CN104878097A

CN104878097A - Nucleotide sequence and detection method for detecting corn plant DBN9981

Info

Publication number: CN104878097A
Application number: CN201510220033.1A
Authority: CN
Inventors: 丁德荣; 康越景; 张云珠; 刘海利; 庞洁; 王利君; 贾志伟; 黄金存; 郭函子; 王磊; 傅学乾; 周毅; 李风; 鲍晓明; 吕玉平; 张世平
Original assignee: BIOTECHNOLOGY CENTER OF BEIJING DABEINONG TECHNOLOGY GROUP Co Ltd; Beijing Dabeinong Technology Group Co Ltd
Current assignee: Beijing Dabeinong Biotechnology Co Ltd
Priority date: 2015-04-30
Filing date: 2015-04-30
Publication date: 2015-09-02
Anticipated expiration: 2035-04-30
Also published as: CN104878097B

Abstract

The invention relates to a nucleotide sequence and a detection method for detecting a corn plant DBN9981. The nucleotide sequence for the corn plant comprises a sequence shown in SEQ ID NO:1 or a complementary sequence thereof, or a sequence shown in SEQ ID NO:2 or a complementary sequence thereof. The corn plant DBN9981 has relatively good resistance on lepidopteron, has relatively good tolerance on a glyphosate herbicide and is free of an effect on the yield; and whether a biological sample contains a DNA (deoxyribonucleic acid) molecule of a genetically modified corn plant DBN9981 or not can be accurately and rapidly identified by the detection method.

Description

For detecting nucleotide sequence and the detection method thereof of maize plant DBN9981

Technical field

The present invention relates to a kind of nucleotide sequence for detecting maize plant DBN9981 and detection method thereof, particularly relating to and a kind ofly to insect, there is resistance and the transgenic corn events DBN9981 of tolerate glyphosate herbicide application and for detecting in biological sample the nucleotide sequence and detection method thereof that whether comprise specific transgenic corn events DBN9981.

Background technology

Corn (Zea mays L.) in the world a lot of area is all main food crop.Biotechnology has been applied to corn to improve its economical character and quality.In Maize Production, insect-resistant is an important economical character, particularly to the resistance of lepidopterous insects, and such as Pyrausta nubilalis (Hubern)., bollworm, armyworm etc.Corn can make the resistant gene of lepidopterous insects express in maize plant by transgenic method to the resistance of lepidopterous insects and obtain.Another important economical character is herbicide tolerant, particularly tolerate glyphosate weedicide.Corn can make glyphosate herbicide tolerant type gene (as EPSPS) express in maize plant by transgenic method to the tolerance of glyphosate herbicidal and obtain.

The expression of known foreign gene in plant materials is subject to the impact of their chromosome position, may be because chromatin Structure (as heterochromatin) or transcription regulatory element (as enhanser) are close to integration site.For this reason, usually needing a large amount of event of screening just likely to identify can business-like event (target gene namely imported obtains the event of optimal expression).Such as, the expression amount having observed quiding gene in plant and other biological body may have very big-difference between event; The space of expressing or temporal mode may also there are differences, as relative expression genetically modified between different plant tissue there are differences, the present actual expression pattern of this difference table may be inconsistent with the expression pattern desired by the transcription regulatory element in the gene construct imported.Therefore, usually need to produce hundreds and thousands of individual different events and filter out from these events that there is transgene expression amount desired for the purpose of commercialization and the single incident of expression pattern.The event of the transgene expression amount and expression pattern with expection can be used for adopting conventional breeding methods transgenosis to be penetrated in other genetic backgrounds by sexual outcross.The offspring produced by this Crossing system maintains the transgene expression feature of original transformant.Apply this strategy pattern and can guarantee, in many kinds, there is reliable genetic expression, and these kinds well can adapt to local growth conditions.

The existence that can detect particular event will be useful to determine whether the offspring of sexual hybridization comprises goal gene.In addition, the method detecting particular event also will contribute to observing relevant laws and regulations, and the food such as deriving from restructuring farm crop needs obtain official approval and mark before putting goods on the market.It is all possible for detecting genetically modified existence by any polynucleotide detection method known, such as polymerase chain reaction (PCR) or utilize the DNA hybridization of polynucleotide probes.These detection methods concentrate on the genetic elements commonly used usually, such as promotor, terminator, marker gene etc.Therefore, unless the sequence of the chromosomal DNA (" flanking DNA ") adjacent with the transgenosis DNA inserted is that oneself knows, above-mentioned this method just can not be used for distinguishing different events, particularly those events produced by identical DNA construct.So the normal pair of primers spanning the transgenosis of insertion and the junction of flanking DNA that utilizes identifies transgenosis particular event by PCR at present, is specifically contained in the first primer of flanking sequence and comprises the second primer of insertion sequence.

Summary of the invention

The object of this invention is to provide a kind of nucleotide sequence for detecting maize plant DBN9981 and detection method thereof, transgenic corn events DBN9981 has good resistance to insect and has good tolerance to glyphosate herbicidal, and whether detection method can comprise the DNA molecular of specific transgenic corn events DBN9981 quickly and accurately in identification of organism sample.

For achieving the above object, the invention provides a kind of nucleotide sequence, at least 11 continuous print Nucleotide at least 11 continuous print Nucleotide and/or SEQ ID NO:4 or its complementary sequence in SEQ ID NO:3 or its complementary sequence.

Preferably, described nucleotide sequence comprises SEQ ID NO:1 or its complementary sequence and/or SEQ ID NO:2 or its complementary sequence.

Further, described nucleotide sequence comprises SEQ ID NO:3 or its complementary sequence and/or SEQ ID NO:4 or its complementary sequence.

Further, described nucleotide sequence comprises SEQ ID NO:5 or its complementary sequence.

Described SEQ ID NO:1 or its complementary sequence are be positioned at 5 ' end of insertion sequence the sequence that the length inserted near junction is 22 Nucleotide in transgenic corn events DBN9981, described SEQ ID NO:1 or its complementary sequence span the DNA sequence dna of the flanking genomic DNA sequence of corn insertion point and 5 ' end of insertion sequence, comprise the existence that described SEQ ID NO:1 or its complementary sequence can be accredited as transgenic corn events DBN9981.Described SEQ ID NO:2 or its complementary sequence are be positioned at 3 ' end of insertion sequence the sequence that the length inserted near junction is 22 Nucleotide in transgenic corn events DBN9981, described SEQ ID NO:2 or its complementary sequence span the DNA sequence dna of 3 ' end of insertion sequence and the flanking genomic DNA sequence of corn insertion point, comprise the existence that described SEQ ID NO:2 or its complementary sequence can be accredited as transgenic corn events DBN9981.

In the present invention, described nucleotide sequence can be at least 11 of any part of transgene insert sequence in described SEQ ID NO:3 or its complementary sequence or more continuously polynucleotide (the first nucleotide sequence), or be at least 11 of any part of 5 ' flank corn gene group DNA region in described SEQ ID NO:3 or its complementary sequence or more continuous polynucleotide (the second nucleotide sequence).Described nucleotide sequence further can for homology in or be complementary to a part of the described SEQ ID NO:3 comprising complete described SEQ ID NO:1.When the first nucleotide sequence uses together with the second nucleotide sequence, the DNA cloning method that these nucleotide sequences are producing amplified production comprises DNA primer group.When using DNA primer to be the amplified production comprising SEQ ID NO:1 to the amplified production produced in DNA cloning method, the existence of transgenic corn events DBN9981 or its offspring can be diagnosed.Well known to those skilled in the art, the first and second nucleotide sequences need not only be made up of DNA, also can comprise the mixture of RNA, DNA and RNA, or DNA, RNA or other is not as the Nucleotide of one or more polysaccharase templates or the combination of its analogue.In addition, probe described in the present invention or primer should be the length of at least about 11,12,13,14,15,16,17,18,19,20,21 or 22 continuous nucleotides, and it can be selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and the Nucleotide described in SEQ ID NO:5.When being selected from the Nucleotide shown in SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5, described probe and primer can be the continuous nucleotides of at least about 21 to about 50 or more for length.Described SEQ ID NO:3 or its complementary sequence are be positioned at 5 ' end of insertion sequence the sequence that the length inserted near junction is 1381 Nucleotide in transgenic corn events DBN9981, described SEQ ID NO:3 or its complementary sequence are by the corn flanking genomic DNA sequence (the Nucleotide 1-1195 of SEQ ID NO:3) of 1195 Nucleotide, 3 ' end DNA sequence (the Nucleotide 1247-1381 of the SEQ ID NO:3) composition of the DBN10124 construct DNA sequence dna (the Nucleotide 1196-1246 of SEQ ID NO:3) of 51 Nucleotide and the tNos terminator of 135 Nucleotide, comprise the existence that described SEQ ID NO:3 or its complementary sequence can be accredited as transgenic corn events DBN9981.

Described nucleotide sequence can be at least 11 of any part of transgene insert sequence in described SEQ ID NO:4 or its complementary sequence or more continuously polynucleotide (the 3rd nucleotide sequence), or be at least 11 of any part of 3 ' flank corn gene group DNA region in described SEQ ID NO:4 or its complementary sequence or more continuous polynucleotide (the 4th nucleotide sequence).Described nucleotide sequence further can for homology in or be complementary to a part of the described SEQ ID NO:4 comprising complete described SEQ ID NO:2.When the 3rd nucleotide sequence uses together with the 4th nucleotide sequence, the DNA cloning method that these nucleotide sequences are producing amplified production comprises DNA primer group.When using DNA primer to be the amplified production comprising SEQ ID NO:2 to the amplified production produced in DNA cloning method, the existence of transgenic corn events DBN9981 or its offspring can be diagnosed.Described SEQ ID NO:4 or its complementary sequence are be positioned at 3 ' end of insertion sequence the sequence that the length inserted near junction is 1384 Nucleotide in transgenic corn events DBN9981, described SEQ ID NO:4 or its complementary sequence are by the t35S transcription terminator sequences (the Nucleotide 1-38 of SEQ ID NO:4) of 38 Nucleotide, the DBN10124 construct DNA sequence dna (the Nucleotide 39-96 of SEQ ID NO:4) of 58 Nucleotide and corn integration site flanking genomic DNA sequence (the Nucleotide 97-1384 of the SEQ ID NO:4) composition of 1288 Nucleotide, comprise the existence that described SEQ ID NO:4 or its complementary sequence can be accredited as transgenic corn events DBN9981.

The sequence of described SEQ ID NO:5 or its complementary sequence to be the length characterizing transgenic corn events DBN9981 be 9732 Nucleotide, its genome specifically comprised and genetic elements as shown in table 1.Comprise the existence that described SEQ ID NO:5 or its complementary sequence can be accredited as transgenic corn events DBN9981.

The genome that table 1, SEQ ID NO:5 comprise and genetic elements

Described nucleotide sequence or its complementary sequence can be used for produce amplicon in DNA cloning method, the existence of transgenic corn events DBN9981 or its offspring in the checkout and diagnosis biological sample of described amplicon; Described nucleotide sequence or its complementary sequence can be used in nucleotide detection method, to detect the existence of transgenic corn events DBN9981 or its offspring in biological sample.

For achieving the above object, present invention also offers a kind of method that DNA detecting transgenic corn events DBN9981 in sample exists, comprising:

Detected sample is contacted in nucleic acid amplification reaction with at least two kinds of primers;

Carry out nucleic acid amplification reaction;

Detect the existence of amplified production;

Described amplified production to comprise in SEQ ID NO:3 or its complementary sequence at least 11 continuous print Nucleotide at least 11 continuous print Nucleotide or SEQ ID NO:4 or its complementary sequence.

Further, described amplified production to comprise in SEQ ID NO:1 or its complementary sequence 1-11 position or 12-22 position continuous nucleotide in 1-11 position or 12-22 position continuous nucleotide or SEQ ID NO:2 or its complementary sequence.

Further, described amplified production comprises SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence or SEQ ID NO:7 or its complementary sequence.

In technique scheme, described primer comprises nucleotide sequence described at least one.

Particularly, described primer comprises the first primer and the second primer, and described first primer is selected from SEQ ID NO:8 and SEQ ID NO:10; Described second primer is selected from SEQ ID NO:9 and SEQ ID NO:11.

Make detected sample and probes touch, described probe to comprise in SEQ ID NO:3 or its complementary sequence at least 11 continuous print Nucleotide at least 11 continuous print Nucleotide or SEQ ID NO:4 or its complementary sequence;

Described detected sample and described probe are hybridized under stringent hybridization condition;

Detect the hybridisation events of described detected sample and described probe.

Described stringent condition can be in 6 × SSC (Trisodium Citrate), 0.5%SDS (sodium lauryl sulphate) solution, hybridizes, then use 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively to wash film 1 time at 65 DEG C.

Further, described probe to comprise in SEQ ID NO:1 or its complementary sequence 1-11 position or 12-22 position continuous nucleotide in 1-11 position or 12-22 position continuous nucleotide or SEQ ID NO:2 or its complementary sequence.

Further, described probe comprises SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence or SEQ ID NO:7 or its complementary sequence.

Selectively, at least one fluorophor of probe described at least one marks.

Detected sample is contacted with marker nucleic acid molecule, and described marker nucleic acid molecule to comprise in SEQ ID NO:3 or its complementary sequence at least 11 continuous print Nucleotide at least 11 continuous print Nucleotide or SEQ ID NO:4 or its complementary sequence;

Described detected sample and described marker nucleic acid molecule are hybridized under stringent hybridization condition;

Detect the hybridisation events of described detected sample and described marker nucleic acid molecule, and then by the analysis of marker assistant breeding to determine that insect-resistant and/or herbicide tolerant and marker nucleic acid molecule are chain on genetics.

Further, described marker nucleic acid molecule to comprise in SEQ ID NO:1 or its complementary sequence 1-11 position or 12-22 position continuous nucleotide in 1-11 position or 12-22 position continuous nucleotide or SEQ ID NO:2 or its complementary sequence.

Further, described marker nucleic acid molecule comprises SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence or SEQ ID NO:7 or its complementary sequence.

For achieving the above object, present invention also offers a kind of DNA detection test kit, comprise at least one DNA molecular, described DNA molecular comprises at least 11 continuous print Nucleotide in the homologous sequence of at least 11 continuous print Nucleotide or SEQ ID NO:4 in the homologous sequence of SEQ ID NO:3 or its complementary sequence or its complementary sequence, and it can have specific DNA primer or probe as transgenic corn events DBN9981 or its offspring.

Further, described DNA molecular to comprise in SEQ ID NO:1 or its complementary sequence 1-11 position or 12-22 position continuous nucleotide in 1-11 position or 12-22 position continuous nucleotide or SEQ ID NO:2 or its complementary sequence.

Further, described DNA molecular comprises the homologous sequence of SEQ ID NO:1 or its complementary sequence, the homologous sequence of SEQ ID NO:2 or its complementary sequence, the homologous sequence of SEQ ID NO:6 or the homologous sequence of its complementary sequence or SEQ ID NO:7 or its complementary sequence.For achieving the above object, present invention also offers a kind of vegetable cell, comprise the nucleotide sequence of coding insect-resistant Cry1Ab albumen, the nucleotide sequence of encodes glyphosate herbicide tolerant EPSPS albumen and the nucleotide sequence of specific region, the nucleotide sequence of described specific region comprises SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or the sequence shown in SEQ ID NO:7.

For achieving the above object; present invention also offers a kind of method protecting maize plant to avoid insect infestations; be included in the meals of target insect and at least one transgenic corn plant cell is provided; described transgenic corn plant cell all comprises and is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7, the suppressed described maize plant of ingesting further of the target insect of described transgenic corn plant cell of ingesting in its genome.

For achieving the above object; present invention also offers a kind of maize plant of protecting from the method for the damage caused by weedicide; comprise the large Tanaka by being applied to plantation at least one rotaring gene corn plant containing effective dose glyphosate herbicidal; described rotaring gene corn plant comprises and is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7 in its genome, and described rotaring gene corn plant has the tolerance to glyphosate herbicidal.

For achieving the above object, present invention also offers a kind of method controlling the large Tanaka weeds of maize planting plant, comprise the large Tanaka by being applied to plantation at least one rotaring gene corn plant containing effective dose glyphosate herbicidal, described rotaring gene corn plant comprises and is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7 in its genome, and described rotaring gene corn plant has the tolerance to glyphosate herbicidal.

For achieving the above object, present invention also offers a kind of cultivation has the maize plant of resistance method to insect, comprising:

Plant at least one corn seed, the genome of described corn seed comprises the nucleotide sequence of coding insect-resistant Cry1Ab albumen and the nucleotide sequence of specific region;

Described corn seed is made to grow up to milpa;

With milpa described in target insect infestations, gather in the crops the plant compared with other plant without the nucleotide sequence of specific region with the plant injury weakened;

The nucleotide sequence of described specific region is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7.

For achieving the above object, present invention also offers a kind of cultivation has the maize plant of tolerance method to glyphosate herbicidal, comprising:

Plant at least one corn seed, the genome of described corn seed comprises the nucleotide sequence of encodes glyphosate herbicide tolerant EPSPS albumen and the nucleotide sequence of specific region;

Described corn seed is made to grow up to milpa;

Spray described milpa with effective dose glyphosate herbicidal, gather in the crops the plant compared with other plant without the nucleotide sequence of specific region with the plant injury weakened;

For achieving the above object, present invention also offers a kind of cultivation to insect there is resistance and the method for the maize plant of tolerate glyphosate weedicide, comprising:

Plant at least one corn seed, the genome of described corn seed comprises the nucleotide sequence of coding insect-resistant Cry1Ab albumen, the nucleotide sequence of encodes glyphosate herbicide tolerant EPSPS albumen and the nucleotide sequence of specific region;

Described corn seed is made to grow up to milpa;

Described milpa is sprayed with effective dose glyphosate herbicidal, results have the plant of the plant injury weakened compared with other plant without the nucleotide sequence of specific region, described in there is the plant injury weakened the feeding damage of plant to insect also have resistance;

For achieving the above object, present invention also offers a kind of generation has the milpa of resistance method to insect, comprise and introduce the nucleotide sequence of coding insect-resistant Cry1Ab albumen and the nucleotide sequence of specific region in the genome of described milpa, the nucleotide sequence of described specific region is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7.

Particularly, the method that described generation has a milpa of resistance to insect comprises:

To insect be had to transgenic corn events DBN9981 first parental maize plant of resistance and lack the second parental maize plant sexual hybridization of insect-resistant, thus produce a large amount of progeny plant;

With progeny plant described in target insect infestations;

Select the described progeny plant compared with other plant without the nucleotide sequence of specific region with the plant injury weakened;

Described transgenic corn events DBN9981 comprises and is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7 in its genome.

For achieving the above object, present invention also offers a kind of generation has the milpa of tolerance method to glyphosate herbicidal, comprise and introduce the nucleotide sequence of encodes glyphosate tolerance EPSPS albumen and the nucleotide sequence of specific region in the genome of described milpa, the nucleotide sequence of described specific region is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7.

Particularly, the method that described generation has a milpa of tolerance to glyphosate herbicidal comprises:

To glyphosate herbicidal be had to transgenic corn events DBN9981 first parental maize plant of tolerance and lack the second parental maize plant sexual hybridization of glyphosate tolerant, thus produce a large amount of progeny plant;

With progeny plant described in glyphosate herbicidal process;

Select the described progeny plant of tolerate glyphosate;

For achieving the above object, present invention also offers a kind of generation and to insect, there is resistance and the method for the milpa of tolerate glyphosate herbicide application, comprising:

By transgenic corn events DBN9981 first parental maize plant of glyphosate tolerance and insect-resistant and the second parental maize plant sexual hybridization lacking glyphosate tolerant and/or insect-resistant, thus produce a large amount of progeny plant;

With progeny plant described in glyphosate process;

Select the described progeny plant of tolerate glyphosate, the feeding damage of described progeny plant to insect of tolerate glyphosate also has resistance;

For achieving the above object, present invention also offers a kind of composition comprising the polynucleotide of SEQ ID NO:1 or SEQ ID NO:2, described composition is Semen Maydis powder, Semen Maydis powder, Semen Maydis oil, corn silk or W-Gum.

For achieving the above object, present invention also offers a kind of agricultural-food or the commodity that comprise the polynucleotide of SEQ ID NO:1 or SEQ ID NO:2, described agricultural-food or commodity are Semen Maydis powder, Semen Maydis powder, Semen Maydis oil, W-Gum, corn gluten, corn-dodger, makeup or weighting agent.

In the present invention in the nucleotide sequence that detects maize plant and detection method thereof, with give a definition and method can define the present invention better and instruct those of ordinary skill in the art to implement the present invention, unless otherwise mentioned, term is understood according to the usage of the routine of those of ordinary skill in the art.

Described " corn " refers to Zea mays (Zea mays), and comprise can with all plant varieties of corn mating, comprise field corn kind.

Described " comprising " refers to " including but not limited to ".

Vegetable cell complete in the Plant cell and tissue culture thing that term " plant " comprises whole strain plant, vegetable cell, plant organ, plant protoplast, plant can therefrom regenerate, plant callus, vegetation bed (plant clumps) and plant or plant part, described plant part is embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stem stalk, root, the tip of a root, flower pesticide etc. such as.The part being interpreted as the transgenic plant in the scope of the invention includes but not limited to vegetable cell, protoplastis, tissue, callus, embryo and flower, stem, fruit, Ye Hegen, and above plant part is derived from the transgenic plant be also therefore made up of transgenic cell at least in part or its filial generation that transform with DNA molecular of the present invention in advance.

Term " gene " refers to the nucleic acid fragment of expressing specific protein, comprises the adjustment sequence (3 ' non-coding sequence) after the adjustment sequence before encoding sequence (5 ' non-coding sequence) and encoding sequence." natural gene " refers to that natural discovery has the gene that himself regulates sequence." mosaic gene " refers to it is not any gene of natural gene, and it comprises adjustment and encoding sequence that non-natural finds." native gene " refers to natural gene, and described natural gene is arranged in its natural place of organism genome." foreign gene " is existing being in biological genome and original non-existent alien gene, also refers to the gene importing recipient cell through Transgenic procedures.Foreign gene can comprise the natural gene or mosaic gene that insert non-native organism." transgenosis " has been introduced into genomic gene by Transformation Program.The site that in Plant Genome, recombinant DNA has been inserted into can be called " insertion point " or " target site ".

External source (allos) DNA that " flanking DNA " can be comprised the genome in the natural organism being present in such as plant or be introduced by conversion process, such as relevant to transformation event fragment.Therefore, flanking DNA can comprise natural and combination that is foreign DNA.In the present invention, " flanking region " or " flanking sequence " or " genome frontier district " or " genome border sequence " refer at least 3,5,10,11,15,20,50,100,200,300,400,1000,1500,2000,2500 or 5000 base pairs or longer sequence, and it is positioned at initial external source and inserts the direct upstream of DNA molecular or downstream and to insert DNA molecular adjacent with initial external source.When this flanking region is positioned at downstream, it also can be called " left margin flank " or " 3 ' flank " or " 3 ' genome frontier district " or " genome 3 ' border sequence " etc.When this flanking region is positioned at upstream, it also can be called " right margin flank " or " 5 ' flank " or " 5 ' genome frontier district " or " genome 5 ' border sequence " etc.

Cause the transformant that the Transformation Program of the random integration of foreign DNA can cause containing different flanking region, described different flanking region is that each transformant institute specificity contains.When recombinant DNA is introduced into plant by conventional hybridization, its flanking region can not change usually.Transformant also can contain the joint of the uniqueness between heterologous insertion DNA and the section of genomic dna or between two fragment gene group DNA or between two sections of allogeneic dna sequence DNAs." joint " is the point that two concrete DNA fragmentations connect.Such as, the position being present in inset DNA and connecting flanking DNA is engaged.Juncture is also present in the organism of conversion, and wherein two DNA fragmentations are to modify linking together of the mode that finds in native organism." engage DNA " and refer to the DNA comprising juncture.

The invention provides the transgenic corn events and offspring thereof that are called DBN9981, described transgenic corn events DBN9981 is maize plant DBN9981, it comprises the Plants and Seeds of transgenic corn events DBN9981 and vegetable cell thereof or its renewable part, the plant part of described transgenic corn events DBN9981, include but not limited to cell, pollen, ovule, flower, bud, root, stem, fringe silk, inflorescence, ear fringe, leaf and the product from maize plant DBN9981, such as Semen Maydis powder, Semen Maydis powder, Semen Maydis oil, corn steep liquor, corn silk, W-Gum and the biomass staying corn crop field.

Transgenic corn events DBN9981 of the present invention contains a DNA construct, and when it expresses in vegetable cell, described transgenic corn events DBN9981 obtains the resistance to insect and the tolerance to glyphosate herbicidal.Described DNA construct comprises the expression cassette of two series connection, first expression cassette comprises for the promotor be applicable to expressed in plant and the polyadenylation signal sequence be applicable to, described promotor is operably connected the nucleotide sequence of Cry1Ab albumen, and the nucleotide sequence of described Cry1Ab albumen mainly has resistance to lepidopterous insects.Second expression cassette comprises for the promotor be applicable to expressed in plant and the polyadenylation signal sequence be applicable to, described promotor be operably connected coding 5-enol-pyrovyl shikimic acid-3-phosphate synthase (EPSPS) gene, the nucleotide sequence of described EPSPS albumen has tolerance to glyphosate herbicidal.Further, described promotor can be the applicable promotor be separated from plant, comprises composing type, induction type and/or tissue-specific promoter, described applicable promotor includes but not limited to, cauliflower mosaic virus (CaMV) 35S promoter, figwort mosaic virus (FMV) 35S promoter, ubiquitin protein (Ubiquitin) promotor, Actin muscle (Actin) promotor, soil Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) promotor, octopine synthase (OCS) promotor, the yellow leaf curl virus promoter of Cestrum (Cestrum), patatin (Patatin) promotor, ribulose-1,5-bisphosphate, 5-bisphosphate Carboxylase/oxygenase (RuBisCO) promotor, glutathione S-transferase (GST) promotor, E9 promotor, GOS promotor, alcA/alcR promotor, Agrobacterium rhizogenes (Agrobacterium rhizogenes) RolD promotor and Arabidopsis (Arabidopsis thaliana) Suc2 promotor.Described polyadenylation signal sequence can for the applicable polyadenylation signal sequence worked in plant, described applicable polyadenylation signal sequence includes but not limited to, derive from the polyadenylation signal sequence of soil Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene, derive from cauliflower mosaic virus (CaMV) 35S terminator, derive from the polyadenylation signal sequence of protease-inhibitor Ⅱ (PIN II) gene and derive from the polyadenylation signal sequence of alpha-tubulin (α-tubulin) gene.

In addition, described expression cassette can also comprise other genetic elements, and described genetic elements includes but not limited to, enhanser and signal peptide/transit peptides.Described enhanser can the expression level of enhancing gene, and described enhanser includes but not limited to, tobacco etch virus (TEV) translates incitant, CaMV35S enhanser and FMV35S enhanser.Described signal peptide/transit peptides can guide specific organoid or compartment in Cry1Ab albumen and/or EPSPS Protein transport to extracellular or cell, such as, utilize encoding chloroplast transit peptide sequence target chloroplast(id), or utilize ' KDEL ' reservation queue target endoplasmic reticulum.

Described Cry1Ab gene can be from Tribactur (Bacillus thuringiensis, be called for short Bt) in be separated and obtain, and by optimizing codon or the nucleotide sequence otherwise changing Cry1Ab gene, the stability of transformant transcription thing and the object of utilizability can be increased to reach.

Described " lepidopteran ", formal name used at school Lepidoptera, comprises moth, butterfly two class insect, is the order that agriculture and forestry injurious insect is maximum, as Pyrausta nubilalis (Hubern)., bollworm, east armyworm, 2 committees noctuid, dichocrocis punctiferalis etc.

Described 5-enol-pyrovyl shikimic acid-3-phosphate synthase (EPSPS) gene can be separated and obtain from soil Agrobacterium (Agrobacterium tumefaciens sp.) CP4 bacterial strain, and by optimizing codon or the polynucleotide otherwise changing coding EPSPS gene, the stability of transformant transcription thing and the object of utilizability can be increased to reach.Described 5-enol-pyrovyl shikimic acid-3-phosphate synthase (EPSPS) gene also can as selected marker.

Described " glyphosate " refers to N-phosphonomethylglycine and its salt, refers to use the herbicide formulations that any one contains glyphosate to process with " glyphosate herbicidal " process.In order to reach ebd, the selection of certain glyphosate formulation rate of utilization is no more than to the technical ability of common agronomic technique personnel.The herbicide formulations pack processing that use any one contains glyphosate contains the field of the vegetable material deriving from transgenic corn events DBN9981, to the weed growth in described field be controlled, and do not affect growth or the output of the vegetable material deriving from transgenic corn events DBN9981.

Described DNA construct adopts method for transformation to be introduced in plant, and described method for transformation includes but not limited to, Agrobacterium (Agrobacterium) mediated transformation method, Gene Knock-out Mice and pollen tube channel conversion method.

Described Agrobacterium_mediated method is the common method of Plant Transformation.Between border, the left and right consensus sequence foreign DNA be introduced in plant being cloned into carrier, i.e. T-DNA district.Described carrier is transformed in agrobatcerium cell, and subsequently, described agrobatcerium cell is used for infection plant's tissue, and the described T-DNA district comprising the carrier of foreign DNA is inserted in Plant Genome.

Described Gene Knock-out Mice is the carrier bombardment vegetable cell (biolistic transformation of particle mediation) with comprising foreign DNA.

Described pollen tube channel conversion method is the natural pollen tube channel (having another name called pollen tube transmitting tissue) formed after utilizing pollinate, through megarchidium passage, carries foreign DNA into blastular.

After conversion, must from the plant tissue regenerating plants transformed, and the Marker selection be applicable to be utilized to have the offspring of foreign DNA.

DNA construct is the combination that DNA molecular is interconnected, and this combination provides one or more expression cassette.DNA construct preferably can self-replacation in bacterial cell, and the plasmid containing different restriction endonuclease sites, contained restriction endonuclease sites is used for importing provides functioning gene element, i.e. the DNA molecular of promotor, intron, leader sequence, encoding sequence, 3 ' terminator region and other sequences.Expression cassette contained in DNA construct comprise messenger RNA(mRNA) is provided transcribe necessary Genetic elements, described expression cassette can be designed as at prokaryotic cell prokaryocyte or eukaryotic expression.Expression cassette of the present invention is designed to most preferably express in vegetable cell.

Transgenosis " event " is by obtaining by heterologous DNA construct transformed plant cells, namely the expression of nucleic acid box that at least one contains target gene is comprised, be inserted in Plant Genome by transgenic method to produce plant population, regenerate described plant population, and select that there is the specific plant inserting specific gene group site feature.Term " event " refers to comprise the original transformant of allogeneic dna sequence DNA and the offspring of this transformant.The offspring that term " event " also refers to carry out sexual hybridization between transformant and other kind individuality containing allogeneic dna sequence DNA and obtains, even if after repeatedly backcrossing with backcross parent, come from the insertion DNA of transformant parent and flanking genomic dna and be also present in same chromosome position in filial generation.Term " event " also refers to the DNA sequence dna from original transformant, this DNA sequence dna comprises insertion DNA and the flanking genomic sequence closely adjacent with inserting DNA, this DNA sequence dna is expected to be transferred in filial generation, this filial generation is by being (filial generation that such as original transformant and its selfing produce) containing the parent inserting DNA and be not carry out sexual hybridization and produce containing the parent inserting DNA, and this filial generation receives the insertion DNA comprising target gene.

In the present invention " restructuring " refer to and usually can not find at occurring in nature and the form of the DNA therefore produced by manual intervention and/or albumen and/or organism.This manual intervention can produce recombinant DNA molecules and/or recombinant plant.Described " recombinant DNA molecules " is that the sequence section be separated in other cases by artificial combination two kinds is obtained, such as, by chemosynthesis or the nucleic acid segment by gene engineering operation separation.The technology of carrying out nucleic-acid manipulation is well-known.

Term " transgenosis " comprises any cell, clone, callus, tissue, plant part or plant, above genotype changes due to the existence of heterologous nucleic acids, and described " transgenosis " is comprised at first by the Transgenics changed like this and the offspring individual generated by sexual hybridization or vegetative propagation by initial Transgenics.In the present invention, term " transgenosis " does not comprise genomic (the chromosomal or extrachromosomal) change by conventional plant breeding method or natural generation event, and described natural generation event is random cross pollination, non-recombinant virus infection, non-recombinant Bacterial Transformation, non-recombinant swivel base or spontaneous mutation such as.

In the present invention, " allos " refers to that occurring in nature first molecule is not found and the second molecular combinations usually.Such as, molecule can be derived from the first species and be inserted in the genome of the second species.Therefore this molecule is allos for host and is manually introduced in the genome of host cell.

Cultivation has resistance to lepidopterous insects and glyphosate herbicidal is had to the transgenic corn events DBN9981 of tolerance, pass through following steps: first make the first parental corn plants and the second parental corn plants sexual hybridization, thus create various first-generation progeny plant, described first parental corn plants is made up of the maize plant cultivating transgenic corn event DBN9981 and offspring thereof, this transgenic corn events DBN9981 and offspring thereof by utilize of the present invention to lepidopterous insects, there is resistance and the expression cassette that glyphosate herbicidal has a tolerance transformed obtain, second parental corn plants lacks the resistance of lepidopterous insects and/or has tolerance to glyphosate herbicidal, then select to the invasion and attack of lepidopterous insects, to there is resistance and/or glyphosate herbicidal is had to the progeny plant of tolerance, can cultivate and to lepidopterous insects, there is resistance and maize plant glyphosate herbicidal to tolerance.These steps may further include and the progeny plant of lepidopterous insects resistance and/or glyphosate tolerant and the second parental corn plants or the 3rd parental corn plants are backcrossed, then by applying with lepidopteran insect infestation, glyphosate herbicidal or carrying out chooser generation by the qualification of the molecular marked compound (as the 5 ' end and 3 ' comprising insertion sequence in transgenic corn events DBN9981 holds the DNA molecular of the bond site identified) relevant to proterties, thus generation has resistance to lepidopterous insects and glyphosate herbicidal is had to the maize plant of tolerance.

It will also be appreciated that two kinds of different transgenic plant also can hybridize to produce containing two independently, the offspring of foreign gene that adds of separate type.It is all homozygous Progeny plants that the selfing of suitable offspring can obtain concerning two foreign genes added.Foregoing to stock plant backcross and and the outcross of non-transgenic plant also it is expected to, vegetative propagation is also same.

Term " probe " is one section of nucleic acid molecule be separated, and is combined with conventional detectable label or reporter molecules above it, such as, and radio isotope, part, chemoluminescence agent or enzyme.A chain of this probe and target nucleic acid is complementary, in the present invention, probe is with complementary from the genomic DNA chain of transgenic corn events DBN9981, no matter this genomic dna is from transgenic corn events DBN9981 or seed or derives from the plant of transgenic corn events DBN9981 or seed or extract.Probe of the present invention not only comprises thymus nucleic acid or Yeast Nucleic Acid, also comprises and is combined with target dna sequence specifically and can be used for detecting polymeric amide and other probe materials of the existence of this target dna sequence.

Term " primer " is one section of nucleic acid molecule be separated, it is by nucleic acid hybridization, and annealed combination, on the target dna chain of complementation, forms heterozygote between primer and target dna chain, then under the effect of polysaccharase (such as archaeal dna polymerase), along target dna chain extension.Primer pair of the present invention relates to its application in target nucleic acid sequence amplification, such as, by the nucleic acid amplification method of polymerase chain reaction (PCR) or other routines.

The length of probe and primer is generally 11 polynucleotide or more, preferably 18 polynucleotide or more, more preferably 24 polynucleotide or more, most preferably 30 polynucleotide or more.This probe and primer are hybridized specifically with target sequence under high stringency conditions.Although be different from target dna sequence and keep the probe of hybridization ability can by conventional design out to target dna sequence, but, preferably, the continuous nucleic acid of the probe in the present invention and primer and target sequence has DNA sequence dna identity completely.

Can be determined by ordinary method based on the primer of flanking genomic dna of the present invention and insertion sequence and probe, such as, by being separated corresponding DNA molecular from the vegetable material deriving from transgenic corn events DBN9981, and determine the nucleotide sequence of this DNA molecular.Described DNA molecular comprises transgene insert sequence and Maize genome flank region, and the fragment of described DNA molecular can be used as primer or probe.

Nucleic acid probe of the present invention and primer are hybridized with target dna sequence under strict conditions.The nucleic acid hybridization of any routine or amplification method may be used to identify the existence deriving from the DNA of transgenic corn events DBN9981 in sample.Nucleic acid molecule or its fragment can carry out specific hybrid with other nucleic acid molecule in any case.As the present invention uses, if two nucleic acid molecule can form antiparallel double-strandednucleic acid structure, just can say that these two nucleic acid molecule can carry out specific hybrid to each other.If two nucleic acid molecule demonstrate complementary completely, then one of them nucleic acid molecule is claimed to be another nucleic acid molecule " complement ".As the present invention uses, when corresponding nucleotide complementary with another nucleic acid molecule of each Nucleotide of a nucleic acid molecule, then these two nucleic acid molecule are claimed to demonstrate " complete complementary ".If two nucleic acid molecule can make their annealing and being bonded to each other under at least conventional " low strict " condition with enough stability phase mutual crosses, then claim these two nucleic acid molecule for " minimum level is complementary ".Similarly, if two nucleic acid molecule can make them anneal under " highly strict " condition of routine and be bonded to each other with enough stability phase mutual crosses, then these two nucleic acid molecule are claimed to have " complementarity ".Depart from from complete complementary and can allow, depart from as long as this and not exclusively stop two molecules to form duplex structure.In order to enable a nucleic acid molecule as primer or probe, only need to ensure that it has sufficient complementarity in sequence, to make form stable duplex structure under adopted specific solvent and salt concn.

As the present invention use, the sequence of basic homology is one section of nucleic acid molecule, this nucleic acid molecule under high stringency can with the complementary strand generation specific hybrid of another section of nucleic acid molecule matched.Promote the stringent condition be applicable to of DNA hybridization, such as, process greatly under 45 DEG C of conditions by 6.0 × sodium chloride/sodium citrate (SSC), then wash with 2.0 × SSC under 50 DEG C of conditions, these conditions are known to those skilled in the art.Such as, the salt concn in washing step can be selected from Low stringency conditions about 2.0 × SSC, 50 DEG C to high stringency about 0.2 × SSC, 50 DEG C.In addition, the temperature condition in washing step from the room temperature of Low stringency conditions about 22 DEG C, can be elevated to about 65 DEG C of high stringency.Temperature condition and salt concn can all change, and also can one of them to remain unchanged and another variable changes.Preferably, a nucleic acid molecule of the present invention can under moderate stringency, such as at about 2.0 × SSC and about 65 DEG C with one or more nucleic acid molecule or its complementary sequence in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7, or arbitrary fragment generation specific hybrid of above-mentioned sequence.More preferably, a nucleic acid molecule of the present invention under high stringency with one or more nucleic acid molecule or its complementary sequence in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7, or arbitrary fragment generation specific hybrid of above-mentioned sequence.In the present invention, preferred marker nucleic acid molecule has SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:7 or its complementary sequence, or arbitrary fragment of above-mentioned sequence.Another preferred marker nucleic acid molecule of the present invention and SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:7 or its complementary sequence, or arbitrary fragment of above-mentioned sequence has the sequence iden of 80% to 100% or 90% to 100%.SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 and SEQ ID NO:7 can as the marker in plant breeding method to identify the offspring of genetic cross.The method that the hybridization of probe and target dna molecule can be well known to those skilled in the art by any one detects, and these methods include but not limited to, fluorescent mark, radio-labeling, antibody class mark and chemiluminescent labeling.

About the amplification using specific amplimer to carry out target nucleic acid sequence (such as, pass through PCR), " stringent condition " refers to and only allows primer pair target nucleic acid sequence that the condition of hybridization occurs in the hot amplified reaction of DNA, there is the primer of the wild-type sequence (or its complementary sequence) corresponding to target nucleic acid sequence, can be combined with described target nucleic acid sequence, and preferably produce unique amplified production, amplified production and amplicon.

Term " specific binding (target sequence) " refers to that probe or primer are only hybridized with the target sequence comprised in the sample of target sequence under stringent hybridization condition.

As the present invention uses, " DNA through amplification " or " amplicon " refer to the nucleic acid amplification product of the target nucleic acid sequence as a nucleic acid-templated part.Such as, in order to determine whether maize plant is produced by sexual hybridization mode by containing transgenic corn events DBN9981 of the present invention, or whether the corn sample gathered from field comprises transgenic corn events DBN9981, or maize extract, such as whether meal, powder or oil comprise transgenic corn events DBN9981, and the DNA extracted from maize plant tissue sample or extract can by using the nucleic acid amplification method of primer pair to be diagnostic amplicon with generation for the existence of the DNA of transgenic corn events DBN9981.Described primer pair comprises first primer derived from the adjacent flanking sequence of foreign DNA insertion point inserted in Plant Genome, and derives from second primer of foreign DNA of insertion.Amplicon has certain length and sequence, and transgenic corn events DBN9981 described in described sequence pair is also diagnostic.The length range of amplicon can be primer pair add a nucleotide base pair in conjunction with length, preferably add about 50 nucleotide bases pair, more preferably add about 250 nucleotide bases pair, most preferably add about 450 nucleotide bases to or more.

Optionally, primer pair can derive from the flanking genomic sequence inserting DNA both sides, to produce the amplicon comprising whole insertion nucleotide sequence.One of deriving from the primer pair of plant genome sequences can be positioned at apart from inserting DNA sequence dna a distance, and the scope of this distance can be that a nucleotide base is to arriving about 20,000 nucleotide bases pair.The use of term " amplicon " eliminates the primer dimer formed in the hot amplified reaction of DNA especially.

Nucleic acid amplification reaction can be realized by any one nucleic acid amplification reaction method known in the art, comprises polymerase chain reaction (PCR).Various nucleic acid amplification method has been well-known to those skilled in the art.PCR amplification method has developed into can the increase genomic dna of 22kb and the phage DNA of 42kb.Other DNA cloning methods of these methods and this area may be used for the present invention.The exogenous DNA array inserted and can increasing by utilizing the genome of primer sequence to transgenic corn events DBN9981 that provide from the flanking DNA sequence of transgenic corn events DBN9981, carries out the DNA sequencing of standard to the DNA of pcr amplification or clone after amplification.

DNA detection test kit based on DNA cloning method contains DNA primer molecule, and they are under suitable reaction conditions on specific hybrid to target dna and the diagnostic amplicon that increases.Test kit can provide the many methods based on the detection method of sepharose or the known checkout and diagnosis amplicon of prior art.Containing with any part homology in the Maize genome district of SEQ ID NO:3 or SEQ ID NO:4 or complementation and be provided by the present invention with the test kit of any part homology of the transgenosis insert district of SEQ ID NO:5 or the DNA primer of complementation.Differentiate that primer pair useful in DNA cloning method is SEQ ID NO:8 and SEQ ID NO:9 especially, the diagnostic amplicon of a part of homology in the 5 ' transgenosis/genome district of its amplification and transgenic corn events DBN9981, wherein amplicon comprises SEQ ID NO:1.Other DNA molecular as DNA primer can be selected from SEQ ID NO:5.

The amplicon that these methods produce can be detected by multiple technologies.One of them method is Genetic Bit Analysis, and the method devises one and crosses over the DNA oligonucleotide chain inserting DNA sequence dna and adjacent flanking genomic DNA sequence.This oligonucleotide chain is fixed in the micropore of a microwell plate, after pcr amplification is carried out to target area (in insertion sequence and in adjacent flanking genomic sequence each use primer), single stranded PCR products can be hybridized with fixing oligonucleotide chain, and as the template of single base extension, this extension employs the ddNTPs of archaeal dna polymerase and the base specific markers for next expection.Result can be obtained by fluorescence or ELISA class methods.Signal represents the existence of insertion/flanking sequence, and it illustrates that amplification, hybridization and single base extension are successful.

Another kind method is Pyrosequencing (Manganic pyrophosphate complex initiation) technology.The method devises one and crosses over the oligonucleotide chain inserting DNA sequence dna and adjacent genomic dna combining site.The single stranded PCR products of this oligonucleotide chain and target area (each in insertion sequence and in adjacent flanking genomic sequence use a primer) is hybridized, then with archaeal dna polymerase, ATP, sulfonyl enzyme, luciferase, apyrase, adenosine-5 '-phosphorus vitriol carries out incubation together with luciferin.Add dNTPs respectively, measure the optical signal produced.Optical signal represents the existence of insertion/flanking sequence, and it illustrates that amplification, hybridization and single base or polybase base extension are successful.

The Fluorescence polarization that Chen etc. (genome research (Genome Res.) 9:492-498,1999) describe also is a kind of method that may be used for detecting amplicon of the present invention.Make to need design one to cross over the oligonucleotide chain inserting DNA sequence dna and adjacent genomic dna combining site in this way.The single stranded PCR products (in insertion sequence and in adjacent flanking genomic sequence each use primer) of this oligonucleotide chain and target area is hybridized, then carries out incubation together with archaeal dna polymerase and a kind of fluorescently-labeled ddNTP.Single-basic extension can cause inserting ddNTP.This insertion can utilize luminoscope to measure the change of its polarization.The change of polarization represents the existence of insertion/flanking sequence, and it illustrates that amplification, hybridization and single base extension are successful.

Taqman is described to a kind of detection and the method for quantitative analysis DNA sequence dna existence, has detailed introduction in the operation instruction that the method provides in manufacturers.Now briefly illustrate as follows, design one and cross over the FRET oligonucleotide probe inserting DNA sequence dna and adjacent flanking genomic combining site.This FRET probe and PCR primer (in insertion sequence and in adjacent flanking genomic sequence each use primer) carry out circulating reaction under heat-stabilised poly synthase and dNTPs exist.The hybridization of FRET probe causes the division of fluorescing fractions and quencher moieties and the release of fluorescing fractions on FRET probe.The generation of fluorescent signal represents the existence of insertion/flanking sequence, and it illustrates that amplification and hybridization are successful.

Based on Hybridization principle, the applicable technology for detecting the vegetable material deriving from transgenic corn events DBN9981 can also comprise Southern blot hybridization, Northern blot hybridization and in situ hybridization.Especially, described applicable technology comprises incubation probe and sample, washs to remove unconjugated probe and whether detection probes hybridizes.Described detection method depends on the type of the appended mark of probe, and such as, being exposed by X-ray and develop can the probe of detection of radioactive labels, or realizes by substrate conversion the probe that colour-change can detect enzyme labelling.

Tyangi etc. (Nature Biotechnol (Nat.Biotech.) 14:303-308,1996) describe the application of molecule marker in sequential detection.Brief description is as follows, designs one and crosses over the FRET oligonucleotide probe inserting DNA sequence dna and adjacent flanking genomic combining site.The unique texture of this FRET probe causes it to contain secondary structure, and this secondary structure can keep fluorescing fractions and quencher moieties within closely.This FRET probe and PCR primer (in insertion sequence and in adjacent flanking genomic sequence each use primer) carry out circulating reaction under heat-stabilised poly synthase and dNTPs exist.Through successful pcr amplification, the hybridization of FRET probe and target sequence causes the forfeiture of probe secondary structure, thus fluorescing fractions is spatially separated with quencher moieties, produces fluorescent signal.The generation of fluorescent signal represents the existence of insertion/flanking sequence, and it illustrates that amplification and hybridization are successful.

Other methods described, such as microfluid (microfluidics) provides the method and apparatus of separation and DNA amplification sample.Photoinitiator dye is used for detecting and measuring specific DNA molecular.Comprise electronic sensor for detecting DNA molecule or receive pearl test tube (nanotube) equipment of receiving that thus can be detected in conjunction with specific DNA molecular are useful for detection DNA molecular of the present invention.

That composition of the present invention and DNA detection field describe or known method can be used to develop DNA detection test kit.Described test kit is conducive to identifying the DNA that whether there is transgenic corn events DBN9981 in sample, can also be used for the maize plant of the DNA cultivated containing transgenic corn events DBN9981.Described test kit can contain DNA primer or probe, it is with coming from or be complementary to SEQ ID NO:1,2,3,4 or 5 at least partially, or containing other DNA primer or probe, it is with coming from or be complementary to DNA contained in the transgene genetic element of DNA, these DNA sequence dnas may be used for DNA amplification reaction, or as the probe in DNA hybridization method.The DNA structure of transgene insert sequence that is that contain in Maize genome and that illustrate in Fig. 1 and table 1 and Maize genome combining site comprises: the corn DBN9981 flanking gene group region being positioned at transgene insert sequence 5 ' end, from a part of insertion sequence in the left border region (LB) of Agrobacterium, first expression cassette is by the cauliflower mosaic virus 35 S promoter (pr35S) of the tandem sequence repeats containing enhanser region, be operably connected on maize Heat Shock 70kDa albumen intron (iZmHSP70), be operably connected on the Cry1Ab albumen (cCry1Ab) of the insect-resistant of bacillus thuringiensis, and the transcription terminator (tNos) being operably connected to nopaline synthase above forms, second expression cassette is by rice actin 1 promotor (prOsAct1), be operably connected on Arabidopis thaliana EPSPS chloroplast transit peptides (spAtCTP2), be operably connected on the 5-enol-pyrovyl shikimic acid-3-phosphate synthase (cEPSPS) of the glyphosate tolerant of Agrobacterium CP4 bacterial strain, and be operably connected on cauliflower mosaic virus 35S terminator (t35S) and form, from a part of insertion sequence in the right side boundary region (RB) of Agrobacterium, and be positioned at the maize plant DBN9981 flanking gene group region (SEQ ID NO:5) of transgene insert sequence 3 ' end.In DNA cloning method, DNA molecular as primer can be any part deriving from transgene insert sequence in transgenic corn events DBN9981, also can be any part in the region of DNA territory deriving from flank Maize genome in transgenic corn events DBN9981.

Transgenic corn events DBN9981 can combine with other transgenic maize varieties, such as the corn of weedicide (as careless ammonium phosphine, dicamba 98 etc.) tolerance, or carries the transgenic maize varieties of other anti insect genes.The various combinations of all these different transgenic events, breeding together with transgenic corn events DBN9981 of the present invention, can provide anti-multiple insect pest and the improvement hybrid transgenic corn variety of anti-multiple weedicide.These kinds can show the more excellent feature such as output lifting compared to the transformed variety of non-transgenic kind and unisexuality shape.

The invention provides a kind of nucleotide sequence for detecting maize plant and detection method thereof, transgenic corn events DBN9981's is have resistance to the feeding damage of lepidoptera pest, and tolerance is containing the phytotoxic effects of the agriculture weedicide of glyphosate.The milpa of this dual proterties expresses the Cry1Ab albumen of bacillus thuringiensis, which provide the resistance to lepidoptera pest (as Ostrinia furnacalis) feeding damage, and express 5-enol-pyrovyl shikimic acid-3-phosphate synthase (EPSPS) albumen of the glyphosate resistance of Agrobacterium strains CP4, it gives plant to the tolerance of glyphosate.Dual proterties corn tool has the following advantages: 1) from the financial loss caused due to lepidoptera pest (as Ostrinia furnacalis, east armyworm and dichocrocis punctiferalis etc.), Ostrinia furnacalis, east armyworm and dichocrocis punctiferalis etc. are the primary pests of corn-growing regions; 2) ability controlled for broad-spectrum weeding to corn crop containing the agriculture weedicide of glyphosate is applied; 3) corn yield does not reduce.In addition, the gene linkage of coding insect-resistant and glyphosate tolerant proterties is in same region of DNA section, and be present on the genomic term single gene seat of transgenic corn events DBN9981, the transgenic insert that the breeding efficiency making it possible to that this point provides enhancing is followed the trail of with molecule marker in reproductive population and filial generation thereof.Simultaneously in detection method, SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence or SEQ ID NO:7 or its complementary sequence can as DNA primer or probe to produce the amplified production that be diagnosed as transgenic corn events DBN9981 or its offspring, and the existence identifying the vegetable material deriving from transgenic corn events DBN9981 that can be quick, accurate, stable.

BRIEF DESCRIPTION OF THE SEQUENCES

11 Nucleotide of the insertion point of 5 ' transgenic fragment and every side of corn gene group DNA in SEQ ID NO:1 transgenic corn events DBN9981;

11 Nucleotide of the insertion point of 3 ' transgenic fragment and every side of corn gene group DNA in SEQ ID NO:2 transgenic corn events DBN9981;

Be positioned at 5 ' end of insertion sequence the sequence that the length inserted near junction is 1381 Nucleotide in SEQ ID NO:3 transgenic corn events DBN9981;

Be positioned at 3 ' end of insertion sequence the sequence that the length inserted near junction is 1384 Nucleotide in SEQ ID NO:4 transgenic corn events DBN9981;

The whole T-DNA sequence of SEQ ID NO:5,5 ' and 3 ' flank maize genomic sequence;

SEQ ID NO:6 is positioned at the sequence of SEQ ID NO:3 inside, spans DBN10124 construct DNA sequence dna and tNos transcription termination sequence;

SEQ ID NO:7 is positioned at the sequence of SEQ ID NO:4 inside, spans t35S transcription termination sequence and DBN10124 construct DNA sequence dna;

First primer of SEQ ID NO:8 amplification SEQ ID NO:3;

Second primer of SEQ ID NO:9 amplification SEQ ID NO:3;

First primer of SEQ ID NO:10 amplification SEQ ID NO:4;

Second primer of SEQ ID NO:11 amplification SEQ ID NO:4;

Primer on SEQ ID NO:125 ' flanking genomic sequence;

The primer be positioned on T-DNA that SEQ ID NO:13 and SEQ ID NO:12 matches;

Primer on SEQ ID NO:143 ' flanking genomic sequence, itself and SEQ ID NO:12 match, and can to detect transgenosis be homozygote or heterozygote;

The primer be positioned on T-DNA that SEQ ID NO:15 and SEQ ID NO:14 matches;

SEQ ID NO:16Taqman detects the primer 1 of Cry1Ab;

SEQ ID NO:17Taqman detects the primer 2 of Cry1Ab;

SEQ ID NO:18Taqman detects the probe 1 of Cry1Ab;

SEQ ID NO:19Taqman detects the primer 3 of EPSPS;

SEQ ID NO:20Taqman detects the primer 4 of EPSPS;

SEQ ID NO:21Taqman detects the probe 2 of EPSPS;

First primer of SEQ ID NO:22 corn native gene Ubiquitin;

Second primer of SEQ ID NO:23 corn native gene Ubiquitin;

The probe of Cry1Ab in SEQ ID NO:24Southern hybridization check;

The probe of EPSPS in SEQ ID NO:25Southern hybridization check;

SEQ ID NO:26 is positioned at the primer on T-DNA, consistent with SEQ ID NO:13 direction;

SEQ ID NO:27 is positioned at the primer on T-DNA, contrary with SEQ ID NO:13 direction, is used as to obtain flanking sequence;

SEQ ID NO:28 is positioned at the primer on T-DNA, contrary with SEQ ID NO:13 direction, is used as to obtain flanking sequence;

SEQ ID NO:29 is positioned at the primer on T-DNA, consistent with SEQ ID NO:15 direction;

SEQ ID NO:30 is positioned at the primer on T-DNA, contrary with SEQ ID NO:15 direction, is used as to obtain flanking sequence;

SEQ ID NO:31 is positioned at the primer on T-DNA, contrary with SEQ ID NO:15 direction, is used as to obtain flanking sequence.

Below by drawings and Examples, technical scheme of the present invention is described in further detail.

Accompanying drawing explanation

Fig. 1 is the present invention for the transgene insert sequence of nucleotide sequence and detection method thereof detecting maize plant DBN9981 and the structural representation of Maize genome combining site;

Fig. 2 is the present invention for the structural representation of the recombinant expression vector DBN10124 of the nucleotide sequence and detection method thereof detecting maize plant DBN9981;

Fig. 3 is the present invention for the transgenic corn events DBN9981 of the nucleotide sequence and detection method thereof detecting maize plant DBN9981 at the field efficacy figure of lobus cardiacus phase and the phase inoculation Ostrinia furnacalis that weaves silk;

The field efficacy figure of Fig. 4 to be the present invention for the transgenic corn events DBN9981 of the nucleotide sequence and detection method thereof detecting maize plant DBN9981 inoculate east armyworm;

The field efficacy figure of Fig. 5 to be the present invention for the transgenic corn events DBN9981 of the nucleotide sequence and detection method thereof detecting maize plant DBN9981 inoculate bollworm;

Fig. 6 is the present invention for the field efficacy figure of transgenic corn events DBN9981 under dichocrocis punctiferalis naturally-occurring condition of the nucleotide sequence and detection method thereof detecting maize plant DBN9981;

Fig. 7 is the present invention for the field efficacy figure of transgenic corn events DBN9981 under beet armyworm naturally-occurring condition of the nucleotide sequence and detection method thereof detecting maize plant DBN9981.

Embodiment

The technical scheme of the present invention for the nucleotide sequence and detection method thereof that detect maize plant DBN9981 is further illustrated below by specific embodiment.

First embodiment, clone and conversion

1.1, carrier cloning

The gene clone technology of use standard builds recombinant expression vector DBN10124 (as shown in Figure 2).Described carrier DBN10124 comprises the transgene expression cassette of two series connection, first expression cassette is by the cauliflower mosaic virus 35 S promoter (pr35S) of the tandem sequence repeats containing enhanser region, be operably connected on maize Heat Shock 70kDa albumen intron (iZmHSP70), be operably connected on the Cry1Ab albumen (cCry1Ab) of the insect-resistant of bacillus thuringiensis, and the transcription terminator (tNos) being operably connected to nopaline synthase above forms; Second expression cassette is by rice actin 1 promotor (prOsAct1), be operably connected on Arabidopis thaliana EPSPS chloroplast transit peptides (spAtCTP2), be operably connected on the 5-enol-pyrovyl shikimic acid-3-phosphate synthase (cEPSPS) of the glyphosate tolerant of Agrobacterium CP4 bacterial strain, and be operably connected on cauliflower mosaic virus 35S terminator (t35S) and form.

Described carrier DBN10124 liquid nitrogen method is transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat.No:18313-015) in, and with 5-enol-pyrovyl shikimic acid-3-phosphate synthase (EPSPS) for selective marker is screened transformant.

1.2, Plant Transformation

Conventional Agrobacterium infestation method is adopted to transform, by the Agrobacterium Dual culture described in the maize immature embryos of sterile culture and the present embodiment 1.1, so that the T-DNA in the recombinant expression vector DBN10124 of structure is transferred in maize chromosome group, to produce transgenic corn events DBN9981.

For agriculture bacillus mediated corn transformation, briefly, immature rataria is separated from corn, rataria is contacted with agrobacterium suspension, wherein the nucleotide sequence of the nucleotide sequence of Cry1Ab gene and EPSPS gene can be passed at least one cell (step 1: infect step) of one of rataria by Agrobacterium, in this step, rataria preferably immerses agrobacterium suspension (OD ₆₆₀=0.4-0.6, infect substratum (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 68.5g/L, glucose 36g/L, Syringylethanone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH 5.3)) in start inoculation.Rataria and Agrobacterium Dual culture one period (3 days) (step 2: Dual culture step).Preferably, rataria after infecting step at solid medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 20g/L, glucose 10g/L, Syringylethanone (AS) 100mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH 5.8) upper cultivation.After this Dual culture stage, optionally " recovery " step can be had.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, plant gel 3g/L, pH 5.8) at least exist a kind of oneself know suppress Agrobacterium growth microbiotic (cephamycin), do not add the selective agent (step 3: recovering step) of vegetable transformant.Preferably, rataria is having microbiotic but is not having the solid medium of selective agent is cultivated, to eliminate Agrobacterium and to provide decubation for infected cell.Then, the rataria of inoculation cultivates the transformed calli (step 4: select step) that also growth selection on the substratum containing selective agent (N-(phosphine carboxymerhyl) glycine).Preferably, rataria is having the screening solid medium of selective agent (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, N-(phosphine carboxymerhyl) glycine 0.25mol/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, plant gel 3g/L, pH 5.8) upper cultivation, cause the cell selective growth transformed.Then, callus regeneration becomes plant (step 5: regeneration step), preferably, is above cultivating with aftergrowth at solid medium (MS division culture medium and MS root media) containing the callus that the substratum of selective agent grows.

Screen the resistant calli obtained and transfer to described MS division culture medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, N-(phosphine carboxymerhyl) glycine 0.125mol/L, plant gel 3g/L, pH 5.8) on, cultivate differentiation at 25 DEG C.Differentiation seedling out transfers to described MS root media (MS salt 2.15g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH 5.8) on, be cultured to about 10cm at 25 DEG C high, move to hot-house culture to solid.In greenhouse, every day cultivates 16 hours at 28 DEG C, then cultivates 8 hours at 20 DEG C.

1.3, the qualification of transgenic event and screening

Generation 770 separate transgenic T altogether ₀individual plant.

Pass through TaqMan ^tMwhether the transgenic corn plant analyzing (see the second embodiment) detection regeneration exists Cry1Ab and EPSPS gene, and characterizes the copy number of insect-resistant and glyphosate herbicide tolerance strain.According to the copy number of goal gene, good insect-resistant, glyphosate herbicide tolerance and Agronomic (see the 5th embodiment and the 6th embodiment), by screening, the event DBN9981 of have selected is excellent, and it has and singly copies transgenosis, good insect-resistant, glyphosate herbicide tolerance and Agronomic (participating in the 5th embodiment and the 6th embodiment).

Second embodiment, carry out transgenic corn events DBN9981 detection with TaqMan

The blade getting transgenic corn events DBN9981 is about 100mg as sample, extracts its genomic dna with the DNeasy Plant Maxi Kit of Qiagen, is detected the copy number of Cry1Ab and EPSPS by Taqman fluorescence probe quantitative PCR method.In contrast with wild-type corn plant, carry out detection according to the method described above to analyze simultaneously.3 repetitions are established in experiment, average.

Concrete grammar is as follows:

Step 11, get the blade 100mg of transgenic corn events DBN9981, in mortar, be ground into homogenate with liquid nitrogen, 3 repetitions got by each sample;

The DNeasy Plant Mini Kit of step 12, use Qiagen extracts the genomic dna of above-mentioned sample, and concrete grammar is with reference to its product description;

Step 13, measure the genomic dna concentration of above-mentioned sample with NanoDrop 2000 (Thermo Scientific);

Step 14, adjust the genomic dna concentration of above-mentioned sample to same concentration value, the scope of described concentration value is 80-100ng/ μ l;

The copy number of step 15, employing Taqman fluorescence probe quantitative PCR method qualification sample, using the sample through qualification known copy number as standard substance, with the sample of wild-type corn plant in contrast, the repetition of 3, each sample, gets its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:

Following primer and probe are used for detecting Cry1Ab gene order:

Primer 1:CGAACTACGACTCCCGCAC is as shown in SEQ ID NO:16 in sequence table;

Primer 2: GTAGATTTCGCGGGTCAGTTG is as shown in SEQ ID NO:17 in sequence table;

Probe 1:CTACCCGATCCGCACCGTGTCC is as shown in SEQ ID NO:18 in sequence table;

Following primer and probe are used for detecting EPSPS gene order:

Primer 3:CTGGAAGGCGAGGACGTCATCAATA is as shown in SEQ ID NO:19 in sequence table;

Primer 4:TGGCGGCATTGCCGAAATCGAG is as shown in SEQ ID NO:20 in sequence table;

Probe 2:ATGCAGGCGATGGGCGCCCGCATCCGTA is as shown in SEQ ID NO:21 in sequence table;

PCR reaction system is:

JumpStart ^TMTaq ReadyMix ^TM(Sigma) 10μL

50 × primer/probe mixture 1 μ L

Genomic dna 3 μ L

Water (ddH ₂o) 6 μ L

Described 50 × primer/probe mixture comprises each 45 μ L of often kind of primer of 1mM concentration, the probe 50 μ L of 100 μMs of concentration and 860 μ L 1 × TE damping fluids, and at 4 DEG C, is housed in amber tube.

PCR reaction conditions is:

Utilize SDS2.3 software (Applied Biosystems) analytical data, obtain the transgenic corn events DBN9981 of single copy.

3rd embodiment, transgenic corn events DBN9981 detect

3.1, extracting genome DNA

CTAB (cetyl trimethylammonium bromide) method that DNA extraction conveniently adopts: after the blade getting the tender transgenic corn events DBN9981 of 2 grams of childrens is pulverized in liquid nitrogen, add 0.5mL in DNA extraction CTAB Buffer (the 20g/L CTAB of temperature 65 DEG C of preheatings, 1.4M NaCl, 100mM Tris-HCl, 20mM EDTA (ethylenediamine tetraacetic acid (EDTA)), pH to 8.0 is adjusted with NaOH), fully after mixing, in temperature 65 DEG C of extracting 90min; Add 0.5 times of volume of phenol, 0.5 times of volume of chloroform, puts upside down mixing; Centrifugal 10min under 12000rpm (rotations per minute) rotating speed; Aspirate supernatant, adds 2 times of volume dehydrated alcohols, softly rocks centrifuge tube, in temperature 4 DEG C of standing 30min; Centrifugal 10min again under 12000rpm rotating speed; Collect at the bottom of DNA to pipe; Abandoning supernatant liquor, is the ethanol of 70% by 1mL mass concentration, washing precipitation; Centrifugal 5min under 12000rpm rotating speed; Vacuum is drained or is dried up at super clean bench; DNA is precipitated and dissolved in appropriate TE damping fluid (10mM Tris-HCl, 1mM EDTA, pH 8.0), under being kept at temperature-20 DEG C of conditions.

3.2, the analysis of flanking DNA sequence

Concentration determination is carried out to the DNA sample of said extracted, makes the concentration of testing sample between 80-100ng/ μ L.With the restriction enzyme Sac I, the Kpn I that select, Xma I, Nhe I (5 ' end analyze) and Spe I, Pst I, BssH II (3 ' end analysis) respectively enzyme cut genomic dna.Each enzyme is cut in system and is added 26.5 μ L genomic dnas, and the restriction enzyme that 0.5 μ L is above-mentioned to be selected and 3 μ L enzyme cutting buffering liquids, enzyme cuts 1 hour.Cut after end until enzyme, cut in system to enzyme and add 70 μ L dehydrated alcohols, the centrifugal 7min of ice bath 30min, rotating speed 12000rpm, abandons supernatant, dries up, and adds 8.5 μ L distilled water (dd H afterwards ₂o), 1 μ L 10X T ₄buffer and 0.5 μ L T ₄ligase enzyme spends the night in temperature 4 DEG C of connections.Carry out pcr amplification with a series of nested primers and be separated 5 ' and 3 ' transgenosis/genomic dna.Concrete, be separated 5 ' transgenosis/genomic dna combination of primers and comprise SEQ ID NO:13, SEQ ID NO:26 as the first primer, SEQ ID NO:27, SEQ ID NO:28 are as the second primer, and SEQ ID NO:13 is as sequencing primer.Be separated 3 ' transgenosis/genomic dna combination of primers and comprise SEQ ID NO:15, SEQ ID NO:29 as the first primer, SEQ ID NO:30, SEQ ID NO:31 are as the second primer, SEQ ID NO:15 is as sequencing primer, and PCR reaction conditions is as shown in table 3.

The amplicon obtained electrophoresis on 2.0% sepharose, to be separated PCR reactant, to use QIAquick Gel to extract test kit (catalogue #_28704, Qiagen Inc., Valencia, CA) subsequently and is separated object fragment from agarose matrix.Then the PCR primer of purifying checked order (such as, ABI PrismTM 377, PE Biosystems, Foster City, CA) and analyze (such as, DNASTAR sequence analysis software, DNASTAR Inc., Madison, WI).

Use standard pcr confirmation 5 ' and 3 ' flanking sequence and junction sequences.5 ' flanking sequence and junction sequences can use SEQ ID NO:8 or SEQ ID NO:12, combination S EQ ID NO:9, SEQ ID NO:13 or SEQ ID NO:26 to confirm.3 ' flanking sequence and junction sequences can use SEQ ID NO:11 or SEQ ID NO:14, combination S EQ ID NO:10, SEQ ID NO:15 or SEQ ID NO:29 to confirm.PCR reaction system and amplification condition are as shown in table 2 and table 3.It will be understood by those skilled in the art that other primer sequence also can be used for confirming flanking sequence and junction sequences.

The DNA sequencing of PCR primer provides the DNA that may be used for designing other DNA moleculars, and other DNA moleculars described are as the qualification for the maize plant or seed that derive from transgenic corn events DBN9981 of primer and probe.

What discovery showed in the Nucleotide 1-1195 position of SEQ ID NO:5 is the right margin flank (5 ' flanking sequence) of maize genomic sequence at transgenic corn events DBN9981 insertion sequence, and what show in the Nucleotide 8445-9732 position of SEQ ID NO:5 is the left margin flank (3 ' flanking sequence) of maize genomic sequence at transgenic corn events DBN9981 insertion sequence.5 ' junction sequence is listed in SEQ ID NO:1, and 3 ' junction sequence is listed in SEQ ID NO:2.

3.3, PCR zygosity determination

Junction sequence is relatively short polynucleotide molecule, and it is new DNA sequence dna, and the DNA when detecting in analyzing in polynucleotide detection for transgenic corn events DBN9981 is diagnostic.Junction sequence in SEQ ID NO:1 and SEQ ID NO:2 is 11 polynucleotide of the insertion point of transgenic fragment in transgenic corn events DBN9981 and every side of corn gene group DNA.Longer or shorter polynucleotide junction sequence can be selected from SEQ ID NO:3 or SEQ ID NO:4.Junction sequence (5 ' connecting zone SEQ ID NO:1, and 3 ' connecting zone SEQ ID NO:2) is useful as DNA probe or as DNA primer molecule in DNA detection method.Junction sequence SEQ ID NO:6 and SEQ ID NO:7 is also DNA sequence dna new in transgenic corn events DBN9981, and it also can as DNA probe or the existence as DNA primer Molecular Detection transgenic corn events DBN9981DNA.Described SEQ ID NO:6 (the Nucleotide 1196-1381 position of SEQ ID NO:3) spans DBN10124 construct DNA sequence dna and tNos transcription termination sequence, and described SEQ ID NO:7 (the Nucleotide 1-96 position of SEQ ID NO:4) spans t35S transcription termination sequence and DBN10124 construct DNA sequence dna.

In addition, by using at least one primer from SEQ ID NO:3 or SEQ ID NO:4 to produce amplicon, the diagnostic amplicon of transgenic corn events DBN9981 when described primer is used in PCR method, is produced.

Particularly, produce PCR primer from 5 ' end of transgene insert sequence, this PCR primer be in the genome comprising the vegetable material deriving from transgenic corn events DBN9981 flank in a part for the genomic dna of 5 ' end of T-DNA insertion sequence.This PCR primer comprises SEQ ID NO:3.In order to carry out pcr amplification, the primer 5 (SEQ ID NO:8) that design is hybridized in the genomic dna sequence of 5 ' end of transgene insert sequence with flank, and the primer 6 (SEQ ID NO:9) being positioned at transgenosis t35S transcription termination sequence matched with it.

Produce PCR primer from 3 ' end of transgene insert sequence, this PCR primer to comprise in the genome of the vegetable material deriving from transgenic corn events DBN9981 flank in a part for the genomic dna of 3 ' end of T-DNA insertion sequence.This PCR primer comprises SEQ ID NO:4.In order to carry out pcr amplification, the primer 8 (SEQ ID NO:11) that design is hybridized in the genomic dna sequence of 3 ' end of transgene insert sequence with flank, and the primer 7 (SEQ IDNO:10) being positioned at the tNos transcription termination sequence of 3 ' end of inset matched with it.

The DNA cloning condition illustrated in table 2 and table 3 may be used for the test of above-mentioned PCR connectivity with the diagnostic amplicon producing transgenic corn events DBN9981.The detection of amplicon can be undertaken by using Stratagene Robocycler, MJ Engine as shown in table 3, Perkin-Elmer 9700 or Eppendorf Mastercycler Gradien thermal cycler etc., or is undertaken by method known to those skilled in the art and equipment.

Table 2, for the PCR step of the 5 ' transgenic insertions/genome engaging zones qualification of transgenic corn events DBN9981 and reaction mixture condition

Table 3, Perkin-Elmer9700 thermal cycler condition

Mix lightly, if thermal cycler does not have hot top, 1-2 can be added above each reaction solution and drip mineral oil.Use following loop parameter (table 3) at Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) the enterprising performing PCR of thermal cycler.MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should run under the pattern calculated.Cooling rate (ramp speed) will be set as maximum value when running by Perkin-Elmer 9700 thermal cycler.

Experimental result shows: primer 5 and 6 (SEQ ID NO:8 and 9), when it is used in the PCR reaction of transgenic corn events DBN9981 genomic dna, produce the amplified production of 1381bp fragment, when it is used in the PCR reaction of unconverted corn gene group DNA and non-DBN9981 corn gene group DNA, fragment is not had to be amplified; Primer 7 and 8 (SEQ ID NO:10 and 11), when it is used in the PCR reaction of transgenic corn events DBN9981 genomic dna, produce the amplified production of 1384bp fragment, when it is used in the PCR reaction of unconverted corn gene group DNA and non-DBN9981 corn gene group DNA, fragment is not had to be amplified.

PCR zygosity determination also can be used for identifying that the material deriving from transgenic corn events DBN9981 is homozygote or heterozygote.By primer 9 (SEQ ID NO:12), primer 10 (SEQ ID NO:13) and primer 11 (SEQ ID NO:14) for amplified reaction to produce the diagnostic amplicon of transgenic corn events DBN9981.The DNA cloning condition illustrated in table 4 and table 5 may be used for the test of above-mentioned connectivity with the diagnostic amplicon producing transgenic corn events DBN9981.

Table 4, zygosity determination reaction solution

Table 5, zygosity determination Perkin-Elmer9700 thermal cycler condition

Use following loop parameter (table 5) at Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) the enterprising performing PCR of thermal cycler.MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should run under the pattern calculated.Cooling rate (ramp speed) will be set as maximum value when running by Perkin-Elmer 9700 thermal cycler.

In described amplified reaction, the biological sample containing template DNA contains the DNA that there is situation of transgenic corn events DBN9981 in this sample of diagnosis.Or react and will be produced two different DNA cloning by the biological sample containing the DNA deriving from Maize genome, described in derive from the DNA of Maize genome corresponding relative to the insertion DNA existed in transgenic corn events DBN9981 allelotrope be heterozygosis.These two different amplicons are by the second amplicon that there is situation corresponding to the first amplicon and diagnosis transgenic corn events DBN9981DNA that derive from wild-type corn genomic gene seat.Only produce the maize dna sample of the single amplicon corresponding to the second amplicon described for heterozygous genes group, the diagnosable existence determining transgenic corn events DBN9981 in this sample, and this sample by the allelotrope corresponding relative to the insertion DNA existed in rotaring gene corn plant DBN9981 by the corn seed isozygotied is produced.

It should be noted that, it is diagnostic amplicon that the primer pair of transgenic corn events DBN9981 is used to produce transgenic corn events DBN9981 genomic dna.These primer pairs include but not limited to, primer 5 and 6 (SEQ ID NO:8 and 9), and primer 7 and 8 (SEQ ID NO:10 and 11), in described DNA cloning method.In addition, contrast primer 12 and 13 (SEQ ID NO:22 and 23) for the corn native gene that increases is included, as an inherent standard of reaction conditions.Should comprise the assaypositive tissue DNA extract contrast of a transgenic corn events DBN9981 to the analysis of transgenic corn events DBN9981DNA extracting sample, a negative DNA extract deriving from non-transgenic corn event DBN9981 contrasts and a negative control not containing template maize dna extract.Except these primer pairs, the any primer pair from SEQ ID NO:3 or SEQ ID NO:4 or its complementary sequence can also be used, produce respectively when they are used to DNA amplification reaction and be organized as the diagnostic amplicon comprising SEQ ID NO:1 or SEQ ID NO:2 for what derive from transgenic event maize plant DBN9981.The DNA cloning condition illustrated in table 2-table 5 may be used for using suitable primer pair to produce the diagnostic amplicon of transgenic corn events DBN9981.Produce when testing in DNA cloning method to transgenic corn events DBN9981 be diagnostic amplicon, estimate extract containing the maize plant or seed DNA comprising transgenic corn events DBN9981, or derive from the product of transgenic corn events DBN9981, the template increased can be used as, determine whether there is transgenic corn events DBN9981.

4th embodiment, carry out transgenic corn events DBN9981 detection by Southern blot hybridization

4.1, for the DNA extraction of Southern blot hybridization

The transformation event utilizing T4, T5 generation to isozygoty carries out Southern engram analysis.Utilize mortar and pestle, in liquid nitrogen, grind about 5 to 10g plant tissue.At 12.5mL Extraction buffer A (0.2M Tris pH8.0,50mM EDTA, 0.25M NaCl, 0.1%v/v β-dredge base ethanol, 2.5%w/v Polyvinyl-pyrrolidone) middle resuspension plant tissue, with centrifugal 10 minutes of 4000rpm (2755g).After discarding supernatant liquor, at 2.5mL Extraction buffer B (0.2M Tris pH 8.0,50mM EDTA, 0.5M NaCl, 1%v/v β-dredge base ethanol, 2.5%w/v Polyvinyl-pyrrolidone, 3% sarcosyl, 20% ethanol) in resuspension precipitation, and 37 DEG C of incubations 30 minutes.Between incubation period, with asepsis ring biased sample once.After incubation, adding isopyknic chloroform/primary isoamyl alcohol (24:1), mixing gently by being inverted, with 4000rpm centrifugal 20 minutes.Collect waterbearing stratum, and after interpolation 0.54 volume isopropanol with centrifugal 5 minutes of 4000rpm to precipitate DNA.Discard supernatant liquor, and resuspension DNA precipitates in 500 μ L TE.In order to the RNA of any existence of degrading, at 37 DEG C, by DNA and 1 μ L 30mg/mL RNAase A incubation 30 minutes, with 4000rpm centrifugal 5 minutes, and deposit in case at 0.5 volume 7.5M ammonium acetate and 0.54 volume isopropanol, by within centrifugal 10 minutes, precipitating DNA with 14000rpm.After discarding supernatant liquor, wash precipitation with the ethanol that 500 μ L massfractions are 70%, and after making its drying in 100 μ L TE resuspension.

4.2, restriction enzyme digestion

Spectrophotometer or fluorometric quantification is utilized to detect DNA concentration (utilizing 1 × TNE and Hoechst dyestuff).

In 100 μ L reaction systems, each digestion 5 μ g DNA.With restriction enzyme EcoR V and Hind III digested genomic dna respectively, on T-DNA, the partial sequence of Cry1Ab and EPSPS is as probe.For often kind of enzyme, be incubated overnight digest at a proper temperature.Utilize SpeedVac (speed vacuum) rotary sample to reduce volume to 30 μ L.

4.3, gel electrophoresis

Add tetrabromophenol sulfonphthalein Loading Dye to each sample derived from the present embodiment 4.2, and by each sample pipetting volume to containing on 0.7% sepharose of ethidium bromide, electrophoretic separation in TBE electrophoretic buffer, running gel spends the night under 20 volts.

In 0.25M HCl, wash gel 15 minutes to make DNA depurination, then wash with water.Setting Southern blot hybridization is as follows: in dish, place 20 thick dry trace paper, it is placed again 4 thin dry trace paper.Moistening 1 thin trace paper in advance in 0.4M NaOH, and be placed on this pile, then places 1 Hybond-N+ transfer film (Amersham Pharmacia Biotech, #RPN303B) moistening in advance in 0.4M NaOH.Gel is seated in top, guarantees do not have bubble between gel and film.3 trace paper soaked in advance are in addition placed on gel top, and fill up damping fluid dish with 0.4M NaOH.Connect gel stack and damping fluid dish with the wick be immersed in advance in 0.4M NaOH, DNA is transferred on film.At room temperature carry out the DNA transfer of about 4 hours.After transfer, rinsing Hybond film 10 seconds in 2 × SSC, DNA is combined with film by UV is crosslinked.

4.4, hybridize

The DNA sequence dna be applicable to pcr amplification is used for probe preparation.Described DNA probe is SEQ ID NO:24 and SEQ ID NO:25, or with above-mentioned Sequence homology or complementation.25ng DNA probe is boiled 5 minutes in 45 μ L TE, places 7 minutes on ice, then transfer in Rediprime II (Amersham Pharmacia Biotech, #RPN1633) test tube.5 μ l are added to Rediprime test tube ³²after the dCTP of P mark, 37 DEG C of incubation probes 15 minutes.According to the specification sheets of manufacturers, centrifugal by micro-centrifugal G-50 pillar (Amersham Pharmacia Biotech, #27-5330-01), to remove uncorporated dNTPs, this probe of purifying.Utilize scintillation counter measuring probe active.

By at 65 DEG C of Church prehybridization solution (500mM Na by 20mL pre-heating ₃p0 ₄, 1mM EDTA, 7%SDS, 1%BSA) and this Hybond film moistening 30 minutes, this Hybond film of prehybridization.Boil the probe 5 minutes of mark, and place 10 minutes on ice.Add appropriate probe (every 1mL pre-hybridization buffer 100 ten thousand countings) to pre-hybridization buffer, spend the night at 65 DEG C and hybridize.Second day, discard hybridization buffer, with 20mL Church rinse solution 1 (40mM Na ₃p0 ₄, 1mM EDTA, 5%SDS, 0.5%BSA) and after rinsing, at 65 DEG C, in 150mL Church rinse solution 1, wash film 20 minutes.With Church rinse solution 2 (40mM Na ₃p0 ₄, 1mM EDTA, 1%SDS) and repeat this process 2 times.This film is exposed to the position that phosphorus shields or X-ray combines with detection probes.

Each Southern comprises three kinds of control samples: (1) from the DNA of the segregant of negative (unconverted), its for the identification of any can with the endogenous corn sequence of element-specific probe hybridization; (2) from the DNA of negative segregant, wherein introduce the DBN10124 that Hind III-digests, its amount is equivalent to a copy number based on probe length, to illustrate when detecting the copy of the individual gene in Maize genome, and the sensitivity of this experiment; (3) the DBN10124 plasmid that the Hind III-being equivalent to a copy number based on probe length digests, it is as the positive control of hybridizing and for illustration of the sensitivity of testing.

The evidence that hybridization data provides confirmation supports TaqMan ^tMpcr analysis, namely maize plant DBN9981 contains the list copy of Cry1Ab and EPSPS gene., utilize this Cry1Ab probe, EcoR V and Hind III enzymolysis produce the single band that size is about 12kb and 8kb respectively; Utilize this EPSPS probe, EcoR V and Hind III enzymolysis produce the single band that size is about 10kb and 4.5kb respectively.This shows that each copy of Cry1Ab and EPSPS is present in corn transformation event DBN9981.

The insect-resistant of the 5th embodiment, event detects

5.1, the biological assay of maize plant DBN9981

By transgenic corn events DBN9981 and wild-type corn plant (non-transgenic, NGM) 2 plants are respectively to Ostrinia furnacalis (Ostrinia furnacalis, ACB), dichocrocis punctiferalis (Conogethes punctiferalis, YPM), 2 committee noctuid (Athetis lepigone, LPG), pink rice borer (Sesamia inferens, PSB), east armyworm (Mythimna seperata, OAW), prodenia litura (Spodoptera litura, TCW), striped rice borer (Chilo suppressalis, SSB), bollworm (Helicoverpa armigera, and beet armyworm (Spodoptera exigua CBW), BAW) biological assay is carried out as follows:

Get transgenic corn events DBN9981 and wild-type corn plant (non-transgenic respectively, NGM) the fresh blade (V3-V4 period) of 2 plants, clean and with gauze, the water on blade is blotted with aseptic water washing, then maize leaf is removed vein, be cut into the strip of about 1cm × 3cm simultaneously, get 1-3 sheet (according to insect appetite determination blade quantity) cut after strip blade put on the filter paper bottom round plastic culture dish, described filter paper distilled water soaks, the newly hatched larvae of 10 artificial breedings is put in each culture dish, after worm examination culture dish is added a cover, at temperature 26-28 DEG C, relative humidity 70%-80%, statistics after 3 days is placed under the condition of photoperiod (light/dark) 16:8.Ostrinia furnacalis statistics mortality ratio, identified by corrected mortality antagonism level, corrected mortality (%)=(1-survival number/connect borer population-wild type control mortality ratio)/(1-wild type control mortality ratio) × 100%.Other insect statistical larvae development progress, mortality ratio and blade injury rate three indexs, obtain resistance total score (full marks 300 points): resistance total score=100 × corrected mortality+[100 × mortality ratio+90 × (just incubate borer population/connect worm sum)+60 × (just incubate-negative control borer population/connect worm sum)+10 × (negative control borer population/connect worm sum)]+100 × (1-blade injury rate).Select 5 strains to test respectively from transgenic corn events DBN9981 and wild-type corn plant (non-transgenic, NGM), every strain repeats 6 times.Result as shown in table 6 and table 7.

Pest-resistant bioassay results-the mortality ratio (%) of table 6, transgenic corn events DBN9981

Pest-resistant bioassay results-resistance the total score of table 7, transgenic corn events DBN9981

Result shows: transgenic corn events DBN9981 has good resistance to Ostrinia furnacalis, dichocrocis punctiferalis, committee noctuid, pink rice borer, east armyworm, prodenia litura, striped rice borer, bollworm and beet armyworms at 2, and the examination worm mortality ratio of transgenic corn events DBN9981 and resistance total score are significantly higher than NGM.

5.2, the field effect of transgenic corn events DBN9981

The seed of transgenic corn events DBN9981 and wild-type corn plant (non-transgenic, NGM) 2 plants is set to 2 process, and each process is by pressing randomized block design, and repeat for 3 times, plot area is 30m ²(5m × 6m), line-spacing 60cm, spacing in the rows 25cm, conventional cultivation manages, and the time of infertility does not spray sterilant.Different insects connects the interval having 2m between worm experimental plot, avoids the diffusion of insect between different districts.(1) Ostrinia furnacalis

Respectively at corn lobus cardiacus phase (litmus mouth phase, milpa is developed to open up the 6-8 leaf phase) and phase Artificial Inoculation of Anoplophora glabripennis of weaving silk, respectively connect worm 2 times.Every community Artificial Inoculation of Anoplophora glabripennis is no less than 40 strains, connects the newly hatched larvae about 60 of artificial breeding, connect worm after 3 days in every strain corn lobus cardiacus/filigree, and second time connects worm, connects borer population amount with first time.After connecing worm 14-21 days, by the killed situation of strain investigation corn.Usually within after connecing worm 14 days, institute an inquiry, if the rank that causes harm of negative control material (NGM) reaches sense or high sense, be then considered as effectively, suitably can postpone investigation if do not reach, but after connecing worm 21 days reaching appropriate level not yet, then this connect worm be considered as invalid.The lobus cardiacus phase connects worm investigation milpa middle and upper part blade and is taken food situation by Ostrinia furnacalis; The phase of weaving silk connects the killed degree of the female fringe of worm " Invest, Then Investigate " and the killed situation of plant.Each process random selecting 15-20 strain/OK.

The lobus cardiacus phase: the description record Ostrinia furnacalis food leaf-size class pressed in table 8 by strain is other.Calculate Ostrinia furnacalis to cause harm to each process blade the mean value of degree (food leaf-size class other): average food leaf-size class not=∑ (food leaf-size class not × this rank plant number)/investigate total strain number.According to other mean value of food leaf-size class, divide the resistance level of each process to Ostrinia furnacalis, as table 9.The resistance result of transgenic corn events DBN9981 lobus cardiacus phase to Ostrinia furnacalis is as shown in table 12.

Weave silk the phase: according to the killed situation of female fringe, channel quantity, channel length of tunnel (cm) and survival instar larvae and amount of survival, calculate the killed rank mean value of the resistance of each community fringe phase Ostrinia furnacalis to female fringe, judging criterion is as shown in table 10, then presses the judgment of standard mealie phase of table 11 to the resistance level of Ostrinia furnacalis.The transgenic corn events DBN9981 resistance result of phase to Ostrinia furnacalis of weaving silk is as shown in table 13.

Table 8, Ostrinia furnacalis are caused harm to corn lobus cardiacus the grade scale of degree

Food leaf-size class is other	Symptom describes
		1	Only indivedual blade there is 1-2 aperture≤1mm worm channel
2	Only indivedual blade there is 3-6 aperture≤1mm worm channel
		3	Minority blade has more than 7 apertures≤1mm worm channel
4	Indivedual blade there is 1-2 aperture≤2mm worm channel
		5	Minority blade there is 3-6 aperture≤2mm worm channel
6	Partial blade has more than 7 apertures≤2mm worm channel
		7	Minority blade there is 1-2 aperture be greater than the worm channel of 2mm
8	Partial blade there is 3-6 aperture be greater than the worm channel of 2mm
		9	Major part blade there are more than 7 apertures to be greater than the worm channel of 2mm

Table 9, corn are to the judgement criteria of Ostrinia furnacalis resistance

The other mean value of lobus cardiacus phase food leaf-size class	Resistance level
		1.0-2.9	High resistance (HR)
3.0-4.9	Anti-(R)
		5.0-6.9	In anti-(MR)
7.0-8.9	Sense (S)
		9.0	High sense (HS)

Table 10, mealie phase cause harm by Ostrinia furnacalis the grade scale of degree

Table 11, mealie phase are to the Evaluation standard of resistance of Ostrinia furnacalis

The killed rank mean value of female fringe	Resistance level
		1.0-2.0	High resistance (HR)
2.1-3.0	Anti-(R)
		3.1-5.0	In anti-(MR)
5.1-7.0	Sense (S)
		≥7.1	High sense (HS)

Table 12, transgenic corn events DBN9981 lobus cardiacus phase are to the resistance result of Ostrinia furnacalis

Table 13, transgenic corn events DBN9981 are weaved silk the resistance result of phase to Ostrinia furnacalis

Result shows: no matter be lobus cardiacus phase or the phase of weaving silk, transgenic corn events DBN9981 all has good resistance level to Ostrinia furnacalis; The lobus cardiacus phase, the other mean value of food leaf-size class of transgenic corn events DBN9981 is significantly lower than NGM.Weave silk the phase, the female fringe percentage of injury of transgenic corn events DBN9981, larvae alive number, length of tunnel and the killed rank of female fringe are all remarkable in NGM.Transgenic corn events DBN9981 inoculates the field efficacy of Ostrinia furnacalis as shown in Figure 3 in lobus cardiacus phase and phase of weaving silk.

(2) east armyworm

Test design and test method are substantially consistent with the resistance evaluating Ostrinia furnacalis as above.Unlike, only carry out Artificial Inoculation of Anoplophora glabripennis in the corn lobus cardiacus phase (milpa is developed to open up the 4-6 leaf phase), connect worm 2 times, connect the second instar larvae about 20 of artificial breeding at every strain corn lobus cardiacus.Connect worm after 3 days, second time connects worm, connects borer population amount with first time.Connecing worm after 14 days, investigation maize leaf is by the degree that causes harm of east armyworm.According to the cause harm degree of maize leaf by east armyworm, calculate east, each community armyworm to cause harm to maize leaf the mean value of rank (food leaf-size class other), its judging criterion is as shown in table 14, then presses the judgment of standard corn of table 15 to the resistance level of east armyworm.The resistance result of transgenic corn events DBN9981 lobus cardiacus phase to east armyworm is shown in table 16.

Table 14, maize leaf are caused harm by east armyworm the grade scale of degree

Food leaf-size class is other	Symptom describes
		1	Blade without killed, or only blade has needle prick shape (≤1mm) worm channel
2	Only indivedual blade there is a small amount of shell hole size (≤5mm) worm channel
		3	Minority blade has shell hole size (≤5mm) worm channel
4	Indivedual blade is incised (≤10mm)
		5	Minority blade is incised (≤10mm)
6	Partial blade is incised (≤10mm)
		7	Indivedual blade-section is taken food, and minority blade has sheet incise (≤10mm)
8	Minority blade is taken food, and partial blade has sheet incise (≤10mm)
		9	Major part blade is taken food

Table 15, corn are to the Evaluation standard of resistance of east armyworm

The other mean value of lobus cardiacus phase food leaf-size class	Resistance level
		1.0-2.0	High resistance (HR)
2.1-4.0	Anti-(R)
		4.1-6.0	In anti-(MR)
6.1-8.0	Sense (S)
		8.1-9.0	High sense (HS)

Table 16, transgenic corn events DBN9981 lobus cardiacus phase are to the resistance result of east armyworm

Result shows: transgenic corn events DBN9981 has good resistance level to east armyworm, and the ratio of incising of transgenic corn events DBN9981 is not all remarkable in NGM with food leaf-size class, transgenic corn events DBN9981 inoculates the field efficacy of east armyworm as shown in Figure 4.

(3) bollworm

Test design and test method are substantially consistent with the resistance evaluating Ostrinia furnacalis as above.Unlike, only carry out Artificial Inoculation of Anoplophora glabripennis in the corn silking phase, connect worm 2 times, connect the newly hatched larvae about 20 of artificial breeding, connect worm after 3 days in every strain corn capillament, second time connects worm, connects borer population amount with first time.After connecing worm 14-21 days, investigate female fringe percentage of injury, each female fringe survival larva number, the killed length of female fringe by strain.Usually within after connecing worm 14 days, institute an inquiry, if the rank that causes harm of negative control material (NGM) reaches sense or high sense, be then considered as effectively, suitably can postpone investigation if do not reach, but after connecing worm 21 days reaching appropriate level not yet, then this connect worm be considered as invalid.According to female fringe percentage of injury, survival larva number, the killed length of female fringe (cm), calculate each community mealie phase bollworm to the rank mean value of causing harm of female fringe, judging criterion is shown in table 17, then presses the judgment of standard mealie phase of table 18 to the resistance level of bollworm.The transgenic corn events DBN9981 resistance result of phase to bollworm of weaving silk is shown in table 19.

Table 17, maize ear are caused harm by bollworm the grade scale of degree

The killed rank of female fringe	Symptom describes
		0	Female fringe is not injured
1	Only filigree is killed
		2	The killed 1cm in fringe top
3+	Killedly under fringe top often increase 1cm, corresponding killed rank increases by 1 grade
		…N

Table 18, maize ear are to the Evaluation standard of resistance of bollworm

The killed rank mean value of female fringe	Resistance level
		0-1.0	High resistance (HR)
1.1-3.0	Anti-(R)
		3.1-5.0	In anti-(MR)
5.1-7.0	Sense (S)
		≥7.1	High sense (HS)

Table 19, transgenic corn events DBN9981 are weaved silk the resistance result of phase to bollworm

Result shows: transgenic corn events DBN9981 has good resistance level to bollworm, and the female fringe percentage of injury of transgenic corn events DBN9981, larvae alive number, the killed length of female fringe and the killed rank of female fringe are significantly lower than NGM, transgenic corn events DBN9981 inoculates the field efficacy of bollworm as shown in Figure 5.

(4) dichocrocis punctiferalis

Test design and test method are substantially consistent with the resistance evaluating Ostrinia furnacalis as above.Unlike, corn only carries out natural INFESTATION in the area that dichocrocis punctiferalis naturally-occurring is comparatively serious.Insect pest is there is after 14-21 days first, and when NGM mostly is the harm of 4-5 height in age instar larvae, by strain investigation dichocrocis punctiferalis to the rate that causes harm of milpa.The resistance result of transgenic corn events DBN9981 to dichocrocis punctiferalis is shown in table 20.

Resistance result to dichocrocis punctiferalis under table 20, transgenic corn events DBN9981 natural INFESTATION condition

Result shows: under dichocrocis punctiferalis naturally-occurring condition, compared with NGM, the cause harm rate of dichocrocis punctiferalis to transgenic corn events DBN9981 significantly reduces, illustrate that transgenic corn events DBN9981 has good resistance to dichocrocis punctiferalis thus, the field efficacy of transgenic corn events DBN9981 under dichocrocis punctiferalis naturally-occurring condition as shown in Figure 6.

(5) beet armyworm

Test design and test method are substantially consistent with the resistance evaluating Ostrinia furnacalis as above.Unlike, corn only carries out natural INFESTATION in the area that beet armyworm naturally-occurring is comparatively serious.Insect pest is there is after 10-15 days first, and when NGM mostly is the harm of 4-6 height in age instar larvae, by strain investigation beet armyworm to the rate that causes harm of milpa.The resistance result of transgenic corn events DBN9981 to beet armyworm is shown in table 21.

Resistance result to beet armyworm under table 21, transgenic corn events DBN9981 natural INFESTATION condition

Result shows: under beet armyworm naturally-occurring condition, compared with NGM, the cause harm rate of beet armyworm to transgenic corn events DBN9981 significantly reduces, illustrate that transgenic corn events DBN9981 has good resistance to beet armyworm thus, the field efficacy of transgenic corn events DBN9981 under beet armyworm naturally-occurring condition as shown in Figure 7.

What is particularly worth mentioning is that, it is the content recorded in 201210509817.2,201210511214.6,201310576970.1,201310578129.6 and 201310681139.2 according to Chinese patent (application) number, with the field effect to insect and its bioassay results of the application's transgenic corn events DBN9981, show that the application's transgenic corn events DBN9981 achieves method and/or the purposes of Control pests, be specially committee noctuid, dichocrocis punctiferalis, prodenia litura, pink rice borer and east armyworms at 2; Namely also the rotaring gene corn plant of any expression Cry1Ab albumen all can realize control 2 committee noctuid, dichocrocis punctiferalis, prodenia litura, the method for pink rice borer and/or east armyworm insect and/or purposes.

The herbicide tolerant of the 6th embodiment, event detects

This test is selected agriculture to reach weedicide (41% glyphosate-isopropylammonium aqua) and is sprayed.Adopt randomized block design, repeat for 3 times.Plot area is 15m ²(5m × 3m), line-spacing 60cm, spacing in the rows 25cm, conventional cultivation manages, and has the wide isolation strip of 1m between community.Transgenic corn events DBN9981 is carried out respectively following 2 kinds of process: 1) do not spray; 2) spray agriculture by 1680g a.e./ha dosage in the V3 leaf phase and reach weedicide, then again spray agriculture in the V8 phase by same dose and reach weedicide.It should be noted that, the form that the glyphosate herbicidal of different content and formulation is converted into equivalent glyphosphonic acid is applicable to draw a conclusion.

1 week and 2 weeks investigation symptom of chemical damage after medication respectively, and the output of community is measured when gathering in the crops.Symptom of chemical damage classification is shown in table 22.To be injured the index of rate as evaluation index assessment transformation event herbicide tolerant with weedicide, particularly, weedicide is injured rate (%)=∑ (peer be injured strain number × number of levels)/(total strain number × highest level); Wherein the weedicide rate of being injured refers to that glyphosate is injured rate, and glyphosate rate of being injured is determined according to the poisoning investigation result of 2 weeks after glyphosate process.The corn yield of each community is the corn grain ultimate production (weight) weighing 3 row in the middle of each community, volume variance between different treatment is measured with the percentile form of output, output percentage (%)=spray output/do not spray output.Transgenic corn events DBN9981 to the result of herbicide tolerant and corn yield result shown in table 23.

Table 22, glyphosate herbicidal are to the grade scale of corn phytotoxicity degree

Poisoning rank	Symptom describes
		1	Growth is normal, without any damage symptoms
2	Slight poisoning, poisoning is less than 10%
		3	Medium poisoning, can recover later, not affect output
4	Poisoning is heavier, is difficult to recover, and causes the underproduction
		5	Poisoning is serious, can not recover, cause the obvious underproduction or total crop failure

Table 23, transgenic corn events DBN9981 are to the result of glyphosate herbicide tolerance and corn yield result

Result explanation, in rate is injured by weedicide (glyphosate): 1) transgenic corn events DBN9981 rate of being injured under glyphosate herbicidal (1680g a.e./ha) process is 0 substantially, thus, transgenic corn events DBN9981 has good glyphosate herbicide tolerance.

In output: transgenic corn events DBN9981 do not spray and spray 1680g a.e./ha glyphosate 2 kinds process under output there is no notable difference, after spraying glyphosate herbicidal, the output of transgenic corn events DBN9981 does not reduce substantially, thus, show that transgenic corn events DBN9981 has good glyphosate herbicide tolerance further.

7th embodiment

Such as agricultural-food or commodity can be produced by transgenic corn events DBN9981.If enough expression amounts detected in described agricultural-food or commodity, described agricultural-food or commodity expection are containing the nucleotide sequence that transgenic corn events DBN9981 material can be diagnosed to exist in described agricultural-food or commodity.Described agricultural-food or commodity include but not limited to Semen Maydis oil, hominy grits, Semen Maydis powder, corn gluten, corn-dodger, W-Gum and will as food source for other food any of animal consumption or in addition as the composition in swelling agent or cosmetic composition for cosmetic use etc.Can be developed to detect the transgenic corn events DBN9981 nucleotide sequence shown in such as SEQ ID NO:1 or SEQ ID NO:2 in biological sample based on the nucleic acid detection method of probe or primer pair and/or test kit, wherein probe sequence or primer sequence are selected from the sequence as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5, to diagnose the existence of transgenic corn events DBN9981.

In sum, transgenic corn events DBN9981 of the present invention has good resistance to lepidopterous insects, to glyphosate herbicidal, there is higher tolerance simultaneously, on output without impact, and whether detection method can comprise the DNA molecular of transgenic corn events DBN9981 quickly and accurately in identification of organism sample.

Seed corresponding to transgenic corn events DBN9981 is deposited in China Committee for Culture Collection of Microorganisms's common micro-organisms center on December 24th, 2014 and (is called for short CGMCC, address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode 100101), Classification And Nomenclature: corn (Zea mays), deposit number is CGMCC No.10293.Preserved material will depository's preservation 30 years.

It should be noted last that, above embodiment is only in order to illustrate technical scheme of the present invention and unrestricted, although with reference to preferred embodiment to invention has been detailed description, those of ordinary skill in the art is to be understood that, can modify to technical scheme of the present invention or equivalent replacement, and not depart from the spirit and scope of technical solution of the present invention.

Claims

1. a nucleotide sequence, is characterized in that, to comprise in SEQ ID NO:3 or its complementary sequence at least 11 continuous print Nucleotide at least 11 continuous print Nucleotide and/or SEQ ID NO:4 or its complementary sequence.

2. nucleotide sequence according to claim 1, is characterized in that, described nucleotide sequence comprises SEQ IDNO:1 or its complementary sequence and/or SEQ ID NO:2 or its complementary sequence.

3. nucleotide sequence according to claim 2, is characterized in that, described nucleotide sequence comprises SEQID NO:3 or its complementary sequence and/or SEQ ID NO:4 or its complementary sequence.

4. nucleotide sequence according to claim 3, is characterized in that, described nucleotide sequence comprises SEQID NO:5 or its complementary sequence.

5. the method that the DNA detecting transgenic corn events DBN9981 in sample exists, is characterized in that, comprising:

Carry out nucleic acid amplification reaction;

Detect the existence of amplified production;

6. the method that the DNA detecting transgenic corn events DBN9981 in sample according to claim 5 exists, it is characterized in that, described amplified production to comprise in SEQ ID NO:1 or its complementary sequence 1-11 position or 12-22 position continuous nucleotide in 1-11 position or 12-22 position continuous nucleotide or SEQ ID NO:2 or its complementary sequence.

7. the method that the DNA detecting transgenic corn events DBN9981 in sample according to claim 5 or 6 exists, it is characterized in that, described amplified production comprises SEQ ID NO:1 or its complementary sequence, SEQID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence or SEQ ID NO:7 or its complementary sequence.

8. the method that the DNA detecting transgenic corn events DBN9981 in sample according to any one of claim 5-7 exists, it is characterized in that, described primer comprises nucleotide sequence described in any one of at least one claim 1-5.

9. the method that the DNA detecting transgenic corn events DBN9981 in sample according to claim 8 exists, it is characterized in that, described primer comprises the first primer and the second primer, and described first primer is selected from SEQ ID NO:8 and SEQ ID NO:10; Described second primer is selected from SEQ ID NO:9 and SEQ IDNO:11.

10. the method that the DNA detecting transgenic corn events DBN9981 in sample exists, is characterized in that, comprising:

The method that 11. DNA detecting transgenic corn events DBN9981 in sample according to claim 10 exist, it is characterized in that, described probe to comprise in SEQ ID NO:1 or its complementary sequence 1-11 position or 12-22 position continuous nucleotide in 1-11 position or 12-22 position continuous nucleotide or SEQ ID NO:2 or its complementary sequence.

The method that 12. DNA detecting transgenic corn events DBN9981 in sample according to claim 10 or 11 exist, it is characterized in that, described probe comprises SEQ ID NO:1 or its complementary sequence, SEQID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence or SEQ ID NO:7 or its complementary sequence.

The method that 13. DNA detecting transgenic corn events DBN9981 in sample according to any one of claim 10-12 exist, it is characterized in that, at least one fluorophor of probe described at least one marks.

The method that 14. 1 kinds of DNA detecting transgenic corn events DBN9981 in sample exist, is characterized in that, comprising:

Detected sample is contacted with marker nucleic acid molecule, and described marker nucleic acid molecule to comprise in SEQ IDNO:3 or its complementary sequence at least 11 continuous print Nucleotide at least 11 continuous print Nucleotide or SEQ ID NO:4 or its complementary sequence;

15. methods existed according to the DNA detecting transgenic corn events DBN9981 in sample described in claim 14, it is characterized in that, described marker nucleic acid molecule to comprise in SEQ ID NO:1 or its complementary sequence 1-11 position or 12-22 position continuous nucleotide in 1-11 position or 12-22 position continuous nucleotide or SEQ ID NO:2 or its complementary sequence.

The method that 16. DNA detecting transgenic corn events DBN9981 in sample according to claims 14 or 15 exist, it is characterized in that, described marker nucleic acid molecule comprises SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence or SEQ IDNO:7 or its complementary sequence.

17. 1 kinds of DNA detection test kits, it is characterized in that, comprise at least one DNA molecular, described DNA molecular comprises at least 11 continuous print Nucleotide in the homologous sequence of at least 11 continuous print Nucleotide or SEQ ID NO:4 in the homologous sequence of SEQ ID NO:3 or its complementary sequence or its complementary sequence, and it can have specific DNA primer or probe as transgenic corn events DBN9981 or its offspring.

18. according to DNA detection test kit described in claim 17, it is characterized in that, described DNA molecular to comprise in SEQ ID NO:1 or its complementary sequence 1-11 position or 12-22 position continuous nucleotide in 1-11 position or 12-22 position continuous nucleotide or SEQID NO:2 or its complementary sequence.

19. according to claim 17 or 18 DNA detection test kit, it is characterized in that, described DNA molecular comprises the homologous sequence of SEQ ID NO:1 or its complementary sequence, the homologous sequence of SEQ ID NO:2 or its complementary sequence, the homologous sequence of SEQ ID NO:6 or the homologous sequence of its complementary sequence or SEQ ID NO:7 or its complementary sequence.

20. 1 kinds of vegetable cells, it is characterized in that, comprise the nucleotide sequence of coding insect-resistant Cry1Ab albumen, the nucleotide sequence of encodes glyphosate herbicide tolerant EPSPS albumen and the nucleotide sequence of specific region, the nucleotide sequence of described specific region comprises SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or the sequence shown in SEQID NO:7.

21. 1 kinds of methods protecting maize plant to avoid insect infestations; it is characterized in that; be included in the meals of target insect and at least one transgenic corn plant cell is provided; described transgenic corn plant cell comprises and is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7, the suppressed described maize plant of ingesting further of the target insect of described transgenic corn plant cell of ingesting in its genome.

Protect maize plant from the method for the damage caused by weedicide for 22. 1 kinds; it is characterized in that; comprise the large Tanaka by being applied to plantation at least one rotaring gene corn plant containing effective dose glyphosate herbicidal; described rotaring gene corn plant comprises and is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7 in its genome, and described rotaring gene corn plant has the tolerance to glyphosate herbicidal.

23. 1 kinds of methods controlling the large Tanaka weeds of maize planting plant, it is characterized in that, comprise the large Tanaka by being applied to plantation at least one rotaring gene corn plant containing effective dose glyphosate herbicidal, described rotaring gene corn plant comprises and is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ IDNO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7 in its genome, and described rotaring gene corn plant has the tolerance to glyphosate herbicidal.

24. 1 kinds of cultivations have the method for the maize plant of resistance to insect, it is characterized in that, comprising:

Described corn seed is made to grow up to milpa;

25. 1 kinds of cultivations have the method for the maize plant of tolerance to glyphosate herbicidal, it is characterized in that, comprising:

Described corn seed is made to grow up to milpa;

26. 1 kinds cultivate to insect there is resistance and the method for the maize plant of tolerate glyphosate weedicide, it is characterized in that, comprising:

Described corn seed is made to grow up to milpa;

27. 1 kinds of generations have the method for the milpa of resistance to insect, it is characterized in that, comprise and introduce the nucleotide sequence of coding insect-resistant Cry1Ab albumen and the nucleotide sequence of specific region in the genome of described milpa, the nucleotide sequence of described specific region is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7.

28., according to the method producing milpa insect to resistance described in claim 27, is characterized in that, comprising:

With progeny plant described in target insect infestations;

Described transgenic corn events DBN9981 comprises and is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ IDNO:7 in its genome.

29. 1 kinds of generations have the method for the milpa of tolerance to glyphosate herbicidal, it is characterized in that, comprise and introduce the nucleotide sequence of encodes glyphosate tolerance EPSPS albumen and the nucleotide sequence of specific region in the genome of described milpa, the nucleotide sequence of described specific region is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQ IDNO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7.

30., according to the method producing milpa glyphosate herbicidal to tolerance described in claim 29, is characterized in that, comprising:

With progeny plant described in glyphosate herbicidal process;

Select the described progeny plant of tolerate glyphosate;

31. 1 kinds of generations have resistance and the method for the milpa of tolerate glyphosate herbicide application to insect, it is characterized in that, comprising:

With progeny plant described in glyphosate process;

32. 1 kinds of compositions comprising the polynucleotide of SEQ ID NO:1 or SEQ ID NO:2, it is characterized in that, described composition is Semen Maydis powder, Semen Maydis powder, Semen Maydis oil, corn silk or W-Gum.

33. 1 kinds of agricultural-food or commodity comprising the polynucleotide of SEQ ID NO:1 or SEQ ID NO:2, it is characterized in that, described agricultural-food or commodity are Semen Maydis powder, Semen Maydis powder, Semen Maydis oil, W-Gum, corn gluten, corn-dodger, makeup or weighting agent.