail：

The present invention relates to the transformation of soybean event of a new glyphosate tolerant for being named as SHZD32-01, Yi Jihan There are the event plant part, seed and the caused product by plant, plant part, seed and product.The present invention proposes a kind of The new DNA molecular contained in the soya cells genome containing event SHZD32-01, sample can be identified with a variety of methods In this new DNA molecular.The present invention proposes the soybean that a kind of field planting contains SHZD32-01, is removed in field with glyphosate Careless agent processing weeds and the soybean plant strain control weeds in field growth containing SHZD32-01.

Following definition and method provide more accurate explanation for the present invention.Annotation and vocabulary are according to the routine in pertinent literature Usage understands.

Soybean (Glycine max) described here, soybean varieties or soybean material comprising all incubations.

Used herein of vocabulary "comprising" the meaning be including but not limited to including.

Glyphosate refers to N-phosphonomethylglycine and its esters, and glyphosate is that agriculture reaches (Roundup.RTM.) Active additive in herbicide (Monsanto Company).Handled with glyphosate herbicidal and refer to be reached with agriculture RoundupRoundup Herbicide or any other include the herbicide containing glyphosate composition.Glyphosate Business formulation examples sell including but not limited to Monsanto Company ULTRAMAX, WithHerbicide, the above all isopropyl ammonium salts containing glyphosate； WEATHERMAX (glyphosate potassium), Monsanto Company is as herbicideWithSell, contain grass Sweet phosphine ammonium salt；What Monsanto Company soldContain sodium glyphosate；First just going out up to crop protection SellHerbicide, containing glyphosate trimethyl salt, it is upper that herbicide also includes containing for domestic each agricultural chemicals manufacturer production The herbicide of composition is stated, is using glyphosate tolerant of any of the above described Gyphosate herbicice agent prescription field processing containing SHZD32-01 Soybean can control the growth of weeds in field and growth or yield on the soybean plant strain containing SHZD32-01 do not influence.

" transformation event " is that allogeneic dna sequence DNA is imported into plant cell by converting, and the carrier for being such as loaded with foreign gene is outer by this The colony that source gene inserts Plant Genome and obtains regeneration plant and obtain, the spy of Plant Genome is inserted according to foreign gene Different site is selected.Event refers to the offspring of original transformant and the transformant including allogeneic dna sequence DNA.Transformation event also refers to logical Cross the offspring with exogenous DNA and flanking sequence DNA that transformant obtains with another mixing breed.Transformation event also refer to by containing The DNA for having the original transformant of insertion gene and flanking sequence passes through with inserting DNA parent containing this and not containing this The parent of insertion carries out sexual hybridization and imported into offspring, offspring is obtained the insertion gene.

" recombinant DNA molecules " refer to the DNA molecular that nature is not present, and the DNA molecular created under the intervention of the mankind, are Artificial synthesized two heterologous DNA moleculars are a polynucleotide sequence.Foreign gene is imported into soybean gene by the present invention Combined in group with the soybean gene group of insertion point, form the DNA molecular of restructuring.

The cultivation of glyphosate tolerant soybean is initially by the genetically engineered soybean containing glyphosate tolerant transformation event SHZD32-01 First parent of plant, or the offspring with there is the above-mentioned plant of glyphosate tolerant phenotype to hybridize, do not have glyphosate with second Tolerance parent carry out sexual hybridization, produce multiple first-filial generation plant；The method handled with glyphosate screens glyphosate tolerant Progeny plants.The step for further comprise being carried out with second or the 3rd soybean parentses with the Progeny plants of glyphosate tolerant Backcrossing, offspring's screening is carried out with glyphosate, or carry out screening using the molecular labeling related to the character and obtain glyphosate tolerant Soybean plant strain.Molecular labeling used includes the 5 ' and 3 ' of the event SHZD32-01 identified transgenic insert locus Land DNA molecular.

Breeding method, which includes that hybridization can be carried out with 2 different transformed plants producing offspring, includes 2 independent separates Foreign transgenes, it is returned, is hybridized with foregoing description method with nontransgenic plants, vegetative propagation with a parent, And the conventional breeding method for being used for various trait and crop described in known references.

Probe is a kind of nucleotides of separation, is attached on conventional detection mark or report molecule, such as the same position of radioactivity Element, part, chemiluminescence agent, or enzyme.One chain complementation of probe and target nucleotide, probe of the invention be with containing transformation event One chain complementation of SHZD32-01 genomic DNA, no matter DNA is from soybean plant strain or seed containing the event, or sample Product, or the extract of plant or seed.

The probe of the present invention not only includes DNA, ribonucleic acid, in addition to polyamide and other and target DNA sequence The probe material of row specific bond is used for the presence for detecting target DNA sequence.

Primer is the polynucleotide sequence of separation, and the target polynucleotide chain after annealing with complementation is hybridized, and is being drawn It is combined with each other between thing and target polynucleotide chain, is then extended in the presence of polymerase along target chain.The present invention's Primer pair is used for PCR, or conventional nucleic acid amplification method carries out the amplification use of target Polynucleotide molecule.

Probe or primer are usually 11 or more, 18 or more, the polynucleotide of 24 or 30 or more, tight Under the hybridization conditions control of lattice, probe and primer carry out specific hybridization with target nucleotide molecule.Probe and the primer of the present invention with The sequence of target molecule is completely the same, although probe is different from target sequence, it and target sequence are kept with conventional design probe sequence Row have the ability of hybridization under strict conditions.

Probe and method for preparing primer are with reference to (1989) such as Sambrook；Ausubel etc. (1992)；With Innis etc. (1990), according to known array using computer program carry out design of primers (Version 0.5 .COPYRGT.1991, Whitehead Institute for Biomedical Research,Cambridge,Mass.)。

Primer and probe is to design (SEQ ID NOS according to the flanking sequence and insertion gene order announced here:1- 4and 9), for confirming and correcting the sequencing result of conventional method announcement, example is from the seed containing transformation event SHZD32-01 Related DNA molecular is separated, determines the sequence of nucleic acid molecules.Further with regards to from contain transgenosis insertion and flanking sequence conversion The DNA of correlation is separated in event SHZD32-01 cellular genome, the part of these molecules and fragment are used as primer or spy Pin.

The nucleic acid probe and primer of the present invention hybridizes with target DNA sequence under strict conditions.Any conventional nucleic acid is miscellaneous Hand over and expand the presence that can be used for identifying transformation event SHZD32-01 specific DNA sequence in sample.Nucleic acid molecules or fragment Can specifically it hybridize with other nucleic acid molecules under certain conditions.If two nucleic acid molecules can be formed it is antiparallel, Double chain nucleotide structure, and this structure, above-mentioned two nucleic acid point are kept under conditions of height is strict with enough length Son just can be special and another hybridization.If nucleic acid molecules show complete complementation, just claim a nucleic acid and another core Acid molecule is complementary.When each nucleotides of molecule and another molecule are complementary, just claim the nucleotides of this molecule with Another molecule complete complementary.Anneal, claim if two molecules hybridize sufficiently stable be maintained under at least conventional low stringency condition Be faint complementation.Similarly, moved back if enough stabilizations can be hybridized between molecule under conditions of height is strict and remained to Fire, it is known as complementation.(1985) such as Sambrook etc. (1989) and Haymes are described to conventional stringent condition.It is not complete Complementation is also allowed, and this, which not fully excludes molecule, can form duplex structure.Nucleic acid molecules is used as primer, need There are enough complementary series, stable duplex structure can be formed under the concentration conditions of special solvent and salt.

Used herein above, basic homologous sequence is that nucleotide sequence is compared under high stringency, can specifically with Complementary nucleic acid array hybridizing.Appropriate stringent condition is the sodium chloride/sodium citrate (SSC) for improving DNA hybridization condition, such as 6 times At 45 DEG C, then washed with 2 times of SSC at 50 DEG C, in John Wiley＆Sons, N.Y. (1989) molecular biology flow (Current Protocols in Molecular Biology) 6.3.1-6.3.6. has been described.The salt such as in washing step Concentration can be from about 2.0 times of SSC of low stringency condition, 50 DEG C, to about 0.2 times of SSC of high stringency conditions, 50 DEG C.In addition, Temperature in washing step can be from the room temperature of ground stringent condition, about 22 DEG C, to about 65 DEG C of high stringency conditions.Temperature and Salinity can change, and either temperature or salinity can another condition changes with constant.It is preferable to carry out at one In example, a nucleic acid and the SEQ ID NOS that above provide in the present invention:1-4, and 9 and complementary series or any fragment One or more sequence of nucleic acid molecules or fragment hybridize under moderate stringency, 2.0 times of SSC, 65 DEG C.At one particularly preferably In embodiment, nucleic acid molecules of the invention and the SEQ ID NOS above provided:1-4, and 9 and its complementary series or any fragment One or more of nucleotide sequence specific hybridization under high stringency.One aspect of the present invention, the present invention one are excellent The labeled nucleic acid molecule of choosing includes nucleic acid sequence SEQ ID NO.1 or SEQ ID NO.2 or its complementary series set forth above Or any one fragment.Another aspect of the present invention, one preferable nucleic acid marking of the present invention have and SEQ set forth above ID NO.1 or SEQ ID NO.2 either any one fragment 80% and 100% or 90% He in its complementary series or both 100% sequence identity.The DNA molecular of molecular labeling includes SEQ ID NO.1 or SEQ ID NO.2 or its complementary series Or both any one fragment be used as the offspring that the molecular markers for identification of plant breeding hybridizes, it is described with Cregan etc. (1997) Simple sequence repeats DNA marker analysis method it is identical.The hybridization of probe and target dna can use known any method real Existing, these are including but not limited to fluorescence labeling, radioactive label, antibody labeling and chemiluminescent labeling.

On being expanded (such as PCR) to target nucleic acid sequence with special amplimer, " strict reaction condition " is to instigate Primer pair only hybridizes with target nucleic acid sequence, and a primer can be combined with template DNA, preferential in hot amplified reaction to produce uniqueness Amplified production.

" (with target sequence) specific bond " refer to primer and probe under stringent hybridization condition only with containing target sequence sample In target sequence hybridization.

" DNA " of amplification or " amplified production " refer to the product of target sequence nucleic acid amplification, are a nucleic acid-templated parts.Example Such as, it is determined that whether the soybean plant strain from sexual hybridization contains transformation event SHZD32-01, or the soybean sample got from field Whether this contains transformation event SHZD32-01, or extract of soybean, food, and whether flour or oil contain transformation event SHZD32-01.DNA is extracted from soybean plant strain tissue sample or extract, carries out nucleic acid amplification with pair of primers, first is drawn Thing comes from the heterologous transgene DNA of insertion from genome sequence adjacent to heterologous transgene DNA insertion points, second primer Sequence, the amplified production for diagnosing the transformation event is produced by amplification.There is amplified production certain length and sequence to diagnose The transformation event.The length range of amplified production adds a nucleotide pair from this length combined to primer, or plus big About 50 nucleotide bases pair, either plus about 250 base-pairs or plus about 350 base-pairs, or more.

In addition, primer may come from the flanking sequence at insetion sequence both ends, caused amplified fragments include whole insertion Nucleotide sequence.The position of primer can have a certain distance apart from insertion gene DNA sequence, and distance is 1 to 20,000 alkali Base pair." amplified production " refers to the product formed under the hot amplified reactions of DNA.

Nucleic acid amplification reaction can be completed by nucleic acid amplification reaction method known to any one, including polymerase chain reaction Answer (PCR).The technology of various amplification methods has been announced and in Innis etc. (1990) U.S. Patent No. 4,683,195 and 4, It is described in 683,202 patent.PCR amplification method has been able to amplification to 22kb genomic DNA and 42kb phagocytosis Body DNA (Cheng etc., 1994).These methods and other known PCR amplification method are applied in the present invention.That inserts is different Source DNA sequence or transformation of soybean event SHZD32-01 flanking sequence can by using primers given here, The method expanded by molecule is separated from transformation event, with the DNA sequencing method validation of standard and amendment PCR primer or The clone of separation.

Utilize the nucleotide sequence and description announced here or known DNA detection methods exploitation DNA detection kits.Reagent Box for the transformation of soybean event in identification sample and is very valuable applied to the soybean breeder containing the DNA.Detection The primer or probe that transformation event DNA is used, be it is homologous or complementary with SEQ ID NO.1-4 and 9, or DNA primer or Probe and the DNA homology included in transgenic element or complementation, it is anti-that these DNA sequence dnas can be used as primer to be used for DNA cloning Or DNA hybridization method should be used for as probe.The DNA structure of transgenic element is as shown in Figure 1 in soybean gene group：Middle beans 32 are big 5 ' ends of beans genome transgenosis insertion flanking sequence, followed by terminator (not having T-DNA left margins sequence), glyphosate resists Property gene G10-EPSPS, arabidopsis chloroplaset signal peptide sequence, enhancer, promoter, from the soil Agrobacterium T-DNA right side 3 ' ends of the genome transgenosis insertion side sequence of beans 32 in a part for arm, and adjacent soybean.Transformation of soybean event The DNA molecular of transgenic element in SHZD32-01 can be as the primer molecule in DNA cloning, and these primer molecules can Part primer as primer sets, also include the DNA primer molecule for carrying out transgenic insertion side wing sequence.Transformation of soybean event SHZD32-01 be as beans 32 in soybean strain as caused by agrobacterium-mediated transformation.

The present invention has following beneficial effect：

External source antiweed transgenosis is inserted into soybean (Glycine max) gene by the present invention by agrobacterium-mediated transformation Group, creates the DNA molecular of uniqueness, and discloses the partial sequence of the DNA molecular.The soybean strain of the present invention contains SHZD32-01 transformation events, show very strong glyphosate tolerant, and the invention of glyphosate tolerant soybean transformation event will be helpful to Control to weeds.Transformation event DNA detection is for the transformation of soybean event in identification sample and is applied to contain the DNA's Soybean breeder is very valuable.

Brief description of the drawings

Fig. 1 is that transgenosis inserts schematic diagram in soybean gene group in soybean SHZD32.

The Classification And Nomenclature of preservation biomaterial is：Glycine the cultivated soybean kind soybean SHZD32-01Glycine max (L) Merr., be stored in China typical culture collection center (China Center for Type Culture Collection, ), CCTCC address：Wuhan, China Wuhan University, preservation date：On August 18th, 2015, deposit number are CCTCC NO: P201513。

Embodiment

It is embodiments of the invention below, these embodiments are merely to illustrate the model of the present invention rather than the limitation present invention Enclose.On the premise of without departing substantially from essence spirit of the present invention and viewpoint, some changes are carried out in the embodiment of announcement and are remained able to Obtain similar or identical result.

Embodiment 1

SHZD32-01 genome specific DNA cloning

DNA, including soya seeds, nutritive issue or food are extracted from transformation of soybean event SHZD32-01 tissue.With The DNA extraction kit of raw work separates DNA from tissue, and method is shown in the specification of the DNA extraction kit.Or carried with CTAB methods Take DNA.

Amplified from the plant genome containing transformation of soybean event SHZD32-01, including T-DNA inserts 5 ' ends Portion gene group flanking sequence pcr amplification product, the DNA product includes SEQ ID NO.3.Designed PCR primer one Individual 5' terminal gene groups flanking sequence hybridization (DNA primer A, the SEQ ID NO.5 with transgenosis insertion；Such as FIG.1), match somebody with somebody therewith Transgenosis terminator region (seeing SEQ ID NO.9) is located to second primer (DNA primer B, SEQ ID NO.6).

Go out from the plant genome amplification containing transformation of soybean event SHZD32-01, including T-DNA inserts 3 ' ends The pcr amplification product of portion gene group flanking sequence, the DNA product include SEQ ID NO.4.A primer used in PCR is set It is calculated as hybridizing (DNA primer D, SEQ ID NO.8) with the genomic flanking sequence at the end of transgenosis insertion 3 ', second primer (DNA Primer C, SEQ ID NO.7) sequence between promoter and carrier.

Event primer DNA is used for the amplified production for producing diagnosis SHZD32-01 transformation of soybean events.These event primer bags Include, but be not limited to be used to describe DNA cloning method primer A and B (SEQ ID NO.5 and 6), and event primer C and D (SEQ ID NO.7 and 8).It is any in addition to come from SEQ ID NO.3 or SEQ ID NO.4, or these event primers being complementary to, Can be respectively used to DNA amplification reaction produce diagnosis SHZD32-01 Event origins tissue comprising SEQ ID NO.1 or The diagnosis that SEQ ID NO.2 amplified production can produce SHZD32-01 using suitable event primer expands.Change any reaction Condition produces diagnosis transformation event SHZD32-01 product all within conventional technique method category.When a kind of extraction of deduction Thing contains the DNA of the soybean plant strain comprising SHZD32-01 or seed, or when product is from plant containing SHZD32-01, can use Be used as template, the diagnosis that transformation of soybean event SHZD32-01 is produced with DNA cloning method is expanded to identify that SHZD32-01 is No presence.

Transformation event is produced using at least one primer sequence from SEQ ID NO.3 or SEQ ID NO.4 sequences SHZD32-01 diagnosis amplification, amplified reaction is carried out using PCR instrument (ABI, 2720) in accordance with the following steps：

DNA is extracted：

Fresh soybean plant strain blade is taken, is placed in liquid nitrogen and is ground into powdery.Add the slow μ l of liquid 500 of 2 × CTAB extractions, leaching Centrifuge tube is simultaneously overturned mixing by the powder of saturating soybean plant strain, plant powder is fully mixed with CTAB, in 65 DEG C of water-baths insulations 30 ~60min, gently mixed once per 10min.Centrifuge tube is taken out, is cooled to room temperature, 500 chloroforms of the μ l through 4 DEG C of precoolings of addition-different Amylalcohol mixed liquor (24:Lv/v), light and slow reverse mixing, 10min is stood.4 DEG C, 12000r/min centrifugations 10min.Supernatant is taken to another In one new centrifuge tube, add it is isometric in advance in the isopropanol of -20 DEG C of refrigerator precoolings, slightly mix after precipitated in refrigerator 30min with On.4 DEG C, after 12000r/min centrifuges 10min, abandon after supernatant and centrifuge tube is inverted on filter paper, 70% ethanol washing is heavy Form sediment 2 times, and in drying up moisture on aseptic operating platform.；DNA is dissolved in 50 μ l TE buffer solutions, adds 1 μ l RNaseA (10mg/ml), 37 DEG C of incubation 15min, -20 DEG C of preservations；DNA concentration is detected with Spectrophotometer ND-1000, every time Applied sample amount is 1.5 μ l.Agarose electrophoresis detects DNA concentration：0.8% agarose electrophoresis liquid is prepared, adds appropriate EB.Deposition condition U =120V, I=140mA.

Need to configure reagent：

CTAB extract solutions：2%CTAB, 1.4mol/L NaCl, 100mmol/L Tris-HCl, pH8.0,20mmol/L EDTA、pH8.0。

CTAB precipitated liquids：1%CTAB, 50mmol/LTris-HCl, pH8.0,10mmol/L EDTA, pH8.0.

TE buffer solutions：10mmol/L Tris-HCl、1mmol/L EDTA(pH8.0).

PCR is detected：PCR reaction conditions：94 DEG C of denaturation 5min, 94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C extend 1min, 35 circulations, amplified fragments 725bp.

72 DEG C of extension 10min after circulation terminates, then 4 DEG C of preservations.Take the μ l of pcr amplification product 10,1.2% Ago-Gel Electrophoresis detection (contains ethidium bromide), electrophoresis 40min, and photograph is observed under uviol lamp.

Embodiment 2

Transgenosis/genome sequence determination and Southern hybridization

The DNA sequence dna of PCR primer can provide the DNA molecular for designing primer or probe, for identifying containing conversion thing Part SHZD32-01 soybean plant strain or seed.Represent the PCR primer of transgenosis/flanking sequence 5' and 3' expection clip size It is separated by 2.0% agarose gel electrophoresis.The PCR primer being separated contain 5' and 3' ends across turning base Because of the Intercalation region being inserted between genome.The PCR primer at transformation of soybean event SHZD32-01 5' and 3' ends passes through Agarose gel electrophoresis is purified, and is operated according to DNA glue reclaims kit (SK8131), by DNA sequence dna and agarose matrix point Separate out and.DNA fragmentation and pMD18-T carriers are connected, send sequencing company to be sequenced.

The nucleotides that the nucleotide sequence that determined dna sequence obtains represents event SHZD32-01 transgenosis/genome area is surveyed Sequence, see Fig. 1.Qualification result is shown in SEQ ID NO.9.Genome and the transgenic element description included in SEQ ID NO.9, sees below Table 1.The flanking sequence at 5' and 3' ends is included in SEQ ID NO.9, and is listed in SEQ ID NO.21 and SEQ ID NO.22.

Binding sequence is relatively short nucleic acid molecule, is new nucleic acid molecules, when progress polynucleotide molecule detection When can be as transformation event SHZD32-01 diagnosis molecule.In SEQ ID NO.1 and SEQ the ID NO.2 generations of binding site Transgenic fragment and the polynucleotide of genomic DNA every aspect 10 in mono- insertion point of table SHZD32-01.It is longer or shorter Polynucleotides binding sequence chosen from SEQ ID NO.3 or SEQ ID NO.4, joint molecule (5' lands SEQ ID NO.1 and 3' lands SEQ ID NO.2) in DNA detection methods as DNA probe or DNA primer molecule it is extremely to have .The primer and probe of transformation event is detected dedicated for transformation of soybean event SHZD32-01 detection.Primer molecule is referred to It is set to SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, probe molecule are designated as SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.10, SEQ ID NO.11.Separately The outer fragment for being used to produce amplified production from soy food product also includes SEQ ID NO.18-20.

Table 1 contains the genome and something lost of SHZH32-01 soybean genes group transgenosis/genomic fragment (SEQ ID NO.9) Pass element

Southern Blot are analyzed

Plant genome DNA containing SHZD32-01 and control Soybean genomic DNA (each about 15mug) are various Restriction Enzyme digestion (140U) includes the 15ul restricted cores of buffer (NEB, Beverly, Mass.) in 150ul cumulative volume Sour restriction endonuclease, e.g., BamH I, Pst I, Hind III, and Xba I are analyzed for SHZD32-01 Southern.Endonuclease exists Digested at appropriate temperature at least 6 hours.After incubation, DNA 3M sodium acetates and the ethanol precipitation of 2.5 volumes.Following DNA is used 70% ethanol washing, dries and is resuspended in 40mul TBE.Loading buffer (0.2 are added in the sample Times), then in Ago-Gel (0.8%) upper 30 watts of electrophoresis 16-18 hours.Gel is brominated the dyeing of second ingot, and it is molten to spend purine Liquid processing (0.125N HCL) 10 minutes, is handled, (0.5M sodium hydroxides, 1.5M sodium chloride) 30 minutes, finally with denaturing soln Handled 30 minutes with solution (0.5M Trizma base, 1.5M sodium chloride) is neutralized.DNA is transferred on hybridization-N films (Amersham Pharmacia Biotech, Buckingamshire, England) uses blotting paper (Schleicher and Schuell, Dassel, Germany) inhale 4-6 hours and then be fixed to ultraviolet lighting on film.

Film 20ml DIG Easy Hyb solution prehybridizations 2-4hours at 45 DEG C.With markd DNA probe with SEQ ID NO.1, or SEQ ID NO.2, or SEQ ID NO.3, or SEQ ID NO.4, or other sequences are a part of homologous Or it is complementary, the nucleic acid being not bound with is removed.The DIG Easy Hyb preheated with 10ml, the solution containing denatured probe replace pre- Hybridization solution.The marking hybridizes 16-18 hours at 45 DEG C.

The marking is washed off in low stringency solutions (5.times.SSC, 0.1.times.SDS) at 45 DEG C, repeats to use again Higher stringency solutions repeated washing (0.1.times.SSC, 0.1%SDS) at 65 DEG C.The marking exposes.What these were illustrated Method and condition in detecting sample DNA when can suitably change.

Embodiment 3

Weeds distribution

With the soybean containing SHZD32-01 the growth of weeds is controlled in field.Field planting contains SHZD32-01 soybean Seed, seed, which is sprouted, turns into plant, with the plant in herbicide treatment field of the formula containing glyphosate.Glyphosate formula it is effective Dosage is used for field with about 0.25lb ae/A (content of glyphosate balance, the pound/land measure equal to fifteen mu in most parts of the Northeast) to 3 or higher dosage.Using model Enclose from about 0.75lb ae/A to 1.5lb ae/A in fertility season as needed in the life of the one or many control weeds of field processing It is long.The seed containing SHZD32-01 is harvested from the plant of glyphosate processing.

The representative SHZD32-01 of Shanghai Communications University's preservation Soybean Species that are disclosed above and being cited in detail in the claims Son is deposited in China typical culture collection center (CCTCC), Wuhan University of Wuhan City of Hubei China province in the school, postcode 430072, the Classification And Nomenclature of the preservation biomaterial is：Glycine the cultivated soybean kind soybean SHZD32-01Glycine max (L) Merr., deposit number is CCTCC NO:P201513, preservation date are August in 2015 18, and storage life is (self-insurance in 30 years Tibetan center calculates from receiving), continue preservation 5 years again after the request that culture samples are provided is received before expiring.

The principle of present invention described above, person skilled in the art can be apparently in the premises without departing from these principles Under be changed in proceedings and details.Our claim be included in without departing from the claims in the present invention scope and All changes of spirit.

Sequence table

SEQ ID NO.1

<110>Shanghai Communications University

<120>Transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 1

<211> 20

<212> DNA

<213> ORGANISM:Artificial Sequence

<400> 1

1TGCATTTTAACGAATTAATT

SEQ ID NO.2

<110>Shanghai Communications University

<120>Transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 2

<211> 20

<212> DNA

<213> ORGANISM:Artificial Sequence

<400> 1

1GTTTCCCGCCATAAGGGTGT

SEQ ID NO.3

<110>Shanghai Communications University

<120>Transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 3

<211> 1054

<212> DNA

<213> ORGANISM:Artificial Sequence

<400> 1

1

TGCCATCATCAATGGTCACACGGAGTGGGACTACAGAATTTGAAAATAGTAGAGAAAACAGCAGTGGGC ACTTGCTATTTTCCTTTCATCATTGGAAATTAAATGGGGAAAGGGAAAAAAATATTTCTGTTTTCTACAATGAATGA CAATAATAGGAGATTTGGTTTTCGTAGAATCAGAATTATTCAAAAAAAGAAAAACAGAATTCCATTGAACGAATTCC CTGCACTTTTGTTGATACTAAGGGTATATCTCTCTCTTGATATTGGGAGATTATTTCCTCCATAGAGTACAATTTTT TTTTTTTTTTACTTTTTTCAAGTTTCAACAAGTTTTTACAGTAAATACATAGAAATTTAATTATTTTCAAAATTGGA TAAAACGCCTTCATTTATAGAGAATTTTCTCTCTCCCTGTGTATTTATTTCTTATAACTTGAAGCTTCTTTGGAATG CTGCTTTATCTTTTAAAACAGCTTGTTTTAAGGTTAACATTAACTAAATTCCCTATCATCTACTTACTTTGCCGGCC GACTAGTTATAAAAGAATTAGATGATTCATTGCCTCAACCTATTAGGGTTTTCCCGATGAAGGATTAAATTAGACAT AATTAGGTGCATGAAGGCTTAAGTTTGATCTTCCTTATTATTATTGTATTAAAAAAAAAGCAAATTACACTAACTCT CTATGTTTAATACTTGTTACACTCAAAGTCACTCATTATTGGAACCCTACACATCCCCTTCCCCCTTCGCTGTTGCA ACTCATTGCACAAAGACCCCCTAACCGTCTATTTCATTAACTTTAGGATGTTGCTAAGCACATGCATTTTAACGAAT TAATTCGGGGGATCTGGATTTTAGTACTGGATTTTGGTTTTAGGAATTAGAAATTTTATTGATAGAAGTATTTTACA AATACAAATACATACTAAGGGTTTCTTATATGCTCAACACATGAGCGAAACCCTATAGGAACCCTAATTCCCTTATC TGGGAACTACTCACACATTATTATGGAGAAACTCGAGCTCCTATAGGCGGTAGCCTCAGCG

SEQ ID NO.4

<110>Shanghai Communications University

<120>Transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 4

<211> 820

<212> DNA

<213> ORGANISM:Artificial Sequence

<400> 1

1

GAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGCTAGAGCAGCTTG AGCTTGGATCAGATTGTCGTTTCCCGCCATAAGGGTGTATACTATAGTTAGTTGTATATGGCTAGTACTATGGCGGC GGTTCCGACCACCACGAGACCGTAGTACAACATGGGCATGCTGTTGCTCTTGGTTGATGGAGAGGAGGGTGGAGGAG GGGATGAGATGGTGAAGGGGCTTAGAACATCACCCATGATGGTTATAATTTAGTGTTTTGGTGAAATTCGAAGAGAG AACACAAGTTTTGAAGAAAGTTCTTTTGTAGACAACTAACTATAGTATACACCCTTATGGCCTTATCTATTCAATGA GGGTTATAATTTAGATGATGGAATTATTGGAGGGGGTTTATTGATTTATTTTTATTGAAAATATTAAATTAATGTTA AGTAGTTAAGCTAAAAGCCGTGGTGGTTATGTTATCATTGAAGGGGAGAATATAATTATTTTTTGCTCAAGTTGGAT ATAATATGTCATGGAATATTTACTATTTTAGAGAAGACTAAGAGGAGCAGACAAAGAAATGTACTATAAAGGGGGCA GTGAACAAAGATGGGTGAGAGTGACCAGAATTTTGTAGATAAGTGTCCTGTGTCCCTTGCACGTTCTATTTCTTTCT TTGCCTGGGGTTTTGGGAAGCCCCTATGGTTAAATGCTAAAAAACAATTTTTTGTATCTATTCGGAAATCAAATTTG CTTCTATTCATCACAGGTAAAGAGACATGTGATTTACTAAGATGTCATTCATAAATCC

SEQ ID NO.5

<110>Shanghai Communications University

<120>Transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 5

<211> 22

<212> DNA

<213> ORGANISM:Glycince max

<400> 1

1TGCCATCATCAATGGTCACACG

SEQ ID NO.6

<110>Shanghai Communications University

<120>Transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 6

<211> 25

<212> DNA

<213> ORGANISM:Radioresistant cocci (Deinococcus radiodurans R1)

<400> 1

1CGCTGAGGCTACCGCCTATAGGAGC

SEQ ID NO.7

<110>Shanghai Communications University

<120>Transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 7

<211> 25

<212> DNA

<213> ORGANISM:Escherichia coli LacZalpha multiple cloning sites

<400> 1

1GAAGAGGCCCGCACCGATCGCCCTT

SEQ ID NO.8

<110>Shanghai Communications University

<120>Transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 8

<211> 22

<212> DNA

<213> ORGANISM:Glycince max

<400> 1

1GGATTTATGAATGACATCTTAG

SEQ ID NO.9

<110>Shanghai Communications University transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 9

<211> 4727

<212> DNA

<213> ORGANISM:Artificial Sequence

<400> 1

1

TGCCATCATCAATGGTCACACGGAGTGGGACTACAGAATTTGAAAATAGTAGAGAAAACAGCAGTGGGC ACTTGCTATTTTCCTTTCATCATTGGAAATTAAATGGGGAAAGGGAAAAAAATATTTCTGTTTTCTACAATGAATGA CAATAATAGGAGATTTGGTTTTCGTAGAATCAGAATTATTCAAAAAAAGAAAAACAGAATTCCATTGAACGAATTCC CTGCACTTTTGTTGATACTAAGGGTATATCTCTCTCTTGATATTGGGAGATTATTTCCTCCATAGAGTACAATTTTT TTTTTTTTTTACTTTTTTCAAGTTTCAACAAGTTTTTACAGTAAATACATAGAAATTTAATTATTTTCAAAATTGGA TAAAACGCCTTCATTTATAGAGAATTTTCTCTCTCCCTGTGTATTTATTTCTTATAACTTGAAGCTTCTTTGGAATG CTGCTTTATCTTTTAAAACAGCTTGTTTTAAGGTTAACATTAACTAAATTCCCTATCATCTACTTACTTTGCCGGCC GACTAGTTATAAAAGAATTAGATGATTCATTGCCTCAACCTATTAGGGTTTTCCCGATGAAGGATTAAATTAGACAT AATTAGGTGCATGAAGGCTTAAGTTTGATCTTCCTTATTATTATTGTATTAAAAAAAAAGCAAATTACACTAACTCT CTATGTTTAATACTTGTTACACTCAAAGTCACTCATTATTGGAACCCTACACATCCCCTTCCCCCTTCGCTGTTGCA ACTCATTGCACAAAGACCCCCTAACCGTCTATTTCATTAACTTTAGGATGTTGCTAAGCACATGCATTTTAACGAAT TAATTCGGGGGATCTGGATTTTAGTACTGGATTTTGGTTTTAGGAATTAGAAATTTTATTGATAGAAGTATTTTACA AATACAAATACATACTAAGGGTTTCTTATATGCTCAACACATGAGCGAAACCCTATAGGAACCCTAATTCCCTTATC TGGGAACTACTCACACATTATTATGGAGAAACTCGAGCTCCTATAGGCGGTAGCCTCAGCGTATTCGAATCTAGCAC CAAGAGCTTCAAGGTGAGCGAAGAACTGAGGGTAGGACTTTCTGATGTGGTGTGCACCGGTGATTCTAAGTGGAGCA TCTGCTCTGAGACCAAGAAGGGTGAGAAGCATGATCATTCTGTGGTCACCGTGACCATCAGCGGTGATACCACCAGC AAGGTGAGCAGAACCAGTAACGGAGAGAGAATCGGCGGTCTCTCTTGCTCTAAGACCAAGTCTTTCAAGCTCAGCTC TGGTGTCAGAGATTCTATCGCATTCCTTGAGTCTAAGAGTAGCAACGTTTTCCCAGGTGGTATCACCCTCAGCGAAG GCAGCAGCAGCGGTAAGAGCTTGCACGGCGTCGGTGAAGGAATCACCATCTCTAGTAACAGCGTGGAGAGGTCTACC ACCTCTCACGGTAAGGGTATCACCTTCTCTAACGATATCAGCACCCATCTCTCTAAGAACGTTCACAGCTTCCTTCT CACCCTGGAGGTCGTGTTCTCTAAGGTTAGAAAGTCTAACCTCACCTGGGAGAAGAGCAGCGGCGGTAAGGATAGCA GCGGAACCAGGGTAATCACCAGGAACGAGCACTCTACCTGGTCTGTACTTCTGACCACCAGGGATGGAGATTCTTCT AAGGTCATCGGAGGCAGTAGCTCTAACACCGAAATCAGAGAGGGTGTCAAGTGTCTGTCTAAGAGGAGCGTGGGACT TGATATCACCGGTGAGTCTAAGTTCGAGTCCGTCAGGAAGAAGAGGACCGAGGAACATAAGGGCGGAAGCGTACTGG GAGGATCTTTCGGCGGAAACCTCCACTGTACCACCTCTAACTGGACCGGAAACGGAGATAGGGAGTCTACCATCGTT GGAGGACACCCAAGCACCAAGTCTTTCGAGGGCTTCAAGAAGGTCACCCTGAGGTCTCTTACCAAGGGAATCAGGGT AATCGGTAACGAAAGTTGTACCAGAGGTGAGAGCAGCAACACCCATAAGGAGTCTGGCCACCGCAGCAGCGTTACCT GGGTTAAGGGTAACACCAGCCTGTGGTCTAGCACCGAAACCTCTGATCACGGCGTCATCACCAACAAGCTCAACACC AGCACCCCAATCTCTGAGGCATCTGAGCATAGCTTCGGCATCCTCAGAGGTAGCCACACCAACAACTCTGGTTTCAC CCTCAGCGAGAGCAGCGGCGAGGAGGTATCTAGTGGTGTAGTTCTTGGATGGCTGTGCTCTAAGTTCACCTCTGAGT TCTCTAGCTGGATGCACGATAACGTCGAAGGTAGCTGGAAGAGCGTCGGATCCCTTCTCCGCCGTGGAAACAGAAGA CATGACCTTAAGAGGACGAAGCTCAGAGCCAATTAAAGTCATCCCACTCTTCTTCAATCCCCAAGATGAAGAAATTG GATAAGCTCGTGGATGCTGCTGAGTCTTCAGAGAAACCGATAAGGGAGATTTCCTTTGACTGGATTTAGAGAGATTG GAGATAAGAGATGGGTTCTGCACACCATTGCAGATTCTGCTAACTTGAGCCATGGCTATCGTTCGTAAATGGTGAAA ATTTTCAGAAAATTGCTTTTGCTTTAAAAGAAATGATTTAAATTGCTGCAATAGAAGTAGAATGCTTGATTGCTTGA GATTCGTTTGTTTTGTATATGTTGTGTTGACTCGAGAGAGATAGATTTGTAGAGAGAGACTGGTGATTTCAGCGTGT CCTCTCCAAATGAAATGAACTTCCTTATATAGAGGAAGGTCTTGCGAAGGATAGTGGGATTGTGCGTCATCCCTTAC GTCAGTGGAGATATCACATCAATCCACTTGCTTTGAAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCTCG TGGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTGAACGATAGCCTTTCCTTTATCGCAATGATGG CATTTGTAGGTGCCACCTTCCTTTTCTACTGTCCTTTTGATGAAGTGACAGATAGCTGGGCAATGGAATCCGAGGAG GTTTCCCGATATTACCCTTTGTTGAAAAGTCTCAATAGCCCTTTGGTCTTCTGAGACTGTATCTTTGATATTCTTGG AGTAGACGAGAGTGTCGTGCTCCACCATGTTATCACATCAATCCACTTGCTTTGAAGACGTGGTTGGAACGTCTTCT TTTTCCACGATGCTCCTCGTGGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTGAACGATAGCCTT TCCTTTATCGCAATGATGGCATTTGTAGGTGCCACCTTCCTTTTCTACTGTCCTTTTGATGAAGTGACAGATAGCTG GGCAATGGAATCCGAGGAGGTTTCCCGATATTACCCTTTGTTGAAAAGTCTCAATAGCCCTTTGGTCTTCTGAGACT GTATCTTTGATATTCTTGGAGTAGACGAGAGTGTCGTGCTCCACCATGTTGGCAAGCTGCTCTAGCCAATACGCAAA CCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA GCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGT TGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGAATTCGAGCTCGGTACC CGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAA ACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGC ACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGCTAGAGCAGCTTGAGCTTGGATCAGATTGTCGT TTCCCGCCATAAGGGTGTATACTATAGTTAGTTGTATATGGCTAGTACTATGGCGGCGGTTCCGACCACCACGAGAC CGTAGTACAACATGGGCATGCTGTTGCTCTTGGTTGATGGAGAGGAGGGTGGAGGAGGGGATGAGATGGTGAAGGGG CTTAGAACATCACCCATGATGGTTATAATTTAGTGTTTTGGTGAAATTCGAAGAGAGAACACAAGTTTTGAAGAAAG TTCTTTTGTAGACAACTAACTATAGTATACACCCTTATGGCCTTATCTATTCAATGAGGGTTATAATTTAGATGATG GAATTATTGGAGGGGGTTTATTGATTTATTTTTATTGAAAATATTAAATTAATGTTAAGTAGTTAAGCTAAAAGCCG TGGTGGTTATGTTATCATTGAAGGGGAGAATATAATTATTTTTTGCTCAAGTTGGATATAATATGTCATGGAATATT TACTATTTTAGAGAAGACTAAGAGGAGCAGACAAAGAAATGTACTATAAAGGGGGCAGTGAACAAAGATGGGTGAGA GTGACCAGAATTTTGTAGATAAGTGTCCTGTGTCCCTTGCACGTTCTATTTCTTTCTTTGCCTGGGGTTTTGGGAAG CCCCTATGGTTAAATGCTAAAAAACAATTTTTTGTATCTATTCGGAAATCAAATTTGCTTCTATTCATCACAGGTAA AGAGACATGTGATTTACTAAGATGTCATTCATAAATCC

SEQ ID NO.10

<110>Shanghai Communications University

<120>Transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 10

<211> 20

<212> DNA

<213> ORGANISM:Artificial Sequence

<400> 1

1CTTTGCCGGCCGACTAGTTA

SEQ ID NO.11

<110>Shanghai Communications University

<120>Transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 11

<211> 21

<212> DNAORGANISM:Artificial Sequence

<400> 1

1ACTAAAATCCAGATCCCCCGA

SEQ ID NO.12

<110>Shanghai Communications University

<120>Transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 12

<211> 20

<212> DNA

<213> ORGANISM:Artificial Sequence

<400> 1

1AGCTTGGATCAGATTGTCGT

SEQ ID NO.13

<110>Shanghai Communications University

<120>Transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 13

<211> 20

<212> DNA

<213> ORGANISM:Artificial Sequence

<400> 1

1TGGGTGATGTTCTAAGCCCC

SEQ ID NO.14

<110>Shanghai Communications University

<120>Transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 14

<211> 23

<212> DNA

<213> ORGANISM:Artificial Sequence

<400> 1

1TGTTGCTAAGCACATGCATTTTA

SEQ ID NO.15

<110>Shanghai Communications University

<120>Transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 15

<211> 20

<212> DNA

<213> ORGANISM:Artificial Sequence

<400> 1

1ACACCAGAGCTGAGCTTGAA

SEQ ID NO.16

<110>Shanghai Communications University

<120>Transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 16

<211> 21

<212> DNA

<213> ORGANISM:Artificial Sequence

<400> 1

1TGCCCATGTTGTACTACGGTC

SEQ ID NO.17

<110>Shanghai Communications University

<120>Transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 17

<211> 20

<212> DNA

<213> ORGANISM:Artificial Sequence

<400> 1

1GTCGTGACTGGGAAAACCCT

SEQ ID NO.18

<110>Shanghai Communications University

<120>Transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 18

<211> 20

<212> DNA

<213> ORGANISM:Artificial Sequence

<400> 1

1TTAACTTTAGGATGTTGCTA

SEQ ID NO.19

<110>Shanghai Communications University

<120>Transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 19

<211> 19

<212> DNA

<213> ORGANISM:Artificial Sequence

<400> 1

1ACCCTTAGTATGTATTTGT

SEQ ID NO.20

<110>Shanghai Communications University

<120>Transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 20

<211> 24

<212> DNA

<213> ORGANISM:Artificial Sequence

<400> 1

1TGGATTTTAGTACTGGATTTTGGTSEQ ID NO.21

<110>Shanghai Communications University

<120>Transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 21

<211> 834

<212> DNA

<213> ORGANISM:Glycince max

<400> 1

1

TGCCATCATCAATGGTCACACGGAGTGGGACTACAGAATTTGAAAATAGTAGAGAAAACAGCAGTGGGC ACTTGCTATTTTCCTTTCATCATTGGAAATTAAATGGGGAAAGGGAAAAAAATATTTCTGTTTTCTACAATGAATGA CAATAATAGGAGATTTGGTTTTCGTAGAATCAGAATTATTCAAAAAAAGAAAAACAGAATTCCATTGAACGAATTCC CTGCACTTTTGTTGATACTAAGGGTATATCTCTCTCTTGATATTGGGAGATTATTTCCTCCATAGAGTACAATTTTT TTTTTTTTTTACTTTTTTCAAGTTTCAACAAGTTTTTACAGTAAATACATAGAAATTTAATTATTTTCAAAATTGGA TAAAACGCCTTCATTTATAGAGAATTTTCTCTCTCCCTGTGTATTTATTTCTTATAACTTGAAGCTTCTTTGGAATG CTGCTTTATCTTTTAAAACAGCTTGTTTTAAGGTTAACATTAACTAAATTCCCTATCATCTACTTACTTTGCCGGCC GACTAGTTATAAAAGAATTAGATGATTCATTGCCTCAACCTATTAGGGTTTTCCCGATGAAGGATTAAATTAGACAT AATTAGGTGCATGAAGGCTTAAGTTTGATCTTCCTTATTATTATTGTATTAAAAAAAAAGCAAATTACACTAACTCT CTATGTTTAATACTTGTTACACTCAAAGTCACTCATTATTGGAACCCTACACATCCCCTTCCCCCTTCGCTGTTGCA ACTCATTGCACAAAGACCCCCTAACCGTCTATTTCATTAACTTTAGGATGTTGCTAAGCACATGCATTTTAA

SEQ ID NO.22

<110>Shanghai Communications University

<120>Transformation of soybean event SHZD32-01 and its detection method

<160> 86

<170> PatentIn version 2.1

<210> 22

<211> 723

<212> DNA

<213> ORGANISM:Glycince max

<400> 1

1

ATAAGGGTGTATACTATAGTTAGTTGTATATGGCTAGTACTATGGCGGCGGTTCCGACCACCACGAGAC CGTAGTACAACATGGGCATGCTGTTGCTCTTGGTTGATGGAGAGGAGGGTGGAGGAGGGGATGAGATGGTGAAGGGG CTTAGAACATCACCCATGATGGTTATAATTTAGTGTTTTGGTGAAATTCGAAGAGAGAACACAAGTTTTGAAGAAAG TTCTTTTGTAGACAACTAACTATAGTATACACCCTTATGGCCTTATCTATTCAATGAGGGTTATAATTTAGATGATG GAATTATTGGAGGGGGTTTATTGATTTATTTTTATTGAAAATATTAAATTAATGTTAAGTAGTTAAGCTAAAAGCCG TGGTGGTTATGTTATCATTGAAGGGGAGAATATAATTATTTTTTGCTCAAGTTGGATATAATATGTCATGGAATATT TACTATTTTAGAGAAGACTAAGAGGAGCAGACAAAGAAATGTACTATAAAGGGGGCAGTGAACAAAGATGGGTGAGA GTGACCAGAATTTTGTAGATAAGTGTCCTGTGTCCCTTGCACGTTCTATTTCTTTCTTTGCCTGGGGTTTTGGGAAG CCCCTATGGTTAAATGCTAAAAAACAATTTTTTGTATCTATTCGGAAATCAAATTTGCTTCTATTCATCACAGGTAA AGAGACATGTGATTTACTAAGATGTCATTCATAAATCC

Claims (14)

1. a kind of transformation of soybean event SHZD32-01 recombinant DNA molecules, it is characterised in that including SEQ ID NO:1 and SEQ IDNO:2, or including SEQ ID NO:3, or including SEQ ID NO:4, or including SEQ ID NO:9, or including with SEQ IDNO:1 and SEQ ID NO:2 or including with SEQ ID NO:3 or including with SEQ ID NO:4 or including with SEQ ID NO:At least one nucleotide sequence in 9 fully-complementary sequences.

2. transformation of soybean event SHZD32-01 according to claim 1 recombinant DNA molecules, it is characterised in that including core Acid sequence SEQ ID NO:1 and sequence SEQ ID NO:2.

A kind of 3. DNA molecular purposes, it is characterised in that it is that exogenous DNA array is inserted into Plant Genome, Plant Genome Combined with exogenous DNA array, the sequence of binding site is respectively SEQ ID NO:1 and SEQ ID NO:2.

4. transformation of soybean event SHZD32-01 according to claim 1 recombinant DNA molecules, it is characterised in that including core Acid sequence SEQ ID NO:3.

5. transformation of soybean event SHZD32-01 according to claim 1 recombinant DNA molecules, it is characterised in that including core Acid sequence SEQ ID NO:4.

6. transformation of soybean event SHZD32-01 according to claim 1 recombinant DNA molecules, it is characterised in that including core Acid sequence SEQ ID NO:9.

7. transformation of soybean event SHZD32-01 according to claim 1 recombinant DNA molecules, it is characterised in that including core Acid sequence SEQ ID NO:3 and SEQ ID NO:4.

8. transformation of soybean event SHZD32-01 according to claim 1 recombinant DNA molecules, it is characterised in that described heavy Group DNA molecular comes from transformation of soybean event SHZD32-01, the representative kind comprising the transformation of soybean event SHZD32-01 Subsample, which is stored in, is deposited in China typical culture collection center, and deposit number is CCTCC NO:P201513.

9. transformation of soybean event SHZD32-01 according to claim 1 recombinant DNA molecules, it is characterised in that described heavy Group DNA molecular is present in soybean plant strain, soybean plant cell, soya seeds, soybean plant strain part or commodity product(s).

10. a kind of DNA primer or probe, it is characterised in that come from SEQ ID comprising sufficiently long continuous nucleotide sequence NO:9 or its complementary series, the DNA primer or probe are to diagnose the transformation of soybean event SHZD32-01, the DNA Primer and probe can be under stringent hybridization condition with including given SEQ ID NO:1-4 and SEQ ID NO:One in 9 The DNA molecular hybridization of nucleotide sequence, and can not be under stringent hybridization condition with not including given SEQ ID NO:1-4 and SEQ ID NO:The DNA molecular hybridization of a nucleotide sequence in 9.

11. a pair of DNA moleculars, it is characterised in that include first DNA molecular and second different from first DNA molecular DNA molecular, each self-contained one section continuous nucleotide sequence of described first DNA molecular and second DNA molecular come from SEQ IDNO:9, or the sequence with its complete complementary, as DNA primer and the transformation of soybean event SHZD32-01 recombinant DNA point The amplified production that son is used for transformation of soybean event SHZD32-01 described in amplified reaction generation diagnostic sample together includes SEQID NO:1 or SEQ ID NO:2.

12. a kind of detect the side that transformation of soybean event SHZD32-01 recombinant DNA molecules described in claim 1 in sample be present Method, it is characterised in that methods described includes：A) DNA of the sample is made to be in contact with the DNA probe described in claim 11； B) above-mentioned sample and the DNA probe is made to be placed under stringent hybridization condition；C) DNA probe and DNA in above-mentioned sample are detected The hybridisation events of molecule, if the DNA molecular of the DNA probe and above-mentioned sample hybridizes, illustrate soybean be present in the sample Transformation event SHZD32-01 recombinant DNA molecules.

13. a kind of detect the side that transformation of soybean event SHZD32-01 recombinant DNA molecules described in claim 1 in sample be present Method, it is characterised in that methods described includes：A) DNA of the sample is made to connect with a pair of DNA moleculars described in claim 12 Touch；B) carry out amplified reaction generation and contain given SEQ ID NO:1-4 and SEQ ID NO:9 and its fully-complementary sequence in The amplified production of one nucleotide sequence；C) the DNA cloning product in above-mentioned reaction is detected, if having amplified production in above-mentioned reaction, Then illustrate the recombinant DNA molecules of the transformation of soybean event SHZD32-01 in the sample be present.

A kind of 14. DNA detection kits, it is characterised in that including a pair of DNA primers or at least one DNA probe, a) described one Include at least one DNA molecular to DNA primer and come from SEQ ID NO comprising sufficiently long continuous nucleotide sequence:9 or its is complete Complementary series, this can produce the amplified fragments for diagnosing the transformation of soybean event SNZD32-01 to DNA primer；B) at least one Individual DNA probe is the diagnosis transformation of soybean event SHZD32-01.