CN104004775B - One sterility changing gene and its application - Google Patents

Abstract

The present invention relates to a sterility changing gene and its applications, belong to field of plant breeding.In particular it relates to the fertility restorer and application thereof of homozygous recessive Genetic male-sterile line plant.Further the present invention relates to structure male sterible series of rice, the method for maintainer, vector construction and transgenic line characters, more specifically, the present invention relates to a kind of constructs, a kind of rice cell, tissue or organ, a method of structure male sterible series of rice, a method of restoring rice sterile plant male fertile, a method of preparing rice paddy seed, a kind of transgenic line, a method of being used to prepare the purposes of hybrid rice and male sterible series of rice in preparing hybrid rice.

Description

One sterility changing gene and its application

Technical field

The present invention relates to field of plant breeding.In particular it relates to homozygous recessive Genetic male-sterile line plant Fertility restorer and application thereof.Further the present invention relates to build male sterible series of rice, the method for maintainer, vector construction and turn Genetic material character, more particularly it relates to a kind of construct, a kind of rice cell, tissue or organ, a kind of structure water The method of rice male sterile line, a method of restoring rice sterile plant male fertile, a method of rice paddy seed is prepared, A kind of transgenic line, a method of hybrid rice and male sterible series of rice are used to prepare in preparing hybrid rice Purposes.

Background technology

The most commonly used is " three systems " and " two systems " hybridization in paddy rice cross breeding breeding." three systems " hybridization needs specific restorer And maintainer, the procedure of breeding and production link are complicated, and period of selection and breeding new sterile line and Combination nova is long, efficiency is low, germ plasm resource Utilization rate be less than 5%.In addition, ternary hybrid rice advantage is weaker, sterile cytoplasm is more single, and there are certain crushing pest and disease damages The potential danger broken out.For " two systems " hybrid rice since relationship is not restricted between by restorer, maintainer, the heredity of parent is more Sample be improved significantly, select High-Yielding Hybrid Rice combination speed obviously accelerate, promote super hybridized rice research and Production.But the sterile line used in current " two systems " hybridization is mostly " light is temperature sensitive " sterile line, temperature of the fertility in by environment and Illumination effect.The unstable purity and yield that will have a direct impact on hybrid seed of these environmental factors increases risk in hybrid seed production, seriously When can cause heavy economic losses to seed industry enterprises and peasant, limitation " two systems " hybrid paddy rice is widely applied.And utilize mesh The two-line hybrid rice sterile line that preceding technology can cultivate is extremely limited, such as almost without good double-line hybrid in japonica rice variety Combination, limits making full use of for variety source.Thus, cultivate it is not affected by environment and can autonomous replication stable sterile line, Have become the break-through point of solution " two systems " hybridization technique bottleneck.Around the stability for how improving sterile line and break Hybrid The limitation of the utilization of resources, and further solve the problems, such as the technical bottlenecks such as existing seeding technique is complex and high cost is a kind of new Crossbreeding technology is paid close attention to.The technology utilizes the male sterile line and transgenic technology of recessive nuclear gene control, by fertility Restoring gene, pollen inactivated gene, seed color marker gene are chain, while being transferred to homozygous recessive kernel male sterile plants （Sterile line）In, the function render transgenic plant of restoring gene restores fertility；But the pollen development later stage is arrived, pollen inactivates base Because making the pollen containing transgenosis inactivate, to which only the pollen of carry genetic modification can be with retentive activity.The transfer-gen plant Two class seeds are generated after selfing：The not male-sterile seed of foreign gene-carrying can be used for hybrid seed production；Foreign gene-carrying Fertile seed, be used for the holding of sterile line, i.e. maintainer；The segregation ratio of two class seeds is 1:1, made using color mark gene Fertile seed shows color, so as to easily use seed color sorting instrument by fertile seed（Maintainer）With sterile seed （Sterile line-）It separates.

This novel crossbreeding technology has following significant superiority：（1）The sterile line fertility of technology initiative Stablize, it is not affected by environment, environmental factor is eliminated to the potential risk in the restriction and production of crossbreeding.（2）It is utilized Recessive Male sterility be suitable for most kinds, and theoretically all rice varieties all can be used as the male parent of hybridization, To make the resource utilization of hybrid vigour greatly improve.（3）The fertilization process for terminating the pollen of foreign gene-carrying prevents outer In source genetic drift to other plants；（4）Generated sterile line is free of foreign gene, eliminates Gu of the people to genetically modified crops Consider.（5）Self-fertility improves sterile line self-reproduction efficiency, using color mark gene easily by sterile seed and fertile Seed separates, and ensure that the purity of sterile seed.

In the art, pollen inactivated gene is one of link of most critical, selected inactivated gene table in pollen The time, level and the pollen inactivation efficiency that reach all are directly related to the success or not of the technology.Current existing technology carrier In structure, mostly uses amylase genes of bacterial origin barnase gene or corn source etc. and be used as pollen inactivated gene, this A little genes are all external sources for rice.Therefore, the endogenous function base for being used as pollen inactivation of exploitation rice Cause, for eliminate public's bio-safety misgivings, break foreign technology fort, obtain it is more optimized new with independent intellectual property right Type technique for breeding of hybridized rice, is of great significance.

One class flavine monooxygenase of rice Os YUCCA1 gene codes（flavinmonooxygenase-like Enzyme, FMO）Family member is heteroauxin（IAA, most important auxins hormone in plant）Biosynthetic process In key enzyme, catalysis is by tryptamines（Tryptamine, TAM) it is converted to hydroxyl color amine（N-hydroxytryptamine, NHT), The rate-limiting enzyme being to rely in the IAA route of synthesis of tryptophan.Homologous gene of the gene in arabidopsis is referred to as YUCCA1, Separated arabidopsis yucca1 dominant mutants show apical dominance enhancing, and hypocotyl and petiole elongation, cotyledon raw The morphological features such as on the upper side and blade is elongated, research find that YUCCA1 gene expressions increase in yucca1 dominant mutants so that trip IAA contents from state also accordingly increase, directly result in more than mutation type surface（A role for flavinmonooxygenase-like enzymes in auxinbiosynthesis,Zhao et al.,2001, Science291:306-309）.Further, the auxin route of synthesis of YUCCA1 genes dependence is also demonstrated in arabidopsis, Regulating and controlling effect is played in the growth course of floral organ, composing type, which is overexpressed YUCCA1 genes, leads to the accumulation of auxin, and single Solely mutation yucca1 genes do not cause visible phenotypic just to make plant when only multiple YUCCA homologous genes are by simultaneous mutation Due to auxin synthesis reduce, and occur floral organ, vascular bundle and other tissue developments exception phenotype（Auxin biosynthesis by the YUCCA flavinmonooxygenases controls the formationof Floral organs and vascular tissuesin Arabidopsis, Cheng et al., 2006, Genes and Development20:1790-1799）.In rice, it has been reported that and shows OsYUCCA1 genes in plant and non-constitutive table It reaches, but discrete expression (Auxin in the blade tip of plant, the tip of a root, young former base, the parenchyma of vascular bundle and floral organ etc. biosynthesis by the YUCCA1genes in rice,Yamamoto et al.,2007,Plant Physiology143:1362-1371).In the present invention, inventor drives OsYUCCA1 bases using pollen specific promoter Because of the specifically expressing in paddy pollen, the effect for causing paddy pollen to inactivate is realized in surprise, thus it is speculated that be due to OsYUCCA1 Gene is overexpressed during leading to pollen development in pollen caused by the abnormal accumulation of auxin.Further utilize OsYUCCA1, rice fertility gene（Ms26,）And seed fluorescent marker gene（RFP）Novel sterility changing carrier is built, and is turned It dissolving into corresponding male sterility of rice plant, has obtained corresponding maintainer, the seed solid to the maintainer is analyzed, As a result the red fluorescence seed and the 1 of the not non-red fluorescence seed of foreign gene-carrying of foreign gene-carrying is realized:1 point From two class seeds can be, respectively, used as maintainer and sterile line, carry out the breeding of sterile line and the production of hybrid seed.

According to the above results, it is believed that OsYUCCA1 is as rice endogenous gene, the specifically mistake in mature pollen Amount expression, may be implemented the effect of pollen inactivation, this is gene constructed in novel sterility changing carrier, can make carrying external source base The pollen of cause inactivates, and terminates the Process of Insemination of the pollen of foreign gene-carrying, prevents foreign gene by pollen dispersal to other In plant, foreign gene only carries out heredity by egagametophyte, and the initiative of rice maintainer and sterile line is furthermore achieved.By In the gene be the key that the endogenous control IAA biosynthesis pathway enzymes of rice, and be rice endogenous gene, from bio-safety angle Degree considers, would be even more beneficial to eliminate potential doubt of the public to transgenosis concept.

Invention content

The present invention is directed to solve the problems, such as one of above-mentioned paddy rice cross breeding breeding technique at least to a certain extent or at least provide A kind of useful business selection.For this purpose, novel stabilising can effectively be built by having an object of the present invention is to provide one kind Male sterible series of rice and make full use of Rice Germplasm Resources, for crossbreeding, improve purity of hybrid means.

The present invention is the following discovery based on inventor and completes：Inventor is prominent with homozygous recessive Genetic male-sterile line Variant is transformation receptor material, by converting 3 target genes of close linkage into sterile recipient plant.Wherein, fertility Restoring gene can make transformation receptor fertility restorer, pollen inactivated gene that the pollen containing foreign gene can be made to inactivate, that is, lose and award Smart ability, screening-gene can be used for the sorting of transgenic seed and non-transgenic seed, and the non-transgenic seed sorted out is used Make sterile line production cenospecies, transgenic seed as maintainer come continuously, steadily produce sterile line.For example, root , can be using the recessive infertility ms26/ms26 mutant of rice core as transformation receptor material according to one embodiment of the present of invention, it will be close 3 chain target genes are converted to sterile line：Restoring gene OsCYP704B2（Corresponding wild type MS26 genes）It can make Transformation receptor fertility restorer, pollen inactivated gene OsYUCCA1 can be such that the pollen containing foreign gene inactivates, that is, lose insemination energy Power, fluorescence color sorting gene are used for the sorting of transgenic seed and non-transgenic seed, and the non-transgenic seed sorted out is used as not It is production cenospecies to educate, and transgenic seed continuously steadily produces sterile line as maintainer.Due to technology profit Non-transgenic product is produced with biotechnology, solves the bottleneck problem faced during the paddy rice cross breeding production of hybrid seeds, is i.e. three line method provides Source utilization rate is low and in two line method the problem of sterile line fertility instability.

As a result, in one embodiment of the present of invention, the present invention proposes a gene, according to an embodiment of the invention, should When gene is specifically overexpressed in Matured Pollen In Rece, the inactivation of paddy pollen can be caused.The design all to contain this The transgenic pollen of gene inactivates, and cannot inseminate can also strictly prevent the bio-safeties problem such as genetic drift, and the pollen of inactivation is not It can pollinate with other plant around or weeds, thus transgenosis cannot be by pollen dispersal to environment.

As a result, in one embodiment of the present of invention, the present invention proposes a kind of construct.According to an embodiment of the invention, The construct includes：First expression cassette, first expression cassette contain the first nucleic acid molecules, the first nucleic acid molecule encoding water Rice fertility restorer gene；And second expression cassette, second expression cassette contain the second nucleic acid molecules, second nucleic acid Molecule encoding pollen inactivated gene.Using the construct, effectively male sterility of rice restoring gene and pollen can be inactivated Gene is introduced into homozygous recessive Genetic male-sterile line mutant plants, to obtain the fertile plant conduct of foreign gene-carrying Maintainer, so as to continuously produce sterile line and maintainer conveniently by selfing, in addition, not foreign gene-carrying Plant may be used as hybridization female parent.Thus, it is possible to be efficiently used for paddy rice cross breeding.

Thus, it is possible to by routine techniques, such as agrobacterium-mediated transformation, by preceding construct be introduced into rice cell, In tissue or organ, to obtain that the sample of research, hybridization can be subsequently used for.Thus, in the second aspect of the present invention, this hair It is bright to propose a kind of rice cell, tissue or organ.According to an embodiment of the invention, contain in the rice cell, tissue or organ There is foregoing construct.

In the third aspect of the present invention, the present invention proposes a kind of method of structure male sterible series of rice.According to this hair Bright embodiment, this method include：Foregoing construct is introduced into the first rice homozygous recessive male sterile plants, To obtain the second rice plant of foreign gene-carrying, second rice plant can generate fertile males gamete；It cultivates Second rice plant, to obtain the seed for being free of foreign gene, to build male sterible series of rice.It is outer by introducing Source gene can enable the second rice plant to carry out self-fertilization, to obtain the seed of foreign gene-carrying and not take Seed with foreign gene.Wherein, the seed of foreign gene-carrying can not be used as male sterible series of rice.It is thus possible to side Just sterile line and maintainer are continuously produced by being selfed, in addition, not the plant of foreign gene-carrying may be used as it is miscellaneous The parent of friendship.Thus, it is possible to be efficiently used for paddy rice cross breeding.

In the fourth aspect of the present invention, the present invention proposes a kind of method for restoring rice sterile plant male fertile.Root According to the embodiment of the present invention, this method includes：Foregoing construct is introduced into rice homozygous recessive male sterile plants In.

In the fifth aspect of the present invention, the present invention proposes a kind of method preparing rice paddy seed.Reality according to the present invention Example is applied, this approach includes the following steps：Foregoing construct is introduced into male sterile rice plant；And it will be described Rice plant self-fertilization, to obtain the seed containing foregoing construct.

In the sixth aspect of the present invention, the present invention proposes a kind of transfer-gen plant.According to an embodiment of the invention, described Transfer-gen plant is obtained by the way that foregoing construct to be introduced into rice homozygous recessive male sterile plants.

In the seventh aspect of the present invention, the present invention proposes a kind of method being used to prepare hybrid rice.According to the present invention Embodiment, this method use novel rice male sterile line, which is to build rice by front The method structure of male sterile line.

In the eighth aspect of the present invention, the present invention proposes purposes of the male sterible series of rice in preparing hybrid rice. According to an embodiment of the invention, the male sterible series of rice is the method structure that male sterible series of rice is built by front 's.

In still another aspect of the invention, the invention also provides a kind of sides of initiative Different Types of Rice male sterile line Method is to utilize molecular labeling and hybridization initiative novel rice sterile line.According to an embodiment of the invention, this method includes：It adopts Use rice ms26 male sterile plants as female parent, the rice homozygous recessive male sterile plants include the homozygosis of Ms26 genes Recessive alleles；The maternal and recurrent parent is subjected to backcross transformation, to obtain with the recurrent parent character Male sterible series of rice, wherein the recurrent parent does not have the homozygous recessive alleles of Ms26 genes.Utilize this as a result, The method of invention can develop more different genetic backgrounds on the basis of ms26 homozygous recessive male rice sterile lines Sterile line.According to an embodiment of the invention, using conventional back cross breeding method, all different types of rice can be formulated into Corresponding intelligence sterile line, makes hybrid vigour resource utilization reach 95% or more.

The additional aspect and advantage of the present invention will be set forth in part in the description, and will partly become from the following description Obviously, or practice through the invention is recognized.

Description of the drawings

The above-mentioned and/or additional aspect and advantage of the present invention will become in the description from combination following accompanying drawings to embodiment Obviously and it is readily appreciated that, wherein：

Fig. 1 is the structural schematic diagram according to the plant expression vector YUCCA1 of one embodiment of the invention；

Fig. 2 is the structural schematic diagram according to the plant expression vector pZN2 of one embodiment of the invention；

Fig. 3 is the structure schematic diagram according to the plant expression vector pZN2 of one embodiment of the invention；

Fig. 4 shows that according to an embodiment of the present invention the recessive infertility ms26/ms26 mutant of rice core is transformation receptor Material obtains the schematic diagram of sterile line by the obtained transformant of transgenosis by selfing, and it is recessive that wherein ms/ms refers to rice core Sterile Mutants homozygous；

Fig. 5 shows the segregation ratio of fluorescent seeds according to an embodiment of the invention and non-fluorescence seed（PZN2 turns Gene plant）；

Fig. 6 is shown according to an embodiment of the present invention, passes through molecule assisting sifting（MAS）Method carry out passing through backcrossing Transformation builds the flow diagram of sterile line；

Detailed description of the Invention

The embodiment of the present invention is described below in detail.The embodiments described below with reference to the accompanying drawings are exemplary, purport For explaining the present invention, and it is not considered as limiting the invention.

All bibliography being mentioned herein all are incorporated herein by reference.

Unless there are indicating on the contrary, all technical and scientific terms used herein all have common with fields of the present invention The identical meaning that technical staff is generally understood.Unless there are indicating on the contrary, technology that is used herein or mentioning is ability Standard technique well known to the those of ordinary skill of domain.Material, method and example are only used as to illustrate, rather than limit.

Term " first ", " second " are used for description purposes only, be not understood to indicate or imply relative importance or Implicitly indicate the quantity of indicated technical characteristic." first " is defined as a result, the feature of " second " can be expressed or imply Ground includes one or more this feature.In the description of the present invention, the meaning of " plurality " is two or more, unless Separately there is clearly specific restriction.

The present invention is the following discovery based on inventor and completes：Inventor is to turn with rice core recessiveness sterile mutant Change acceptor material, by converting 3 target genes of close linkage to sterile line, wherein restoring gene can make conversion Receptor fertility restorer, pollen inactivated gene can be such that the pollen containing foreign gene inactivates, that is, lose fertilizing ability, and screening-gene can For the sorting of transgenic seed and non-transgenic seed, the non-transgenic seed sorted out is used as sterile line production hybridization Kind, transgenic seed as maintainer come continuously, steadily produce sterile line.For example, a reality according to the present invention Example is applied, it can be using the recessive infertility ms26/ms26 mutant of rice core as transformation receptor material, by 3 target bases of close linkage Because of conversion to sterile line：Restoring gene OsCYP704B2 (Ms26) can make transformation receptor fertility restorer, pollen inactivated gene OsYUCCA1 can be such that the pollen containing foreign gene inactivates, that is, lose fertilizing ability, and fluorescence color sorting gene is used for transgenic seed With the sorting of non-transgenic seed, the non-transgenic seed sorted out is used as sterile line and produces cenospecies, and transgenic seed is used as Maintainer come continuously, steadily produce sterile line.Since the technology produces non-transgenic product, solution using biotechnology It has determined the bottleneck problem faced during the paddy rice cross breeding production of hybrid seeds, i.e., three line method resource utilization is low and sterile line fertility in two line method Unstable problem.

As a result, in one embodiment of the present of invention, the present invention proposes a gene, according to an embodiment of the invention, should It is overexpressed in paddy pollen to gene specific, the dysplasia of paddy pollen can be caused, and further result in pollen mistake It is living, lose fertilizing ability.In one embodiment of the invention, the coding region nucleotide sequence of the paddy pollen inactivated gene Such as SEQ ID NO：Shown in 1, the nucleotide coding such as SEQ ID NO：The protein of amino acid sequence shown in 3.I.e., it is possible to adopt Paddy pollen inactivated gene is OsYUCCA1, thus, it is possible to which it to be overexpressed in pollen to the inactivation as paddy pollen Gene.OsYUCCA1 genes when specificity overexpression, can cause the pollen activity of plant to decline, lose insemination energy in anther Power, and female fertility is normal.

As a result, in one embodiment of the present of invention, the present invention proposes a kind of construct.According to an embodiment of the invention, The construct includes：First expression cassette, first expression cassette contain the first nucleic acid molecules, the first nucleic acid molecule encoding water Rice fertility restorer gene；And second expression cassette, second expression cassette contain the second nucleic acid molecules, second nucleic acid Molecule encoding pollen inactivated gene.Using the construct, effectively male sterility of rice restoring gene and pollen can be inactivated Gene is introduced into rice plant such as rice homozygous recessive male sterile plants, to obtain the fertile plant of foreign gene-carrying As maintainer, so as to continuously produce sterile line and maintainer conveniently by selfing, in addition, not carrying external source The plant of gene may be used as the parent among hybridization.Thus, it is possible to be efficiently used for paddy rice cross breeding.

Herein, the form of construct is not particularly limited, specific example according to the present invention, can be plasmid, Bacteriophage, artificial chromosome, clay（Cosmid）, virus at least one.Specific example according to the present invention, construct（Have When also referred to as expression vector, genetic carrier or carrier）In the form of plasmid.Plasmid as genetic carrier, have it is easy to operate, can To carry the property of larger segment, easy to operation and processing.The form of plasmid is also not particularly limited, either annular matter Grain, can also be linear plasmid, you can also be double-strand to be single-stranded.Those skilled in the art can be as needed It is selected.According to an embodiment of the invention, Ti carriers may be used, such as may be used and the first and second expression cassettes are arranged Between the right boundary of the T-DNA of expression vector pZN2.Thus, it is possible to by Agrobacterium-medialed transformation method by the first He Second expression cassette is converted into recipient plant, such as rice ms26 recessive nucleus male sterility mutant.Thus, it is possible to be free of The rice conversion strain of herbicide resistance markers' gene and antibiotic-resistance marker's gene.The transformation plant so obtained has as follows Feature：（1）It converts site and is in heterozygous state always in each generation, therefore there is half pollen to be free of foreign gene, half contains Foreign gene, the pollen inactivation containing foreign gene（Lose fertilizing ability）, so foreign gene is only transferred to by oogamete The next generation, will not be by pollen dispersal to environment；（2）Transformant selfing can be solid, ties fertile seed and sterile seed Ratio is 1：1, fertile plant（With foreign gene）As maintainer, can easily, continuously be produced not by selfing It educates and is and maintainer, sterile plant（Without transgene component）It is used as the parent of hybrid seeding in production；（3）Because sterile plant is not Transgenosis is free of containing transgenosis, therefore with the hybrid seed of its production, the rice commodity grain produced with this cenospecies less contains Transgenosis, to eliminate the hidden danger of GMO bio-safety.The novel crossbreeding system is to make full use of paddy rice hybrid excellent Gesture provides practicable technology new breakthrough.

It includes deoxyribonucleotide or ribonucleotide that term " nucleic acid " as used in the present invention, which can be any, The polymer of acid, including but not limited to by modification or unmodified DNA, RNA, length is not by any special limit System.It is more stable because DNA is for RNA for the carrier for building recombinant cell, preferred nucleic acid DNA, and And it is easily operated.

According to an embodiment of the invention, the type of male sterility of rice restoring gene is not particularly restricted, including but not Be limited to MSP1, PAIR1, PAIR2, ZEP1, MELL, PSS1, TDR, UDT1, GAMYB4, PTC1, API5, WDA1, Ms26, DPW, The fertility-related genes such as MADS3, AID1, MS2.In one embodiment of the invention, the male sterility of rice restoring gene Coding has such as SEQ ID NO：The protein of amino acid sequence shown in 8.I.e., it is possible to the male sterility of rice restoring gene used For OsCYP704B2, thus, it is possible to as rice receptor ms26 Mutants homozygous（Holandry infertility）Wild type educate Property restoring gene.The albumen of OsCYP704B2 gene codes plays an important role in the stage of anther development, gene mutation Plant male sterility can all be caused afterwards, and female fertility is normal.

According to a particular embodiment of the invention, in one embodiment of the invention, the male sterility of rice restores base Because having such as SEQ ID NO：Nucleotide sequence shown in 4.Wherein SEQ ID NO：4 with the OsCYP704B2 genes of wild type （Its nucleotide sequence such as SEQ ID NO：Shown in 5）It compares, SEQ ID NO：Nucleotide sequence shown in 4 introduces three monokaryons Nucleotide mutation, but do not change the amino acid sequence of its coding, these three single nucleotide mutations are in the gene coding regions OsCYP704B2 On position and specific mutation be respectively：238 nucleotide A sport C；240 nucleotide G sport C；243 core Thuja acid G sports C.It is surprisingly found by the inventors that utilizing the SEQ ID NO:Nucleotide sequence shown in 4 can be convenient for various Foreign gene and endogenous gene are distinguished in Molecular Identification, and can more effectively make rice ms26/ms26 infertility recipient plants Fertility be restored.

In one embodiment of the invention, first expression cassette can further include：First promoter, it is described First promoter and first nucleic acid molecules are operably associated, and first promoter is andro gamete specificity promoter； And first terminator, first terminator and first nucleic acid molecules are operably associated.Implementation according to the present invention The type of example, the first promoter and the first terminator is not particularly restricted.According to one embodiment of present invention, for OsCYP704B2 may be used the endogenesis promoter of OsCYP704B2, the sequence in the areas ORF and terminator, be wild rice base Because of a group sequence.In one embodiment of the invention, first promoter has such as SEQ ID NO：Nucleotides sequence shown in 6 Row.In one embodiment of the invention, first terminator has such as SEQ ID NO：Nucleotide sequence shown in 7.Hair A person of good sense it has surprisingly been found that using the promoter and terminator combination, can significantly further improve the corresponding albumen of expression Efficiency, and then the efficiency that sterile line is built using construct can be improved, and can more effectively make rice ms26/ms26 not The fertility for educating recipient plant is restored.According to an embodiment of the invention, the type of pollen inactivated gene is not particularly restricted. According to an embodiment of the invention, the pollen inactivated gene coding has such as SEQ ID NO：The albumen of amino acid sequence shown in 3 Matter.Thus, it is possible to encode the encoded class flavine monooxygenases of OsYUCCA1.Class flavine monooxygenase is heteroauxin（IAA, Most important auxins hormone in plant）Key enzyme in biosynthetic process is catalyzed tryptamines（Tryptamine, TAM) it is converted to hydroxyl color amine（N-hydroxytryptamine, NHT).According to an embodiment of the invention, the pollen inactivates base Because having such as SEQ ID NO：Nucleotide sequence shown in 1, the OsYUCCA1 genes with wild type（Its nucleotide sequence such as SEQ ID NO：Shown in 2）It compares, the nucleotide sequence SEQ ID NO of the OsYUCCA1 genes in the present invention:1 introduces three monokaryons Nucleotide mutation, but do not change the amino acid sequence of its coding, these three single nucleotide mutations are on the gene coding regions OsYUCCA1 Position and specific mutation be respectively：33 nucleotide G sport A；36 nucleotide G sport C；42 nucleotide C Sport G.It is surprisingly found by the inventors that utilizing the SEQ ID NO：Nucleotide sequence shown in 1 can be convenient in various molecules Foreign gene and endogenous gene are distinguished in identification, and can more effectively play pollen deactivation function in rice.As a result, may be used To further increase the efficiency for expressing corresponding albumen.According to an embodiment of the invention, the second expression cassette further comprises：Second opens Mover, second promoter and second nucleic acid molecules are operably associated, and second promoter is pollen specific Promoter；And second terminator, second terminator and second nucleic acid molecules are operably associated.Thus, it is possible to More effectively improve the expression efficiency of corresponding gene.The design makes all transgenic pollens containing this gene inactivate, cannot Insemination can also strictly prevent the bio-safeties problem such as genetic drift, the pollen of inactivation from cannot be awarded with around other plant or weeds Powder, thus transgenosis cannot be by pollen dispersal to environment.

In addition, according to an embodiment of the invention, construct can further include：Third expression cassette, the third table Include third nucleic acid molecules up to box, the third nucleic acid molecule encoding screening-gene, the screening-gene is bioluminescence gene.By This, convenient for determining plant and its part whether containing the introduced gene of construct by the expression of screening-gene.

According to an embodiment of the invention, it may be used selected from red fluorescent gene, cyan fluorescent protein gene, yellow fluorescence Protein gene, luciferase gene, green fluorescence protein gene, anthocyanin p1 genes and glufosinate transacetylase encoding gene At least one as screening-gene.In one embodiment of the invention, red fluorescent protein may be used as screening base Cause.Red fluorescent protein gene（RFP）, derive from reef coral（Discosoma sp.）, it is unique non-cereal crops in expression cassette The gene order in source.Red fluorescent protein maximum absorption wave a length of 558nm, maximum emission wavelength 583nm.RFP is encoded Amino acid sequence by showing that similitude is extremely low with anaphylactogen and toxalbumin sequence alignment, non-toxic and sensitization.RFP is normal GMO bio-safety event never occurred for the screening-gene as genetic transformation.In one embodiment of the invention, institute Stating screening-gene has such as SEQ ID NO：Nucleotide sequence described in 12.Thus, it is possible to more efficiently express red fluorescence Albumen, the expression of enhancing RFP genes in rice.SEQ IDNO：Nucleotide sequence described in 12 and wild type RFP genes（Its Nucleotide sequence such as SEQ ID NO：Shown in 13）It compares, there are two single nucleotide mutations for tool, are named as RFP (r).The two lists Coding mutation is respectively：G is converted to by the 21st bit base C, C is converted to by the 315th bit base G.It is surprisingly found by the inventors that The mutation of the two mononucleotides can more efficiently express red fluorescent protein, and enhancing red fluorescent protein gene is in rice In expression.

In one embodiment of the invention, the third expression cassette further comprises：Third promoter, the third open Mover and the third nucleic acid molecules are operably associated, and the third promoter is callus and/or seed, kind skin, embryo With the promoter of the specificity such as endosperm；Third terminator, the third terminator and the third nucleic acid molecules operationally phase Even.In one embodiment of the invention, the third promoter includes a 35S enhancer and LTP2 promoters, wherein 35s Enhancer has such as SEQ ID NO：Nucleotide sequence shown in 16, LTP2 have such as SEQ ID NO：Nucleotides sequence shown in 11 Row.In one embodiment of the invention, the third terminator has such as SEQ ID NO：Nucleotide sequence shown in 14.By This, according to one embodiment of present invention, the opening code-reading frame of RFP (r) is connected to from barley and is callus and seed （Kind skin）Between specificity promoter LTP2 and terminator PIN II from potato, there are one come before LTP2 promoters From the 35S enhancer sequences of tobacco mosaic virus (TMV), RFP (r) expression casettes are reassembled into（35S：：LTP2 ﹕ ﹕ RFP (r) ﹕ ﹕ PINII）.The red for being very easy to identification is presented in rice callus and seed containing the expression cassette under fluorescence excitation, therefore should Expression cassette is used for the selection markers of genetic transformation and in the present invention for recognizing and sorting maintainer and male-sterile seed.

As a result, according to an embodiment of the invention, construct according to an embodiment of the invention can be utilized, with non-transgenic Receptor of the recessive nucleus male sterility rice (ms26/ms26) as conversion, carries out genetic transformation, obtains integrating containing following close Three chain foreign gene RFP (r), the rice maintainer of Ms26, OsYUCCA1, Ms26, that is, OsCYP704B2 fertile genes. The insertion of foreign gene and endogenous male sterility site（ms26/ms26）It is non-chain, therefore obtained transgenic paddy rice is protected Hold be the recessive sterile site ms26 containing independent homozygosis and heterozygosis foreign gene（Including Ms26 genes）Integration site.

Thus, it is possible to by routine techniques, such as agrobacterium-mediated transformation, by preceding construct be introduced into rice cell, In tissue or organ, to obtain that the sample of research, hybridization can be subsequently used for.Thus, in the second aspect of the present invention, this hair It is bright to propose a kind of rice cell, tissue or organ.According to an embodiment of the invention, contain in the rice cell, tissue or organ There is foregoing construct.In one embodiment of the invention, the rice cell, tissue or organ are homozygous from rice Recessive male sterile plants.In one embodiment of the invention, the rice homozygous recessive male sterile plants include Ms26 The homozygous recessive alleles of gene.It is male can be efficiently used for structure for rice cell, tissue or organ of the invention as a result, Property sterile plant.Feature and advantage described in construct are previously with regard to, are also applied for the rice cell, tissue or organ, no longer It repeats.

As a result, in the third aspect of the present invention, the present invention proposes a kind of method of structure male sterible series of rice.According to The embodiment of the present invention, with reference to figure 4, this method includes：It is male that foregoing construct is introduced into the first rice homozygous recessive In property sterile plant, to obtain the second rice plant of foreign gene-carrying, second rice plant can generate fertile Male gamete, and the foreign gene in the second rice plant is in heterozygous state, therefore have half flower in the second rice plant Powder is free of foreign gene, and half contains foreign gene, the pollen inactivation containing foreign gene（Lose fertilizing ability）.Second rice Plant, that is, transformant self fertilizing obtains two class seeds:The red fluorescence seed of foreign gene-carrying and not foreign gene-carrying Non- red fluorescence seed, the two respectively accounts for 50%.This two classes seed can be, respectively, used as maintainer and sterile line, carry out infertility The breeding of system and the production of hybrid seed.

According to an embodiment of the invention, the first rice homozygous recessive male sterile plants include the homozygous recessive of Ms26 genes Allele.In addition, according to an embodiment of the invention, the step of can be sorted by fluoroscopic examination, i.e., by detecting water Whether rice carries bioluminescence gene, for example whether send out fluorescence to be sorted, distinguish its whether foreign gene-carrying, such as scheme Shown in 5.Feature and advantage described in construct are previously with regard to, this method is also applied for, are repeated no more.

In the fourth aspect of the present invention, the present invention proposes a kind of method for restoring rice sterile plant male fertile.Root According to the embodiment of the present invention, this method includes：Foregoing construct is introduced into rice homozygous recessive male sterile plants In.In one embodiment of the invention, the rice homozygous recessive male sterile plants include the homozygous recessive of Ms26 genes Allele.Feature and advantage described in construct are previously with regard to, this method is also applied for, are repeated no more.

In the fifth aspect of the present invention, the present invention proposes a kind of method preparing rice paddy seed.Reality according to the present invention Example is applied, this approach includes the following steps：Foregoing construct is introduced into rice plant；And by the rice plant Self-fertilization, to obtain the seed containing foregoing construct.In one embodiment of the invention, the rice plant For rice homozygous recessive male sterile plants.In one embodiment of the invention, the rice homozygous recessive male sterility is planted Strain includes the homozygous recessive alleles of Ms26 genes.

In the sixth aspect of the present invention, the present invention proposes a kind of transgenic line.According to an embodiment of the invention, described Transgenic line is obtained by the way that foregoing construct to be introduced into rice homozygous recessive male sterile plants.At this In one embodiment of invention, the rice homozygous recessive male sterile plants include the homozygous recessive equipotential base of Ms26 genes Cause.In one embodiment of the invention, the construct is introduced by agrobacterium-mediated transformation.

In the seventh aspect of the present invention, the present invention proposes a kind of method being used to prepare hybrid rice.According to the present invention Embodiment, this method use male sterible series of rice, which is to build male sterility of rice by front The method structure of system.Thus, it is possible to further carry out paddy rice cross breeding using the male sterible series of rice of the present invention, rice is improved The efficiency of hybridization.Feature and advantage described in construct are previously with regard to, this method is also applied for, are repeated no more.

In the eighth aspect of the present invention, the present invention proposes purposes of the male sterible series of rice in preparing hybrid rice. According to an embodiment of the invention, the male sterible series of rice is the method structure that male sterible series of rice is built by front 's.Thus, it is possible to further carry out paddy rice cross breeding using the male sterible series of rice of the present invention, it is excellent that cultivation can be greatly improved The probability of New Hybrid Rice Combination.Feature and advantage described in construct are previously with regard to, the purposes is also applied for, it is no longer superfluous It states.

In still another aspect of the invention, the invention also provides a kind of methods of structure male sterible series of rice.According to this The embodiment of invention, this method include using rice homozygous recessive male sterile plants as maternal, the rice homozygous recessive Male sterile plants include the homozygous recessive alleles of Ms26 genes；Backcross transformation is carried out with recurrent parent by maternal, so as to Obtain the male sterible series of rice with the recurrent parent character, wherein the recurrent parent does not have the pure of Ms26 genes Close Recessive alleles.The method for utilizing the present invention as a result, can be on the basis of MS26 homozygous recessive male rice sterile lines On, develop the sterile line of more different genetic backgrounds.According to an embodiment of the invention, conventional back cross breeding method, institute are utilized Having different types of rice that can formulate into corresponding intelligent sterile line (can continuously produce corresponding infertility System), and theoretically all rice varieties all can be used as the male parent of hybridization, and hybrid vigour resource utilization is made to reach 95% or more.

According to an embodiment of the invention, it can be not particularly limited as the strain of recurrent parent, be implemented according to specific Example, recurrent parent can have selected from coordinate force is strong, plant type is good, disease-resistant, pest-resistant and high yield at least one character.As a result, may be used To obtain the male rice sterile line with these characters.According to an embodiment of the invention, recurrent parent can be selected from day it is rich, China 268, China is extensive 624, China 211, China are extensive 3411, China is extensive 451, China is extensive 2855, R608, China are extensive 374, China is extensive 3501, H451, R608, China account for, at least one of Huang Huazhan, H268, H819, Shanghai Fujian round-grained rice etc..

According to a particular embodiment of the invention, with reference to figure 6, molecule assisting sifting can be passed through（MAS）Method carry out Sterile line is built by backcross transformation.It specifically, will be described maternal with samsara parent as shown in fig. 6, according to an embodiment of the invention At least 3 times backcrossings of this progress.In addition, during being returned, can assist carrying out by molecular labeling foreground selection and Foreground selection.

Further, according to an embodiment of the invention, the method for above-mentioned structure male sterible series of rice may include following step Suddenly：

First, by ms26 mutant（MS26 homozygous recessive male rice sterile lines）Hybridized with recurrent parent, is obtained Hybridize F1；

Next, F1 and recurrent parent are returned, BC1F1 is obtained；

Next, BC1F1 and recurrent parent are returned, BC2F1 is obtained；

Then, BC2F1 is selfed, obtains BC2F2；

Then, BC2F2 and recurrent parent are returned, to obtain BC3F1；

Finally, BC3F1 is selfed, the sterile line BC3F2 newly built.

According to an embodiment of the invention, foreground selection and the back of the body can be carried out to being returned and being selfed product by molecular labeling Scape selects.For example, can need not select F1 generation, foreground and background selection is carried out to BC1F1, selects the heterozygosis of ms26 Body；Foreground and background selection is carried out to B2C2F1, selects the heterozygote of ms26；Foreground selection and background choosing are carried out to B2C2F1 It selects, obtains the heterozygote of ms26；Foreground and background selection is carried out to BC3F1, obtains the heterozygote of ms26；Finally, to BC3F2 into Row foreground selection and Foreground selection, to obtain ms26 homozygotes.On the right side of Fig. 6 shown in two columns, samsara parent after being selected by MAS This blood relationship can reach 99.5%.

According to an embodiment of the invention, can be by preceding for the rice homozygous recessive male sterile plants of backcross transformation What the method structure of the structure sterile line described in face obtained.Feature and advantage described in construct are previously with regard to, are also applied for This method repeats no more.

It should be noted that construct according to the ... of the embodiment of the present invention and application thereof is present inventor by arduous Creative work and Optimization Work just complete.During specific implementation mode is stated, unless otherwise indicated, the meaning of " plurality " is two It is a or more than two.

Below according to specific embodiment, the present invention will be described.It should be noted that these embodiments are only to be Illustrate the present invention, and limitation of the present invention cannot be construed in any way.In addition, unless stated otherwise, following Involved method is conventional method in embodiment, and involved material and preparation are also commercially available.

Below with reference to specific embodiment, the present invention will be described, it should be noted that these embodiments are only explanation Property, and be not considered as limiting the invention.

Unless otherwise specified, the conventional hand that the technological means employed in embodiment is well known to those skilled in the art Section, is referred to《Molecular Cloning:A Laboratory guide》The third edition or Related product carry out.Production is not specified in agents useful for same or instrument Manufacturer person, being can be with conventional products that are commercially available.

Embodiment 1：The phenotypic analysis of specificity overexpression OsYUCCA1 genes in paddy pollen

By assembling following DNA elements, the expression vector shown in FIG. 1 for being referred to as YUCCA1, specific construction step are built It is as follows：PG47 promoters are expanded from Maize genome（SEQ ID NO：9, amplimer：F1,R1）, expand from rice cDNA Increase OsYUCCA1 genes（SEQ ID NO：1, amplimer：F2,R2）, expand artificial synthesized IN2-1 terminators（SEQ ID NO：17, amplimer：F3,R3）, after three connects carrier T sequence verification, Hind III+Not I, AsiSI+Not are used respectively I, AsiSI+Bgl II digestions, while connecting into the complete pCAMBIA1300 carriers of BamH I+Hind III digestions, it obtains To the expression vector of pYUCCA1., obtain the expression vector of YUCCA1.

Wherein, the primer sequence is：

F1:TTGCATGCCTGCAGGTCGACTCTAGAGGATCTGCACCGGACACTGTCTGGTGG（SEQ ID NO:21）, interior box is HindIII restriction enzyme sites.

R1:ATTATGACGTGATCGATGCTTTATTCG（SEQ ID NO:22）, interior box is NotI enzymes Enzyme site,

F2:TTATGGACAACAAGCCGGCGCAAGAACGCCGCGAAACCTGGGTGCCG（SEQ ID NO: 23）, interior box is NotI restriction enzyme sites.

R2:TCTCATCTCGAGATATATATCACTAGTAG（SEQ ID NO:24）, interior box is Asis I Restriction enzyme site

F3:GAGATCTGACAAAGCAGCATTAGTCCG（SEQ ID NO:25）, interior box is AsiSI enzymes Enzyme site

R3:GTCGTGGAGATATAGGGGAAAGAGAAC（SEQ ID NO:26）, interior box is BglII digestions Site.

Plasmid YUCCA1 is transferred to Agrobacterium AGL0 bacterial strains using heat shock method, round-grained rice is transported to rice force using agrobacterium-mediated transformation No. 7 wild-type receptor materials carry out genetic transformation, obtain the corresponding transfer-gen plant material of 25 plants of carriers.It is transplanted to field Afterwards, the phenotype for observing transfer-gen plant and non-transgenic reference, be not observed between two class plant it is apparent it is modal not Together.

In the pollen maturation phase, the anther of military fortune No. 7 wild-type receptor materials of round-grained rice and transgenic line is taken to carry out vital staining. The method used for：In Rice Flowering late period, from No. 7 wild-type receptor adjoining trees of transgenic rice plant and military fortune round-grained rice respectively with Machine extracts single plant, and each strain takes a flower, every flower to take 1 anther, is placed in glass slide center, and the I of a drop 1% is added dropwise₂- IK solution, With tweezers and dissecting needle release pollen after, covered, under the microscope observe, count can stained pollen number and pollen it is total Number.As a result show the fertile rates of transgenic rice plant and military fortune No. 7 wild-type receptor adjoining trees of round-grained rice 95%~100% it Between, illustrate that the pollen for being overexpressed OsYUCCA1 utilizes I in the pollen maturation phase₂- IK dyeing is normal, does not dye abortion and goes out It is existing.

Further, in that morning of anther loose powder, military fortune No. 7 wild-type receptor materials of round-grained rice and transgenic line are acquired Anther has carried out the measurement of external pollen germination and pollen tube growth ability.It is planted from force fortune No. 7 WT lines of round-grained rice and transgenosis Single plant is respectively randomly selected in strain, and each strain takes a flower, and every flower takes 1 anther, after splitting anther with dissecting needle, by ripe pollen It evenly spreads in pollen fluid nutrient medium（Ingredient is：20% sucrose, 10%PEG4000,3mMCaCl2,40mg/L boric acid, 3mg/ L vitamin B1s）, it is placed in 28 DEG C of degree incubators after keeping the temperature 30 minutes, counts pollen germination and pollen tube in each plant anther The pollen of elongation accounts for the ratio of total Average pollen number.PRELIMINARY RESULTS shows that the pollen of transgenic rice plant is sprouted in vitro and pollen The pollen of the ratio tourney fortune No. 7 wild-type receptor adjoining trees of round-grained rice of pipe elongation is sprouted in vitro and the ratio of pollen tube growth is notable Decline（Decline~50%）, thus it is speculated that it is the pollen containing transgenosis in the rice plant due to transgenosis（50%）Because crossing scale Up to OsYUCCA1 genes, its activity is caused to reduce.

The above result shows that be specifically overexpressed OsYUCCA1 genes in paddy pollen, can make paddy pollen sprout or Pollen tube growth activity reduces, namely loses fertilizing ability, and therefore, which can be used as pollen inactivated gene, after being used for One of the key gene element of structure of continuous novel sterility changing carrier.

Embodiment 2：PZN2 vector constructions

By assembling following DNA elements, the expression vector shown in Fig. 2 for being referred to as pZN2 is built, specific construction step is such as Shown in Fig. 3：

The first step：PG47 promoters are first expanded from Maize genome（SEQ ID NO：9, amplimer：F1,R1）, from OsYUCCA1 genes are expanded in rice cDNA（SEQ ID NO：1, amplimer：F2,R2）, Hind III+Not I are used respectively, BamHI+Not I digestions, while connecting into the complete pCAMBIA1300 carriers of BamHI+Hind III digestions, in obtaining Between carrier 1.

Second step：The artificial synthesized PINII-RFP-LTP2 sequences of PCR amplification（SEQ ID NO：10, amplimer is： F3,R3）, after connecting carrier T sequence verification, with NaeI+AscI digestions and connect the intermediate carrier into NaeI+AscI complete degestions 1, obtain intermediate carrier 2.

Third walks：CYP1 (SEQ ID NO are expanded from oryza sativa genomic dna：19, amplimer is：F4,R4)；From people CYP2-IN2-1 amplification CYP2-IN2-1 (the SEQ ID NO of work synthesis：15, amplimer is：F5, R5), obtained two Segment, connection T- carrier sequence verifications it is correct after, then respectively use AscI+SalI and SalI+AsiS I double digestions, while connect into Enter with the intermediate carriers 2 of AsiSI+AscI double digestions to get to intermediate carrier 3.

4th step：The artificial synthesized 35S enhancers of PCR amplification（35S enhancer）Sequence (SEQ ID NO：16, amplification Primer is：F6, R6), after connection T- carrier sequence verifications are correct, then open connection with Asc I digestions and open into Asc I digestions Between carrier 3, obtain carrier pZN2 after verification is correct.

Wherein, the primer sequence is：

F1：GCCATGCCTGCAGGTCGACTCTAGAGGATCTGCACCGGACACTGTCTGGTGG（SEQ ID NO:27）, interior box is Hind III digestions site.

R1：ATTATGACGTGATCGATGCTTTATTCG（SEQ ID NO:28）, interior box is Not I enzymes Enzyme site.F2:TAATGGACAACAAGCCGGCGCAAGAAC（SEQ ID NO:29）, interior box is Not I enzymes Enzyme site.R2：AAAGAATCCTTCATCTCGAGATATATATCACTAGTAGT（SEQ ID NO:30）, it is followed successively by BamHI, Asc I and AsiS I restriction enzyme sites respectively in box.

F3:TAAACCGTCTCTTCGTGAGAATAACCG（SEQ ID NO:31）, interior box is Asc I enzymes Enzyme site .R3：CTTCGCATTCGCAAAACACACCTAGAC（SEQ ID NO:32）, interior box is restriction enzyme Enzyme Nae I restriction enzyme sites；

F4:TCGAAGGACCGCACCGTGACCATG（SEQ ID NO:33）, interior box is Sal I digestions position Point.

R4：CGTCGCGATTGGTCGAACACGAGGTAGGCGTG（SEQ ID NO:34）, interior box is Asc I restriction enzyme sites.

F5:GAGATCTGACAAAGCAGCATTAGTCCG（SEQ ID NO:35）, interior box is AsiS I Restriction enzyme site.R5:CATGGTCACGGTGCGGTCCTTCGA（SEQ ID NO:36）, interior box is Sal I digestions position Point.

F6：TTATCACATCAATCCACTTGCTTTGA（SEQ ID NO:37）, interior box is Asc I enzymes Enzyme site;

R6：GACGTCAACATGGTGGAGCACGACAC（SEQ ID NO:38）, interior box is Asc I enzymes Enzyme site

Embodiment 3：Numerous and sterile line production and principle are expanded in the acquisition of maintainer

By designing and verifying, the present invention provides a kind of structure rice maintainers, and further produce male sterile line Method.According to an embodiment of the invention, with reference to figure 4, this method includes：

The first step：By the construct described in embodiment 2（Contain restoring gene, pollen inactivated gene and color sorting gene Expression cassette）It is introduced into rice homozygous recessive male sterile plants ms/ms by genetic transformation（Ms26/ms26 or other core males Sterile mutant）In, the T0 of foreign gene-carrying is obtained for rice plant, and T0 is in for the foreign gene of transfer-gen plant Heterozygous state；There is half to be free of foreign gene in the pollen that the plant generates, the other half contains foreign gene, containing foreign gene Pollen inactivates（Lose fertilizing ability）, T0 is restored for the fertility of plant；

Second step cultivates the obtained T0 of the first step for transfer-gen plant, and solid after so that it is selfed, the T1 of acquisition is for seed Two classes can be divided into according to genetic background, wherein 50% seed is ms/ms (ms26/ms26 or other kernel male steriles mutant) Homozygous recessive and foreign gene heterozygosis background（It can be directly as maintainer）, also 50% seed be ms/ms (ms26/ms26 or Other kernel male sterile mutant) homozygous recessive and do not contain foreign gene（As male-sterile seed）；Pass through seed iridescent Choosing can separate two class seeds；

Third walks, and the maintainer seed for cultivating second step is plant（Background is prominent for ms26/ms26 or other kernel male steriles Variant homozygous recessive and foreign gene heterozygosis）, the pollen half that the maintainer in these sources generates contains foreign gene, and in addition one Half is free of foreign gene, and half i.e. 50% containing foreign gene and is red fluorescence seed in the seed that maintainer generates（Background is Ms26/ms26 or other kernel male steriles mutant homozygous recessive mutational site and foreign gene heterozygosis）, can be further used as Maintainer；The other half 50% non-fluorescence seed without containing foreign gene and for normal color（Background is ms26/ms26 or other Kernel male sterile mutant homozygous recessive mutational site and do not contain transgene component）, as sterile line.This two classes seed can be with Sorted out by color sorting instrument, contain the seed of fluorescence as maintainer, can continue selfing expand it is numerous obtain equivalent maintainer and The seed of sterile line, and the non-fluorescence seed without foreign transgenes is cross-breeding as sterile line or the production of hybrid seeds（Fig. 4）.

Embodiment 4：Rice conversion

Plasmid pZN2 is transferred to Agrobacterium AGL0 bacterial strains using heat shock method, heredity is carried out to rice using agrobacterium-mediated transformation Conversion, using the red fluorescent protein of RFP (r) gene codes in carrier as selection markers, the callus fluorescence taken turns by 3-4 After screening cutting, differentiation obtains the corresponding transfer-gen plant material of two carriers.Specific transformation receptor material is rice ms26 Holandry infertility Mutants homozygous, the specific descriptions about rice ms26 holandry infertility Mutants homozygous materials are shown in China Patent CN200910309083.1 (and The Plant Cell Vol.22:173-190, in January, 2010), the material is current The public can obtain, by the way that this two documents reference to be incorporated herein.

It should be noted that can also by the method for conventional gene knockout, after rice ms26 genes are all knocked out, Obtain rice ms26 holandry infertility Mutants homozygous.

Embodiment 5：The pollen fertility of transfer-gen plant detects

Analysis is carried out to the obtained transfer-gen plant material of construct genetic transformation in embodiment 2 to find, transgenosis Apparent modal difference is not observed between plant and non-transgenic reference plant.

To the obtained transfer-gen plant material of pZN2 constructs conversion ms26 mutant, be carried out at the same time pollen can contaminate rate and Pollen germination and pollen tube growth viability examination, while including that the corresponding wild type of receptor strain is non-to two control materials and turning base Because rice varieties force transports round-grained rice 7（It is fertile, hereinafter simply referred to as CK1）Non-transgenic rice strain force corresponding with transgenic paddy rice transports round-grained rice No. 7 ms26 mutant (infertility, hereinafter simply referred to as CK2）, rate and pollen germination and pollen tube growth viability examination can be contaminated by carrying out pollen.

Measure pollen can contaminate the method that rate uses for：In Rice Flowering late period, from transgenic rice plant and its control CK1 and CK2 cells respectively randomly select single plant, and each strain takes a flower, every flower to take 1 anther, are placed in glass slide center, are added dropwise one The I of drop 1%₂- IK solution, after tweezers and dissecting needle release pollen, covered is observed, counts and can dye under the microscope Pollen number and pollen frequence.Under the premise of the normal fertile and CK2 of CK1 normal infertility, transgenic rice plant is analyzed（It keeps System）Pollen can contaminate rate.As a result the fertile rate of fertile control (CK1) is shown between 96%~100%, and infertility control (CK2) can It is 0 to educate rate, and multiple transgenosis randomly selected（Maintainer）In plant, pollen staining ratio is also between 95-98%, explanation It converts and is overexpressed the pollen of OsYUCCA1 in the transgenic rice plant of pZN2 carriers in pollen maturation phase I₂- IK dyeing is normal, Abortion appearance is not dyed.

Measure the method that pollen germination and pollen tube growth vigor use for：In the pollen maturation phase, planted from transgenic paddy rice Strain and control CK1 and CK2 cells respectively randomly select single plant, and each strain takes a flower, every flower to take 1 anther, it is external to carry out pollen Sprout the measurement with pollen tube growth ability（The specific method of use is the same as embodiment 1）.PRELIMINARY RESULTS shows that transgenic paddy rice is planted The pollen of strain is sprouted in vitro and No. 7 wild-type receptor controls of the ratio tourney of pollen tube growth fortune round-grained rice（CK1）The pollen body of plant The ratio of outer sprouting and pollen tube growth is remarkably decreased（Decline~50%）, thus it is speculated that it is to contain in the rice plant due to transgenosis The pollen of transgenosis（50%）Because of overexpression OsYUCCA1 genes, its activity is caused to reduce.These are the result shows that in the present invention The OsYUCCA1 gene overexpressions frame provided is working properly in entire novel sterile expression vector, may be implemented to cause pollen The purpose of inactivation, expression is good as a whole.

Embodiment 6：The fluorescent seeds of transfer-gen plant and non-fluorescence seed segregation ratio

Randomly select obtained carrier in embodiment 2（pZN2）24 T0 for plant single plant, to tied T1 generations thereon The segregation ratio of fluorescence and non-fluorescence seed is investigated, the results showed that is born seeds on transfer-gen plant and is met 1:1 point From than（Fig. 5）, show that each element of expression vector provided in the present invention is expressed well as a whole.That is constructed maintainer (fluorescent seeds) can generate the pollen of the foreign gene-carrying of equivalent and the pollen of foreign gene-carrying, pollination self be not solid It obtains two classes afterwards to carry respectively and the seed of not foreign gene-carrying, wherein the fluorescent seeds of foreign gene-carrying is as keeping System can continuously continue to produce sterile line and maintainer, without the non-fluorescence normal of foreign gene-carrying by being selfed The plant of cultivating seeds can be used as the parent of crossbreeding as sterile line.

It can be seen from above-described embodiment 5 and embodiment 6 present invention realize its stablize initiative male sterible series of rice and The goal of the invention of maintainer.

Embodiment 7：Backcross transformation formulates sterile line

Selection traits are excellent in having Rice Germplasm Resources, such as coordinate force is strong, the excellent agriculture of disease-resistant, pest-resistant and high yield The rice material of skill character is as male parent（Recurrent parent, in embodiment, rich using day, China 268, China extensive 624, China 211, China Extensive 3411, China extensive 451, China extensive 2855, R608, China is extensive 374, China is extensive 3501, H451, R608, China account for, Huang Huazhan, H268, H819, Shanghai Fujian round-grained rice etc. are used as recurrent parent）, by sterile gene and the transgenic event to be obtained by the above method as mother This, recurrent parent is fabricated to the novel sterile line with merit by the two by backcross transformation（Fig. 6）, formulated a collection of new Type sterile line and the crossing performance rate for greatly expanding variety source, can especially change in japonica rice almost without good two It is the present situation of cross combination, expansible Japonica Hybrid cultivated area expands heterosis utilization range, improves variety source Utilization ratio.

Industrial applicibility

The construct of the present invention can be effectively applied to male sterible series of rice and the structure of maintainer, and then obtain Stable fertility male sterible series of rice and maintainer can be efficiently applied to the production of hybrid seed, so as to obtain Safety, good hybrid rice seeds.

Although the specific implementation mode of the present invention has obtained detailed description, it will be understood to those of skill in the art that.Root According to all introductions having disclosed, those details can be carry out various modifications and be replaced, these change the guarantor in the present invention Within the scope of shield.The full scope of the present invention is given by the appended claims and any equivalents thereof.

In the description of this specification, reference term " one embodiment ", " some embodiments ", " illustrative examples ", The description of " example ", " specific example " or " some examples " etc. means specific features described in conjunction with this embodiment or example, knot Structure, material or feature are included at least one embodiment or example of the invention.In the present specification, to above-mentioned term Schematic representation may not refer to the same embodiment or example.Moreover, specific features, structure, material or the spy of description Point can be combined in any suitable manner in any one or more of the embodiments or examples.

SEQUENCE LISTING

<110>Non- name prosperity system Crop Design forward position laboratory（Beijing）Co., Ltd

Shenzhen Xingwang Biological Seed Industry Co., Ltd.

<120>One sterility changing gene and its application

<150> 201310060104.7

<151> 2013-02-26

<160> 38

<170> PatentIn version 3.3

<210> 1

<211> 1095

<212> DNA

<213>Rice（Oryza sativa)

<400> 1

atggacaaca agccggcgca agaacgccgc gagacgtggg tcccgggcgc cgtcatcgtc 60

ggcgcgggcc cgtcggggct cgccgcggcg gcgtgcctcg cggcgcgggg cgttccggcg 120

acggtgcttg agcggtccga ctcgctggcg tccacgtggc gccaccgcat gtacgaccgc 180

ctcgctctcc acctgcccaa gcgcttctgc gagctgccgc tcctcccgtt cccggaggag 240

tacccgacgt acccgtccaa ggaccagttc gtggcgtaca tggaggcgta cgccgcggcg 300

gcgggcgtcg cgccgcgctt cggcgccacc gtcgaggagg ccgcgttcga cgcggccgtc 360

ggcgcatgga gggtgcgtct cgacggcggg gaggtgctca tggcgcggtg gctcgtcgtc 420

gcgacggggg agaacgccga gccgcgggtg ccggactttc ccggcatgca gaagttcgcc 480

gggtgtgcca tgcatacttc cgagtacaag tccggcgagc agtttgccgg taagaaggtg 540

ttggtcgtgg gatgcgggaa ttctggcatg gaagtgagct tggatttgtg ccggcatggc 600

gcgaagccct ccatggtggt gcgcaacacg gtgcatgtcc taccaaggga aatgttcggt 660

ctatccacgt tcggcatcgc catggcgctg ctgcgatggc taccggttca gctcgtcgac 720

cggttccttc tcacggcggc tcacctcatc ctcggtaaca cggggcagtt cggcctaagg 780

cggcccaaaa cagggcccat cgagctcaag aacctcaccg gcaggacacc cgtactggac 840

gttgggacgc tagaccacat caaatccggc aaaattaagg tagtgggagc agtgaaggag 900

atgacgaggc aaggggtcag gttcacggat ggcaaggagg agcaattcga cacaataatc 960

ctcgccacag gctacaggag caacgtgcca tcttggctca aggtaaagca gagtgtgact 1020

cactcttgtt cgttttattt ttctttctgt ccgcactgca ctatactact actagtgata 1080

tatatctcga gatga 1095

<210> 2

<211> 1095

<212> DNA

<213>Rice（Oryza sativa）

<400> 2

atggacaaca agccggcgca agaacgccgc gagacgtggg tcccgggcgc cgtcatcgtc 60

ggcgcgggcc cgtcggggct cgccgcggcg gcgtgcctcg cggcgcgggg cgttccggcg 120

acggtgcttg agcggtccga ctcgctggcg tccacgtggc gccaccgcat gtacgaccgc 180

ctcgctctcc acctgcccaa gcgcttctgc gagctgccgc tcctcccgtt cccggaggag 240

tacccgacgt acccgtccaa ggaccagttc gtggcgtaca tggaggcgta cgccgcggcg 300

gcgggcgtcg cgccgcgctt cggcgccacc gtcgaggagg ccgcgttcga cgcggccgtc 360

ggcgcatgga gggtgcgtct cgacggcggg gaggtgctca tggcgcggtg gctcgtcgtc 420

gcgacggggg agaacgccga gccgcgggtg ccggactttc ccggcatgca gaagttcgcc 480

gggtgtgcca tgcatacttc cgagtacaag tccggcgagc agtttgccgg taagaaggtg 540

ttggtcgtgg gatgcgggaa ttctggcatg gaagtgagct tggatttgtg ccggcatggc 600

gcgaagccct ccatggtggt gcgcaacacg gtgcatgtcc taccaaggga aatgttcggt 660

ctatccacgt tcggcatcgc catggcgctg ctgcgatggc taccggttca gctcgtcgac 720

cggttccttc tcacggcggc tcacctcatc ctcggtaaca cggggcagtt cggcctaagg 780

cggcccaaaa cagggcccat cgagctcaag aacctcaccg gcaggacacc cgtactggac 840

gttgggacgc tagaccacat caaatccggc aaaattaagg tagtgggagc agtgaaggag 900

atgacgaggc aaggggtcag gttcacggat ggcaaggagg agcaattcga cacaataatc 960

ctcgccacag gctacaggag caacgtgcca tcttggctca aggtaaagca gagtgtgact 1020

cactcttgtt cgttttattt ttctttctgt ccgcactgca ctatactact actagtgata 1080

tatatctcga gatga 1095

<210> 3

<211> 364

<212> PRT

<213>Rice（Oryza sativa)

<400> 3

Met Asp Asn Lys Pro Ala Gln Glu Arg Arg Glu Thr Trp Val Pro Gly

1 5 10 15

Ala Val Ile Val Gly Ala Gly Pro Ser Gly Leu Ala Ala Ala Ala Cys

20 25 30

Leu Ala Ala Arg Gly Val Pro Ala Thr Val Leu Glu Arg Ser Asp Ser

35 40 45

Leu Ala Ser Thr Trp Arg His Arg Met Tyr Asp Arg Leu Ala Leu His

50 55 60

Leu Pro Lys Arg Phe Cys Glu Leu Pro Leu Leu Pro Phe Pro Glu Glu

65 70 75 80

Tyr Pro Thr Tyr Pro Ser Lys Asp Gln Phe Val Ala Tyr Met Glu Ala

85 90 95

Tyr Ala Ala Ala Ala Gly Val Ala Pro Arg Phe Gly Ala Thr Val Glu

100 105 110

Glu Ala Ala Phe Asp Ala Ala Val Gly Ala Trp Arg Val Arg Leu Asp

115 120 125

Gly Gly Glu Val Leu Met Ala Arg Trp Leu Val Val Ala Thr Gly Glu

130 135 140

Asn Ala Glu Pro Arg Val Pro Asp Phe Pro Gly Met Gln Lys Phe Ala

145 150 155 160

Gly Cys Ala Met His Thr Ser Glu Tyr Lys Ser Gly Glu Gln Phe Ala

165 170 175

Gly Lys Lys Val Leu Val Val Gly Cys Gly Asn Ser Gly Met Glu Val

180 185 190

Ser Leu Asp Leu Cys Arg His Gly Ala Lys Pro Ser Met Val Val Arg

195 200 205

Asn Thr Val His Val Leu Pro Arg Glu Met Phe Gly Leu Ser Thr Phe

210 215 220

Gly Ile Ala Met Ala Leu Leu Arg Trp Leu Pro Val Gln Leu Val Asp

225 230 235 240

Arg Phe Leu Leu Thr Ala Ala His Leu Ile Leu Gly Asn Thr Gly Gln

245 250 255

Phe Gly Leu Arg Arg Pro Lys Thr Gly Pro Ile Glu Leu Lys Asn Leu

260 265 270

Thr Gly Arg Thr Pro Val Leu Asp Val Gly Thr Leu Asp His Ile Lys

275 280 285

Ser Gly Lys Ile Lys Val Val Gly Ala Val Lys Glu Met Thr Arg Gln

290 295 300

Gly Val Arg Phe Thr Asp Gly Lys Glu Glu Gln Phe Asp Thr Ile Ile

305 310 315 320

Leu Ala Thr Gly Tyr Arg Ser Asn Val Pro Ser Trp Leu Lys Val Lys

325 330 335

Gln Ser Val Thr His Ser Cys Ser Phe Tyr Phe Ser Phe Cys Pro His

340 345 350

Cys Thr Ile Leu Leu Leu Val Ile Tyr Ile Ser Arg

355 360

<210> 4

<211> 3810

<212> DNA

<213>Rice（Oryza sativa）

<400> 4

aggtggaaga caaggtggtg aggattggga gggctaccta tggcagggta gtgaagaggc 60

aggcaatgag agctctcttc agacttacat tggatgctga cagtaacaaa agcctgtagg 120

ttttgatact cttgattgat tgtttattta gttacctagt atcttcagta acagatgaga 180

gatttattca gcaaatgctc cggtttgctc gaaggttgta ataagagtgt gggcaagaat 240

caaggtcaat ccataagagc actattttca tgctcttctg atcttggttt cagacttgtt 300

tcagtgttga cattggttat ttctcaattc attcgagtat ttgttgttac atcacaaagg 360

ataagttcta tagaaaaaat cttccttttc aagtgatgtt ctttaatttt ctgtagaatt 420

gtgccctgca atttctcaaa tctttgatag atggcttatt tgtattgact ggaaaagaaa 480

ttagttgtca ataactagaa gctttagaga tgcaaagtat tggatatatc ttggcaatag 540

tattttatat tgcttgttta tgtgagaatg ttttaactag atggcaactg atttctggga 600

caaaatcgct tctacaatag cattttatgg aactcgtact cgtcgatagc atttcttgga 660

tttgggtgtt tgtaaatggc atttcttgga ttttctcttc attaaaatag cctattcaga 720

tgaagtagaa ttcaggtgaa gtagaaacca actactttgg gttcacaatt tatatttctt 780

ttgaggatac cccatttcat tttagttgtc atcaaagact agacaatatc gacagaaaat 840

ggtaagcctg gtttcagttg gtgacaattt aacagaattc agatggatat ggttctgata 900

ttagaaggtg gcataccttt agtcgctgca aacgcttcag ttatctgaac aaaacaacga 960

acttggctga gcaggggaaa aaaatactgt agcattcatt ttgtgtttac atgagtaacg 1020

attcttttct aggtggacag atcacaaaaa gaaaactaaa gctaagatcc aactcctaag 1080

ggtgttaggt tagggacacc atatgaatga gacaatctta attcttggtc acacaaagat 1140

tgtctcaagg ttggtagcat cagtgcccaa tatatcacct aactatgcca tccaaaatgc 1200

tacatagcat ctcttgtaga ctgaaccctt catgaagagc cccatggagg aagctcatgc 1260

aatgccagtg acatcattct tcccagtagc aggaatccac aagctcatag ctatcttcct 1320

tgttgtcctc tcatggatct tggtccacaa gtggagcctg aggaaccaga aagggccaag 1380

atcatggcca atcatcggcg cgacagtgga gcaactgaag aactaccaca ggatgcatga 1440

ctggcttgtc gagtacttgt cgaaggaccg caccgtgacc gtcgacatgc ctttcacctc 1500

ctacacctac attgccgacc cggtgaacgt cgagcatgtc ctgaagacca acttcaccaa 1560

ttaccccaag gtaaaagaac cataggatct tcagtgtact gtaaaatgtg ccttgcacag 1620

tactaacact gacacaaaaa atgtctgaaa atatgcaggg tgaagtgtac aggtcttaca 1680

tggatgtgct gctcggtgat ggcatattca atgccgacgg cgagatgtgg aggaagcaaa 1740

ggaagacggc gagcttcgag tttgcctcca agaacttgag agacttcagc actgtggtgt 1800

tcagggagta ctccctgaag ctatcaagca ttctgagcca agcatgcaag gccggcagag 1860

ttgtagacat gcaggtaacc aactgaattc cttgcctaat acctaaacat ttcttgagaa 1920

accaaattgt tcagaattct gatgcaagaa ctaaccaaaa ttcaggaatt gttcatgagg 1980

atgacactgg actcgatctg caaggtcggg tttggggttg agatcgggac gctgtcacct 2040

gatctcccgg agaacagctt tgcccaggca ttcgacgctg ccaacatcat cgtcacgctg 2100

cggttcatcg atcctctgtg gcgtctgaag aagttcttgc acgtcggatc agaggctctc 2160

ctcgagcaga gcatgaagct ggttgatgac ttcacctaca gcgtgatccg ccgccgcaag 2220

gctgagatct tgcaggctcg agccagcggc aagcaagaga aggtgatcct tcctctcttg 2280

ctcaaagaat cagtagaact gaactgacat ggtaatggtg atgatcagat cggaaaaggt 2340

tttgtttctt gatatcgttg atttgtaatg gcgagcagat caagcacgac atactgtcgc 2400

ggttcatcga gctcggggag gccggcggcg acgagggggg cggcagcttc ggggacgaca 2460

agagcctccg cgacgtggtg ctcaacttcg tgatcgccgg gcgtgacacg acggcgacga 2520

cgctgtcgtg gttcacgtac atggcgatga cgcacccggc cgtcgccgac aagctccggc 2580

gcgagctggc cgcgttcgag gatgagcgcg cgcgcgagga gggcgtcgcg ctcgccgacg 2640

ccgccggcga ggcgtcgttc gcggcgcgcg tggcgcagtt cgcgtcgctg ctgagctacg 2700

acgcggtggg gaagctggtg tacctgcacg cgtgcgtgac ggagacgctc cgcctctacc 2760

cggcggtgcc gcaggacccc aaggggatcg tggaggacga cgtgctcccc gacggcacca 2820

aggtgcgcgc cggcgggatg gtgacgtacg tgccctactc catggggagg atggagtaca 2880

actggggccc cgacgcggcg agcttccggc cggagcggtg gctcagcggc gacggcggcg 2940

cgttccggaa cgcgtcgccg ttcaagttca ccgcgttcca ggccgggccg cggatctgcc 3000

tcggcaagga ctccgcctac ctccagatga agatggcgct cgccatcctc ttccgcttct 3060

acaccttcga cctcgtcgag gaccaccccg tcaagtaccg gatgatgacc atcctctcca 3120

tggctcacgg cctcaaggtc cgcgtctcca cctccgtctg acccccgccg ccgctcgccg 3180

gcagccgcgc cgccgccgcc cgtatcgctt accggagtag taaataagcc tatgtaatct 3240

ggtttgaatt tgaaatttga atgtaccatg tttgattcta ggatttgttg gtcctagacc 3300

ctgcttgaaa cggtgcgaat ttcatctaaa tggttgagaa attttatcga aagctgttcc 3360

attctacgct acaaatggtg ggactggatt taaacattgg cgacgtggac aaggccgtat 3420

caccatgttt gcacattttt aaacctgtaa tctggtttga atttgaatgt accatgacac 3480

catgtttgca aaactttaca tgaatgtttg agaaaaaata tggagaactg ttcaattagt 3540

atgcgtttaa aatgggactg gatttaaaca ttggcgacgt ggacaaggct agtggactga 3600

gactctgaga tgttgcggaa gtcggggacg cagcggcggc agccgccggc gtggcggcgg 3660

tgccggagcc tgcgacacat caagcagatg cacgcggtga tggcgctccg gggcttcctc 3720

tccgatccct ccgagctccg cgagctcctt ttcgcctccg ccgtcgcggt ccgcggcgcc 3780

atcgcgcacg cctacctcgt gttcgaccaa 3810

<210> 5

<211> 3810

<212> DNA

<213>Rice（Oryza sativa）

<400> 5

aggtggaaga caaggtggtg aggattggga gggctaccta tggcagggta gtgaagaggc 60

aggcaatgag agctctcttc agacttacat tggatgctga cagtaacaaa agcctgtagg 120

ttttgatact cttgattgat tgtttattta gttacctagt atcttcagta acagatgaga 180

gatttattca gcaaatgctc cggtttgctc gaaggttgta ataagagtgt gggcaagaat 240

caaggtcaat ccataagagc actattttca tgctcttctg atcttggttt cagacttgtt 300

tcagtgttga cattggttat ttctcaattc attcgagtat ttgttgttac atcacaaagg 360

ataagttcta tagaaaaaat cttccttttc aagtgatgtt ctttaatttt ctgtagaatt 420

gtgccctgca atttctcaaa tctttgatag atggcttatt tgtattgact ggaaaagaaa 480

ttagttgtca ataactagaa gctttagaga tgcaaagtat tggatatatc ttggcaatag 540

tattttatat tgcttgttta tgtgagaatg ttttaactag atggcaactg atttctggga 600

caaaatcgct tctacaatag cattttatgg aactcgtact cgtcgatagc atttcttgga 660

tttgggtgtt tgtaaatggc atttcttgga ttttctcttc attaaaatag cctattcaga 720

tgaagtagaa ttcaggtgaa gtagaaacca actactttgg gttcacaatt tatatttctt 780

ttgaggatac cccatttcat tttagttgtc atcaaagact agacaatatc gacagaaaat 840

ggtaagcctg gtttcagttg gtgacaattt aacagaattc agatggatat ggttctgata 900

ttagaaggtg gcataccttt agtcgctgca aacgcttcag ttatctgaac aaaacaacga 960

acttggctga gcaggggaaa aaaatactgt agcattcatt ttgtgtttac atgagtaacg 1020

attcttttct aggtggacag atcacaaaaa gaaaactaaa gctaagatcc aactcctaag 1080

ggtgttaggt tagggacacc atatgaatga gacaatctta attcttggtc acacaaagat 1140

tgtctcaagg ttggtagcat cagtgcccaa tatatcacct aactatgcca tccaaaatgc 1200

tacatagcat ctcttgtaga ctgaaccctt catgaagagc cccatggagg aagctcatgc 1260

aatgccagtg acatcattct tcccagtagc aggaatccac aagctcatag ctatcttcct 1320

tgttgtcctc tcatggatct tggtccacaa gtggagcctg aggaaccaga aagggccaag 1380

atcatggcca atcatcggcg cgacagtgga gcaactgaag aactaccaca ggatgcatga 1440

ctggcttgtc gagtacttgt cgaaggacag gacggtgacc gtcgacatgc ctttcacctc 1500

ctacacctac attgccgacc cggtgaacgt cgagcatgtc ctgaagacca acttcaccaa 1560

ttaccccaag gtaaaagaac cataggatct tcagtgtact gtaaaatgtg ccttgcacag 1620

tactaacact gacacaaaaa atgtctgaaa atatgcaggg tgaagtgtac aggtcttaca 1680

tggatgtgct gctcggtgat ggcatattca atgccgacgg cgagatgtgg aggaagcaaa 1740

ggaagacggc gagcttcgag tttgcctcca agaacttgag agacttcagc actgtggtgt 1800

tcagggagta ctccctgaag ctatcaagca ttctgagcca agcatgcaag gccggcagag 1860

ttgtagacat gcaggtaacc aactgaattc cttgcctaat acctaaacat ttcttgagaa 1920

accaaattgt tcagaattct gatgcaagaa ctaaccaaaa ttcaggaatt gttcatgagg 1980

atgacactgg actcgatctg caaggtcggg tttggggttg agatcgggac gctgtcacct 2040

gatctcccgg agaacagctt tgcccaggca ttcgacgctg ccaacatcat cgtcacgctg 2100

cggttcatcg atcctctgtg gcgtctgaag aagttcttgc acgtcggatc agaggctctc 2160

ctcgagcaga gcatgaagct ggttgatgac ttcacctaca gcgtgatccg ccgccgcaag 2220

gctgagatct tgcaggctcg agccagcggc aagcaagaga aggtgatcct tcctctcttg 2280

ctcaaagaat cagtagaact gaactgacat ggtaatggtg atgatcagat cggaaaaggt 2340

tttgtttctt gatatcgttg atttgtaatg gcgagcagat caagcacgac atactgtcgc 2400

ggttcatcga gctcggggag gccggcggcg acgagggggg cggcagcttc ggggacgaca 2460

agagcctccg cgacgtggtg ctcaacttcg tgatcgccgg gcgtgacacg acggcgacga 2520

cgctgtcgtg gttcacgtac atggcgatga cgcacccggc cgtcgccgac aagctccggc 2580

gcgagctggc cgcgttcgag gatgagcgcg cgcgcgagga gggcgtcgcg ctcgccgacg 2640

ccgccggcga ggcgtcgttc gcggcgcgcg tggcgcagtt cgcgtcgctg ctgagctacg 2700

acgcggtggg gaagctggtg tacctgcacg cgtgcgtgac ggagacgctc cgcctctacc 2760

cggcggtgcc gcaggacccc aaggggatcg tggaggacga cgtgctcccc gacggcacca 2820

aggtgcgcgc cggcgggatg gtgacgtacg tgccctactc catggggagg atggagtaca 2880

actggggccc cgacgcggcg agcttccggc cggagcggtg gctcagcggc gacggcggcg 2940

cgttccggaa cgcgtcgccg ttcaagttca ccgcgttcca ggccgggccg cggatctgcc 3000

tcggcaagga ctccgcctac ctccagatga agatggcgct cgccatcctc ttccgcttct 3060

acaccttcga cctcgtcgag gaccaccccg tcaagtaccg gatgatgacc atcctctcca 3120

tggctcacgg cctcaaggtc cgcgtctcca cctccgtctg acccccgccg ccgctcgccg 3180

gcagccgcgc cgccgccgcc cgtatcgctt accggagtag taaataagcc tatgtaatct 3240

ggtttgaatt tgaaatttga atgtaccatg tttgattcta ggatttgttg gtcctagacc 3300

ctgcttgaaa cggtgcgaat ttcatctaaa tggttgagaa attttatcga aagctgttcc 3360

attctacgct acaaatggtg ggactggatt taaacattgg cgacgtggac aaggccgtat 3420

caccatgttt gcacattttt aaacctgtaa tctggtttga atttgaatgt accatgacac 3480

catgtttgca aaactttaca tgaatgtttg agaaaaaata tggagaactg ttcaattagt 3540

atgcgtttaa aatgggactg gatttaaaca ttggcgacgt ggacaaggct agtggactga 3600

gactctgaga tgttgcggaa gtcggggacg cagcggcggc agccgccggc gtggcggcgg 3660

tgccggagcc tgcgacacat caagcagatg cacgcggtga tggcgctccg gggcttcctc 3720

tccgatccct ccgagctccg cgagctcctt ttcgcctccg ccgtcgcggt ccgcggcgcc 3780

atcgcgcacg cctacctcgt gttcgaccaa 3810

<210> 6

<211> 1231

<212> DNA

<213>Rice（Oryza sativa）

<400> 6

aggtggaaga caaggtggtg aggattggga gggctaccta tggcagggta gtgaagaggc 60

aggcaatgag agctctcttc agacttacat tggatgctga cagtaacaaa agcctgtagg 120

ttttgatact cttgattgat tgtttattta gttacctagt atcttcagta acagatgaga 180

gatttattca gcaaatgctc cggtttgctc gaaggttgta ataagagtgt gggcaagaat 240

caaggtcaat ccataagagc actattttca tgctcttctg atcttggttt cagacttgtt 300

tcagtgttga cattggttat ttctcaattc attcgagtat ttgttgttac atcacaaagg 360

ataagttcta tagaaaaaat cttccttttc aagtgatgtt ctttaatttt ctgtagaatt 420

gtgccctgca atttctcaaa tctttgatag atggcttatt tgtattgact ggaaaagaaa 480

ttagttgtca ataactagaa gctttagaga tgcaaagtat tggatatatc ttggcaatag 540

tattttatat tgcttgttta tgtgagaatg ttttaactag atggcaactg atttctggga 600

caaaatcgct tctacaatag cattttatgg aactcgtact cgtcgatagc atttcttgga 660

tttgggtgtt tgtaaatggc atttcttgga ttttctcttc attaaaatag cctattcaga 720

tgaagtagaa ttcaggtgaa gtagaaacca actactttgg gttcacaatt tatatttctt 780

ttgaggatac cccatttcat tttagttgtc atcaaagact agacaatatc gacagaaaat 840

ggtaagcctg gtttcagttg gtgacaattt aacagaattc agatggatat ggttctgata 900

ttagaaggtg gcataccttt agtcgctgca aacgcttcag ttatctgaac aaaacaacga 960

acttggctga gcaggggaaa aaaatactgt agcattcatt ttgtgtttac atgagtaacg 1020

attcttttct aggtggacag atcacaaaaa gaaaactaaa gctaagatcc aactcctaag 1080

ggtgttaggt tagggacacc atatgaatga gacaatctta attcttggtc acacaaagat 1140

tgtctcaagg ttggtagcat cagtgcccaa tatatcacct aactatgcca tccaaaatgc 1200

tacatagcat ctcttgtaga ctgaaccctt c 1231

<210> 7

<211> 647

<212> DNA

<213>Rice（Oryza sativa）

<400> 7

cccccgccgc cgctcgccgg cagccgcgcc gccgccgccc gtatcgctta ccggagtagt 60

aaataagcct atgtaatctg gtttgaattt gaaatttgaa tgtaccatgt ttgattctag 120

gatttgttgg tcctagaccc tgcttgaaac ggtgcgaatt tcatctaaat ggttgagaaa 180

ttttatcgaa agctgttcca ttctacgcta caaatggtgg gactggattt aaacattggc 240

gacgtggaca aggccgtatc accatgtttg cacattttta aacctgtaat ctggtttgaa 300

tttgaatgta ccatgacacc atgtttgcaa aactttacat gaatgtttga gaaaaaatat 360

ggagaactgt tcaattagta tgcgtttaaa atgggactgg atttaaacat tggcgacgtg 420

gacaaggcta gtggactgag actctgagat gttgcggaag tcggggacgc agcggcggca 480

gccgccggcg tggcggcggt gccggagcct gcgacacatc aagcagatgc acgcggtgat 540

ggcgctccgg ggcttcctct ccgatccctc cgagctccgc gagctccttt tcgcctccgc 600

cgtcgcggtc cgcggcgcca tcgcgcacgc ctacctcgtg ttcgacc 647

<210> 8

<211> 544

<212> PRT

<213>Rice（Oryza sativa)

<400> 8

Met Lys Ser Pro Met Glu Glu Ala His Ala Met Pro Val Thr Ser Phe

1 5 10 15

Phe Pro Val Ala Gly Ile His Lys Leu Ile Ala Ile Phe Leu Val Val

20 25 30

Leu Ser Trp Ile Leu Val His Lys Trp Ser Leu Arg Asn Gln Lys Gly

35 40 45

Pro Arg Ser Trp Pro Ile Ile Gly Ala Thr Val Glu Gln Leu Lys Asn

50 55 60

Tyr His Arg Met His Asp Trp Leu Val Glu Tyr Leu Ser Lys Asp Arg

65 70 75 80

Thr Val Thr Val Asp Met Pro Phe Thr Ser Tyr Thr Tyr Ile Ala Asp

85 90 95

Pro Val Asn Val Glu His Val Leu Lys Thr Asn Phe Thr Asn Tyr Pro

100 105 110

Lys Gly Glu Val Tyr Arg Ser Tyr Met Asp Val Leu Leu Gly Asp Gly

115 120 125

Ile Phe Asn Ala Asp Gly Glu Met Trp Arg Lys Gln Arg Lys Thr Ala

130 135 140

Ser Phe Glu Phe Ala Ser Lys Asn Leu Arg Asp Phe Ser Thr Val Val

145 150 155 160

Phe Arg Glu Tyr Ser Leu Lys Leu Ser Ser Ile Leu Ser Gln Ala Cys

165 170 175

Lys Ala Gly Arg Val Val Asp Met Gln Glu Leu Phe Met Arg Met Thr

180 185 190

Leu Asp Ser Ile Cys Lys Val Gly Phe Gly Val Glu Ile Gly Thr Leu

195 200 205

Ser Pro Asp Leu Pro Glu Asn Ser Phe Ala Gln Ala Phe Asp Ala Ala

210 215 220

Asn Ile Ile Val Thr Leu Arg Phe Ile Asp Pro Leu Trp Arg Leu Lys

225 230 235 240

Lys Phe Leu His Val Gly Ser Glu Ala Leu Leu Glu Gln Ser Met Lys

245 250 255

Leu Val Asp Asp Phe Thr Tyr Ser Val Ile Arg Arg Arg Lys Ala Glu

260 265 270

Ile Leu Gln Ala Arg Ala Ser Gly Lys Gln Glu Lys Ile Lys His Asp

275 280 285

Ile Leu Ser Arg Phe Ile Glu Leu Gly Glu Ala Gly Gly Asp Glu Gly

290 295 300

Gly Gly Ser Phe Gly Asp Asp Lys Ser Leu Arg Asp Val Val Leu Asn

305 310 315 320

Phe Val Ile Ala Gly Arg Asp Thr Thr Ala Thr Thr Leu Ser Trp Phe

325 330 335

Thr Tyr Met Ala Met Thr His Pro Ala Val Ala Asp Lys Leu Arg Arg

340 345 350

Glu Leu Ala Ala Phe Glu Asp Glu Arg Ala Arg Glu Glu Gly Val Ala

355 360 365

Leu Ala Asp Ala Ala Gly Glu Ala Ser Phe Ala Ala Arg Val Ala Gln

370 375 380

Phe Ala Ser Leu Leu Ser Tyr Asp Ala Val Gly Lys Leu Val Tyr Leu

385 390 395 400

His Ala Cys Val Thr Glu Thr Leu Arg Leu Tyr Pro Ala Val Pro Gln

405 410 415

Asp Pro Lys Gly Ile Val Glu Asp Asp Val Leu Pro Asp Gly Thr Lys

420 425 430

Val Arg Ala Gly Gly Met Val Thr Tyr Val Pro Tyr Ser Met Gly Arg

435 440 445

Met Glu Tyr Asn Trp Gly Pro Asp Ala Ala Ser Phe Arg Pro Glu Arg

450 455 460

Trp Leu Ser Gly Asp Gly Gly Ala Phe Arg Asn Ala Ser Pro Phe Lys

465 470 475 480

Phe Thr Ala Phe Gln Ala Gly Pro Arg Ile Cys Leu Gly Lys Asp Ser

485 490 495

Ala Tyr Leu Gln Met Lys Met Ala Leu Ala Ile Leu Phe Arg Phe Tyr

500 505 510

Thr Phe Asp Leu Val Glu Asp His Pro Val Lys Tyr Arg Met Met Thr

515 520 525

Ile Leu Ser Met Ala His Gly Leu Lys Val Arg Val Ser Thr Ser Val

530 535 540

<210> 9

<211> 2770

<212> DNA

<213>Corn (Zea mays)

<400> 9

agcttgcatg cctgcaggtc gactctagag gatctgcacc ggacactgtc tggtggcata 60

ccagacagtc cggtgtgcca gatcagggca cccttcggtt cctttgctcc tttgcttttg 120

aaccctaact ttgatcgttt attggtttgt gttgaacctt tatgcacctg tggaatatat 180

aatctagaac aaactagtta gtccaatcat ttgtgttggg cattcaacca ccaaaattat 240

ttataggaaa aggttaaacc ttatttccct ttcaatctcc ccctttttgg tgattgatgc 300

caacacaaac caaagaaaat atataagtgc agaattgaac tagtttgcat aaggtaagtg 360

cataggttac ttagaattaa atcaatttat acttttactt gatatgcatg gttgctttct 420

tttattttaa cattttggac cacatttgca ccacttgttt tgttttttgc aaatcttttt 480

ggaaattctt tttcaaagtc ttttgcaaat agtcaaaggt atatgaataa gattgtaaga 540

agcattttca agatttgaaa tttctccccc tgtttcaaat gcttttcctt tgactaaaca 600

aaactccccc tgaataaaat tctcctctta gctttcaaga gggttttaaa tagatatcaa 660

ttggaaatat atttagatgc taattttgaa aatataccaa ttgaaaatca acataccaat 720

ttgaaattaa acataccaat ttaaaaaatt tcaaaaagtg gtggtgcggt ccttttgctt 780

tgggcttaat atttctcccc ctttggcatt aatcgccaaa aacggagact ttgtgagcca 840

tttatacttt ctccccattg gtaaatgaaa tatgagtgaa agattatacc aaatttggac 900

agtgatgcgg agtgacggcg aaggataaac gataccgtta gagtggagtg gaagccttgt 960

cttcgccgaa gactccattt ccctttcaat ctacgactta gcatagaaat acacttgaaa 1020

acacattagt cgtagccacg aaagagatat gatcaaaggt atacaaatga gctatgtgtg 1080

taatgtttca atcaaagttt cgagaatcaa gaatatttag ctcattccta agtttgctaa 1140

aggttttatc atctaatggt ttggtaaaga tatcgactaa ttgttctttg gtgctaacat 1200

aagcaatctc gatatcaccc ctttgttggt gatccctcaa aaagtgatac cgaatgtcta 1260

tgtgcttagt gcggctgtgt tcaacgggat tatccgccat gcagatagca ctctcattgt 1320

cacataggag agggactttg ctcaatttgt agccatagtc cctaaggttt tgcctcatcc 1380

aaagtaattg cacacaacaa tgtcctgcgg caatatactt ggcttcggcg gtagaaagag 1440

ctattgagtt ttgtttcttt gaagtccaag acaccaggga tctccctaga aactgacaag 1500

tccctgatgt gctcttccta tcaattttac accctgccca atcggcatct gaatatccta 1560

ttaaatcaaa ggtggatccc ttggggtacc aaagaccaaa tttaggagtg taaactaaat 1620

atctcatgat tcttttcacg gccctaaggt gaacttcctt aggatcggct tggaatcttg 1680

cacacatgca tatagaaagc atactatctg gtcgagatgc acataaatag agtaaagatc 1740

ctatcatcga ccggtatacc ttttggtcta cggatttacc tcccgtgtcg aggtcgagat 1800

gcccattagt tcccatgggt gtcctgatgg gcttggcatc cttcattcca aacttgttga 1860

gtatgtcttg aatgtacttt gtttggctga tgaaggtgcc atcttggagt tgcttgactt 1920

gaaatcctag aaaatatttc aacttcccca tcatagacat ctcgaatttc ggaatcatga 1980

tcctactaaa ctcttcacaa gtagatttgt tagtagaccc aaatataata tcatcaacat 2040

aaatttggca tacaaacaaa acttttgaaa tggttttagt aaagagagta ggatcggctt 2100

tactgactct gaagccatta gtgataagaa aatctcttag gcattcatac catgctgttg 2160

gggcttgctt gagcccataa agcgcctttg agagtttata aacatggtta gggtactcac 2220

tatcttcaaa gccgagaggt tgctcaacat agacctattc accccatttg atcacttttt 2280

tggtccttca ggatctaata gttatgtata atttagagtc tcttgtttaa tggccagata 2340

tttctaatta atctaagaat ttatgatatt ttttaatttt ttatcatgtc tgatgagaat 2400

taacataaag gctcaattgg gtcctgaatt aataatagag tgaaaattaa tccagaggct 2460

ctattagaac cttcaattag taataccaag atatatataa gatagtagag tatagtttaa 2520

atgttggcat tgttcattct ttcttttgtt atttaattta tgctttccac ggtggttagt 2580

ggttacttct gaagggtcca aataatgcat gaagagtttg aggacaagaa gtctgcccta 2640

aaaatagcga tgcaaaggca tggtgtccaa gccatacata tagcgcacta attttatcag 2700

cagaacaatg gtatttatag gtcctagtgc ccaggcaaca agagacacga ataaagcatc 2760

gatcacgtca 2770

<210> 10

<211> 1839

<212> DNA

<213>It is artificial synthesized

<400> 10

aaccgtctct tcgtgagaat aaccgtggcc taaaaataag ccgatgagga taaataaaat 60

gtggtggtac agtacttcaa gaggtttact catcaagagg atgcttttcc gatgagctct 120

agtagtacat cggacctcac atacctccat tgtggtgaaa tattttgtgc tcatttagtg 180

atgggtaaat tttgtttatg tcactctagg ttttgacatt tcagttttgc cactcttagg 240

ttttgacaaa taatttccat tccgcggcaa aagcaaaaca attttatttt acttttacca 300

ctcttagctt tcacaatgta tcacaaatgc cactctagaa attctgttta tgccacagaa 360

tgtgaaaaaa aacactcact tatttgaagc caaggtgttc atggcatgga aatgtgacat 420

aaagtaacgt tcgtgtataa gaaaaaattg tactcctcgt aacaagagac ggaaacatca 480

tgagacaatc gcgtttggaa ggctttgcat cacctttgga tgatgcgcat gaatggagtc 540

gtctgcttgc tagccttcgc ctaccgccca ctgagtccgg gcggcaacta ccatcggcga 600

acgacccagc tgacctctac cgaccggact tgaatgcgct accttcgtca gcgacgatgg 660

ccgcgtacgc tggcgacgtg cccccgcatg catggcggca catggcgagc tcagaccgtg 720

cgtggctggc tacaaatacg taccccgtga gtgccctagc tagaaactta cacctgcaac 780

tgcgagagcg agcgtgtgag tgtagccgag taatggcctc ctccgagaac gtgatcaccg 840

agttcatgcg cttcaaggtg cgcatggagg gcaccgtgaa cggccacgag ttcgagatcg 900

agggcgaggg cgagggccgc ccctacgagg gccacaacac cgtgaagctg aaggtgacca 960

agggcggccc cctgcccttc gcctgggaca tcctgtcccc ccagttccag tacggctcca 1020

aggtgtacgt taagcacccc gccgacatcc ccgactacaa gaagctgtcc ttccccgagg 1080

gcttcaagtg ggagcgcgtg atgaacttcg aggacggcgg cgtggccacc gtgacccagg 1140

actcctccct gcaggacggc tgcttcatct acaaggtgaa gttcatcggc gtgaacttcc 1200

cctccgacgg ccccgtgatg cagaagaaga ccatgggctg ggaggcctcc accgagcgcc 1260

tgtacccccg cgacggcgtg ctgaagggcg agacccacaa ggccctgaag ctgaaggacg 1320

gcggccacta cctggtggag ttcaagtcca tctacatggc caagaagccc gtgcagctgc 1380

ccggctacta ctacgtggac gccaagctgg acatcacctc ccacaacgag gactacacca 1440

tcgtggagca gtacgagcgc accgagggcc gccaccacct gttcctgtag ttcgaacgcg 1500

taggtaccac atggttaacc tagacttgtc catcttctgg attggccaac ttaattaatg 1560

tatgaaataa aaggatgcac acatagtgac atgctaatca ctataatgtg ggcatcaaag 1620

ttgtgtgtta tgtgtaatta ctagttatct gaataaaaga gaaagagatc atccatattt 1680

cttatcctaa atgaatgtca cgtgtcttta taattctttg atgaaccaga tgcatttcat 1740

taaccaaatc catatacata taaatattaa tcatatataa ttaatatcaa ttgggttagc 1800

aaaacaaatc tagtctaggt gtgttttgcg aatgcggcc 1839

<210> 11

<211> 812

<212> DNA

<213>Barley（Hordeum vulgare）

<400> 11

aaccgtctct tcgtgagaat aaccgtggcc taaaaataag ccgatgagga taaataaaat 60

gtggtggtac agtacttcaa gaggtttact catcaagagg atgcttttcc gatgagctct 120

agtagtacat cggacctcac atacctccat tgtggtgaaa tattttgtgc tcatttagtg 180

atgggtaaat tttgtttatg tcactctagg ttttgacatt tcagttttgc cactcttagg 240

ttttgacaaa taatttccat tccgcggcaa aagcaaaaca attttatttt acttttacca 300

ctcttagctt tcacaatgta tcacaaatgc cactctagaa attctgttta tgccacagaa 360

tgtgaaaaaa aacactcact tatttgaagc caaggtgttc atggcatgga aatgtgacat 420

aaagtaacgt tcgtgtataa gaaaaaattg tactcctcgt aacaagagac ggaaacatca 480

tgagacaatc gcgtttggaa ggctttgcat cacctttgga tgatgcgcat gaatggagtc 540

gtctgcttgc tagccttcgc ctaccgccca ctgagtccgg gcggcaacta ccatcggcga 600

acgacccagc tgacctctac cgaccggact tgaatgcgct accttcgtca gcgacgatgg 660

ccgcgtacgc tggcgacgtg cccccgcatg catggcggca catggcgagc tcagaccgtg 720

cgtggctggc tacaaatacg taccccgtga gtgccctagc tagaaactta cacctgcaac 780

tgcgagagcg agcgtgtgag tgtagccgag ta 812

<210> 12

<211> 678

<212> DNA

<213>Reef coral（Discosoma sp.）

<400> 12

atggcctcct ccgagaacgt gatcaccgag ttcatgcgct tcaaggtgcg catggagggc 60

accgtgaacg gccacgagtt cgagatcgag ggcgagggcg agggccgccc ctacgagggc 120

cacaacaccg tgaagctgaa ggtgaccaag ggcggccccc tgcccttcgc ctgggacatc 180

ctgtcccccc agttccagta cggctccaag gtgtacgtta agcaccccgc cgacatcccc 240

gactacaaga agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag 300

gacggcggcg tggccaccgt gacccaggac tcctccctgc aggacggctg cttcatctac 360

aaggtgaagt tcatcggcgt gaacttcccc tccgacggcc ccgtgatgca gaagaagacc 420

atgggctggg aggcctccac cgagcgcctg tacccccgcg acggcgtgct gaagggcgag 480

acccacaagg ccctgaagct gaaggacggc ggccactacc tggtggagtt caagtccatc 540

tacatggcca agaagcccgt gcagctgccc ggctactact acgtggacgc caagctggac 600

atcacctccc acaacgagga ctacaccatc gtggagcagt acgagcgcac cgagggccgc 660

caccacctgt tcctgtag 678

<210> 13

<211> 678

<212> DNA

<213>Reef coral（Discosoma sp.）

<400> 13

atggcctcct ccgagaacgt catcaccgag ttcatgcgct tcaaggtgcg catggagggc 60

accgtgaacg gccacgagtt cgagatcgag ggcgagggcg agggccgccc ctacgagggc 120

cacaacaccg tgaagctgaa ggtgaccaag ggcggccccc tgcccttcgc ctgggacatc 180

ctgtcccccc agttccagta cggctccaag gtgtacgtga agcaccccgc cgacatcccc 240

gactacaaga agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag 300

gacggcggcg tggcgaccgt gacccaggac tcctccctgc aggacggctg cttcatctac 360

aaggtgaagt tcatcggcgt gaacttcccc tccgacggcc ccgtgatgca gaagaagacc 420

atgggctggg aggcctccac cgagcgcctg tacccccgcg acggcgtgct gaagggcgag 480

acccacaagg ccctgaagct gaaggacggc ggccactacc tggtggagtt caagtccatc 540

tacatggcca agaagcccgt gcagctgccc ggctactact acgtggacgc caagctggac 600

atcacctccc acaacgagga ctacaccatc gtggagcagt acgagcgcac cgagggccgc 660

caccacctgt tcctgtag 678

<210> 14

<211> 318

<212> DNA

<213>Potato（Solanum tuberosum）

<400> 14

agacttgtcc atcttctgga ttggccaact taattaatgt atgaaataaa aggatgcaca 60

catagtgaca tgctaatcac tataatgtgg gcatcaaagt tgtgtgttat gtgtaattac 120

tagttatctg aataaaagag aaagagatca tccatatttc ttatcctaaa tgaatgtcac 180

gtgtctttat aattctttga tgaaccagat gcatttcatt aaccaaatcc atatacatat 240

aaatattaat catatataat taatatcaat tgggttagca aaacaaatct agtctaggtg 300

tgttttgcga atgcggcc 318

<210> 15

<211> 1842

<212> DNA

<213>It is artificial synthesized

<400> 15

gcgatcgcga tctgacaaag cagcattagt ccgttgatcg gtggaagacc actcgtcagt 60

gttgagttga atgtttgatc aataaaatac ggcaatgctg taagggttgt tttttatgcc 120

attgataata cactgtactg ttcagttgtt gaactctatt tcttagccat gccaagtgct 180

tttcttattt tgaataacat tacagcaaaa agttgaaaga caaaaaaaaa aacccccgaa 240

cagagtgctt tgggtcccaa gctactttag actgtgttcg gcgttccccc taaatttctc 300

cccctatatc tcactcactt gtcacatcag cgttctcttt cccctatatc tccacgaggt 360

ggaagacaag gtggtgagga ttgggagggc tacctatggc agggtagtga agaggcaggc 420

aatgagagct ctcttcagac ttacattgga tgctgacagt aacaaaagcc tgtaggtttt 480

gatactcttg attgattgtt tatttagtta cctagtatct tcagtaacag atgagagatt 540

tattcagcaa atgctccggt ttgctcgaag gttgtaataa gagtgtgggc aagaatcaag 600

gtcaatccat aagagcacta ttttcatgct cttctgatct tggtttcaga cttgtttcag 660

tgttgacatt ggttatttct caattcattc gagtatttgt tgttacatca caaaggataa 720

gttctataga aaaaatcttc cttttcaagt gatgttcttt aattttctgt agaattgtgc 780

cctgcaattt ctcaaatctt tgatagatgg cttatttgta ttgactggaa aagaaattag 840

ttgtcaataa ctagaagctt tagagatgca aagtattgga tatatcttgg caatagtatt 900

ttatattgct tgtttatgtg agaatgtttt aactagatgg caactgattt ctgggacaaa 960

atcgcttcta caatagcatt ttatggaact cgtactcgtc gatagcattt cttggatttg 1020

ggtgtttgta aatggcattt cttggatttt ctcttcatta aaatagccta ttcagatgaa 1080

gtagaattca ggtgaagtag aaaccaacta ctttgggttc acaatttata tttcttttga 1140

ggatacccca tttcatttta gttgtcatca aagactagac aatatcgaca gaaaatggta 1200

agcctggttt cagttggtga caatttaaca gaattcagat ggatatggtt ctgatattag 1260

aaggtggcat acctttagtc gctgcaaacg cttcagttat ctgaacaaaa caacgaactt 1320

ggctgagcag gggaaaaaaa tactgtagca ttcattttgt gtttacatga gtaacgattc 1380

ttttctaggt ggacagatca caaaaagaaa actaaagcta agatccaact cctaagggtg 1440

ttaggttagg gacaccatat gaatgagaca atcttaattc ttggtcacac aaagattgtc 1500

tcaaggttgg tagcatcagt gcccaatata tcacctaact atgccatcca aaatgctaca 1560

tagcatctct tgtagactga acccttcatg aagagcccca tggaggaagc tcatgcaatg 1620

ccagtgacat cattcttccc agtagcagga atccacaagc tcatagctat cttccttgtt 1680

gtcctctcat ggatcttggt ccacaagtgg agcctgagga accagaaagg gccaagatca 1740

tggccaatca tcggcgcgac agtggagcaa ctgaagaact accacaggat gcatgactgg 1800

cttgtcgagt acttgtcgaa ggaccgcacc gtgaccgtcg ac 1842

<210> 16

<211> 331

<212> DNA

<213>It is artificial synthesized

<400> 16

cgtcaacatg gtggagcacg acacgcttgt ctactccaaa aatatcaaag atacagtctc 60

agaagaccaa agggcaattg agacttttca acaaagggta atatccggaa acctcctcgg 120

attccattgc ccagctatct gtcactttat tgtgaagata gtggaaaagg aaggtggctc 180

ctacaaatgc catcattgcg ataaaggaaa ggccatcgtt gaagatgcct ctgccgacag 240

tggtcccaaa gatggacccc cacccacgag gagcatcgtg gaaaaagaag acgttccaac 300

cacgtcttca aagcaagtgg attgatgtga t 331

<210> 17

<211> 448

<212> DNA

<213>It is artificial synthesized

<400> 17

gatctgacaa agcagcatta gtccgttgat cggtggaaga ccactcgtca gtgttgagtt 60

gaatgtttga tcaataaaat acggcaatgc tgtaagggtt gttttttatg ccattgataa 120

tacactgtac tgttcagttg ttgaactcta tttcttagcc atgccaagtg cttttcttat 180

tttgaataac attacagcaa aaagttgaaa gacaaaaaaa aaaacccccg aacagagtgc 240

tttgggtccc aagctacttt agactgtgtt cggcgttccc cctaaatttc tccccctata 300

tctcactcac ttgtcacatc agcgttctct ttcccctata tctccacgtc gacgcggcca 360

aatcctgagg atctggtctt cctaaggacc cgggatatcg gacgggggat ccactagttc 420

tagagcggcc gggtaccgag ctcgaatt 448

<210> 18

<211> 59

<212> DNA

<213>Primer

<400> 18

gcaagcttgc atgcctgcag gtcgactcta gaggatctgc accggacact gtctggtgg 59

<210> 19

<211> 2352

<212> DNA

<213>Rice（Oryza sativa）

<400> 19

gtcgaaggac cgcaccgtga ccgtcgacat gcctttcacc tcctacacct acattgccga 60

cccggtgaac gtcgagcatg tcctgaagac caacttcacc aattacccca aggtaaaaga 120

accataggat cttcagtgta ctgtaaaatg tgccttgcac agtactaaca ctgacacaaa 180

aaatgtctga aaatatgcag ggtgaagtgt acaggtctta catggatgtg ctgctcggtg 240

atggcatatt caatgccgac ggcgagatgt ggaggaagca aaggaagacg gcgagcttcg 300

agtttgcctc caagaacttg agagacttca gcactgtggt gttcagggag tactccctga 360

agctatcaag cattctgagc caagcatgca aggccggcag agttgtagac atgcaggtaa 420

ccaactgaat tccttgccta atacctaaac atttcttgag aaaccaaatt gttcagaatt 480

ctgatgcaag aactaaccaa aattcaggaa ttgttcatga ggatgacact ggactcgatc 540

tgcaaggtcg ggtttggggt tgagatcggg acgctgtcac ctgatctccc ggagaacagc 600

tttgcccagg cattcgacgc tgccaacatc atcgtcacgc tgcggttcat cgatcctctg 660

tggcgtctga agaagttctt gcacgtcgga tcagaggctc tcctcgagca gagcatgaag 720

ctggttgatg acttcaccta cagcgtgatc cgccgccgca aggctgagat cttgcaggct 780

cgagccagcg gcaagcaaga gaaggtgatc cttcctctct tgctcaaaga atcagtagaa 840

ctgaactgac atggtaatgg tgatgatcag atcggaaaag gttttgtttc ttgatatcgt 900

tgatttgtaa tggcgagcag atcaagcacg acatactgtc gcggttcatc gagctcgggg 960

aggccggcgg cgacgagggg ggcggcagct tcggggacga caagagcctc cgcgacgtgg 1020

tgctcaactt cgtgatcgcc gggcgtgaca cgacggcgac gacgctgtcg tggttcacgt 1080

acatggcgat gacgcacccg gccgtcgccg acaagctccg gcgcgagctg gccgcgttcg 1140

aggatgagcg cgcgcgcgag gagggcgtcg cgctcgccga cgccgccggc gaggcgtcgt 1200

tcgcggcgcg cgtggcgcag ttcgcgtcgc tgctgagcta cgacgcggtg gggaagctgg 1260

tgtacctgca cgcgtgcgtg acggagacgc tccgcctcta cccggcggtg ccgcaggacc 1320

ccaaggggat cgtggaggac gacgtgctcc ccgacggcac caaggtgcgc gccggcggga 1380

tggtgacgta cgtgccctac tccatgggga ggatggagta caactggggc cccgacgcgg 1440

cgagcttccg gccggagcgg tggctcagcg gcgacggcgg cgcgttccgg aacgcgtcgc 1500

cgttcaagtt caccgcgttc caggccgggc cgcggatctg cctcggcaag gactccgcct 1560

acctccagat gaagatggcg ctcgccatcc tcttccgctt ctacaccttc gacctcgtcg 1620

aggaccaccc cgtcaagtac cggatgatga ccatcctctc catggctcac ggcctcaagg 1680

tccgcgtctc cacctccgtc tgacccccgc cgccgctcgc cggcagccgc gccgccgccg 1740

cccgtatcgc ttaccggagt agtaaataag cctatgtaat ctggtttgaa tttgaaattt 1800

gaatgtacca tgtttgattc taggatttgt tggtcctaga ccctgcttga aacggtgcga 1860

atttcatcta aatggttgag aaattttatc gaaagctgtt ccattctacg ctacaaatgg 1920

tgggactgga tttaaacatt ggcgacgtgg acaaggccgt atcaccatgt ttgcacattt 1980

ttaaacctgt aatctggttt gaatttgaat gtaccatgac accatgtttg caaaacttta 2040

catgaatgtt tgagaaaaaa tatggagaac tgttcaatta gtatgcgttt aaaatgggac 2100

tggatttaaa cattggcgac gtggacaagg ctagtggact gagactctga gatgttgcgg 2160

aagtcgggga cgcagcggcg gcagccgccg gcgtggcggc ggtgccggag cctgcgacac 2220

atcaagcaga tgcacgcggt gatggcgctc cggggcttcc tctccgatcc ctccgagctc 2280

cgcgagctcc ttttcgcctc cgccgtcgcg gtccgcggcg ccatcgcgca cgcctacctc 2340

gtgttcgacc aa 2352

<210> 20

<211> 1486

<212> DNA

<213>Rice（Oryza sativa）

<400> 20

aggtggaaga caaggtggtg aggattggga gggctaccta tggcagggta gtgaagaggc 60

aggcaatgag agctctcttc agacttacat tggatgctga cagtaacaaa agcctgtagg 120

ttttgatact cttgattgat tgtttattta gttacctagt atcttcagta acagatgaga 180

gatttattca gcaaatgctc cggtttgctc gaaggttgta ataagagtgt gggcaagaat 240

caaggtcaat ccataagagc actattttca tgctcttctg atcttggttt cagacttgtt 300

tcagtgttga cattggttat ttctcaattc attcgagtat ttgttgttac atcacaaagg 360

ataagttcta tagaaaaaat cttccttttc aagtgatgtt ctttaatttt ctgtagaatt 420

gtgccctgca atttctcaaa tctttgatag atggcttatt tgtattgact ggaaaagaaa 480

ttagttgtca ataactagaa gctttagaga tgcaaagtat tggatatatc ttggcaatag 540

tattttatat tgcttgttta tgtgagaatg ttttaactag atggcaactg atttctggga 600

caaaatcgct tctacaatag cattttatgg aactcgtact cgtcgatagc atttcttgga 660

tttgggtgtt tgtaaatggc atttcttgga ttttctcttc attaaaatag cctattcaga 720

tgaagtagaa ttcaggtgaa gtagaaacca actactttgg gttcacaatt tatatttctt 780

ttgaggatac cccatttcat tttagttgtc atcaaagact agacaatatc gacagaaaat 840

ggtaagcctg gtttcagttg gtgacaattt aacagaattc agatggatat ggttctgata 900

ttagaaggtg gcataccttt agtcgctgca aacgcttcag ttatctgaac aaaacaacga 960

acttggctga gcaggggaaa aaaatactgt agcattcatt ttgtgtttac atgagtaacg 1020

attcttttct aggtggacag atcacaaaaa gaaaactaaa gctaagatcc aactcctaag 1080

ggtgttaggt tagggacacc atatgaatga gacaatctta attcttggtc acacaaagat 1140

tgtctcaagg ttggtagcat cagtgcccaa tatatcacct aactatgcca tccaaaatgc 1200

tacatagcat ctcttgtaga ctgaaccctt catgaagagc cccatggagg aagctcatgc 1260

aatgccagtg acatcattct tcccagtagc aggaatccac aagctcatag ctatcttcct 1320

tgttgtcctc tcatggatct tggtccacaa gtggagcctg aggaaccaga aagggccaag 1380

atcatggcca atcatcggcg cgacagtgga gcaactgaag aactaccaca ggatgcatga 1440

ctggcttgtc gagtacttgt cgaaggaccg caccgtgacc gtcgac 1486

<210> 21

<211> 59

<212> DNA

<213>Artificial synthesized primer

<400> 21

ttaagcttgc atgcctgcag gtcgactcta gaggatctgc accggacact gtctggtgg 59

<210> 22

<211> 35

<212> DNA

<213>Artificial synthesized primer

<400> 22

atgcggccgc tatgacgtga tcgatgcttt attcg 35

<210> 23

<211> 55

<212> DNA

<213>Artificial synthesized primer

<400> 23

ttgcggccgc atggacaaca agccggcgca agaacgccgc gaaacctggg tgccg 55

<210> 24

<211> 37

<212> DNA

<213>Artificial synthesized primer

<400> 24

tcgcgatcgc tcatctcgag atatatatca ctagtag 37

<210> 25

<211> 35

<212> DNA

<213>Artificial synthesized primer

<400> 25

gagcgatcgc gatctgacaa agcagcatta gtccg 35

<210> 26

<211> 33

<212> DNA

<213>Artificial synthesized primer

<400> 26

gtagatctcg tggagatata ggggaaagag aac 33

<210> 27

<211> 59

<212> DNA

<213>Artificial synthesized primer

<400> 27

gcaagcttgc atgcctgcag gtcgactcta gaggatctgc accggacact gtctggtgg 59

<210> 28

<211> 35

<212> DNA

<213>Primer

<400> 28

atgcggccgc tatgacgtga tcgatgcttt attcg 35

<210> 29

<211> 35

<212> DNA

<213>Primer

<400> 29

tagcggccgc atggacaaca agccggcgca agaac 35

<210> 30

<211> 60

<212> DNA

<213>Primer

<400> 30

aaggatccag gcgcgccgaa tcctgcgatc gctcatctcg agatatatat cactagtagt 60

<210> 31

<211> 35

<212> DNA

<213>Primer

<400> 31

taggcgcgcc aaccgtctct tcgtgagaat aaccg 35

<210> 32

<211> 33

<212> DNA

<213>Primer

<400> 32

cttgccggcc gcattcgcaa aacacaccta gac 33

<210> 33

<211> 30

<212> DNA

<213>Primer

<400> 33

tcgaaggacc gcaccgtgac cgtcgacatg 30

<210> 34

<211> 40

<212> DNA

<213>Primer

<400> 34

cgggcgcgcc tcgcgattgg tcgaacacga ggtaggcgtg 40

<210> 35

<211> 35

<212> DNA

<213>Primer

<400> 35

gagcgatcgc gatctgacaa agcagcatta gtccg 35

<210> 36

<211> 30

<212> DNA

<213>Primer

<400> 36

catgtcgacg gtcacggtgc ggtccttcga 30

<210> 37

<211> 34

<212> DNA

<213>Primer

<400> 37

ttggcgcgcc atcacatcaa tccacttgct ttga 34

<210> 38

<211> 34

<212> DNA

<213>Primer

<400> 38

gaggcgcgcc cgtcaacatg gtggagcacg acac 34

Claims (25)

1. it is a kind of make pollen inactivate method, the method by the way that pollen activity controlling gene is overexpressed in pollen, To make pollen reduce or lose vigor, which is characterized in that the coding of the pollen activity controlling gene used in the method Region nucleotide sequence is selected from following group of one of sequence：

A) encoding amino acid sequence such as SEQ ID NO:Nucleotide sequence shown in 3；

B) its nucleotide sequence such as SEQ ID NO:Nucleotide sequence shown in 2.

2. method described in claim 1, wherein the pollen activity controlling gene is opened by what a pollen specific was expressed Mover driving expression.

3. the method described in claim 2, wherein the nucleotide sequence such as SEQ of the promoter of the pollen specific expression ID NO:Shown in 9.

4. any method of claim 2-3, wherein the pollen activity controlling gene also connects there are one terminator, The nucleotide sequence of the terminator such as SEQ ID NO:Shown in 17.

5. a kind of method for restoring male sterile plants fertility, the method includes：It is prominent with rice homozygous recessive kernel male sterile Variant is transformation receptor material, is transferred to the construct containing restoring gene, pollen inactivated gene and riddled basins, makes The malesterile mutants for being transferred to the construct restore fertility, can generate fertile males gamete, it is characterised in that institute The nucleotide sequence for stating pollen inactivated gene included in construct is selected from following group of one of sequence：

A) encoding amino acid sequence such as SEQ ID NO:Nucleotide sequence shown in 3；

B) its nucleotide sequence such as SEQ ID NO:Nucleotide sequence shown in 2.

6. the method described in claim 5, wherein the promoter that the pollen inactivated gene is expressed by a pollen specific Driving expression.

7. the method described in claim 5, wherein the nucleotide sequence such as SEQ of the promoter of the pollen specific expression ID NO:Shown in 9.

8. any method of claim 5-7, wherein the pollen inactivated gene also connects, there are one terminators, described The nucleotide sequence of terminator such as SEQ ID NO:Shown in 17.

9. the method described in claim 5, wherein the rice homozygous recessive kernel male sterile mutant includes but not limited to MSP1、PAIR1、PAIR2、ZEP1、MELL、PSS1、TDR、UDT1、GAMYB4、PTC1、API5、WDA1、Ms26、DPW、 It is formed by mutant after the mutation of MADS3, AID1, MS2 fertility-related gene.

10. the method described in claim 5, wherein the rice homozygous recessive kernel male sterile mutant is since fertility is extensive Multiple genes such as SEQ ID NO:Caused by the biological function missing of nucleotide sequence shown in 4.

11. the method described in claim 5, wherein the riddled basins are selected from red fluorescent gene, hanced cyan fluorescent egg White gene, yellow fluorescent protein gene, luciferase gene, green fluorescence protein gene, anthocyanin p1 genes and glufosinate second At least one of acyltransferase encoding gene.

12. the method described in claim 11, wherein the nucleotide sequence such as SEQ ID NO of the red fluorescent gene:12 It is shown.

13. the method described in claim 12, wherein the red fluorescent gene connects there are one promoter, the promoter Nucleotide sequence such as SEQ ID NO:Shown in 11.

14. the method described in claim 13, wherein 5 ' ends of the promoter also connect, there are one enhancer sequence, the increasings The nucleotide sequence of hadron such as SEQ ID NO:Shown in 16.

15. the method described in claim 13, wherein the red fluorescent gene also connects, there are one terminator, the terminators Nucleotide sequence such as SEQ ID NO:Shown in 14.

16. a kind of propagation method of rice core recessiveness male sterile line is to turn with rice homozygous recessive kernel male sterile mutant Change acceptor material, is transferred to the construct containing restoring gene, pollen inactivated gene and riddled basins, makes to be transferred to institute The seed of rice core recessiveness male sterile line can be generated by stating the malesterile mutants of construct, i.e. the mutant can generate Fertile males gamete simultaneously realizes self-reproduction, it is characterised in that the nucleotide of pollen inactivated gene included in the construct Sequence is selected from following group of one of sequence：

A) encoding amino acid sequence such as SEQ ID NO:Nucleotide sequence shown in 3；

B) its nucleotide sequence such as SEQ ID NO:Nucleotide sequence shown in 2.

17. the propagation method of claim 16, wherein the rice homozygous recessive kernel male sterile mutant includes But be not limited to MSP1, PAIR1, PAIR2, ZEP1, MELL, PSS1, TDR, UDT1, GAMYB4, PTC1, API5, WDA1, Ms26, It is formed by mutant after the mutation of DPW, MADS3, AID1, MS2 fertility-related gene.

18. the method described in claim 16, wherein the startup that the pollen inactivated gene is expressed by a pollen specific Son driving expression.

19. method of claim 18, wherein the nucleotide sequence such as SEQ of the promoter of the pollen specific expression ID NO:Shown in 9.

20. any method of claim 16-19, wherein the pollen inactivated gene also connects there are one terminator, The nucleotide sequence of the terminator such as SEQ ID NO:Shown in 17.

21. the method described in claim 16, wherein the riddled basins are selected from red fluorescent gene, hanced cyan fluorescent egg White gene, yellow fluorescent protein gene, luciferase gene, green fluorescence protein gene, anthocyanin p1 genes and glufosinate second At least one of acyltransferase encoding gene.

22. the method described in claim 21, wherein the nucleotide sequence such as SEQ ID NO of the red fluorescent gene:12 It is shown.

23. the method described in claim 22, wherein the red fluorescent gene connects there are one promoter, the promoter Nucleotide sequence such as SEQ ID NO:Shown in 11.

24. right wants the method described in 23, wherein 5 ' ends of the promoter also connect, there are one enhancer sequence, the enhancings The nucleotide sequence such as SEQ ID NO of son:Shown in 16.

25. the method described in claim 22, wherein the red fluorescent gene also connects, there are one terminator, the terminators Nucleotide sequence such as SEQ ID NO:Shown in 14.