CN103068849B

CN103068849B - Anti-Bv8 antibody and uses thereof

Info

Publication number: CN103068849B
Application number: CN201080064579.8A
Authority: CN
Inventors: X.吴; L.俞; W-C.梁; Y-J.G.孟; J.蒂恩; 吴雁; N.费拉拉
Original assignee: F Hoffmann La Roche AG
Current assignee: F Hoffmann La Roche AG
Priority date: 2009-12-23
Filing date: 2010-12-22
Publication date: 2016-04-06
Anticipated expiration: 2030-12-22
Also published as: RU2559542C2; WO2011079185A1; CA2784385A1; ZA201204373B; IL220536A0; EP2516465A1; HK1178917A1; US9266948B2; IL220536A; NZ600826A; CN103068849A; DK2516465T3; SG181905A1; HUE027713T2; US8771685B2; US20120014941A1; RU2012131411A; JP2013515485A; AU2010336485A1; US20140377860A1

Abstract

The present invention pays close attention to the antibody and uses thereof for Bv8.

Description

Anti-Bv8 antibody and uses thereof

Related application

The application is according to 37CFR1.53(b) (1) non-provisional application of submitting to, according to 35USC119(e) require the provisional application No.61/284 that on December 23rd, 2009 submits to, the provisional application No.61/414 that on November 16th, 743 and 2010 submits to, the right of priority of 052, by addressing by its content income herein.

Invention field

Generally speaking, the present invention relates to biology field.More specifically, the present invention pays close attention to anti-Bv8 antibody and uses thereof.

Background of invention

Establish now the pathogeny relating to the blood vessel generation participation various disease conditions forming neovascularity from existing endothelium completely.These comprise solid tumor and transfer, atherosclerosis, Terry's sign, vascular tumor, chronic inflammatory diseases, the immunological rejection of intraocular neovascularity syndrome such as proliferating retinopathy such as diabetic retinopathy, senile macular degeneration SMD (AMD), neovascular glaucoma, corneal transplant tissue and other tissue, rheumatoid arthritis and psoriatic.Folkmanetal., J.Biol.Chem., 267:10931-10934 (1992); Klagsbrunetal., Annu.Rev.Physiol., 53:217-239 (1991); And GarnerA., " Vasculardiseases ", In:PathobiologyofOcularDisease.ADynamicApproach, GarnerA., KlintworthGK, eds., 2ndEdition (MarcelDekker, NY, 1994), pp1625-1710.

When tumor growth, blood vessel occur for from hyperplasia to neoplastic conversion, and provide nutrition seemingly vital for the growth of tumour and transfer.Folkmanetal.,Nature,339:58(1989)。Neovascularization (neovascularization) allows tumour cell obtain the growth vigor compared with normal cell and to breed autonomous.Tumour starts from single abnormal cells usually, due to the distance that can utilize capillary bed, this cell can only breed the size to several cubic millimeters, and it can keep " dormancy " state and not further growth and propagation in long period of time.Then some tumour cell turns to angiogenic phenotype to activate endotheliocyte, described endothelial cell proliferation the capillary vessel becoming maturation new.The blood vessel of these new formation not only allows primary tumor continued growth, and allows metastatic cancer cell propagate and to build group (recolonization) again.Thus, observed dependency between the patients survive of the microvessel density in tumor biopsy and mammary cancer and several other tumours.Weidneretal.,N.Engl.J.Med,324:1-6(1991);Horaketal.,Lancet,340:1120-1124(1992);Macchiarinietal.,Lancet,340:145-146(1992)。Understand the precise mechanism controlling blood vessel and change not yet completely, but think that the neovascularization of tumor mass is derived from the clean balance (Folkman, 1995, NatMed1 (1): 27-31) of numerous angiogenic stimulators and inhibition.

Vascular development is subject to tight adjustment.Up to now, different kinds of molecules, mostly is the secretion sex factor generated by peripheral cell, has demonstrated and has regulated EC to break up, breed, move and be bonded into rope spline structure.Such as, vascular endothelial growth factor (VEGF) has been accredited as the key factor relating to and stimulate blood vessel generation and induction of vascular permeability.Ferraraetal.,Endocr.Rev.,18:4-25(1997)。The allelic loss of even single VEGF causes the discovery of embryonic death to point to the not replaceable effect that plays in the growth of vascular system and differentiation of this factor.In addition, VEGF has been shown as the key mediator of the neovascularization relevant with tumour and intra-ocular disorders.Ferraraetal., Endocr.Rev., sees above.Process LAN in people's tumour that VEGFmRNA checks at majority.Berkmanetal.,J.Clin.Invest.,91:153-159(1993);Brownetal.,HumanPathol.,26:86-91(1995);Brownetal.,CancerRes.,53:4727-4735(1993);Matternetal.,Brit.J.Cancer，73:931-934(1996);Dvoraketal.,Am.J.Pathol.,146:1029-1039(1995)。

The propagation of Bv8 induction suprarenal gland cortical capillaries endotheliocyte, survival and migration (LeCouter, J.etal., ProcNatlAcadSciUSA100,2685-2690 (2003)) are shown.Bv8 and EG-VEGF is the secretory protein of two kinds of height correlations; also referred to as prokineticin-1 and-2; they structurally belong to the larger peptide classification (DeCouter of of being limited by five disulphide bridges motifs (being called colipase/colipase to fold); J.etal.; Nature420,860-867 (2002); LeCouter, J.etal., ProcNatlAcadSciUSA100,2685-2690 (2003); Li, M.etal., MolPharmacol59,692-698 (2001)).Bv8 is accredited as the secretory protein (Mollay, C.etal., EurJPharmacol374,189-196 (1999)) from frog Bombinavariegate skin at first.The cloning and expressing of Bv8 is recorded in the WO03/020892 announced on March 13rd, 2003.Bv8 and EG-VEGF is in conjunction with the g protein coupled receptor (GPCR) of two kinds of height correlations; EG-VEGF/PKR-1 (R1) and EG-VEGF/PKR-2 (R2) (Masuda; Yetal.; BiochemBiophysResCommun293,496-402 (2002); Lin, D.C.etal., JBiolChem277,19276-19280 (2002)).EG-VEGF and Bv8 is characterized as being specific endothelial cell types optionally mitogen (LeCouter, J.etal., Nature412 (6850): 877-84 (2001); LeCouter, J.etal., ProcNatlAcadSciUSA100,2685-2690 (2003)).Other activity is attributed to this family, comprises nociception (Mollay, C.etal., see above), the adjustment (Cheng of gastrointestinal movement (Li, M.etal. see above), the diel rhythm motion rhythm and pace of moving things, M.Y., etal., Nature417,405-410 (2002)) and olfactory bulb nerve generation (Matsumoto, S., etal., ProcNatlAcadSciUSA103,4140-4145 (2006)).In addition, Bv8 stimulate in vitro granulocyte and monocyte colony generation (LeCouter, J.etal., (2003), see above; Dorsch, M.etal., J.LeukocBiol78 (2), 426-34 (2005)).Bv8 has been characterized as being the chemoattractant (LeCouteretal., ProcNatlAcadSciUSA101,16813-16919 (2004)) of scavenger cell.

In view of blood vessel occurs in the effect in numerous disease and illness, wish reduce or suppress one or more to cause the means of the biological effect of these processes.Completely including all reference quoted herein by addressing, comprising patent application and publication.

Summary of the invention

Part of the present invention is based on the multiple antibody for Bv8.Bv8 as a kind of important and favourable therapeutic target, and the invention provides antibody, as therapeutical agent and diagnostic reagent, to express and/or in active relevant pathological condition for target with Bv8.Thus, the invention provides the method, composition, test kit and the goods that relate to Bv8.

In certain embodiments, provide the antibody in conjunction with Bv8 or its fragment, wherein said antibody comprises variable domain, this variable domain comprise at least one, two kinds, three kinds, four kinds, five kinds or six kinds be selected from hypervariable region (HVR) sequence of lower group:

I () comprises KASQSX ₁x ₂yX ₃x ₄x ₅the HVR-L1 of SYMN, wherein X ₁for L or V; X ₂for D or I; X ₃for D, F, G, S, W or Y; X ₄for A, G, H or V; And X ₅for D, E or Y;

(ii) AASX is comprised ₁x ₂eX ₃hVR-L2, wherein X ₁for N or Y; X ₂for L or R; And X ₃for S or T;

(iii) HVR-L3 of QQINEDPFT is comprised;

(iv) GYX is comprised ₁x ₂x ₃x ₄the HVR-H1 of YDMH, wherein X ₁for S or T; X ₂for F or L; X ₃for F, M, P, T or V; X ₄for D, E, H, I or N;

V () comprises YIX ₁x ₂yX ₃gX ₄tX ₅the HVR-H2 of YNQKFKG, wherein X ₁for H, S or T; X ₂for C, S or T; X ₃for A, L, N, S or T; X ₄for A, E or S; X ₅for I, L, S or T; With

(vi) DX is comprised ₁the HVR-H3 of NYGEAYAMDY, wherein X ₁for G or S.

In certain embodiments, this anti-Bv8 antibody comprises following three kinds of HVR sequences:

(ii) AASX is comprised ₁x ₂eX ₃hVR-L2, wherein X ₁for N or Y; X ₂for L or R; And X ₃for S or T; With

(iii) HVR-L3 of QQINEDPFT is comprised; And

People VL card handkerchief subgroup IV has Frame sequence SEQIDNO:240.

I () comprises GYX ₁x ₂x ₃x ₄the HVR-H1 of YDMH, wherein X ₁for S or T; X ₂for F or L; X ₃for F, M, P, T or V; X ₄for D, E, H, I or N;

(ii) YIX is comprised ₁x ₂yX ₃gX ₄tX ₅the HVR-H2 of YNQKFKG, wherein X ₁for H, S or T; X ₂for C, S or T; X ₃for A, L, N, S or T; X ₄for A, E or S; X ₅for I, L, S or T; With

(iii) DX is comprised ₁the HVR-H3 of NYGEAYAMDY, wherein X ₁for G or S; And

People VH subgroup I has Frame sequence SEQIDNO:241.

In certain embodiments, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises variable domain, and this variable domain comprises following six kinds of HVR sequences:

(iii) HVR-L3 of QQINEDPFT is comprised;

V () comprises YIX ₁x ₂yX ₃gX ₄the HVR-H2 of TX5YNQKFKG, wherein X ₁for H, S or T; X ₂for C, S or T; X ₃for A, L, N, S or T; X ₄for A, E or S; X ₅for I, L, S or T; With

(vi) DX is comprised ₁the HVR-H3 of NYGEAYAMDY, wherein X ₁for G or S.

In certain embodiments, this anti-Bv8 antibody comprises sudden change further at VL position 28 and 29 one or both of place compared with mouse/inosculating antibody Bv8 antibody.In certain embodiments, this anti-Bv8 antibody comprises sudden change further at 52a place, VH position compared with mouse/inosculating antibody Bv8 antibody.In certain embodiments, this anti-Bv8 antibody comprises sudden change further at VH position 54 place compared with mouse/inosculating antibody Bv8 antibody.In certain embodiments, this anti-Bv8 antibody comprises sudden change further at VH position 95 and 96 one or both of place compared with mouse/inosculating antibody Bv8 antibody.In certain embodiments, this anti-Bv8 antibody compared with mouse/inosculating antibody Bv8 antibody (1) at VL position 28 and 29 one or both of place; And/or (2) are at 52a place, VH position; And/or (3) are at VH position 54 place; And/or (4) comprise sudden change further at VH position 95 and 96 one or both of place.In certain embodiments, this anti-Bv8 antibody comprises further at VH position 96 place and to suddenly change and at VH position 95 place containing suddenling change compared with mouse/inosculating antibody Bv8 antibody.

In certain embodiments, provide and in conjunction with the antibody of Bv8 or its fragment be, wherein HVR-L1 comprises and is selected from SEQIDNO:49, 55, 61, 67, 73, 79, 85, 91, 97, 103, 109, 115, 121, 127, 133, 139, the aminoacid sequence of 145 and 151, HVR-L2 comprises and is selected from SEQIDNO:50, 56, 62, 68, 74, 80, 86, 92, 98, 104, 110, 116, 122, 128, 134, 140, the aminoacid sequence of 146 and 152, HVR-L3 comprises and is selected from SEQIDNO:51, 57, 63, 69, 75, 81, 87, 93, 99, 105, 111, 117, 123, 129, 135, 141, the aminoacid sequence of 147 and 153, HVR-H1 comprises and is selected from SEQIDNO:52, 58, 64, 70, 76, 82, 88, 94, 100, 106, 112, 118, 124, 130, 136, 142, the aminoacid sequence of 148 and 154, HVR-H2 comprises and is selected from SEQIDNO:53, 59, 65, 71, 77, 83, 89, 95, 101, 107, 113, 119, 125, 131, 137, 143, the aminoacid sequence of 149 and 155, and HVR-H3 comprises and is selected from SEQIDNO:54, 60, 66, 72, 78, 84, 90, 96, 102, 108, 114, 120, 126, 132, 138, 144, the aminoacid sequence of 150 and 156.

In certain embodiments, this anti-Bv8 antibody comprises people VL card handkerchief subgroup IV further and has Frame sequence.In certain embodiments, this anti-Bv8 antibody comprises people VH subgroup I further and has Frame sequence.In certain embodiments, this anti-Bv8 antibody comprises people VL card handkerchief subgroup IV further and has Frame sequence and people VH subgroup I has Frame sequence.In certain embodiments, people VL card handkerchief subgroup IV has Frame sequence to deduct three light chain HVR sequences is SEQIDNO:240.In certain embodiments, VH subgroup I has Frame sequence to deduct three heavy chain HVR sequences is SEQIDNO:241.

In certain embodiments, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises variable domain, this variable domain comprise at least one, two kinds, three kinds, four kinds, five kinds or six kinds be selected from hypervariable region (HVR) sequence of lower group:

I () comprises KASQSX ₁x ₂yX ₃x ₄x ₅the HVR-L1 of SYMN, wherein X ₁for L or V; X ₂for D or I; X ₃for F, G, S, W or Y; X ₄for A, G, H or V; And X ₅for D, E or Y;

(iii) HVR-L3 of QQINEDPFT is comprised;

V () comprises YIX ₁x ₂yX ₃gX ₄tX ₅the HVR-H2 of YNQKFKG, wherein X ₁for H, S or T; X ₂for S or T; X ₃for A, L, S or T; X ₄for A, E or S; X ₅for I, L, S or T; With

(vi) HVR-H3 of DSNYGEAYAMDY is comprised.

(iii) HVR-L3 of QQINEDPFT is comprised; And

People VL card handkerchief subgroup IV has Frame sequence SEQIDNO:240.

(ii) YIX is comprised ₁x ₂yX ₃gX ₄tX ₅the HVR-H2 of YNQKFKG, wherein X ₁for H, S or T; X ₂for S or T; X ₃for A, L, S or T; X ₄for A, E or S; X ₅for I, L, S or T; With

(iii) HVR-H3 of DSNYGEAYAMDY is comprised; And

People VH subgroup I has Frame sequence SEQIDNO:241.

(iii) HVR-L3 of QQINEDPFT is comprised;

V () comprises YIX ₁x ₂yX ₃gX ₄the HVR-H2 of TX5YNQKFKG, wherein X ₁for H, S or T; X ₂for S or T; X ₃for A, L, S or T; X ₄for A, E or S; X ₅for I, L, S or T; With

(vi) HVR-H3 of DSNYGEAYAMDY is comprised.

In certain embodiments, provide the antibody in conjunction with Bv8 or its fragment, wherein HVR-L1 comprises and is selected from SEQIDNO:55, 61, 67, 73, 79, 85, 91, 97, 103, 109, 115, 121, 127, 133, 139, the aminoacid sequence of 145 and 151, HVR-L2 comprises and is selected from SEQIDNO:56, 62, 68, 74, 80, 86, 92, 98, 104, 110, 116, 122, 128, 134, 140, the aminoacid sequence of 146 and 152, HVR-L3 comprises and is selected from SEQIDNO:57, 63, 69, 75, 81, 87, 93, 99, 105, 111, 117, 123, 129, 135, 141, the aminoacid sequence of 147 and 153, HVR-H1 comprises and is selected from SEQIDNO:58, 64, 70, 76, 82, 88, 94, 100, 106, 112, 118, 124, 130, 136, 142, the aminoacid sequence of 148 and 154, HVR-H2 comprises and is selected from SEQIDNO:59, 65, 71, 77, 83, 89, 95, 101, 107, 113, 119, 125, 131, 137, 143, the aminoacid sequence of 149 and 155, and HVR-H3 comprises and is selected from SEQIDNO:60, 66, 72, 78, 84, 90, 96, 102, 108, 114, 120, 126, 132, 138, 144, the aminoacid sequence of 150 and 156.

In another embodiment, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises:

(1) HVR-H1 of aminoacid sequence SEQIDNO:61 is comprised;

(2) HVR-H2 of aminoacid sequence SEQIDNO:62 is comprised;

(3) HVR-H3 of aminoacid sequence SEQIDNO:63 is comprised;

(4) HVR-L1 of aminoacid sequence SEQIDNO:64 is comprised;

(5) HVR-L2 of aminoacid sequence SEQIDNO:65 is comprised; With

(6) HVR-L3 of aminoacid sequence SEQIDNO:66 is comprised.

(1) HVR-H1 of aminoacid sequence SEQIDNO:85 is comprised;

(2) HVR-H2 of aminoacid sequence SEQIDNO:86 is comprised;

(3) HVR-H3 of aminoacid sequence SEQIDNO:87 is comprised;

(4) HVR-L1 of aminoacid sequence SEQIDNO:88 is comprised;

(5) HVR-L2 of aminoacid sequence SEQIDNO:89 is comprised; With

(6) HVR-L3 of aminoacid sequence SEQIDNO:90 is comprised.

(1) HVR-H1 of aminoacid sequence SEQIDNO:91 is comprised;

(2) HVR-H2 of aminoacid sequence SEQIDNO:92 is comprised;

(3) HVR-H3 of aminoacid sequence SEQIDNO:93 is comprised;

(4) HVR-L1 of aminoacid sequence SEQIDNO:94 is comprised;

(5) HVR-L2 of aminoacid sequence SEQIDNO:95 is comprised; With

(6) HVR-L3 of aminoacid sequence SEQIDNO:96 is comprised.

(1) HVR-H1 of aminoacid sequence SEQIDNO:121 is comprised;

(2) HVR-H2 of aminoacid sequence SEQIDNO:122 is comprised;

(3) HVR-H3 of aminoacid sequence SEQIDNO:123 is comprised;

(4) HVR-L1 of aminoacid sequence SEQIDNO:124 is comprised;

(5) HVR-L2 of aminoacid sequence SEQIDNO:125 is comprised; With

(6) HVR-L3 of aminoacid sequence SEQIDNO:126 is comprised.

In one embodiment, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises light-chain variable domain and heavy chain variable domain, and this light-chain variable domain comprises SEQIDNO:7, and this heavy chain variable domain comprises SEQIDNO:8.

In another embodiment, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises light-chain variable domain and heavy chain variable domain, and this light-chain variable domain comprises SEQIDNO:9, and this heavy chain variable domain comprises SEQIDNO:10.

In another embodiment, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises light-chain variable domain and heavy chain variable domain, and this light-chain variable domain comprises SEQIDNO:11, and this heavy chain variable domain comprises SEQIDNO:12.

In another embodiment, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises light-chain variable domain and heavy chain variable domain, and this light-chain variable domain comprises SEQIDNO:13, and this heavy chain variable domain comprises SEQIDNO:14.

In certain embodiments, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprise be selected from SEQIDNO:3,5,7,9,11, the aminoacid sequence of 13 and 15 has the light-chain variable domain of at least 90% sequence iden.

In certain embodiments, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises light-chain variable domain, this light-chain variable domain comprise be selected from SEQIDNO:3,5,7,9,11, the aminoacid sequence of 13 and 15.

In one embodiment, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises light-chain variable domain, and this light-chain variable domain comprises aminoacid sequence SEQIDNO:7.

In another embodiment, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises light-chain variable domain, and this light-chain variable domain comprises aminoacid sequence SEQIDNO:9.

In another embodiment, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises light-chain variable domain, and this light-chain variable domain comprises aminoacid sequence SEQIDNO:11.

In another embodiment, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises light-chain variable domain, and this light-chain variable domain comprises aminoacid sequence SEQIDNO:13.

In certain embodiments, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprise be selected from SEQIDNO:4,6,8,10,12, the aminoacid sequence of 14 and 16 has the heavy chain variable domain of at least 90% sequence iden.

In certain embodiments, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises heavy chain variable domain, this heavy chain variable domain comprise be selected from SEQIDNO:4,6,8,10,12, the aminoacid sequence of 14 and 16.

In one embodiment, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises heavy chain variable domain, and this heavy chain variable domain comprises aminoacid sequence SEQIDNO:8.

In another embodiment, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises heavy chain variable domain, and this heavy chain variable domain comprises aminoacid sequence SEQIDNO:10.

In another embodiment, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises heavy chain variable domain, and this heavy chain variable domain comprises aminoacid sequence SEQIDNO:12.

In another embodiment, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises heavy chain variable domain, and this heavy chain variable domain comprises aminoacid sequence SEQIDNO:14.

In certain embodiments, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprise be selected from SEQIDNO:3,5,7,9,11, the aminoacid sequence of 13 and 15 have at least 90% sequence iden light-chain variable domain and be selected from SEQIDNO:4,6,8,10,12, the aminoacid sequence of 14 and 16 has the heavy chain variable domain of at least 90% sequence iden.In certain embodiments, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises light-chain variable domain and heavy chain variable domain, this light-chain variable domain comprise be selected from SEQIDNO:3,5,7,9,11, the aminoacid sequence of 13 and 15, this heavy chain variable domain comprise be selected from SEQIDNO:4,6,8,10,12, the aminoacid sequence of 14 and 16.

In certain embodiments, provide the antibody in conjunction with Bv8 or its fragment, wherein this anti-Bv8 antibody is to be less than the Kd value of 0.02nM in conjunction with people Bv8.

In certain embodiments, provide the antibody in conjunction with Bv8 or its fragment, wherein this anti-Bv8 antibody with the Kd value of about 0.01nM or less in conjunction with people Bv8.

In certain embodiments, provide the antibody in conjunction with Bv8 or its fragment, wherein the tightness degree of this anti-Bv8 antibodies people Bv8 is than chimeric 2G9 anti-Bv8 antibody height at least twice.In certain embodiments, provide the antibody in conjunction with Bv8 or its fragment, wherein the tightness degree of this anti-Bv8 antibodies people Bv8 is than chimeric 2G9 anti-Bv8 antibody height at least five times.

In certain embodiments, Kd value uses surperficial plasmon resonance assays to measure.In certain embodiments, Kd value uses the anti-Bv8 antibody of total length to measure.In certain embodiments, Kd value uses the anti-Bv8 antibody of Fab form to measure.

In certain embodiments, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprise at least one, two kinds, three kinds, four kinds, five kinds or six kinds be selected from hypervariable region (HVR) sequence of lower group:

I () comprises SASSX ₁the HVR-L1 of VFYMH, wherein X ₁for P or S;

(ii) DTSX is comprised ₁the HVR-L2 of LAS, wherein X ₁for K or N;

(iii) QQWSX is comprised ₁x ₂pX ₃the HVR-L3 of T, wherein X ₁for F, S, W or Y; X ₂for D or E; X ₃for I, L or M;

(iv) GFX is comprised ₁x ₂sTX ₃the HVR-H1 of GMGVS, wherein X ₁for L or Y; X ₂for I or L; X ₃for P or S;

V () comprises the HVR-H2 of HIYWDDDTRYNPSLKS; With

(vi) RDHGYYWFX is comprised ₁the HVR-H3 of Y, wherein X ₁for D or T.

I () comprises SASSX ₁the HVR-L1 of VFYMH, wherein X ₁for P or S;

(ii) DTSX is comprised ₁the HVR-L2 of LAS, wherein X ₁for K or N;

V () comprises the HVR-H2 of HIYWDDDTRYNPSLKS; With

(vi) RDHGYYWFX is comprised ₁the HVR-H3 of Y, wherein X ₁for D or T.

In certain embodiments, provide the antibody in conjunction with Bv8 or its fragment, wherein HVR-L1 comprises and is selected from SEQIDNO:157, 163, 169, 175, 181, the aminoacid sequence of 187 and 193, HVR-L2 comprises and is selected from SEQIDNO:158, 164, 170, 176, 182, the aminoacid sequence of 188 and 194, HVR-L3 comprises and is selected from SEQIDNO:159, 165, 171, 177, 183, the aminoacid sequence of 189 and 195, HVR-H1 comprises and is selected from SEQIDNO:160, 166, 172, 178, 184, the aminoacid sequence of 190 and 196, HVR-H2 comprises and is selected from SEQIDNO:161, 167, 173, 179, 185, the aminoacid sequence of 191 and 197, and HVR-H3 comprises and is selected from SEQIDNO:162, 168, 174, 180, 186, the aminoacid sequence of 192 and 198.

In certain embodiments, this anti-Bv8 antibody comprises people VL card handkerchief subgroup I further and has Frame sequence.In certain embodiments, this anti-Bv8 antibody comprises people VH subgroup III further and has Frame sequence.In certain embodiments, this anti-Bv8 antibody comprises people VL card handkerchief subgroup I further and has Frame sequence and people VH subgroup III has Frame sequence.

I () comprises SASSX ₁the HVR-L1 of VFYMH, wherein X ₁for P or S;

(ii) DTSX is comprised ₁the HVR-L2 of LAS, wherein X ₁for K or N;

V () comprises the HVR-H2 of HIYWDDDTRYNPSLKS; With

(vi) HVR-H3 of RDHGYYWFDY is comprised.

In certain embodiments, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises following six kinds of HVR sequences:

I () comprises SASSX ₁the HVR-L1 of VFYMH, wherein X ₁for P or S;

(ii) DTSX is comprised ₁the HVR-L2 of LAS, wherein X ₁for K or N;

V () comprises the HVR-H2 of HIYWDDDTRYNPSLKS; With

(vi) HVR-H3 of RDHGYYWFDY is comprised.

In certain embodiments, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises HVR-L1, HVR-L2, HVR-L3, HVR-H1, HVR-H2 and HVR-H3, this HVR-L1 comprises and is selected from SEQIDNO:157, 163, 169, 175, 181, the aminoacid sequence of 187 and 193, this HVR-L2 comprises and is selected from SEQIDNO:158, 164, 170, 176, 182, the aminoacid sequence of 188 and 194, this HVR-L3 comprises and is selected from SEQIDNO:159, 165, 171, 177, 183, the aminoacid sequence of 189 and 195, this HVR-H1 comprises and is selected from SEQIDNO:160, 166, 172, 178, 184, the aminoacid sequence of 190 and 196, this HVR-H2 comprises and is selected from SEQIDNO:161, 167, 173, 179, 185, the aminoacid sequence of 191 and 197, this HVR-H3 comprises and is selected from EQIDNO:174, 180, 186, the aminoacid sequence of 192 and 198.

In another embodiment, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises light-chain variable domain and heavy chain variable domain, and this light-chain variable domain comprises SEQIDNO:23, and this heavy chain variable domain comprises SEQIDNO:24.

I () comprises the HVR-L1 of EASQSVDYDDDSYMN;

(ii) HVR-L2 of ATSNLAS is comprised;

(iii) HVR-L3 of QQSNEDPFT is comprised;

(iv) HVR-H1 of GYTFTNSWMN is comprised;

V () comprises the HVR-H2 of RIDPSDSETHYNQKFKD; With

(vi) HVR-H3 of DSSYDGFYAMDY is comprised.

I () comprises the HVR-L1 of EASQSVDYDDDSYMN;

(ii) HVR-L2 of ATSNLAS is comprised;

(iii) HVR-L3 of QQSNEDPFT is comprised;

(iv) HVR-H1 of GYTFTNSWMN is comprised;

V () comprises the HVR-H2 of RIDPSDSETHYNQKFKD; With

(vi) HVR-H3 of DSSYDGFYAMDY is comprised.

In certain embodiments, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises HVR-L1, HVR-L2, HVR-L3, HVR-H1, HVR-H2 and HVR-H3, this HVR-L1 comprises the aminoacid sequence being selected from SEQIDNO:199 and 205, this HVR-L2 comprises the aminoacid sequence being selected from SEQIDNO:200 and 206, this HVR-L3 comprises the aminoacid sequence being selected from SEQIDNO:201 and 207, this HVR-H1 comprises the aminoacid sequence being selected from SEQIDNO:202 and 208, this HVR-H2 comprises the aminoacid sequence being selected from SEQIDNO:203 and 209, this HVR-H3 comprises the aminoacid sequence being selected from SEQIDNO:204 and 210.

I () comprises the HVR-L1 of KSSEYVSNALS;

(ii) HVR-L2 of GTNKLED is comprised;

(iii) HVR-L3 of QQGYDIPT is comprised;

(iv) HVR-H1 of GFTFSDYFMG is comprised;

V () comprises the HVR-H2 of GIDTKSYNYATYYSGSVKG; With

(vi) HVR-H3 of NYGNYGAFDS is comprised.

I () comprises the HVR-L1 of KSSEYVSNALS;

(ii) HVR-L2 of GTNKLED is comprised;

(iii) HVR-L3 of QQGYDIPT is comprised;

(iv) HVR-H1 of GFTFSDYFMG is comprised;

V () comprises the HVR-H2 of GIDTKSYNYATYYSGSVKG; With

(vi) HVR-H3 of NYGNYGAFDS is comprised.

In certain embodiments, provide the antibody in conjunction with Bv8 or its fragment, wherein this antibody comprises HVR-L1, HVR-L2, HVR-L3, HVR-H1, HVR-H2 and HVR-H3, this HVR-L1 comprises aminoacid sequence SEQIDNO:211, this HVR-L2 comprises aminoacid sequence SEQIDNO:212, this HVR-L3 comprises aminoacid sequence SEQIDNO:213, this HVR-H1 comprises aminoacid sequence SEQIDNO:214, this HVR-H2 comprises aminoacid sequence SEQIDNO:215, and this HVR-H3 comprises aminoacid sequence SEQIDNO:216.

In certain embodiments, this anti-Bv8 antibody is monoclonal antibody.In certain embodiments, this anti-Bv8 antibody is humanized.In certain embodiments, this anti-Bv8 antibody is behaved.In certain embodiments, at least part of Frame sequence of this anti-Bv8 antibody is behaved and is had Frame sequence.In one embodiment, this antibody is for being selected from Fab, Fab '-SH, Fv, scFv or (Fab ') ₂the antibody fragment of fragment.

In certain embodiments, polynucleotide or the nucleic acid of any antibody described herein of encoding is provided.In one embodiment, the carrier comprising these polynucleotide or nucleic acid is provided.In one embodiment, this carrier is expression vector.In one embodiment, the host cell comprising this carrier is provided.In one embodiment, this host cell is eucaryon.In one embodiment, this host cell is protokaryon.In one embodiment, this host cell is Chinese hamster ovary celI.In one embodiment, provide the method preparing anti-Bv8 antibody, wherein the method cultivates this host cell under being included in the condition of the polynucleotide expression being suitable for encoding antibody, and separation antibody.

In certain embodiments, the invention still further relates to the composition comprising above-mentioned any anti-Bv8 antibody.In certain embodiments, the present invention relates to the pharmaceutical composition comprising the above-mentioned any anti-Bv8 antibody mixed with pharmaceutical acceptable carrier.

In certain embodiments, the present invention relates to a kind of pharmaceutical composition, it, for prevention or treatment metastases, comprises the described herein any anti-Bv8 antibody of the significant quantity mixed with pharmaceutical acceptable carrier.

In certain embodiments, provide the method for the existence detecting Bv8 in biological sample, the method makes biological sample and anti-Bv8 antibody contacts of the present invention under being included in and allowing the condition of antibodies Bv8, and detects between antibody and Bv8 whether form mixture.

In certain embodiments, provide the method being used for the treatment of tumour, cancer or cell proliferative disorders, comprise described herein any anti-Bv8 antibody experimenter being used to significant quantity.In certain embodiments, this cancer is selected from lower group: mammary cancer, colorectal carcinoma, lung cancer, kidney, glioblastoma, the esophageal carcinoma, melanoma, bladder cancer, ovarian cancer, carcinoma of the pancreas, and hepatocellular carcinoma.In certain embodiments, this cancer is mammary cancer, colorectal carcinoma, lung cancer, kidney, ovarian cancer or glioblastoma.An exemplary and non-limiting list of contained cancer is provided in this article under " definition ".

In certain embodiments, providing for having in the experimenter that relevant pathological condition occurs with blood vessel the method reducing or suppress blood vessel and occur, comprising described herein any anti-Bv8 antibody experimenter being used to significant quantity.In certain embodiments, this pathological condition is true tumor situation (neoplasticcondition).In certain embodiments, this pathological condition is non-true tumor situation.An exemplary and non-limiting list of contained non-true tumor situation is provided in this article under " definition ".In certain embodiments, this non-true tumor situation is selected from lower group: diabetic and other proliferating retinopathy, retinopathy of prematurity, neovascular glaucoma, senile macular degeneration SMD, diabetic macular edema, cornea neovascularization, corneal graft neovascularization, retina/choroidal neovascular is formed and rheumatoid arthritis.

In certain embodiments, provide the method for inhibition of endothelial cell proliferation, comprise described herein any anti-Bv8 antibody experimenter being used to significant quantity.In certain embodiments, this endotheliocyte is suprarenal gland cortex endotheliocyte.

In certain embodiments, providing the method for suppressing neutrophil migration, comprising described herein any anti-Bv8 antibody experimenter being used to significant quantity.

In certain embodiments, provide the method for Tumor suppression transfer, comprise described herein any anti-Bv8 antibody experimenter being used to significant quantity.In certain embodiments, this transfer is in lymphsystem.In certain embodiments, this transfer is in remote organ.

In certain embodiments, provide the method being used for the treatment of, preventing or easing the pain, comprise described herein any anti-Bv8 antibody experimenter being used to significant quantity.In certain embodiments, this pain is acute or chronic pain.In certain embodiments, this pain is acute or chronic inflam-matory pain.In certain embodiments, provide the method being used for the treatment of rheumatoid arthritis, comprise described herein any anti-Bv8 antibody experimenter being used to significant quantity.

In certain embodiments, herein and method mentioned above and comprise the second medicine experimenter being used to significant quantity further, wherein this anti-Bv8 antibody is the first medicine.In certain embodiments, this second medicine is another kind of antibody, chemotherapeutics, cytotoxic agent, antiangiogenic agent, immunosuppressor, prodrug, cytokine, cytokine antagonist, cytotoxic radiotherapy, reflunomide, antiemetic, cancer vaccine, pain killer or growth inhibitor.In certain embodiments, this second medicine is antiangiogenic agent.In certain embodiments, this second medicine or antiangiogenic agent are VEGF antibody.In certain embodiments, this VEGF antibody is rhuMAb-VEGF (bevacizumab).In certain embodiments, this second medicine was used before or after using anti-Bv8 antibody.In certain embodiments, this second medicine and anti-Bv8 antibody are used simultaneously.In certain embodiments, the method comprises the 3rd medicine experimenter being used to significant quantity further, and wherein the 3rd medicine is chemotherapeutics.

An exemplary and non-limiting list of contained chemotherapeutics is provided in this article under " definition ".In certain embodiments, this chemotherapeutics is selected from lower group: Pa Litasai (paclitaxel), carboplatin (carboplatin), cis-platinum (cisplatin), gemcitabine (gemcitabine) and pemetrexed (pemetrexed).

In certain embodiments, provide in the method with the effect strengthening antiangiogenic agent in the experimenter that relevant pathological condition occurs with blood vessel, the method comprises described herein any anti-Bv8 antibody experimenter being used to the significant quantity combined with antiangiogenic agent, strengthens the inhibit activities of described antiangiogenic agent thus.In certain embodiments, with blood vessel, relevant pathological condition should occur is tumour, cancer or cell proliferative disorders.In certain embodiments, with blood vessel, relevant pathological condition should occur is non-true tumor situation.In certain embodiments, this non-true tumor situation is selected from lower group: diabetic and other proliferating retinopathy, retinopathy of prematurity, neovascular glaucoma, senile macular degeneration SMD, diabetic macular edema, cornea neovascularization, corneal graft neovascularization, retina/choroidal neovascular is formed and rheumatoid arthritis.In certain embodiments, this non-true tumor situation is rheumatoid arthritis.

In certain embodiments, this experimenter behaves patient.In certain embodiments, this experimenter behaves cancer patients.In certain embodiments, this experimenter is the human cancer patient that transfer can be had after diagnosing maybe can be in the risk that transfer occurs.In certain embodiments, this experimenter for from VEGF antagonist recurrence or VEGF antagonist is not answered.In certain embodiments, this VEGF antagonist is VEGF antibody.In certain embodiments, this VEGF antibody is rhuMAb-VEGF.

In certain embodiments, this antiangiogenic agent was used before or after using anti-Bv8 antibody.In certain embodiments, this antiangiogenic agent and anti-Bv8 antibody are used simultaneously.In certain embodiments, this antiangiogenic agent is anti-vegf agent.In certain embodiments, this anti-vegf agent is VEGF antibody.In certain embodiments, this VEGF antibody is rhuMAb-VEGF.

Any embodiment described herein or its any combination are applicable to any and all anti-Bv8 antibody of invention described herein and method.

Accompanying drawing is sketched

Figure 1A-F: the light chain of anti-Bv8 antibody and heavy chain HVR ring sequence.Described figure shows light chain HVR sequence L1, L2 and L3 and heavy chain HVR sequence H1, H2 and H3.The sequence numbering mode of often kind of antibody is as follows: chimeric 2G9(HVR-H1 is SEQIDNO:49; HVR-H2 is SEQIDNO:50; HVR-H3 is SEQIDNO:51; HVR-L1 is SEQIDNO:52; HVR-L2 is SEQIDNO:53; HVR-L3 is SEQIDNO:54); H2G9.K4G1.Polish(HVR-L1 is SEQIDNO:55; HVR-L2 is SEQIDNO:56; HVR-L3 is SEQIDNO:57; HVR-H1 is SEQIDNO:58; HVR-H2 is SEQIDNO:59; HVR-H3 is SEQIDNO:60); H2G9.K4G1.v19(HVR-L1 is SEQIDNO:61; HVR-L2 is SEQIDNO:62; HVR-L3 is SEQIDNO:63; HVR-H1 is SEQIDNO:64; HVR-H2 is SEQIDNO:65; HVR-H3 is SEQIDNO:66); H2G9.K4G1.v25(HVR-L1 is SEQIDNO:67; HVR-L2 is SEQIDNO:68; HVR-L3 is SEQIDNO:69; HVR-H1 is SEQIDNO:70; HVR-H2 is SEQIDNO:71; HVR-H3 is SEQIDNO:72); H2G9.K4G1.v27(HVR-L1 is SEQIDNO:73; HVR-L2 is SEQIDNO:74; HVR-L3 is SEQIDNO:75; HVR-H1 is SEQIDNO:76; HVR-H2 is SEQIDNO:77; HVR-H3 is SEQIDNO:78); H2G9.K4G1.v37(HVR-L1 is SEQIDNO:79; HVR-L2 is SEQIDNO:80; HVR-L3 is SEQIDNO:81; HVR-H1 is SEQIDNO:82; HVR-H2 is SEQIDNO:83; HVR-H3 is SEQIDNO:84); H2G9.K4G1.v52(HVR-L1 is SEQIDNO:85; HVR-L2 is SEQIDNO:86; HVR-L3 is SEQIDNO:87; HVR-H1 is SEQIDNO:88; HVR-H2 is SEQIDNO:89; HVR-H3 is SEQIDNO:90); H2G9.K4G1.v55(HVR-L1 is SEQIDNO:91; HVR-L2 is SEQIDNO:92; HVR-L3 is SEQIDNO:93; HVR-H1 is SEQIDNO:94; HVR-H2 is SEQIDNO:95; HVR-H3 is SEQIDNO:96); H2G9.K4G1.v63(HVR-L1 is SEQIDNO:97; HVR-L2 is SEQIDNO:98; HVR-L3 is SEQIDNO:99; HVR-H1 is SEQIDNO:100; HVR-H2 is SEQIDNO:101; HVR-H3 is SEQIDNO:102); H2G9.K4G1.v64(HVR-L1 is SEQIDNO:103; HVR-L2 is SEQIDNO:104; HVR-L3 is SEQIDNO:105; HVR-H1 is SEQIDNO:106; HVR-H2 is SEQIDNO:107; HVR-H3 is SEQIDNO:108); H2G9.K4G1.v65(HVR-L1 is SEQIDNO:109; HVR-L2 is SEQIDNO:110; HVR-L3 is SEQIDNO:111; HVR-H1 is SEQIDNO:112; HVR-H2 is SEQIDNO:113; HVR-H3 is SEQIDNO:114); H2G9.K4G1.v67(HVR-L1 is SEQIDNO:115; HVR-L2 is SEQIDNO:116; HVR-L3 is SEQIDNO:117; HVR-H1 is SEQIDNO:118; HVR-H2 is SEQIDNO:119; HVR-H3 is SEQIDNO:120); H2G9.K4G1.v73(HVR-L1 is SEQIDNO:121; HVR-L2 is SEQIDNO:122; HVR-L3 is SEQIDNO:123; HVR-H1 is SEQIDNO:124; HVR-H2 is SEQIDNO:125; HVR-H3 is SEQIDNO:126); H2G9.K4G1.v75(HVR-L1 is SEQIDNO:127; HVR-L2 is SEQIDNO:128; HVR-L3 is SEQIDNO:129; HVR-H1 is SEQIDNO:130; HVR-H2 is SEQIDNO:131; HVR-H3 is SEQIDNO:132); H2G9.K4G1.v77(HVR-L1 is SEQIDNO:133; HVR-L2 is SEQIDNO:134; HVR-L3 is SEQIDNO:135; HVR-H1 is SEQIDNO:136; HVR-H2 is SEQIDNO:137; HVR-H3 is SEQIDNO:138); H2G9.K4G1.v80(HVR-L1 is SEQIDNO:139; HVR-L2 is SEQIDNO:140; HVR-L3 is SEQIDNO:141; HVR-H1 is SEQIDNO:142; HVR-H2 is SEQIDNO:143; HVR-H3 is SEQIDNO:144); H2G9.K4G1.v92(HVR-L1 is SEQIDNO:145; HVR-L2 is SEQIDNO:146; HVR-L3 is SEQIDNO:147; HVR-H1 is SEQIDNO:148; HVR-H2 is SEQIDNO:149; HVR-H3 is SEQIDNO:150); H2G9.K4G1.v19H/v55L(HVR-L1 is SEQIDNO:151; HVR-L2 is SEQIDNO:152; HVR-L3 is SEQIDNO:153; HVR-H1 is SEQIDNO:154; HVR-H2 is SEQIDNO:155; HVR-H3 is SEQIDNO:156); Chimeric 2B9(HVR-L1 is SEQIDNO:157; HVR-L2 is SEQIDNO:158; HVR-L3 is SEQIDNO:159; HVR-H1 is SEQIDNO:160; HVR-H2 is SEQIDNO:161; HVR-H3 is SEQIDNO:162); H2B9.v1(HVR-L1 is SEQIDNO:163; HVR-L2 is SEQIDNO:164; HVR-L3 is SEQIDNO:165; HVR-H1 is SEQIDNO:166; HVR-H2 is SEQIDNO:167; HVR-H3 is SEQIDNO:168); H2B9.v10(HVR-L1 is SEQIDNO:169; HVR-L2 is SEQIDNO:170; HVR-L3 is SEQIDNO:171; HVR-H1 is SEQIDNO:172; HVR-H2 is SEQIDNO:173; HVR-H3 is SEQIDNO:174); H2B9.v23(HVR-L1 is SEQIDNO:175; HVR-L2 is SEQIDNO:176; HVR-L3 is SEQIDNO:177; HVR-H1 is SEQIDNO:178; HVR-H2 is SEQIDNO:179; HVR-H3 is SEQIDNO:180); H2B9.v37(HVR-L1 is SEQIDNO:181; HVR-L2 is SEQIDNO:182; HVR-L3 is SEQIDNO:183; HVR-H1 is SEQIDNO:184; HVR-H2 is SEQIDNO:185; HVR-H3 is SEQIDNO:186); H2B9.v56(HVR-L1 is SEQIDNO:187; HVR-L2 is SEQIDNO:188; HVR-L3 is SEQIDNO:189; HVR-H1 is SEQIDNO:190; HVR-H2 is SEQIDNO:191; HVR-H3 is SEQIDNO:192); H2B9.v76(HVR-L1 is SEQIDNO:193; HVR-L2 is SEQIDNO:194; HVR-L3 is SEQIDNO:195; HVR-H1 is SEQIDNO:196; HVR-H2 is SEQIDNO:197; HVR-H3 is SEQIDNO:198); Chimeric 3F1(HVR-L1 is SEQIDNO:199; HVR-L2 is SEQIDNO:200; HVR-L3 is SEQIDNO:201; HVR-H1 is SEQIDNO:202; HVR-H2 is SEQIDNO:203; HVR-H3 is SEQIDNO:204); (HVR-L1 is SEQIDNO:205 to h3F1.v1; HVR-L2 is SEQIDNO:206; HVR-L3 is SEQIDNO:207; HVR-H1 is SEQIDNO:208; HVR-H2 is SEQIDNO:209; HVR-H3 is SEQIDNO:210); Be SEQIDNO:211 with chimeric 2D3(HVR-L1; HVR-L2 is SEQIDNO:212; HVR-L3 is SEQIDNO:213; HVR-H1 is SEQIDNO:214; HVR-H2 is SEQIDNO:215; HVR-H3 is SEQIDNO:216).

Amino acid position is numbered according to hereinafter described Kabat numbering system.

Fig. 1 G.People VL card handkerchief (κ) subgroup IV has Frame sequence and deducts Kabat light chain HVR sequence and be shown in SEQIDNO:240.People VH subgroup I has Frame sequence and deducts Kabat heavy chain HVR sequence and be shown in SEQIDNO:241.

Fig. 2 A-B.Anti-(A) light-chain variable domain of Bv8 antibody 2G9 variant and the aminoacid sequence of (B) heavy chain variable domain.Position is numbered according to Kabat and hypervariable region shows with frame.

Fig. 3 A-B.Anti-(A) light-chain variable domain of Bv8 antibody 2B9 variant and the aminoacid sequence of (B) heavy chain variable domain.Position is numbered according to Kabat and hypervariable region shows with frame.

Fig. 4 A-B.Anti-(A) light-chain variable domain of Bv8 antibody 3F1 variant and the aminoacid sequence of (B) heavy chain variable domain.Position is numbered according to Kabat and hypervariable region shows with frame.

Fig. 5 A-B.Anti-(A) light-chain variable domain of Bv8 antibody 2D3 variant and the aminoacid sequence of (B) heavy chain variable domain.Position is numbered according to Kabat and hypervariable region shows with frame.

Fig. 6 A-B.(A) light-chain variable domain of humanization anti-Bv8 antibody 2B9 variant and the aminoacid sequence of (B) heavy chain variable domain.Position is numbered according to Kabat and hypervariable region shows with frame.

Fig. 7.Light chain variable domain amino acid sequence, display (1) mouse 2G9 (m2G9) Frame sequence and people have card handkerchief I Frame sequence and (2) m2G9 Frame sequence and people and have difference between card handkerchief IV Frame sequence.Position is numbered according to Kabat and hypervariable region shows with frame.

Fig. 8.Weight chain variable domain amino acid sequence, display (1) mouse 2G9 (m2G9) Frame sequence and people have subgroup I (G1) Frame sequence and (2) m2G9 Frame sequence and people and have difference between subgroup III (G3) Frame sequence.Position is numbered according to Kabat and hypervariable region shows with frame.

Fig. 9.L1, L2 and L3 aminoacid sequence of anti-Bv8 antibody h2G9.K4G1.Polish, h2G9.K4G1.v27, h2G9.K4G1.v52, h2G9.K4G1.v55, h2G9.K4G1.v63, h2G9.K4G1.v64, h2G9.K4G1.v67, h2G9.K4G1.v77 and h2G9.K4G1.v80.

Figure 10.H1, H2 and H3 aminoacid sequence of anti-Bv8 antibody h2G9.K4G1.Polish, h2G9.K4G1.v19, h2G9.K4G1.v25, h2G9.K4G1.v37, h2G9.K4G1.v65, h2G9.K4G1.v73, h2G9.K4G1.v75, h2G9.K4G1.v77, h2G9.K4G1.v92.

Figure 11 shows chimeric 2D3 antibody can have the epi-position different with chimeric 2G9 antibody from chimeric 2B9 and chimeric 3F1.The chimeric 3F1 of ELISA competition assay display and chimeric 2G9 antibody compete the combination to people Bv8 with chimeric 2B9.Chimeric 2D3 only partly with chimeric 2B9 antibody competition to the combination of people Bv8.

Figure 12 shows mouse 2G9, chimeric 2G9, mouse 2B9, chimeric 2B9 and chimeric 3F1 to the blocking-up of the ACE cell proliferation that people Bv8 induces.The result of this assay method shows the ACE cell proliferation being fitted together to 2G9 and people Bv8 can be suppressed completely to induce.

Figure 13 shows the blocking-up of the ACE cell proliferation that chimeric 2G9, h2G9.K4G1, h2G9.K4G3, h2G9.K1G1 and h2G9.K1G3 anti-Bv8 antibody on human Bv8 induces.The chimeric 2G9 anti-Bv8 antibody of result display of this assay method has the highest blocking-up activity in 20 μ g/mL antibody concentration.

Figure 14 A-B describes the result from phage competition assay, proves the combination of h2G9.K4G1 variant (L1:D28E, D28S, G29A, G29S, H2:C52aA, C52aS, N54A, N54S, H3:D95E, D95S, G96A and G96S) for people Bv8.

Figure 15 shows the blocking-up of the ACE cell proliferation that chimeric 2G9 and h2G9.K4G1.Polish anti-Bv8 antibody on human Bv8 induces.

Figure 16 describes from the result of phage competition assay, proves the combination for people Bv8 of h2G9.K4G1.Polish variant (h2G9.K4G1.v27, v52, v55, v63, v64, v67, v77, v80 from the soft randomised libraries of L1/L2) that avidity improves.

Figure 17, from the result of phage competition assay, proves the combination for people Bv8 of h2G9.K4G1.Polish variant (h2G9.K4G1.v19, v25, v37, v65, v73, v75, v77.v92 from the soft randomised libraries of H1/H2) that avidity improves.

Figure 18 shows the dissociation constant of following anti-Bv8 antibody (Fab) for people Bv8: h2G9.K4G1.Polish, h2G9.K4G1.v19, h2G9.K4G1.v52, h2G9.K4G1.v55 and h2G9.K4G1.v73.

Figure 19 shows the dissociation constant of the anti-Bv8 antibody (Fab and IgG) of humanization h2G9.K4G1.v19 and h2G9.K4G1.v55 for people Bv8 and macaque Bv8.

Figure 20 is shown in the sensing figure that 25 ° of C inject the anti-Bv8Fab antibody of 50nM on people Bv8 immobilization BIAcore chip, proves that dissociation rate improves.

Figure 21 shows the dissociation constant of following anti-Bv8 antibody (IgG) for people Bv8 and macaque Bv8: chimeric 2G9, h2G9.K4G1.v19 and h2G9.K4G1.v55.The avidity of result display humanization anti-Bv8 antibody h2G9.K4G1.v19 and h2G9.K4G1.v55 shows as at least twice tightr than the anti-Bv8 antibody of chimeric 2G9.

Figure 22 shows humanization anti-Bv8 antibody blocking people Bv8 to the combination of mouse 2G9 antibody.The humanization anti-Bv8 antibody (h2G9.K4G1.v19, h2G9.K4G1.v52, h2G9.K4G1.v55, h2G9.K4G1.v73 and h2G9.K4G1.v19H/v55L) of five kinds of affinity maturations has powerful about 5-8 blocking ability doubly compared with parent's modified version K4G1 molecule.

Figure 23 shows the anti-Bv8 antibody of chimeric 2G9, h2G9K4G1.Polish, h2G9K4G1.v19, h2G9K4G1.v52, h2G9K4G1.v55 and h2G9K4G1.v73 in the blocking-up of prescribed concentration (μ g/mL) to the ACE cell proliferation that people Bv8 induces.Humanization anti-Bv8 antibody h2G9K4G1.v19, h2G9K4G1.v52, h2G9K4G1.v55 and h2G9K4G1.v73 display blocks the remarkable improvement of the ACE propagation aspect of people Bv8 induction.

Figure 24 shows h2G9K4G1.Polished, h2G9K4G1.v19, h2G9K4G1.v55 and the anti-Bv8 antibody of chimeric 2D3 in the blocking-up of prescribed concentration (μ g/mL) to the ACE cell proliferation that mouse Bv8 induces.

Figure 25.Chimeric 3F1, chimeric 2B9, the chimeric anti-Bv8 antibody of 2D3 and the chimeric 2G9 efficacy study in treatment HM7 human colon carcinoma.

Figure 26.Chimeric 3F1, chimeric 2B9, the chimeric anti-Bv8 antibody of 2D3 and the chimeric 2G9 efficacy study in treatment A673 human rhabdomyosarcoma cancer.

Figure 27.Chimeric 3F1, chimeric 2B9, the chimeric anti-Bv8 antibody of 2D3 and the chimeric 2G9 efficacy study in treatment HT55 human colon carcinoma.

Figure 28.Chimeric 3F1, chimeric 2B9, the chimeric anti-Bv8 antibody of 2D3 and the chimeric 2G9 efficacy study in treatment Calu-6 people lung cancer.

Figure 29.Chimeric 3F1, chimeric 2B9, the chimeric anti-Bv8 antibody of 2D3 and the chimeric 2G9 efficacy study in treatment Colo-205 human colon carcinoma.

Figure 30.Chimeric 3F1, chimeric 2B9, the chimeric anti-Bv8 antibody of 2D3 and the chimeric 2G9 efficacy study in treatment HPAC human pancreas cancer.

Figure 31.The efficacy study of the chimeric anti-Bv8 antibody of 2G9, h2G9.K4G1.v19 and h2G9.K4G1.v55 in treatment Calu-6 people lung cancer.

Figure 32.Chimeric 2D3, h2G9.K4G1.Polish, the efficacy study of the anti-Bv8 antibody of h2G9.K4G1.v19 and h2G9.K4G1.v55 in treatment HM7 human colon carcinoma.

Figure 33.The efficacy study of the chimeric anti-Bv8 antibody of 2G9, h2G9.K4G1.v19 and h2G9.K4G1.v55 in treatment A673 human rhabdomyosarcoma cancer.

Figure 34.The efficacy study of the chimeric anti-Bv8 antibody of 2G9, h2G9.K4G1.v19 and h2G9.K4G1.v55 in treatment HT55 human colon carcinoma.

Figure 35.The efficacy study of the chimeric anti-Bv8 antibody of 2G9, h2G9.K4G1.v19 and h2G9.K4G1.v55 in treatment Colo-205 human colon carcinoma.

Figure 36.The efficacy study of the chimeric anti-Bv8 antibody of 2G9, h2G9.K4G1.v19 and h2G9.K4G1.v55 in treatment HPAC human pancreas cancer.

Figure 37.Anti-Bv8 mouse antibodies (3F1 and 2B9) is having and without the efficacy study for the treatment of under VEGF antibody in LXFL529 people's lung non-small cell cancer cells.

Figure 38 shows the response of Lewis lung cancer (LLC) allograft as single medicament or the growth-inhibiting of anti-Bv8 antibody that combines with VEGF antibody.

Figure 39 shows the response of HM7 human colorectal cancer heterograft as single medicament or the growth-inhibiting of anti-Bv8 antibody that combines with VEGF antibody.

Figure 40 shows the growth-inhibiting of the anti-Bv8 antibody that the response of H460 Non-small cell lung carcinoma heterograft is combined with VEGF antibody.

The survival of the prolongation of the anti-Bv8 antibody that the mouse response that H460 Non-small cell lung carcinoma heterograft is carried in Figure 41 display is combined with VEGF antibody.

Figure 42 shows the growth-inhibiting of the independent anti-Bv8 antibody combined with VEGF antibody of HT29 human colorectal cancer heterograft response.

The survival of the prolongation of the independent anti-Bv8 antibody combined with VEGF antibody of the mouse response of HT29 human colorectal cancer heterograft is carried in Figure 43 display.

Detailed Description Of The Invention

The invention provides the method for anti-Bv8 antibody, composition, test kit and goods.The details of these methods, composition, test kit and goods are provided herein.

Current techique

The technology described herein or mention and code generally obtain fully understanding of those skilled in the art, and usually utilize ordinary method to be adopted, the method of the widespread use recorded in such as such as following documents: Sambrooketal., MolecularCloning:ALaboratoryManual3rd.edition (2001) ColdSpringHarborLaboratoryPress, ColdSpringHarbor, N.Y; CURRENTPROTOCOLSINMOLECULARBIOLOGY (F.M.Ausubel, etal.eds., (2003)); Book series METHODSINENZYMOLOGY (AcademicPress, Inc.): PCR2:APRACTICALAPPROACH (M.J.MacPherson, B.D.HamesandG.R.Tayloreds. (1995)); HarlowandLane, eds. (1988) ANTIBODIES, ALABORATORYMANUAL; And ANIMALCELLCULTURE (R.I.Freshney, ed. (1987)).

Definition

Term " Bv8 ", " Bv8 homologue ", " starting proteinogen-2 " (also referred to as " PK2 ", " KAL4 " and " MIT1 ") are used interchangeably in this article, refer to the active fragments of full-length polypeptide and/or full-length polypeptide.Native sequences Bv8 is former (prepro), former (pro) and mature form and clipped form before containing the natural existence of Bv8, and natural exist variant form (such as alternative splice forms and naturally there is allelic variant.In certain embodiments, natural B v8 aminoacid sequence is shown in SEQIDNO:235 to 239.People and mouse Bv8 sequence are also disclosed in such as Wechselbergeretal. (FEBSLett.462:177-181 (1999)) and Lietal. (Mol.Pharm.59:692-698 (2001)).

" Bv8 acceptor " refers to that Bv8 combines with molecule that is mediation Bv8 biological characteristics.Therefore; term " Bv8 acceptor " comprises PKR1/GPR73/EG-VEGF acceptor-1/PROKR1 and PKR2/GPR73L1/EG-VEGF acceptor-2/PROKR2 (LeCouteretal. in its implication; 2003, Proc.Natl.Acad.Sci.USA, 100:2685-2690; Linetal., 2002, J.Biol.Chem., 277:19276-19280; Masudaetal., 2002, Biochem.Biophys.Res.Commun., 293:396-402).

Term " biologic activity " and " having biologic activity " refer to that with regard to polypeptide molecular specificity combines and regulates the ability of cell response (such as breed, migration etc.).Cell response also comprises those via receptor-mediated, includes but not limited to migration and/or propagation.

About Bv8, in order to object herein, " activated " or " activity " refers to retain the biology of Bv8 that is natural or natural generation and/or the Bv8 form of immunologic competence, wherein " biology " activity refers to what Bv8 that is natural or natural generation had, inducing beyond the ability for the antibody tormation of antigenic epitopes, the biological function that caused by Bv8 that is natural or natural generation (or inhibition or irritating), and " immunology " activity refers to what Bv8 that is natural or natural generation had, induce the ability for the antibody tormation of antigenic epitopes.In certain embodiments, the biologic activity of Bv8 is that regulation and control medullary cell is mobilized, promoted tumor vessel to occur and/or promote the ability of metastases.

Term " anti-Bv8 antibody " or " antibody in conjunction with Bv8 " refer to enough avidity in conjunction with Bv8, to make this antibody can be used as the diagnostic reagent of target Bv8 and/or the antibody of therapeutical agent.In certain embodiments, the antibody in conjunction with Bv8 has≤1 μM ,≤100nM ,≤10nM ,≤1nM ,≤0.1nM or≤0.01nM dissociation constant (Kd).In certain embodiments, the Bv8 epi-position that anti-Bv8 antibodies is conservative between the Bv8 from different plant species.In certain embodiments, anti-Bv8 antibody and identical epi-position on the antibodies people Bv8 being selected from lower group: chimeric 2G9, h2G9.K4G1.v19, h2G9.K4G1.v52, h2G9.K4G1.v55, h2G9.K4G1.v73 and chimeric 2D3.In certain embodiments, anti-Bv8 antibody be selected from the antibody competition of lower group to the combination of people Bv8: chimeric 2G9, h2G9.K4G1.v19, h2G9.K4G1.v52, h2G9.K4G1.v55, h2G9.K4G1.v73 and chimeric 2D3.

" binding affinity " is often referred to the intensity of whole noncovalent interaction summation between the single binding site of molecule (such as antibody) and its binding partners (such as antigen).Except as otherwise noted, when for this paper, " binding affinity " refers to reflect in conjunction with the interactional inherent binding affinity of 1:1 between right member's (such as antibody and antigen).The usual available dissociation constant (Kd) of the avidity of molecule X to its mating partner Y is stated.The common method that avidity is known by this area is measured, and comprises described herein.Low-affinity antibody usually conjugated antigen and be tending towards easily dissociating slowly, and high-affinity antibody conjugated antigen and be tending towards the combination keeping the longer time faster usually.The multiple method measuring binding affinity is known in this area, wherein any one object all used in the present invention.Described below is concrete exemplary.

In certain embodiments, that the radio-labelled antigen binding assay (RIA) that anti-Bv8 antibody and antigen thereof by using Fab pattern described in following assay method carry out is measured according to " Kd " of the present invention or " Kd value ": by under the condition of titration series that there is unlabelled antigen, with Cmin ¹²⁵i labelled antigen balances, and then catches with the flat board of anti-Fab antibody bag quilt the antigen combined and measures the solution binding affinity (Chen, etal., (1999) J.MolBiol293:865-881) of Fab to antigen.In order to determine condition determination, catch with 5 μ g/ml in 50mM sodium carbonate (pH9.6) and spent the night by microtiter plate (Dynex) with anti-Fab antibody (CappelLabs) bag, use 2% in PBS (w/v) bovine serum albumin(BSA) to close 2-5 hour in room temperature (about 23 ° of C) subsequently.In non-adsorbed flat board (Nunc#269620), by 100pM or 26pM [ ¹²⁵i]-antigen mixes (such as with Prestaetal., VEGF antibody in (1997) CancerRes.57:4593-4599, the assessment of Fab-12 is consistent) with the object Fab of serial dilution.Then by object Fab incubated overnight; But, the sustainable longer time (such as 65 hours) is incubated to ensure to reach balance.After this, mixture is transferred to seizure plate to carry out incubation at room temperature (such as 1 hour).Then solution is removed, and with containing 0.1%Tween ^tMthe PBS of-20 washes plate 8 times.After dull and stereotyped drying, add 150 μ l/ hole scintillation solution (MicroScint ^tM-20; Packard), then in TopCount gamma counter (Packard) to plate count 10 minutes.The concentration selecting each Fab to provide to be less than or equal to maximum combined 20% is for competitive binding assay method.According to another embodiment, Kd or Kd value uses BIAcore by surperficial plasmon resonance assays ^tM-2000 or BIAcore ^tM-3000 (BIAcore, Inc., Piscataway, NJ) use immobilized antigen CM5 chip to measure about 10 response units (RU) at 25 ° of C.In brief, carboxymethylation dextran biosensor matrix chip (CM5, BIAcoreInc.) is activated according to specification sheets hydrochloric acid N-ethyl-N '-(3-dimethylaminopropyl)-carbodiimide (EDC) of supplier and N-hydroxy-succinamide (NHS).With 10mM sodium acetate pH4.8 by antigen diluent to 5 μ g/ml(about 0.2 μM), the coupling protein matter of acquisition about 10 response units (RU) is then injected into the flow velocity of 5 μ l/ minutes.After injecting antigen, inject 1M thanomin with closed unreacted group.In order to carry out kinetic measurement, be infused in containing 0.05%Tween with the flow velocity of about 25 μ l/ minutes at 25 ° of C ^tMthe Fab(0.78nM to 500nM of twice serial dilution in the PBS (PBST) of-20).Use simple Lang Gemiaoer (Langmuir) combination model (BIAcore one to one ^tMevaluationSoftwareversion3.2) combined and the sensing figure calculations incorporated speed (k that dissociates by matching simultaneously _on) and dissociation rate (k _off).Equilibrium dissociation constant (Kd) is with ratio k _off/ k _oncalculate.See such as Chen, Y., etal., (1999) J.Mol.Biol.293:865-881.If according to surperficial plasmon resonance assays above, association rate is more than 10 ⁶m ^-1s ^-1so association rate can use fluorescent quenching technology to measure, namely spectrophotometer (astop-flowequippedspectrophometer) (AvivInstruments) or the middle measurement with stirring cuvette of 8000 serial SLM-Aminco spectrophotometers (ThermoSpectronic) of cut-off device is such as equipped with according to spectrometer, under the condition of antigen that there is increasing concentration, the anti-antigen-antibody of 20nM (Fab form) measured in PBS, pH7.2 (excites=295nm in the fluorescent emission intensity of 25 ° of C; Transmitting=340nm, 16nm band is logical) rising or reduction.

" separation " nucleic acid molecule refers to identify and the nucleic acid molecule separated with at least one contaminative nucleic acid molecule of usual associated in the natural origin of antibody nucleic acids.The nucleic acid molecule differ be separated is in the form when occurring in nature finds it or background.Therefore the nucleic acid molecule be separated has any different with nucleic acid molecule when being present in n cell.But the nucleic acid molecule of separation comprises the nucleic acid molecule of usually expressing and comprising in the cell of this antibody, such as, when the chromosomal localization of described nucleic acid molecule in described cell is different from its chromosomal localization in n cell.

Term " carrier " is for meaning the nucleic acid molecule that can transport other nucleic acid connected during this paper.One class carrier is " plasmid ", refers to the circular double stranded DNA ring that wherein can connect other region of DNA section.Another kind of carrier is phage vector.Another kind of carrier is virus vector, wherein other region of DNA section can be connected in viral genome.Self-replicating (such as there is bacteria carrier and the episomal mammalian vectors of bacterial origin of replication) in the host cell that some carrier can import at it.Other carrier (such as non-add type mammalian vector) can be incorporated in the genome of host cell, thus along with host genome copies together after importing host cell.In addition, some carrier can instruct the genetic expression be operatively connected with it.Examples of such carriers is referred to herein as " recombinant expression vector " (or referred to as " recombinant vectors " or " expression vector ").Usually, useful in recombinant DNA technology expression vector is usually plasmid form.In this manual, " plasmid " and " carrier " is used interchangeably.

" polynucleotide " or " nucleic acid " are used interchangeably in this article, refer to the nucleotide polymer of any length, comprise DNA and RNA.Nucleotide can be deoxyribonucleotide, ribonucleotide, through the Nucleotide modified or base and/or its analogue, or by DNA or RNA polymerase or any substrate being mixed polymkeric substance by building-up reactions.Polynucleotide can comprise the Nucleotide through modifying, such as methylated nucleotide and analogue thereof.If any, can carry out before or after assembling polymkeric substance the modification of nucleotide structure.Nucleotide sequence can be interrupted by non-nucleotide component.Polynucleotide can be modified in post synthesis further, such as by with marker coupling.The modification of other type comprises such as " cap ", one or more naturally occurring Nucleotide analogue is substituted, modify between Nucleotide and such as such as there is neutral connection (such as methyl-phosphonate, phosphotriester, phosphoramidate (phosphoamidate), carbamate etc.) and there is electrically charged connection (such as thiophosphatephosphorothioate, phosphorodithioate etc.) modification, containing pendency module (pendantmoiety) such as such as protein (such as nuclease, toxin, antibody, signal peptide, polylysine etc.) modification, there is intercalator (such as acridine, psoralene etc.) modification, containing sequestrant (such as metal, radioactive metal, boron, oxidisability metal etc.) modification, modification containing alkylating agent, there is the modification of modified connection (such as α anomeric nucleic acid (anomericnucleicacid) etc.), and the polynucleotide of unmodified form.In addition; usually any hydroxyl be present in carbohydrate can be replaced with such as phosphonic acids (phosphonate) group, phosphoric acid (phosphate) group; protect with standard protecting group; or activation is connected with other of other Nucleotide with preparation, or solid and semi-solid support can be coupled to.5' and 3' end OH can phosphorylation or replace with organic cap group module that adds of amine or 1-20 carbon atom.Other hydroxyl also can be derivatized to standard protecting group.The analogue form of the ribose that polynucleotide also generally can be known containing this area or ribodesose carbohydrate, comprise the fluoro-or 2'-nitrine-ribose of such as 2'-oxygen-methyl, 2'-oxygen-allyl group, 2'-, carba sugars, α-anomeric sugar, epimerization sugar is pectinose, wood sugar or lyxose, pyranose, furanose, sedoheptulose such as, acyclic analog and dealkalize yl nucleosides analogue such as methylribonucleotide.Available alternative linking group is replaced one or more phosphodiester and is connected.These alternative linking groups include but not limited to following embodiment, and wherein phosphoric acid ester is with P (O) S(" thioester " (thioate)), P (S) S(" dithioester " (dithioate)), (O) NR ₂(" carboxylic acid amide esters " (amidate)), P (O) R, P (O) OR', CO or CH ₂(" methylal " (formacetal)) substitutes, wherein R or R' is independently H or substituted or unsubstituted alkyl (1-20 C) separately, optionally containing ether (-O-) connection, aryl, thiazolinyl, cycloalkyl, cycloalkenyl group or aralkyl (araldyl).All connections not in polynucleotide are all necessarily identical.Aforementioned description is applicable to all polynucleotide mentioned in this article, comprises RNA and DNA.

" oligonucleotide ", for referring generally to short polynucleotide during this paper, is generally strand, and be generally synthesis, length generally but be not to be less than about 200 Nucleotide.Term " oligonucleotide " is not mutually exclusive with " polynucleotide ".Above about polynucleotide description equality and be applicable to oligonucleotide completely.

Term " antibody " and " immunoglobulin (Ig) " exchange with most broad sense and use, comprise monoclonal antibody (such as total length or intact monoclonal antibodies), polyclonal antibody, multivalent antibody, multi-specificity antibody (such as bi-specific antibody, as long as they show the biologic activity of expectation), but also some antibody fragment (as specifically described) can be comprised herein.Antibody can be people, humanized and/or affinity maturation.

" separation " antibody refers to identify and the antibody separating from a kind of composition of its natural surroundings and/or reclaim.The contaminative composition of its natural surroundings refers to disturb the diagnosis of this antibody or the material of therepic use, can comprise the solute of enzyme, hormone and other oroteins character or non-proteinaceous.In preferred embodiments, by antibody purification to (1) mensuration according to Lowry method, antibody weight is more than 95%, most preferably weight is more than 99%, (2) be enough to by using spinning cup sequenator to obtain the N-end of at least 15 residues or the degree of internal amino acid sequence, or (3) are according to the SDS-PAGE under reductibility or non-reducing conditions and use Coomassie blue or preferred Silver stain, reach homogeneity.Since at least one composition of antibody natural surroundings can not exist, the antibody be so separated comprises the antibody iM situ in reconstitution cell.But the antibody of separation will be prepared by least one purification step usually.

" variable " refer to some part in variable domain between antibody sequence difference extensively and for often kind of specific antibodies to the combination of its specific antigen and specific truth.But variability is not uniformly distributed in the whole variable domain of antibody.It concentrates in light chain and heavy chain variable domain three sections being called complementary determining region or hypervariable region (CDR or HVR is used interchangeably in this article).Part comparatively conservative in variable domain is called framework region (FR).Each self-contained four FR of variable domain of native heavy and light chain, they take beta-pleated sheet conformation mostly, by forming loop connecting and three HVR forming a beta-pleated sheet structure part in some situation connect.HVR in every bar chain is by FR keeping together closely, and facilitate the formation of the antigen binding site of antibody (see Kabatetal. together with the HVR of another chain, sequence ofProteinsofImmunologicalInterest, 5th edition, NationalInstituteofHealth, Bethesda, MD. (1991)).Constant domain does not participate in the combination of antibody and antigen directly, but shows multiple effector functions, the participation of antibody in (cell) toxicity of such as antibody dependent cellular.

Produce two identical Fabs with Papain digestion of antibodies, be called " Fab " fragment, there is an antigen binding site separately, and remaining " Fc " fragment, its title reflects the ability that it is easy to crystallization.Pepsin produces a F (ab') ₂fragment, it has two antigen binding sites and still can crosslinking antigen.

" Fv " is the minimum antibody fragment comprising intact antigen identification and binding site.In two-chain Fv species, this district is made up of tight a, heavy chain variable domain of Non-covalent binding and the dimer of a light-chain variable domain.In single-chain Fv species, a heavy chain variable domain can be connected by flexible peptide linker covalency with a light-chain variable domain, and light chain and heavy chain are combined in " dimer " structure similar with two-chain Fv species.Just in such configuration, three HVR of each variable domain interact and at V _h-V _ldimer interface determines antigen binding site.Six HVR give antibody jointly with antigen-binding specificity.But even single variable domain (or only comprising half Fv of three HVR to antigen-specific) also has the ability of identification and conjugated antigen, just avidity is lower than entire binding site.

Fab fragment also comprises the constant domain of light chain and first constant domain (CH1) of heavy chain.The difference of Fab' fragment and Fab fragment is that the C-terminal of heavy chain CH1 structural domain adds minority residue, comprises the one or more halfcystines from antibody hinge region.Fab'-SH carries the appellation of the Fab' of free sulphur alcohol radical to wherein constant domain cysteine residues herein.F (ab') ₂antibody fragment is as there being the paired Fab' fragment of hinge cysteine to generate between Fab' fragment at first.Also know other chemical coupling of antibody fragment.

According to the aminoacid sequence of its constant domain, " light chain " from the antibody (immunoglobulin (Ig)) of any invertebrate species can be included into the one in two kinds of distinct types, is called card handkerchief (κ) and lambda (λ).

According to the aminoacid sequence of its heavy-chain constant domains, immunoglobulin (Ig) can be included into different classes.Immunoglobulin (Ig) has five large classes: IgA, IgD, IgE, IgG and IgM, wherein some can be further divided into subclass (isotype), such as IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2.The heavy-chain constant domains corresponding with inhomogeneous immunoglobulin (Ig) is called α, δ, ε, γ and μ.The subunit structure of inhomogeneous immunoglobulin (Ig) and three-dimensional structure are well-known.

" antibody fragment " only comprises a part for complete antibody, and wherein said part preferably retains at least one item usually relevant with it when this part is present in complete antibody, preferably great majority or all functions.The example of antibody fragment comprises Fab, Fab', F (ab ') ₂with Fv fragment; Double antibody; Linear antibodies; Single-chain antibody molecules; And the multi-specificity antibody to be formed by antibody fragment.In one embodiment, antibody fragment comprises the antigen binding site of complete antibody, so retains the ability of conjugated antigen.In another embodiment, antibody fragment, such as comprise the antibody fragment in Fc district, retain at least one biological function usually relevant with it when being usually present in complete antibody with Fc district, such as FcRn combination, regulation and control antibody half life, ADCC function and complement combine.In one embodiment, antibody fragment is the Half-life in vivo univalent antibody substantially similar to complete antibody.Such as, such antibody fragment can comprise an antigen binding arm and its with can give this fragment and be connected with the Fc sequence of body internal stability.

Term " hypervariable region ", " HVR " or " HV " to refer in antibody variable domains alterable height in sequence and/or form the region of the ring that structure defines when for this paper.Usually, antibody comprises six HVR: three in VH (H1, H2, H3), and three in VL (L1, L2, L3).In natural antibody, H3 and L3 shows the maximum diversity of these six HVR, and thinks that particularly H3 plays unique effect in imparting antibody is with accurate specificity.See such as Xuetal., Immunity13:37-45 (2000); JohnsonandWu, inMethodsinMolecularBiology248:1-25 (Lo, ed., HumanPress, Totowa, NJ, 2003).In fact, the natural camelid of the existence antibody be only made up of heavy chain is have function and stable when lacking light chain.See such as Hamers-Castermanetal., Nature363:446-448 (1993); Sheriffetal., NatureStruct.Biol.3:733-736 (1996).

Use herein and contain describing of many HVR.Kabat complementary determining region (CDR) is based on sequence variability, and be the most frequently used (Kabatetal., sequence ofProteinsofImmunologicalInterest, 5thEd.PublicHealthService, NationalInstitutesofHealth, Bethesda, MD. (1991)).Chothia changes the position (ChothiaandLeskJ.Mol.Biol.196:901-917 (1987)) referring to structure ring into.It is compromise that AbMHVR represents between KabatHVR and Chothia structure ring, and obtain the use of AbM antibody modeling software of OxfordMolecular." contact (contact) " HVR is based on the analysis to obtainable complex crystal structure.Hereafter to have recorded in these HVR the residue of each.

HVR can comprise " HVR of extension " as follows: the 26-35 (H1) in 24-36 or 24-34 (L1) in VL, 46-56 or 50-56 (L2) and 89-97 or 89-96 (L3) and VH, 50-65 or 49-65 (H2) and 93-102,94-102 or 95-102 (H3).For each in these definition, variable domain residue is according to Kabat etc., the numbering that sees above.

" framework " or " FR " residue refers to those residues in variable domain except some hypervariable region residues as defined herein.

" humanization " form of inhuman (such as mouse) antibody refers to that bottom line comprises the chimeric antibody of the sequence derived from non-human immunoglobulin.In one embodiment, humanized antibody refers to the immunoglobulin (Ig) that HVR residue in human normal immunoglobulin (receptor antibody) is replaced with the HVR residue with non-human species's (donor antibody) such as mouse, rat, rabbit or the non-human primates of expecting specificity, avidity and/or ability.In some situation, the FR residue of human normal immunoglobulin is replaced with corresponding non-human residues.In addition, humanized antibody can be included in the residue do not found in receptor antibody or donor antibody.Carrying out these modifications can be performance in order to improve antibody further.Generally speaking, humanized antibody will comprise at least one, usual two whole following variable domains substantially, wherein whole or substantially whole height become ring and correspond to the Gao Bianhuan of non-human immunoglobulin, and whole or substantially whole FR be the FR of human normal immunoglobulin sequence.Humanized antibody optionally also will comprise at least part of constant region for immunoglobulin (Fc), normally the constant region of human normal immunoglobulin.More details are see such as Jonesetal., Nature321:522-525 (1986); Riechmannetal., Nature332:323-329 (1988); Presta, Curr.Op.Struct.Biol.2:593-596 (1992).Also can see such as VaswaniandHamilton, Ann.Allergy, Asthma & Immunol.1:105-115 (1998); Harris, Biochem.Soc.Transactions23:1035-1038 (1995); HurleandGross, Curr.Op.Biotech.5:428-433 (1994); And U.S. Patent No. 6,982,321 and 7,087,409.

" people's antibody " refers to have the aminoacid sequence corresponding with the aminoacid sequence of the antibody generated by people and/or use the antibody generated for any technology of raw human antibodies disclosed herein.This definition clear-cut of people's antibody gets rid of the humanized antibody comprising inhuman antigen binding residues.People's antibody can use multiple technologies known in the art to generate, and comprises phage display library (HoogenboomandWinter, J.Mol.Biol.227:381 (1991); Marksetal., J.Mol.Biol.222:581 (1991)).What also can be used for preparing human monoclonal antibodies is with the method recorded in Publication about Document: Coleetal., MonoclonalAntibodiesandCancerTherapy, AlanR.Liss, p.77 (1985); Boerneretal., J.Immunol.147 (1): 86-95 (1991).Also can see vanDijkandvandeWinkel, Curr.Opin.Pharmacol., 5:368-74 (2001).By giving, modified reply that antigenicity stimulates, the transgenic animal of raw human antibodies but its native gene group anergy such as pass through immune xenotypic mice (xenomice) administration of antigens to prepare people's antibody (see such as 6,075,181 and 6,150,584, about XENOMOUSE ^tMtechnology).Also can see such as Lietal., Proc.Natl.Acad.Sci.USA, 103:3557-3562 (2006), about the people's antibody generated through people B-cell hybridoma technique.

Term " monoclonal antibody " is for referring to the antibody obtained from the antibody of a group homogeneity substantially during this paper, each antibody namely forming colony is identical, except can may suddenly change except (such as natural existence sudden change) with indivisible existence.So, modifier " mono-clonal " shows that antibody is not the feature of different antibodies mixture.In certain embodiments, this type of monoclonal antibody typically comprises that comprise can in conjunction with the antibody of the peptide sequence of target thing, and its thing Binding peptide sequence that hits the more selects the process of single target thing Binding peptide sequence to obtain in peptide sequence by comprising comforming.Such as, chosen process can be polyclone (set that such as hybridoma clone, phage clone or recombinant DNA are cloned) middle selection Unique clones of comforming.Be to be understood that, selected target thing binding sequence can change further, such as in order to improve avidity to target thing, by target thing binding sequence humanization, improve its output in cell culture, reduce its immunogenicity in vivo, create multi-specificity antibody etc., and the antibody comprising the target thing binding sequence after change is also monoclonal antibody of the present invention.Different from the polyclonal antibody preparations typically comprised for the different antibodies of different determinant (epi-position), often kind of monoclonal antibody of monoclonal antibody preparations is for the single determinant on antigen.Outside their specificity, the advantage of monoclonal antibody preparations is that they are not subject to the pollution of other immunoglobulin (Ig) usually.

Modifier " mono-clonal " show antibody basically homogeneity antibody population obtain feature, should not be construed as require produce antibody by any ad hoc approach.Such as, the monoclonal antibody used according to the present invention is generated by multiple technologies, comprise such as hybridoma (such as KohlerandMilstein, Nature256:495-97 (1975); Hongoetal., Hybridoma, 14 (3): 253-260 (1995); Harlowetal., Antibodies:ALaboratoryManual, ColdSpringHarborLaboratoryPress, 2nded.1988; Hammerlingetal.; in: MonoclonalAntibodiesandT-CellHybridomas; 563-681; Elsevier; N.Y., 1981), recombinant DNA method is (see such as U.S. Patent No. 4,816; 567), display technique of bacteriophage is (see such as Clacksonetal., Nature352:624-628 (1991); Marksetal., J.Mol.Biol.222:581-597 (1992); Sidhuetal., J.Mol.Biol.338 (2): 299-310 (2004); Leeetal., J.Mol.Biol.340 (5): 1073-1093 (2004); Fellouse, Proc.Nat.Acad.Sci.USA101 (34): 12467-12472 (2004); And Leeetal., J.Immunol.Methods284 (1-2): 119-132 (2004)) and for generating the technology of people or human-like antibodies (see such as WO1998/24893 in the animal of gene with part or whole human immunoglobulin gene's seat or encoding human immunoglobulin's sequence; WO1996/34096; WO1996/33735; WO1991/10741; Jakobovitsetal., Proc.Natl.Acad.Sci.USA90:2551 (1993); Jakobovitsetal., Nature362:255-258 (1993); Bruggemannetal., YearinImmuno.7:33 (1993); U.S. Patent No. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016; Marksetal., Bio/Technology10:779-783 (1992); Lonbergetal., Nature368:856-859 (1994); Morrison, Nature368:812-813 (1994); Fishwildetal., NatureBiotechnol.14:845-851 (1996); Neuberger, NatureBiotechnol.14:826 (1996); And LonbergandHuszar, Intern.Rev.Immunol.13:65-93 (1995)).

Monoclonal antibody clearly comprises in this article " being fitted together to " antibody; a wherein part for heavy chain and/or light chain or homology identical with derived from the corresponding sequence of Special Thing species or genus in the antibody of specific antibodies classification or subclass; and the remainder of chain with derived from another species or belong to the identical or homology of corresponding sequence in the antibody of another antibody isotype or subclass; and the fragment of this antibody-like; as long as they show the biologic activity of expectation (see such as U.S. Patent No. 4; 816,567; Morrisonetal., Proc.Natl.Acad.Sci.USA81:6851-6855 (1984)).Chimeric antibody comprises " primatized " antibody, wherein the antigen binding domain of antibody is derived from the antibody by such as generating with antigen immune macaque interested.

Term " multi-specificity antibody " uses with most broad sense, and specifically contains and have the specific antibody of multi-epitope.This type of multi-specificity antibody includes but not limited to: comprise heavy chain variable domain (V _h) and light-chain variable domain (V _l) antibody, wherein V _hv _lunit has multi-epitope specificity; There is two or more V _land V _hthe antibody in territory, wherein each V _hv _lunit is in conjunction with different epi-position; Have the antibody of two or more single variable domains, wherein each single variable domain is in conjunction with different epi-position; Full length antibody; Antibody fragment, such as Fab, Fv, dsFv, scFv, double antibody, dual specific double antibody and three antibody and the antibody fragment be covalently or non-covalently connected.According to an embodiment, multi-specificity antibody be with 5 μMs to 0.001pM, 3 μMs to 0.001pM, 1 μM to 0.001pM, 0.5 μM to 0.001pM or the 0.1 μM avidity to 0.001pM in conjunction with the IgG antibody of each epi-position.

" multi-epitope specificity " refers to the ability of two or more different epi-positions on the identical or different antigen of specific binding.Such as, as used in this article, " dual specific " refers to the ability in conjunction with two kinds of different epi-positions." monospecific " refers to only in conjunction with a kind of ability of epi-position.

Statement " single domain antibody " (sdAb) or " single variable domain (SVD) antibody " refer generally to following antibody, wherein single variable domain (V _hor V _l) antigen combination can be given.In other words, single variable domain does not need to interact to identify target antigen with another variable domain.The example of single domain antibody comprise those from hunchbacked class animal (camelid) (yamma and camel) and selachian (such as twisted mouth shark) is derivative and those from recombination method from people and derivative (Nature (1989) 341:544-546 of mouse antibodies; DevCompImmunol (2006) 30:43-56; TrendBiochemSci (2001) 26:230-235; TrendsBiotechnol (2003): 21:484-490; WO2005/035572; WO03/035694; FebsLett (1994) 339:285-290; WO00/29004; WO02/051870).

" scFv " or " scFv " antibody fragment comprises the V of antibody _hand V _lstructural domain, wherein these structural domains are present on a polypeptide chain.Usually, scFv polypeptide is at V _hwith V _lcomprise peptide linker further between structural domain, it makes scFv can form the desired structure of conjugated antigen.About the summary of scFv see Pluckthun, in " ThePharmacologyofMonoclonalAntibodies ", the 113rd volume, Rosenburg and Moore compiles, Springer-Verlag, NewYork, 269-315 page, 1994.

" antigen " refers to the predetermined antigens that antibody alternative combines.Target antigen can be polypeptide, carbohydrate, nucleic acid, lipid, haptens or other compound that is naturally occurring or synthesis.

Term " double antibody " refers to the little antibody fragment with two antigen binding sites, and this fragment is at same polypeptide chain (V _h-V _l) in comprise connected heavy chain variable domain (V _h) and light-chain variable domain (V _l).Making by using too short joint can not match between on same chain two structural domains, forcing the complementary domain of these structural domains and another chain to match, thus produce two antigen binding sites.What double antibody was more complete is recorded in such as EP404, and 097; WO93/11161; And Hollingeretal., Proc.Natl.Acad.Sci.USA, 90:6444-6448 (1993).Three antibody (Triabody) and four antibody (tetrabody) are also recorded in Hudsonetal., Nat.Med.9:129-134 (2003).

Term " the variable domain residue according to Kabat is numbered " or " amino acid position number according to Kabat " and variant thereof refer to Kabatetal., and the antibody editor in seeing above is for the numbering system of heavy chain variable domain or light-chain variable domain.Use this numbering system, actual linear amino acid sequence can comprise less or other amino acid, corresponding to shortening or the insertion of variable domain FR or HVR.Such as, single amino acid after heavy chain variable domain can comprise H2 residue 52 inserts (be residue 52a according to Kabat) and insertion residue after heavy chain FR residue 82 (be such as residue 82a, 82b and 82c etc. according to Kabat).The Kabat residue numbering of given antibody is by contrasting homologous region to determine by antibody sequence and " standard " Kabat numbered sequence.

Kabat numbering system generally uses (such as Kabatetal. when mentioning the residue in variable domain (being approximately light chain residues 1-107 and heavy chain residues 1-113), sequence ofImmunologicalInterest.5thEd.PublicHealthService, NationalInstitutesofHealth, Bethesda, Md. (1991))." EU numbering system " or " EU index " is general uses (such as Kabatetal., the EU index of the middle report that sees above) when mentioning the residue in immunoglobulin heavy chain constant region." the EU index in Kabat " refers to the residue numbering of human IgG1 EU antibody.Unless otherwise indicated herein, mention that the residue in antibody variable domains numbers the residue numbering referred to according to Kabat numbering system.Unless otherwise indicated herein, mention that the residue in antibody constant territory numbers the residue numbering (for example, see U.S. Provisional Application 60/640,323, the figure about EU numbering) referred to according to EU numbering system.

" barrier " antibody or " Antagonism " antibody refer to the antibody of the biologic activity suppressing or reduce the antigen that it combines.Some blocking antibody or antagonistic antibodies essence or suppress the biologic activity of antigen completely.

Phrase " substantially similar " or " substantially the same " for represent during this paper two numerical value (such as one relate to antibody of the present invention and another relate to reference to/compare antibody) between sufficiently high similarity degree so that those skilled in the art will think having by the difference in the biological characteristics background measured by described numerical value (such as Kd value) between two numerical value very little or do not have biological significance.As the function of reference/comparative figure, the difference between described two numerical value is such as less than about 50%, be less than about 40%, be less than about 30%, be less than about 20% and/or be less than about 10%.

Phrase " substantive reduce " or " substantive different " for represent during this paper two numerical value (usual one relevant with certain molecule and another with reference/to compare molecule relevant) between sufficiently high difference degree so that those skilled in the art will think having significance,statistical by the difference in the biological characteristics background measured by described numerical value (such as Kd value) between two numerical value.As with reference to/compare the function of this numerical value of molecule, the difference between described two numerical value is such as greater than about 10%, is greater than about 20%, is greater than about 30%, be greater than about 40%, and/or be greater than about 50%.

Antibody " effector functions " refers to that those are attributable to antibody Fc district (native sequences Fc district or amino acid sequence variation Fc district) and the biologic activity changed with antibody isotype.The example of antibody mediated effect device function comprises: C1q combines and CDC (CDC); Fc receptors bind; The cytotoxicity (ADCC) of antibody dependent cellular mediation; Phagolysis; Cell surface receptor (such as B-cell receptor) is lowered; Activate with B cell.

Term " Fc district ", in this article for defining the C-end region of heavy chain immunoglobulin, comprises native sequences Fc district and variant Fc district.Although the border in heavy chain immunoglobulin Fc district can change, human IgG heavy chain Fc district is normally defined the section of the amino-acid residue from itself Cys226 or Pro230 position to C-terminal.The C-terminal lysines (residue 447, according to EU numbering system) in Fc district can be eliminated, such as produce or antibody purification process in, or by carrying out recombined engineering to the nucleic acid of encoding antibody heavy.Accordingly, complete antibody composition can comprise the antibody population eliminating all K447 residues, the antibody population not eliminating K447 residue or be mixed with and do not have the antibody population of antibody of K447 residue.

" functional Fc district " has " effector functions " in native sequences Fc district.Exemplary " effector functions " comprises C1q combination, CDC, Fc receptors bind, ADCC, phagolysis, cell surface receptor (such as B-cell receptor; BCR) lower.This type of effector functions general requirement Fc district combines with binding domain (such as antibody variable domains), and can use many measure method to assess, such as, in definition herein disclosed in.

" native sequences Fc district " comprises the identical aminoacid sequence of the aminoacid sequence in the Fc district found with occurring in nature.Native sequences people Fc district comprises native sequences human IgG1 Fc district (non-A and A allotype), native sequences human IgG2 Fc district, native sequences human IgG 3Fc district and native sequences human IgG 4Fc district, and naturally there is variant.

" variant Fc regions " comprises because at least one place is amino acid modified, preferably a place or many places amino acid replacement and the aminoacid sequence different with native sequences Fc district.Preferably, variant Fc regions have with native sequences Fc district or compared with the Fc district of parental polypeptide at least one place amino acid replacement, in native sequences Fc district or in the Fc district of parental polypeptide, such as have about 1 place to about 10 place's amino acid replacements, preferably about 1 place is to about 5 place's amino acid replacements.Variant Fc regions in this article by preferably and the Fc district of native sequences Fc district and/or parental polypeptide have homology at least about 80%, most preferably with its at least about 90% homology, more preferably with its at least about 95% homology.

" Fc acceptor " or " FcR " describe the acceptor in binding antibody Fc district.Preferred FcR is native sequences people FcR.In addition, preferred FcR is the FcR(γ acceptor in conjunction with IgG antibody), comprise the acceptor of Fc γ RI, Fc γ RII and Fc γ RIII subclass, comprise allelic variant and the alternative splice forms of these acceptors.Fc γ RII acceptor comprises Fc γ RIIA(" activated receptor ") and Fc γ RIIB(" suppression acceptor "), they have similar aminoacid sequence, and difference is main in its cytoplasmic domains.Activated receptor Fc γ RIIA comprises the activation motifs (ITAM) of immunity receptor based on tyrosine in its cytoplasmic domains.Suppress acceptor Fc γ RIIB in its cytoplasmic domains, comprise the suppression motif (ITIM) (see summary Da ё ron, Annu.Rev.Immunol.15:203-234 (1997)) of immunity receptor based on tyrosine.The summary of FcR is see RavetchandKinet, Annu.Rev.Immunol.9:457-492 (1991); Capeletal., Immunomethods4:25-34 (1994); DeHaasetal., J.Lab.Clin.Med.126:330-41 (1995).Term " FcR " also contains other FcR in this article, comprises will identifying those futures.

Term " Fc acceptor " or " FcR " also comprise neonatal receptor, FcRn, it is responsible for Maternal immunoglobulin G to be transferred to fetus (Guyeretal., J.Immunol.117:587 (1976) and Kimetal., J.Immunol.24:249 (1994)) and the running balance of immunity moderation sphaeroprotein.Measuring the method for the combination of FcRn is known (see such as GhetieandWard, Immunol.Today18:592-8 (1997)); Ghetieetal., NatureBiotechnology, 15 (7): 637-640 (1997); Hintonetal., J.Biol.Chem.279 (8): 6213-6216 (2004); WO2004/92219 (Hintonetal.).

Binding in vivo and the serum half-life of people FcRn high-affinity Binding peptide and people FcRn can be measured, such as, at the transgenic mice of expression people FcRn or in the human cell line of transfection, or in the primate that application of Fc variant polypeptide.PCT application WO00/42072 (Presta) and U. S. application No.12/577,967 (Lowman) describe the antibody variants improving the combination of FcR or reduce.Also can see Shieldsetal., J.Biol.Chem.9 (2): 6591-6604 (2001).

" people effector cell " refers to express one or more FcR and the white corpuscle of exercising effector functions.In certain embodiments, this cell is at least expressed Fc γ RIII and is exercised ADCC effector functions.The example of the human leukocyte of mediation ADCC comprises peripheral blood mononuclear cell (PBMC), NK cell (NK) cell, monocyte, cytotoxic T cell and neutrophilic granulocyte.Effector cell can be separated from its natural origin, such as blood.

" antibody dependent cellular mediation cytotoxicity " or " ADCC " refers to that the secretor type Ig be wherein attached on the upper Fc acceptor (FcR) existed of some cytotoxic cell (such as NK cell, neutrophilic granulocyte and scavenger cell) makes these cytotoxic effect cells can carry the target cell of antigen by specific binding, kills the cytotoxic form of target cell subsequently with cytotoxin.The main cell of mediation ADCC, NK cell, only expresses Fc γ RIII, and monocytes Fc γ RI, Fc γ RII and Fc γ RIII.The FcR that RavetchandKinet, Annu.Rev.Immunol.9:457-92 (1991) the 464th page table 3 summarizes on hematopoietic cell expresses.In order to the ADCC of purpose of appraisals molecule is active, external ADCC assay method can be carried out, such as U.S. Patent No. 5,500,362 or 5,821,337 or U.S. Patent No. 6,737,056 (Presta) in described.The effector cell that can be used for this type of assay method comprises PBMC and NK cell.Or/in addition, can the ADCC of purpose of appraisals molecule in vivo active, such as, in animal model, disclosed in such as Clynesetal., PNAS (USA) 95:652-656 (1998).

Dissolving to target cell when " CDC " or " CDC " refers to there is complement.The activation of CCP is initial by complement system first component (C1q) binding antibody (suitable subclass), and this antibody has been bonded to it and has closed associated antigen.In order to assess complement activation, CDC assay method can be carried out, such as, as described in Gazzano-Santoroetal., J.Immunol.Methods202:163 (1996).The polypeptide variants with the Fc region amino acid sequence (having the polypeptide of variant Fc regions) of change and the C1q binding ability of raising or reduction is recorded in such as U.S. Patent No. 6,194,551B1 and WO1999/51642.Also can see such as Idusogieetal., J.Immunol.164:4178-4184 (2000).

" antibody containing Fc district " refers to the antibody comprising Fc district.The C-terminal lysines (residue 447 according to EU numbering system) in Fc district can be eliminated, such as, in the process of antibody purification or by the nucleic acid of modified recombinant encoding antibody.Therefore, the composition comprising the antibody with Fc district according to the present invention can comprise the antibody with K447, the antibody eliminating all K447 or have the mixture with the antibody not having K447 residue.

With regard to this paper object, " acceptor people framework " comprises the framework that derived from human immunoglobulin framework or people have the aminoacid sequence of VL or the VH framework of framework." derived from " human normal immunoglobulin framework or the people acceptor people framework that has a framework can comprise aminoacid sequence identical with it, or can comprise the aminoacid sequence change be pre-existing in.When there is the amino acid change be pre-existing in, preferably existing and being no more than 5, preferably 4 or less, or 3 or the amino acid change that is less pre-existing in.When there is the amino acid change be pre-existing in VH, preferably those changes are only arranged in three, two or a position of 71H, 73H and 78H; Such as, the amino-acid residue being positioned at those positions can be 71A, 73T and/or 78A.In one embodiment, in sequence, have Frame sequence with VL human normal immunoglobulin Frame sequence or people identical for VL acceptor people framework.

" people has framework " refers to the framework of modal amino-acid residue in table human normal immunoglobulin VL or VH Frame sequence selected works.Usually, human normal immunoglobulin VL or VH sequence selected works are from variable region sequences subgroup.Usually, sequence subgroup is the subgroup as people such as Kabat.In one embodiment, for VL, subgroup is the subgroup κ IV as people such as Kabat.In one embodiment, for VH, subgroup is the subgroup I as people such as Kabat.

" VH subgroup I has framework " comprises the consensus sequence obtained from the aminoacid sequence the variable heavy chain subgroup I of the people such as Kabat.

" VH subgroup III has framework " comprises the consensus sequence obtained from the aminoacid sequence the variable heavy chain subgroup III of the people such as Kabat.

" VL subgroup IV has framework " comprises the consensus sequence obtained from the aminoacid sequence the variable light κ subgroup IV of the people such as Kabat.

" VL subgroup I has framework " comprises the consensus sequence obtained from the aminoacid sequence the variable light κ subgroup I of the people such as Kabat.

" medicine " or " medicament " refers to the active medicine being used for the treatment of discussed illness or its symptom or side effect.

" illness " or " disease " refers to that the illness of the treatment of substances/molecules of the present invention or method is benefited from any meeting.This comprises chronic and acute disease or disease, comprises those and makes Mammals tend to the pathological condition of discussed illness.The non-limitative example of illness to be treated herein comprises pernicious and innocent tumour; Cancer knurl, blastoma and sarcoma.

" pathology " of disease comprises all phenomenons jeopardizing patient's health and happiness.Such as, this include but not limited to abnormal or uncontrollable Growth of Cells, transfer, interference to the normal function of adjacent cells, the abnormal level release of cytokine or other secretory product, the suppression of inflammatory or immunological response or deterioration, etc.

Term " cell proliferative disorders " refers to the illness relevant with abnormal cell proliferation to a certain degree with " proliferative disorders ".In one embodiment, cell proliferative disorders refers to cancer.

No matter " tumour ", for referring to the growth of all neoplastic cell and propagation during this paper, is pernicious or optimum, and (pre-cancerous) and cancerous cells and tissue before all cancers.It is not mutually exclusive when term " cancer ", " carcinous ", " cell proliferative disorders ", " proliferative disorders " and " tumour " are mentioned in this article.

Term " cancer " and " carcinous " are pointed to or describe feature in Mammals and be generally the not modulated physiology illness of Growth of Cells/propagation.The example of cancer includes but not limited to cancer knurl, lymphoma, blastoma, sarcoma and leukemia.The more specifically example of this type of cancer comprises squamous cell carcinoma, small cell lung cancer, pituitary gland cancer, the esophageal carcinoma, astrocytoma, soft tissue sarcoma, nonsmall-cell lung cancer, the gland cancer of lung, the squama cancer of lung, peritoneal cancer, hepatocellular carcinoma, gastrointestinal cancer, carcinoma of the pancreas, glioblastoma, cervical cancer, ovarian cancer, liver cancer (livercancer), bladder cancer, hepatoma (hepatoma), mammary cancer, colorectal carcinoma, colorectal carcinoma, carcinoma of endometrium or uterus carcinoma, salivary-gland carcinoma, kidney (kidneycancer, renalcancer), prostate cancer, carcinoma vulvae, thyroid carcinoma, liver cancer (hepaticcarcinoma), the cancer of the brain, carcinoma of endometrium, carcinoma of testis, cholangiocarcinoma, carcinoma of gallbladder, cancer of the stomach, melanoma, and various types of head and neck cancer.

There are many illnesss that imbalance can cause treating by the compositions and methods of the invention in blood vessel.These illnesss comprise non-superfluous natural disposition with the illness of superfluous natural disposition.Superfluous sick include but not limited to as described above those.

Be applicable to including but not limited to such as undesired or abnormal hypertrophy by the non-true tumor situation of antibody of the present invention and antibody fragment treatment, benign prostatauxe, pain (acute and chronic), comprise inflammatory pain, sacroiliitis, rheumatoid arthritis (RA), psoriatic arthritis, (such as Alzheimer (Alzheimer) family name is sick for neurodegenerative disease, AIDS related dementias, Parkinson (Parkinson) family name is sick, amyotrophic lateral sclerosis, retinitis pigmentosa, Duchenne-Arandisease and cerebellar degeneration), autoimmune disorder, psoriatic, plaque psoriasis, sarcoidosis, atherosclerosis, atherosclerotic plaque, this (Hasimoto) family name thyroiditis of bridge, angiogenesis disorders, ocular histoplasmosis's syndrome (presumedocularhistoplasmosissyndrome) of such as supposing of disease of eye, retinal vessel is formed, diabetic retinopathy and other proliferating retinopathy comprise retinopathy of prematurity, diabetic nephropathy, microstructure hyperplasia after lens, neovascular glaucoma, senile macular degeneration SMD, diabetic macular edema, cornea neovascularization, corneal graft neovascularization, corneal graft rejection, retina/choroidal neovascular is formed, the neovascularization (rubescent) at canthus, ocular neovascular disorders, vascular disease, relate to the situation of vascular endothelial abnormality proliferation, vascular restenosis, Ge-Ba (Guillain-Barre) syndrome, polyp is polyp of colon such as, familial adenomatosis polyposis, nasal polyp or Polyp of gastrointestinal tract, gastroenteritic ulcer, infantile hypertrophic pyloric stenosis, uropoiesis Chiari syndrome, Men Neiteliai (Menetrier) family name is sick, endocrine active adenoma or protein-loss syndrome (proteinlosssyndrome), fibroadenoma, respiratory disease, cholecystitis, neurofibromatosis, arteriovenous malformotion (AVM), meningioma, vascular tumor, hemangiofibroma, thyroid hyperplasia (comprising Robert Graves (Grave) family name sick), cornea and other tissue transplantation, inflammatory diseases, chronic inflammatory diseases, the inflammation of lung, acute lung injury/ARDS, septicemia/Sepsis, chronic obstructive pulmonary disease, primary pulmonary hypertension, malignant pulmonary hydrops, congee sample spot, burn, wound, radiation, apoplexy, oedema after anoxic or ischemic, oedema caused by myocardial infarction, ischemic injuries, damage after cerebral ischemic event, cerebral edema (such as relevant with Acute Stroke/closed head injury/wound), the thrombus caused by platelet aggregation, Fibrotic or edema disease such as liver cirrhosis, pulmonary fibrosis, carcoidosis, throiditis, systematicness hyperviscosity syndrome, synovial membrane inflammation (synovialinflammation), pannus in RA is formed, myositis ossificans, hypertrophy bone forming, bone associated pathology, such as osteoarthritis (OA), rickets and osteoporosis, refractory ascites, bone or Joint Inflammation, myelodysplastic syndrome (MyelodysplasticSyndrome), aplastic anemia, kidney or liver, the hypersensitivity disease of T cell mediation, Paget (Paget) family name is sick, POLYCYSTIC KIDNEY DISEASE, 3rd space fluid disease (3rdspacingoffluiddiseases) (pancreatitis, compartment syndrome, burn, enteropathy), chronic inflammatory diseases is IBD(Ke Laien (Crohn) family name disease and ulcerative colitis such as), kidney disorders, renal allograft rejection, graft versus host disease (GVH disease) or transplant rejection, inflammatory bowel, acute and chronic nephropathy (comprising the ephrosis of proliferative glomerulonephritis and diabetes-induced), nephrotic syndrome, undesirable or abnormal tissue block growth (non-cancer), fat, fatty tissue block grows, bleeder's joint, hypertrophic cicatrix, the suppression of hair growth, Ao Sile-weber-Lang Di (OslerWeber-Rendu) syndrome, botryomycosis hominis Terry's sign, scleroderma, trachoma, blood vessel adhesion, synovitis, the allergy of skin, skin disorder comprises psoriatic and dermatitis, eczema, photoaging (such as being caused by UV irradiation human skin), hypertrophic cicatrix is formed, reproduction illness, such as endometriosis, ovary stimulation oversaturation syndrome, PCOD, preeclampsia, anovulatory dysfunctional uterine hemorrhage, or menorrhagia, uterus fibrid knurl, premature labor, ascites, pericardial effusion (such as relevant with pericarditis), hydrothorax, endotoxin shock and fungi infestation, certain micro-organisms infects, comprise and be selected from adenovirus, Hantaan virus (hantaviruses), B. burgdorferi (Borreliaburgdorferi), the microbial pathogen of Yersinia (Yersiniaspp.) and Bordetella pertussis (Bordetellapertussis), with psychiatric disorders (such as schizophrenia, bipolar depression, autism, and attention deficit disorder).

Term " before cancer " refers to typically before cancer or develop into illness or the growth of cancer." before cancer " growth can have regulate with aberrant cell cycles, propagation or be divided into the cell of feature, these marks by Cycle Regulation, cell proliferation or differentiation measure.

" heteroplasia " refers to any misgrowth or the growth of tissue, organ or cell.In certain embodiments, heteroplasia is senior or before cancer.

" transfer " refers to that cancer is transmitted to other position in health from its original site.Cancer cells can depart from primary tumor, infiltrates through lymph and blood vessel, circulate via blood flow and other place in the body healthy tissues in far-end focus (transfer) in grow.Transfer can be local or far-end.Transfer is a successive processes, comes off, propagate and stop at distal site via blood flow or lymphsystem depending on tumour cell from primary tumor.At new position, this cell is set up blood and is supplied and can grow to form life-threatening agglomerate.In certain embodiments, term metastatic tumo(u)r refers to shift, but is not yet transferred to the tissue in other places or the tumour of organ in health.In certain embodiments, term metastatic tumo(u)r refers to be transferred to the tissue in other places or the tumour of organ in health.

Pungency in tumour cell and inhibition molecular pathways regulate this behavior, and the interaction between host cell in tumour cell and distal site is also important.

" non-diverting " refers to optimum or is retained in original site and not yet infiltrates through lymph or vascular system or infiltrate into the cancer of the tissue beyond original site.Generally speaking, non-metastatic cancer refers to as is any cancer of 0 phase, I phase or II phase cancer and III phase cancer once in a while.

As used in this article, " transfer before organ (pre-metastaticorgan) " or " before transfer tissue " refer to the organ or tissue that wherein do not detect from primary tumor or the cancer cells from health another part.In certain embodiments, as used in this article, before transfer, organ or the front tissue of transfer refer to be in cancer cells from primary tumor or the organ or tissue propagating the stage before so far organ or tissue occurs from health another part.Before transfer, the example of organ or the front tissue of transfer includes but not limited to lung, liver, brain, ovary, bone and marrow.

" primary tumor " or " primary cancer " refers to initial cancer, instead of is arranged in the metastatic lesion of another tissue of experimenter's health, organ or position.

" transfer organ " or " transfer tissue (metastaticorgan) " uses with most broad sense, refers to wherein from the cancer cells of primary tumor or the organ or tissue that propagated from the cancer cells of health another part.The example of transfer organ and transfer tissue includes but not limited to lung, liver, brain, ovary, bone and marrow.

" cancer return " refers to that cancer is returned after the treatment in this article, and comprises cancer returning in primary organ, and far-end recurrence, and namely cancer occurs beyond primary organ.

" tumor burden " refers to the amount of the number of cancer cells in health, the size of tumour or cancer.Tumor burden is also referred to as tumor load.

" tumor number " refers to the number of tumour.

When for this paper, " treatment " or " process " refers to attempt change the clinical intervention that the nature process of individuality or cell is treated by institute, can be to prevent or carrying out in the process of clinical pathology.The desired effects for the treatment of comprise prophylactic generation or recurrence, relief of symptoms, weakening disease any direct or indirect pathological consequences, slow down progression of disease speed, improve or the state and exempt or improve prognosis of palliating a disease.In some embodiment, antibody of the present invention is for postponing the generation/development of disease or illness.

Term " anti-tumor compositions " refers to the composition that can be used for Therapeutic cancer, and it comprises at least one active therapeutic agent, such as " carcinostatic agent ".The medicament that the example of therapeutical agent (such as carcinostatic agent) includes but not limited to use in such as chemotherapeutics, growth inhibitor, cytotoxic agent, radiotherapy, antiangiogenic agent, apoptosis agent, antitublin and other be used for the treatment of medicament such as anti-HER-2 antibody, anti-CD20 antibodies, EGF-R ELISA (EGFR) antagonist (such as tyrosine kinase inhibitor), the HER1/EGFR inhibitor (such as erlotinib (TARCEVA of cancer ^tM), Thr6 PDGF BB inhibitor (such as Gleevec ^tM(ImatinibMesylate)), cox 2 inhibitor (such as celecoxib (celecoxib)), Interferon, rabbit, cytokine, can one or more target things in ErbB2, ErbB3, ErbB4, PDGFR-β, BlyS, APRIL, BCMA or vegf receptor be combined antagonist (such as neutrality antibody), TRAIL/Apo2 and other biological activity and organic chemistry agent etc.The present invention also comprises their combination.

Term " anti-cancer therapies " or " cancer therapy " refer to therapy useful in Therapeutic cancer.The example of anticancer therapeutic agent includes but not limited to the medicament of medicament, antiangiogenic agent, apoptosis agent, antitublin and other Therapeutic cancer used in such as chemotherapeutics, growth inhibitor, cytotoxic agent, radiotherapy, such as anti-HER-2 antibody, anti-CD20 antibodies, EGF-R ELISA (EGFR) antagonist (such as tyrosine kinase inhibitor), HER1/EGFR inhibitor (such as erlotinib ), Thr6 PDGF BB inhibitor (such as (ImatinibMesylate)), cox 2 inhibitor (such as celecoxib), (cetuximab, Imclone), Interferon, rabbit, cytokine, in conjunction with the antagonist (such as neutrality antibody) (ErbB2, ErbB3, ErbB4, PDGFR-β, BlyS, APRIL, BCMA or vegf receptor, TRAIL/Apo2) of one or more following target things and other biological activity and organic chemistry agent, etc.The present invention also comprises their combination.

" radiotherapy " or " radiotherapy " refers to use directed gamma ray or beta ray to bring out enough damages to cell, the ability worked orderly with restrictive cell or destroy cell completely.Will be appreciated that many modes are known to determine dosage and the time length for the treatment of in this area.Typical treatment gives as applied once, and typical dosage range is 10-200 unit every day (gray(Gy) (Gray)).

Term " VEGF " and " VEGF-A " are for referring to 165 amino acid whose human vascular endothelial growth factors and relevant 121,189 and 206 amino acid whose human vascular endothelial growth factors during this paper, as (1991) Mol.Endocrin such as (1989) Science246:1306 and Houck such as Leung, described in 5:1806, and naturally there is allelic form and form processing.Term " VEGF " also refers to the VEGF from non-human species such as mouse, rat or primate.Sometimes, the VEGF from specific species is expressed as follows, and hVEGF represents people VEGF, and mVEGF represents mouse VEGF, etc.Term " VEGF " is also used in reference to and comprises the amino acid 8-109 position of 165 amino acid whose human vascular endothelial growth factors or the clipped form polypeptide of 1-109 position.Can by such as " VEGF (8-109) ", " VEGF (1-109) ", " VEGF-A in the application ₁₀₉" or " VEGF ₁₆₅" differentiate this type of form VEGF any.The amino acid position of " brachymemma " natural VE GF is numbered as shown in native VEGF sequence.Such as, the 17th amino acids (methionine(Met)) in the natural VE GF of brachymemma is also the 17th (methionine(Met)) in natural VE GF.The natural VE GF of brachymemma has the binding affinity to KDR and Flt-1 acceptor suitable with natural VE GF.

" VEGF antagonist " refers to can to neutralize, block, suppress, eliminate, reduce or disturb the molecule of the VEGF activity combination of vegf receptor (include but not limited to itself and one or more).VEGF antagonist includes but not limited to VEGF antibody and Fab thereof, specific binding VEGF makes its isolated acceptor molecule with one or more receptors bind and derivative, anti-vegf receptor antibody, vegf receptor antagonist (such as the micromolecular inhibitor of VEGFR Tyrosylprotein kinase) and immunoadhesin such as VEGFTrap in conjunction with VEGF thus.As used herein, term " VEGF antagonist " clearly comprises in conjunction with VEGF and can neutralize, blocks, suppresses, eliminates, reduces or disturb the molecule of VEGF activity.So, term " VEGF is active " clearly comprises the VEGF biologic activity of VEGF mediation.

Term " biologic activity " and " having biologic activity " about VEGF polypeptide or " VEGF active " refer to the physical/chemical properties relevant with the VEGF of total length and/or brachymemma and biological function.In certain embodiments, VEGF activity is for inducing and/or stimulating and/or promote that blood vessel occurs.In certain embodiments, VEGF activity is for inducing and/or stimulating and/or promote neovascularization.In certain embodiments, VEGF activity is induction and/or modulating vascular permeability.In certain embodiments, VEGF activity is for inducing and/or stimulating and/or promote endothelial cell migration and/or endothelial cell proliferation.

Anti-vegf neutrality antibody containment various human tumour cell ties up to growth (Kimetal., Nature362:841-844 (1993) in nude mice; Warrenetal., J.Clin.Invest.95:1789-1797 (1995); etal., CancerRes.56:4032-4039 (1996); Melnyketal., CancerRes.56:921-924 (1996)), but also suppress the ocular angiogenesis in the model of ischemic retinopathies disease that (Adamisetal., Arch.Ophthalmol.114:66-71 (1996)) occur.

Term " VEGF antibody " or " antibody in conjunction with VEGF " refer to can with the antibody of enough avidity and specific binding VEGF, and this antibody can be used as diagnostic reagent and/or therapeutical agent in target VEGF.Such as, VEGF antibody of the present invention and can be intervened wherein to relate in the disease of VEGF activity or illness and is used as therapeutical agent at target.See such as United States Patent (USP) 6,582,959,6,703,020; WO98/45332; WO96/30046; WO94/10202; WO2005/044853; EP0666868B1; U.S. Patent application 20030206899,20030190317,20030203409,20050112126,20050186208 and 20050112126; Popkovetal., JournalofImmunologicalMethods288:149-164 (2004); And WO2005012359.Selected antibody has the enough strong binding affinity for VEGF usually.Such as described antibody can with the K between 100nM-1pM _dvalue is in conjunction with hVEGF.Affinity of antibody can by the assay method (such as BIAcore assay method, described in PCT application publication number WO2005/012359) such as resonated based on surperficial plasmon; Enzyme-linked immunosorbent assay (ELISA); Measure with competition assay (such as RIA).Described antibody can carry out other biological activity assavs, such as, in order to assess its effect as therapeutical agent.This type of assay method is known in the art, and depends on target antigen and the desired use of described antibody.Example comprises HUVEC and suppresses assay method; Growth of tumour cell suppresses assay method (as such as described in WO89/06692); The cytotoxicity (ADCC) of antibody dependent cellular and cytotoxicity (CDC) assay method (United States Patent (USP) 5,500,362) of complement-mediated; And agonistic activities or hematopoiesis assay method (see WO95/27062).VEGF antibody usually can not in conjunction with other VEGF homologue, such as VEGF-B, VEGF-C, VEGF-D or VEGF-E, also can not in conjunction with other somatomedin, such as PlGF, PDGF or bFGF.In one embodiment, the monoclonal anti VEGF antibody A 4.6.1 that VEGF antibody comprises with hybridoma ATCCHB10709 generates is in conjunction with the monoclonal antibody of identical epi-position; Recombinant humanized Anti-X activity (see Prestaetal. (1997) CancerRes.57:4593-4599), include but not limited to be called rhuMAb-VEGF i.e. " rhuMAb-VEGF (BV) ", also referred to as " rhuMAbVEGF " or " " antibody. it is current commodity.RhuMAb-VEGF comprises human IgG1's framework region of sudden change and A.4.6.1(it blocks people VEGF in conjunction with its acceptor from murine antibody) antigen in conjunction with complementary determining region.Aminoacid sequence (comprising most of framework region) the derived from human IgG1 of rhuMAb-VEGF about 93%, and the sequence of about 7% is derived from A4.6.1.RhuMAb-VEGF has about 149,000 daltonian molecular weight, and is glycosylated.RhuMAb-VEGF and other humanization VEGF antibody are recorded in the U.S. Patent No. 6,884,879 of bulletin on February 26th, 2005 further.Other VEGF antibody comprises G6 or B20 series antibody (such as G6-23, G6-31, B20-4.1), described in PCT application publication number WO2005/012359.Other preferred antibody see U.S. Patent No. 7,060,269,6,582,959,6,703,020; 6,054,297; WO98/45332; WO96/30046; WO94/10202; EP0666868B1; U.S. Patent Application Publication No. 2006009360,20050186208,20030206899,20030190317,20030203409 and 20050112126; And Popkovetal., JournalofImmunologicalMethods288:149-164 (2004).

As used in this article, term " B20 series polypeptide " refers to the polypeptide of the antibody comprised in conjunction with VEGF.B20 series polypeptide includes but not limited to from the derivative antibody of the sequence of B20 antibody or the open text No.20060280747 of the U.S., the B20 recorded in the open text No.20070141065 of the U.S. and/or the open text No.20070020267 of the U.S. derives antibody, by addressing clearly by the content of these patent applications income herein.In one embodiment, B20 series polypeptide is the open text No.20060280747 of the U.S., the B20-4.1 recorded in the open text No.20070141065 of the U.S. and/or the open text No.20070020267 of the U.S..In another embodiment, B20 series polypeptide is the B20-4.1.1 recorded in the open text No.WO2009/073160 of PCT, by addressing by its entire disclosure income herein.

As used in this article, term " G6 series polypeptide " refers to the polypeptide of the antibody comprised in conjunction with VEGF.G6 series polypeptide includes but not limited to that, from the derivative antibody of the sequence of G6 antibody or the open text No.20060280747 of the U.S., the G6 recorded in the open text No.20070141065 of the U.S. and/or the open text No.20070020267 of the U.S. derives antibody.The G6 series polypeptide recorded in the open text No.20060280747 of the U.S., the open text No.20070141065 of the U.S. and/or the open text No.20070020267 of the U.S. includes but not limited to G6-8, G6-23 and G6-31.

" angiogenesis factor " or " anti-angiogenesis agent " refers to stimulate vascular development, such as, promote that the somatomedin of (angiogenesis), endothelial cell growth, stabilization of vascular and/or vasculogenesis (vasculogenesis) etc. occurs blood vessel.Such as, angiogenesis factor includes but not limited to the member (VEGF-B of such as VEGF and VEGF family, VEGF-C and VEGF-D), PlGF, PDGF family, fibroblast growth family (FGF), TIE part (angiogenin), ephrin, Delta sample part 4 (DLL4), Del-1, acid (aFGF) and alkalescence (bFGF) fibroblast growth factor, follistatin (Follistatin), granulocyte colony-stimulating factor (G-CSF), pHGF (HGF)/scattering factor (SF), interleukin-8 (IL-8), Leptin, Midkine, Neuropilin, placenta growth factor, thymidine phosphorylase/platelet-derived endothelial cell growth factor (PD-ECGF), Thr6 PDGF BB is PDGF-BB or PDGFR-β especially, Pleiotrophin (PTN), Progranulin, Proliferin, transforminggrowthfactor-α (TGF-α), transforming growth factor-beta (TGF-β), tumor necrosis factor-alpha (TNF-α) etc.It also comprises the factor of accelerating wound healing, the member of such as tethelin, insulin like growth factor-1 (IGF-I), VIGF, Urogastron (EGF), CTGF and family thereof and TGF-α and TGF-β.See such as KlagsbrunandD ' Amore (1991) Annu.Rev.Physiol.53:217-39; StreitandDetmar (2003) Oncogene22:3172-3179; Ferrara & Alitalo (1999) NatureMedicine5 (12): 1359-1364; Tonini etc. (2003) Oncogene22:6549-6556 (such as enumerating the table 1 of known angiogenesis factor); Sato (2003) Int.J.Clin.Oncol.8:200-206.

" antiangiogenic agent " or " angiogenesis inhibitor " refers to or directly or indirectly suppresses blood vessel that (angiogenesis), the small molecular weight material of vasculogenesis (vasculogenesis) or undesired vascular permeability, polynucleotide, polypeptide, the protein of separation, recombinant protein, antibody or its conjugate or fusion rotein occur.Such as, antiangiogenic agent is antibody or other antagonist of anti-angiogenesis agent defined above, the antibody of such as VEGF, the antibody of vegf receptor, blocking VEGF receptor signal conduction small molecules (such as PTK787/ZK2284, SU6668, (sunitinibmalate), AMG706).Antiangiogenic agent also comprises native blood vessels generation inhibitor, such as angiostatin (angiostatin), endostatin (endostatin) etc.See such as KlagsbrunandD ' Amore, Annu.Rev.Physiol., 53:217-39 (1991); StreitandDetmar, Oncogene, 22:3172-3179 (2003) (such as enumerating the table 3 of anti-angiogenic therapies in malignant melanoma); Ferrara & Alitalo, NatureMedicine5 (12): 1359-1364 (1999); Toninietal., Oncogene, 22:6549-6556 (2003) (such as enumerating the table 2 of anti-angiogenic factors); SatoInt.J.Clin.Oncol., 8:200-206 (2003) (such as enumerating the table 1 of the antiangiogenic agent used in clinical trial).In certain embodiments, antiangiogenic agent is anti-vegf agent, such as VEGF antibody (such as rhuMAb-VEGF)

Term " cytotoxic agent " for refer to during this paper suppress or prevent the function of cell and/or cause the material of cytoclasis.This term intention comprises: radio isotope, such as At ²¹¹, I ¹³¹, I ¹²⁵, Y ⁹⁰, Re ¹⁸⁶, Re ¹⁸⁸, Sm ¹⁵³, Bi ²¹², P ³²with the radio isotope of Lu; Chemotherapeutics, such as methotrexate (methotrexate), Zorubicin (adriamycin), vinca alkaloids (vincaalkaloids) (vincristine(VCR) (vincristine), vinealeucoblastine(VLB) (vinblastine), Etoposide (etoposide)), Dx (doxorubicin), melphalan (melphalan), mitomycin (mitomycin) C, Chlorambucil (chlorambucil), daunorubicin (daunorubicin) or other intercalator; Enzyme and fragment thereof, such as nucleolytic enzyme; Microbiotic; And toxin, the enzyme of such as small molecule toxins or bacterium, fungi, plant or animal origin is lived toxin, comprises its fragment and/or variant; And the various antitumour drug hereafter disclosed or anticarcinogen.Hereafter describe other cytotoxic agent.Kill the destruction that tumour efficacy-enhancing ingredient plays tumour cell.

" toxin " refers to any material that can produce deleterious effects to the growth of cell or propagation.

" chemotherapeutics " refers to the chemical compound that can be used for Therapeutic cancer.The example of chemotherapeutics comprises alkylating agent class (alkylatingagents), such as phosphinothioylidynetrisaziridine (thiotepa) and endoxan (cyclophosphamide) Alkyl sulfonate esters class (alkylsulfonates), such as busulfan (busulfan), Improsulfan (improsulfan) and piposulfan (piposulfan); Aziridines (aziridines), such as Benzodepa (benzodepa), card ripple quinone (carboquone), U.S. appropriate in sending (meturedepa) and uredepa (uredepa); Ethylenimine class (ethylenimines) and methylmelamine class (methylamelamines), comprise hemel (altretamine), triethylenemelamine (triethylenemelamine), APO (triethylenephosphoramide), TESPA (triethylenethiophosphoramide) and trimethylolmelamine (trimethylolomelamine); Annonaceousacetogenicompounds (acetogenin) (especially bullatacin (bullatacin) and bullatacin ketone (bullatacinone)); Delta-9-Tetrahydrocannabinol (tetrahydrocannabinol) (Dronabinol (dronabinol), ); β-lapachol (lapachone); Lapachol (lapachol); Colchicine class (colchicines); Betulic acid (betulinicacid);Camptothecine (camptothecin) (comprises synthetic analogues Hycamtin (topotecan) CPT-11(Irinotecan (irinotecan), ), acetyl camptothecine, scopoletin (scopoletin) and 9-aminocamptothecin), bryostatin (bryostatin), callystatin, CC-1065(comprises its Adozelesin (adozelesin), Carzelesin (carzelesin) and Bizelesin (bizelesin) synthetic analogues), podophyllotoxin (podophyllotoxin), podophyllic acid (podophyllinicacid), Teniposide (teniposide), hidden algae element class (cryptophycins) (particularly hidden algae element 1 and hidden algae element 8), dolastatin (dolastatin), duocarmycin(comprises synthetic analogues, KW-2189 and CB1-TM1), Eleutherobin (eleutherobin), pancratistatin, sarcodictyin, sponge chalone (spongistatin), nitrogen mustards (nitrogenmustards), such as Chlorambucil (chlorambucil), Chlornaphazine (chlornaphazine), courage phosphamide (cholophosphamide), Estramustine (estramustine), ifosfamide (ifosfamide), chlormethine (mechlorethamine), mustron (mechlorethamineoxidehydrochloride), melphalan (melphalan), novoembichin (novembichin), phenesterin (phenesterine), prednimustine (prednimustine), Trofosfamide (trofosfamide), uracil mastard (uracilmustard),Nitrosourea (nitrosoureas), such as BCNU (carmustine), chlorozotocin (chlorozotocin), Fotemustine (fotemustine), lomustine (lomustine), Nimustine (nimustine) and Ranimustine (ranimustine), antibiotics, such as Enediyne Antibiotic (enediyne) (as Calicheamicin (calicheamicin), especially Calicheamicin γ 1I and Calicheamicin ω I1(are see for example Nicolaouetal., Angew.ChemIntl.Ed.Engl., 33:183-186 (1994)), CDP323, a kind of oral administration of alpha-4 integrin inhibitor, anthracycline antibiotic (dynemicin), comprises dynemicinA, Ai Sibo mycin (esperamicin), and Neocarzinostatin (neocarzinostatin) chromophore and related colour albumen Enediyne Antibiotic chromophore), aclacinomycin (aclacinomycin), D actinomycin D (actinomycin), anthramycin (anthramycin), azaserine (azaserine), bleomycin (bleomycin), act-C (cactinomycin), carabicin, carminomycin (carminomycin), cardinophyllin (carzinophilin), chromomycin (chromomycin), actinomycin D (dactinomycin), daunorubicin (daunorubicin), Detorubicin (detorubicin), 6-phenodiazine-5-oxygen-L-nor-leucine, Doxorubicin (doxorubicin) (comprises morpholino Doxorubicin, Cyanomorpholino Doxorubicin, 2-pyrroles are for Doxorubicin, doxorubicin hydrochloride liposome injection Liposomal doxorubicin TLCD-99 PEGization liposomal doxorubicin and deoxydoxorubicin), epirubicin (epirubicin), esorubicin (esorubicin), idarubicin (idarubicin), marcellomycin (marcellomycin), mitomycin (mitomycins) is such as mitomycin C, mycophenolic acid (mycophenolicacid), nogalamycin (nogalamycin), olivomycin (olivomycin), Peplomycin (peplomycin), porfiromycin (potfiromycin), puromycin (puromycin), triferricdoxorubicin (quelamycin), rodorubicin (rodorubicin), streptonigrin (streptonigrin), streptozotocin (streptozocin), tubercidin (tubercidin), ubenimex (ubenimex), Zinostatin (zinostatin), zorubicin (zorubicin), antimetabolite class, such as methotrexate (MTX), gemcitabine (gemcitabine) Pemetrexed (pemetrexed) Tegafur (tegafur) Capecitabine (capecitabine) Epothilones (epothilone) and 5 FU 5 fluorouracil (5-FU); Folacin, such as denopterin (denopterin), methotrexate (MTX), pteroyltriglutamic acid (pteropterin), Trimetrexate (trimetrexate); Purine analogue, such as fludarabine (fludarabine), Ismipur (mercaptopurine), ITG (thiamiprine), thioguanine (thioguanine); Pyrimidine analogue, such as ancitabine (ancitabine), azacitidine (azacitidine), 6-azauridine, Carmofur (carmofur), cytarabine (cytarabine), two BrdU (dideoxyuridine), doxifluridine (doxifluridine), enocitabine (enocitabine), floxuridine (floxuridine); Androgens, such as calusterone (calusterone), dromostanolone propionate (dromostanolonepropionate), epitiostanol (epitiostanol), Mepitiostane (mepitiostane), Testolactone (testolactone); Anti-adrenal gland class, such as aminoglutethimide (aminoglutethimide), mitotane (mitotane), Trilostane (trilostane);Folic acid supplement, such as folinic acid (folinicacid); Aceglatone (aceglatone); Aldophosphamide glucosides (aldophosphamideglycoside); Amino-laevulic acid (aminolevulinicacid); Eniluracil (eniluracil); Amsacrine (amsacrine); Bestrabucil; Bisantrene (bisantrene); Edatrexate (edatraxate); Defosfamide (defosfamide); Demecolcine (demecolcine); Diaziquone (diaziquone); Elfornithine; Elliptinium Acetate (elliptiniumacetate); Epothilone; Ethoglucid (etoglucid); Gallium nitrate; Hydroxyl urea (hydroxyurea); Lentinan (lentinan); Lonidamine (lonidamine); Maytansinoid class (maytansinoids), such as maytansine (maytansine) and ansamitocin (ansamitocin); Mitoguazone (mitoguazone); Mitoxantrone (mitoxantrone); Mopidamol (mopidamol); C-283 (nitracrine); Pentostatin (pentostatin); Phenamet (phenamet); THP (pirarubicin); Losoxantrone (losoxantrone); 2-ethyl hydrazides (ethylhydrazide); Procarbazine (procarbazine); Polysaccharide compound (JHSNaturalProducts, Eugene, OR); Razoxane (razoxane); Rhizomycin (rhizoxin); Sizofiran (sizofiran); Spirogermanium (spirogermanium); Tenuazonic acid (tenuazonicacid); Triethyleneiminobenzoquinone (triaziquone); 2,2', 2 " RA3s; Trichothecin class (trichothecenes) (especially T-2 toxin, verrucarine (verrucarin) A, roridin (roridin) A and the rhzomorph (anguidin) that crawls); Urethane (urethan);Eldisine (vindesine) ( ); Dacarbazine (dacarbazine); Mannomustin (mannomustine); Dibromannitol (mitobronitol); Mitolactol (mitolactol); Pipobroman (pipobroman); Gacytosine; Cytarabine (arabinoside) (" Ara-C "); Phosphinothioylidynetrisaziridine (thiotepa); Taxoid (taxoids), for example Taxol (paclitaxel) The nano particle formulation Taxol (ABRAXANE of albumin transformation ^TM) and Taxotere (doxetaxel) Chlorambucil (chlorambucil); 6-thioguanine (thioguanine); Purinethol (mercaptopurine); Methotrexate (MTX) (methotrexate); Platinum analogs, such as cis-platinum (cisplatin),Oxaliplatin (oxaliplatin) (for example ) and carboplatin (carboplatin); Changchun medicine class (vincas), it stops tubulin polymerization to form microtubule, comprises vincaleukoblastinum (vinblastine) Vincristine (vincristine) Eldisine (vindesine) ( ) and vinorelbine (vinorelbine) Etoposide (etoposide) (VP-16); Ifosfamide (ifosfamide); Mitoxantrone (mitoxantrone); Folinic acid (leucovorin); NSC-279836 (novantrone); Edatrexate (edatrexate); Daunomycin (daunomycin); Aminopterin (aminopterin); Ibandronate (ibandronate); Topoisomerase enzyme inhibitor RFS2000; DFMO (DMFO); Class Tretinoin (retinoids), such as Tretinoin (retinoicacid), comprises bexarotene (bexarotene) Diphosphonates (bisphosphonates), such as clodronate (clodronate) (for example Or ), etidronate (etidronate) NE-58095,Zoledronic acid/zoledronate (zoledronicacid/zoledronate) Alendronate (alendronate) Pamidronate (pamidronate) Tiludronate (tiludronate) Or Risedronate (risedronate) And troxacitabine (troxacitabine) (DOX nucleosides analogue of cytosine); ASON, the signal that particularly suppresses to relate to abnormal cell proliferation by way of in the ASON of gene expression, such as example PKC-α, Raf, H-Ras and EGF-R ELISA (EGF-R); Vaccine,Such as Vaccine and gene therapy vaccine, for example Vaccine, Vaccine and Vaccine; Topoisomerase 1 inhibitor (for example ); RmRH(for example ); BAY439006 (sorafenib; Bayer);SU-11248 (sunitinib, Pfizer); Perifosine (perifosine), cox 2 inhibitor (as celecoxib (celecoxib) or etoricoxib (etoricoxib)), proteasome inhibitor (for example PS341); Bortezomib CCI-779; Tipifarnib(R11577); Orafenib, ABT510; Bcl-2 inhibitor, such as oblimersensodium Pixantrone; EGFR inhibitor (definition sees below); Tyrosine kinase inhibitor (definition sees below); Serine-threonine kinase inhibitor, such as rapamycin (rapamycin) (sirolimus, ); Farnesyl transferase inhibitor, such as lonafarnib (SCH6636, SARASARTM); And any above-mentioned every pharmaceutically acceptable salt, acid or derivative; And two or more above-mentioned every combinations, such as the abbreviation of CHOP(endoxan, Doxorubicin, vincristine and prednisolone conjoint therapy) and FOLFOX(oxaliplatin (ELOXATIN ^TM) abbreviation of therapeutic scheme of associating 5-FU and folinic acid).

The chemotherapeutics defined herein has comprised adjustment, reduction, blocking-up or has suppressed " antihormone agent " or " endocrine therapy agent " class of the hormone effect effect that cancer can be promoted to grow.They self can be hormones, include but not limited to: the anti-estrogens with the agonist/antagonist characteristic of mixing, comprise tamoxifen (tamoxifen) (NOLVADEX), 4-hydroxytamoxifen, toremifene (toremifene) idoxifene (idoxifene), droloxifene (droloxifene), raloxifene (raloxifene) trioxifene (trioxifene), that Lip river former times sweet smell (keoxifene), and selective estrogen receptor modulators class (SERM), such as SERM3; There is no the pure anti-estrogens of agonist properties, such as fulvestrant (fulvestrant) with this type of medicament of EM800(estrogen receptor capable of blocking (ER) dimerization, suppress DNA combination, raising ER turnover and/or containment ER level); Aromatase inhibitor class, comprises steroidal aromatase inhibitor class, such as formestane (formestane) and Exemestane (exemestane) with on-steroidal aromatase inhibitor class, such as Anastrozole (anastrozole) letrozole (letrozole) with aminoglutethimide (aminoglutethimide), and other aromatase inhibitor class, comprise vorozole (vorozole) magace (megestrolacetate) fadrozole (fadrozole) and 4 (5)-imidazoles; Gonadotropin-releasing hormone agonist class, comprise Leuprolide (leuprolide) ( with ), goserelin (goserelin), buserelin (buserelin) and triptorelin (triptorelin); Sex steroid class (sexsteroids), comprise ethisterone class (progestine), such as Magace and medroxyprogesterone acetate (medroxyprogesteroneacetate), estrogens, such as diethylstilbestrol (diethylstilbestrol) and premarin (premarin), with androgens/retinoic acid-like class, such as Fluoxymesterone (fluoxymesterone), all trans retinoic acids (transretionicacid) and fenretinide (fenretinide); Onapristone (onapristone); Mifepristone class; Estrogen receptor down-regulation agent class (ERD); Anti-androgens, such as Drogenil (flutamide), Nilutamide (nilutamide) and than Ka meter Te (bicalutamide); And the pharmaceutically acceptable salt of any above-mentioned substance, acid or derivative; And the combination of two or more above-mentioned substances.

" growth inhibitor " is for referring to during this paper in vitro or the compound that grows of T suppression cell (such as expressing the cell of Bv8) or composition in vivo.Therefore, growth inhibitor can be significantly reduce the medicament being in cell (such as expressing the cell of the Bv8) per-cent of S phase.The example of growth inhibitor comprises and blocks the cell cycle and to advance the medicament of (being in the position beyond the S phase), such as induces the medicament that G1 stagnates and the M phase stagnates.Classical M phase blocker comprises Changchun medicine class (vincas) (vincristine(VCR) (vincristine) and vinealeucoblastine(VLB) (vinblastine)), taxanes (taxanes) and Topoisomerase II inhibitors such as Dx (doxorubicin), epirubicin (epirubicin), daunorubicin (daunorubicin), Etoposide (etoposide) and bleomycin (bleomycin).Medicaments of those retardances G1 also overflow and enter the S phase and stagnate, such as DNA alkylating agent class such as tamoxifen (tamoxifen), prednisone (prednisone), Dacarbazine (dacarbazine), chlormethine (mechlorethamine), cis-platinum (cisplatin), methotrexate (methotrexate), 5 FU 5 fluorouracil (5-fluorouracil) and ara-C.More information can be compiled see Mendelsohn and Israel, " TheMolecularBasisofCancer ", 1st chapter, is entitled as " Cellcycleregulation, oncogenes; andantieioplasticdrugs ", the people such as Murakaini, W.B.Saunders, Philadelphia, 1995, such as the 13rd page.Taxanes (taxol (paclitaxel) and docetaxel (docetaxel)) is the anticarcinogen derived from yew tree.Derived from European yew docetaxel ( rhone-PoulencRorer) be taxol ( bristol-MyersSquibb) semi-synthetic analogue.Taxol and docetaxel promote be assembled into microtubule by tubulin dimer and by preventing depolymerization from making microtubule stabilization, cause suppression mitotic in cell.

" Dx (Doxorubicin) " is anthracycline antibiotics.The full chemical name of Dx is (8S-cis)-10-[(3-amino-2; 3; 6-tri-deoxidation-α-L-lysol-pyranohexose base) oxygen base]-7; 8; 9,10-tetrahydrochysene-6,8; 11-trihydroxy--8-(hydroxyacetyl)-1-methoxyl group-5,12-naphthalenedione.

(8S-cis)-10-[(3-amino-2,3,6-trideoxy-α-L-lyxo-hexapyranosyl)oxy]-7,8,9,10-tetrahydro-6,8,11-trihydroxy-8-(hydroxyacetyl)-1-methoxy-5,12-naphthacenedione

The polypeptide comprising Fc district is referred to, such as antibody or immunoadhesin (see below definition) containing " Fc district polypeptide ".The C-terminal lysines (residue 447 according to EU numbering system) in Fc district can be eliminated, such as, in the process of purified polypeptide or by the nucleic acid of modified recombinant coded polypeptide.Therefore, the composition comprising the polypeptide with Fc district according to the present invention can comprise the polypeptide with K447, the polypeptide eliminating all K447 or have the mixture with the polypeptide not having K447 residue.

" individuality ", " experimenter " or " patient " refer to vertebrates.In certain embodiments, vertebrates is Mammals.Mammals includes but not limited to livestock (such as ox), motion animal, pet (such as cat, dog and horse), primate, Mouse and rat.In certain embodiments, Mammals is behaved.

" significant quantity " refers in required dosage and the amount effectively realizing treatment or the preventive effect expected the time.

" the treatment significant quantity " of substances/molecules of the present invention, antagonist or agonist can cause the factors such as the ability expecting response according to such as individual morbid state, age, sex and body weight and this substances/molecules, agonist or antagonist and change in individuality.Treatment significant quantity also refers to that the treatment beneficial effect of this substances/molecules, agonist or antagonist surpasses the amount of any poisonous or detrimental consequences." prevention significant quantity " refers in required dosage and the amount effectively realizing the preventive effect expected the time.Typically but not necessarily, because preventive dose is before seizure of disease or at disease early stage for experimenter, therefore prevent significant quantity can lower than treatment significant quantity.

" intractable " or " refractoriness " refers to that disease or illness have resistance or not response (such as, even if treat, angiogenic plasmacytic number still increases) to treatment.In certain embodiments, term " intractable " or " refractoriness " refer to have resistance or not response to any prior treatment (including but not limited to VEGF antagonist, antiangiogenic agent and chemotherapeutic treatment).In certain embodiments, term " intractable " or " refractoriness " refer to that disease or illness are to the inherence not responsiveness of any prior treatment (comprising VEGF antagonist, antiangiogenic agent and/or chemotherapeutic treatment).In certain embodiments, VEGF antagonist is VEGF antibody.

" recurrence " refers to that the row of retiring due to illness of patient gets back to its disease state in the past, especially recovers the reply of (partialrecovery) symptom afterwards in apparent recovery (apparentrecovery) or part.In certain embodiments, recurrence state refers to get back to the front process of disease of prior treatment (including but not limited to VEGF antagonist, antiangiogenic agent and/or chemotherapeutic treatment) or the disease before getting back to prior treatment.In certain embodiments, recurrence state refers to, after the initial strong response to cancer therapy (comprising VEGF antagonist, antiangiogenic agent and/or chemotherapeutic treatment), get back to the process of disease or get back to disease.In certain embodiments, VEGF antagonist is VEGF antibody.

Term " effect " uses with most broad sense in this article, and refers to that immunoglobulin (Ig), antibody or Fc fusion rotein produce the ability of desired effects.In certain embodiments, effect refers to the maximum efficiency observed immunoglobulin (Ig), antibody or Fc fusion rotein at saturated level.In certain embodiments, effect refers to the EC of immunoglobulin (Ig), antibody or Fc fusion rotein ₅₀.In certain embodiments, effect refers to the effect of immunoglobulin (Ig), antibody or Fc fusion rotein.In certain embodiments, effect refers to that immunoglobulin (Ig), antibody or Fc fusion rotein produce the ability of beneficial effect to the process of disease or time length, comprises clinical benefit described herein.

" EC ₅₀" refer to that immunoglobulin (Ig), antibody or Fc fusion rotein induce the concentration of the response of halfway between baseline and maximum value.In certain embodiments, EC ₅₀represent following immunoglobulin (Ig), antibody or Fc fusion rotein concentration, now observe 50% of its maximum efficiency.In certain embodiments, EC ₅₀represent the blood plasma in acquisition 50% largest body required for effect or serum-concentration.

Effect in Therapeutic cancer proves by the ability of the symptom detecting antibody of the present invention, fusion rotein, coupling molecule or composition and suppress or reduce cancerous cell growth or transfer or improvement or alleviate one or more and related to cancer.If have the reduction of such as cancerous cell growth or transfer, the improvement of symptom of one or more and related to cancer or the reduction of mortality ratio and/or sickness rate after using antibody of the present invention, fusion rotein, coupling molecule or composition, then think that process is curative.Also can test the swollen neoplastic ability of their reductions to antibody of the present invention, fusion rotein or composition in vitro in vitro, with in vivoassay method.For cancer therapy, in body, effect can also such as be measured by time length of assessment survival, apart from time length of time (TTP) of progression of disease, responsiveness (RR), response and/or quality of life.

Clinical benefit by assessing various terminal to measure, such as, can suppress progression of disease to a certain extent, comprises and slows down and block completely; Reduce the number of seizure of disease and/or symptom; Reduce infringement size; (namely alleviate, slow down or stop completely) disease cells is suppressed to be impregnated into and to close on peripheral organs and/or tissue; Suppress (namely alleviate, slow down or stop completely) disease's spread; Alleviate autoimmune response, its can but not necessarily cause disease to be damaged disappear or melt; Alleviate one or more symptoms relevant with illness to a certain extent; Present the extension of (such as progresson free survival) without disease after treatment; Overall survival extends; Responsiveness raises; And/or the mortality ratio for the treatment of point rear preset time reduces.

The treatment plan that " supportive care " means the possibility in order to reduce palindromia or progress and give.Supportive care can provide the time of random length, comprises the period growing to the lifelong prolongation of experimenter.Supportive care can be combined after initial therapy or with initial or other therapy to be provided.For the variable dose of supportive care, and the dosage of reduction compared with the dosage that uses with the therapy of other type can be comprised.

" adjuvant therapy " refers to the therapy given after the procedure in this article, wherein can't detect the sign of Residual Disease, thus reduces the risk of palindromia.The target of adjuvant therapy is preventing cancer recurrence, and therefore reduces the chance of cancer related mortality.

" combine " to use with one or more other therapeutical agents and comprise simultaneously (jointly) and use and use with the sequential of any order.

Term " simultaneously " or " walking abreast " are used in reference in this article uses two or more therapeutical agents, and the time that is wherein applied at least partly is upper overlapping.Thus, parallel using comprises following dosage regimen, and using of rear one or more other medicaments of continuation is interrupted in using of one or more medicaments.

" biological sample " (being called interchangeably " sample " or " tissue or cell sample ") contain from individual obtain and can be used for diagnosing or the several samples type of monitoring assay method.Other liquid sample of blood and biology origin, Solid Tissue Samples such as biopsy specimen or tissue culture or from its derivative cell and offspring thereof are contained in this definition.This definition is also encompassed in the sample obtaining and carried out after them operating, and is such as imbedded in semisolid or solid substrate with some composition of agent treated, solubilising or enrichment such as protein or polynucleotide or for object of cutting into slices.Clinical sample contained in term " biological sample ", but also comprise cell, cell conditioned medium liquid, the molten born of the same parents' thing of cell, serum, blood plasma, biological fluid and the tissue sample in cultivation.The source of biological sample can be solid tissue, as from organ or tissue's sample that is fresh, freezing and/or that preserve or biopsy samples or puncture sample; Blood or any blood constitutent; Body fluid, such as cerebrospinal fluid, amniotic fluid, peritoneal fluid or interstitial fluid; The cell of any time in growing from gestation or experimenter.In some embodiment, biological sample obtains from primary or metastatic tumo(u)r.Biological sample can containing at the occurring in nature not natural mixed compound with this tissue, such as sanitas, antithrombotics, buffer reagent, fixing agent, nutrition, microbiotic, like this.

For the object of the invention, " section " of tissue sample refers to one piece or a slice tissue sample, the thin sectioned tissue such as scaled off from tissue sample or cell.Should understand, multi-disc slicing tissue samples can be made and analyze according to the present invention.In some embodiment, the method that the analysis or carry out for both protein and the nucleic acid same section of tissue sample being used for morphology and molecule two levels is analyzed.

Term " pharmaceutical formulation ", " pharmaceutical composition " or " therapeutic preparaton " refer to be in following form, thus allow that the biologic activity of activeconstituents is effective, and containing for the preparation that can accept experimenter that preparaton uses and have other component of unacceptable toxicity.This type of preparaton can be aseptic.

" aseptic " preparaton is aseptic or does not contain microorganism and the spore thereof of all work.

Term " marker " for referring to during this paper and the direct or indirect coupling of reagent such as nucleic acid probe or antibody or fusion so that detect its coupled or compound of reagent of merging or composition.Marker can be self detectable (such as radioisotopic tracer or fluorescent marker), or when enzyme marker, can the chemically changed of the detectable substrate compounds of catalysis or composition.

" carrier " for comprising pharmaceutically acceptable carrier, vehicle or stablizer during this paper, they in adopted dosage and concentration to being exposed to its cell or Mammals is nontoxic.Usually, physiology acceptable carrier is pH aqueous buffer solution.The example that physiology can accept carrier comprises buffer reagent, such as phosphoric acid salt, Citrate trianion and other organic acid; Antioxidant, comprises xitix; Lower molecular weight (being less than about 10 residues) polypeptide; Protein, such as serum albumin, gelatin or immunoglobulin (Ig); Hydrophilic polymer, such as polyvinylpyrrolidone; Amino acid, such as glycine, glutamine, l-asparagine, arginine or Methionin; Monose, disaccharides and other carbohydrate, comprise glucose, seminose or dextrin; Sequestrant, such as EDTA; Sugar alcohol, such as N.F,USP MANNITOL or sorbyl alcohol; Salify gegenion, such as sodium; And/or nonionogenic tenside, such as TWEEN ^tM, polyoxyethylene glycol (PEG) and PLURONICS ^tM.

" liposome " refers to be made up of various types of lipid, phosphatide and/or tensio-active agent, can be used for the vesicles to Mammals deliver drugs.The composition of liposome is arranged in bilayer formation usually, similar to biomembranous lipid arrangement.

Composition

Anti-Bv8 antibody of the present invention is preferably monoclonal.Scope of the present invention also contains Fab, Fab', Fab'-SH and F (ab') of provided anti-Bv8 antibody herein ₂fragment.These antibody fragments are prepared by traditional means, such as enzymatic digestion, or can be generated by recombinant technology.This type of antibody fragment can be chimeric or humanized.These fragments can be used for Diagnosis and Treat object listed hereinafter.

Monoclonal antibody is obtained by the antibody of a group homogeneity substantially, and each antibody namely forming colony is identical, except may with the possible natural existence sudden change of indivisible existence.So, modifier " mono-clonal " indicates the feature of antibody, is not namely the mixture of different antibodies.

Anti-Bv8 monoclonal antibody of the present invention can use the hybridoma method recorded by Kohler etc., Nature256:495 (1975) at first to prepare, or can pass through recombinant DNA method (U.S. Patent No. 4,816,567) and prepare.

In hybridoma method, immune mouse or other suitable host animal, such as hamster, to cause the lymphocyte that generation maybe can generate following antibody, described antibody can be used for immune protein by specific binding.The antibody of Bv8 can by animal repeatedly subcutaneous (sc) or intraperitoneal (ip) injects Bv8 and adjuvant generates.Bv8 can use method well-known in the art to prepare, and wherein some method further describes in this article.Such as, the recombinant production of people and mouse Bv8 has description hereinafter.In one embodiment, by the animal Bv8 immunity of merging to heavy chain immunoglobulin Fc part.In a preferred embodiment, animal is used Bv8-IgG1 fusion protein immunization.Usually by animal for the immunogenic conjugate of Bv8 or derivative and monophosphoryl lipid A (MPL)/bis-rod mycolic acid trehalose (trehalosedicrynomycolate, TDM) RibiImmunochem.Research, Inc., Hamilton, MT) immunity is carried out, by solution intradermal injection in multiple position.After 2 weeks, booster immunization is carried out to animal.After 7-14 days, to animal blood taking, and to the anti-Bv8 titre of determination of serum.Booster immunization is carried out to animal, until titre reaches platform (plateaus).

Or, can immunological lymphocyte in vitro.Then, use suitable fusogen such as polyoxyethylene glycol by lymphocyte and myeloma cell fusion, to form hybridoma (Goding, MonoclonalAntibodies:PrinciplesandPractice, pp.59-103, AcademicPress, 1986).

By the hybridoma so prepared in suitable inoculation of medium and cultivation, described substratum one or more materials preferably containing the Parent Myeloma Cell growth suppressing not merge or survival.Such as, if Parent Myeloma Cell lacks enzyme hypoxanthine guanine phosphoribosyltransferase (HGPRT or HPRT), substratum then for hybridoma typically will containing xanthoglobulin, aminopterin-induced syndrome and thymidine (HAT substratum), and these materials stop the growth of HGPRT deficient cells.

Preferred myeloma cell is that those efficiently merge, support the stable high level of selected antibody-producting cell to generate antibody and substratum sensitivity to such as HAT substratum.In these cells, preferred myeloma cell line is rat bone marrow tumour system, such as those can from Sol gram institute cell distribution center (SalkInstituteCellDistributionCenter, SanDiego, California, USA) MOPC-21 and the MPC-11 mouse tumor obtained and can from American type culture collection (AmericanTypeCultureCollection, Rockville, Maryland, USA) SP-2 or the X63-Ag8-653 cell that obtains derive.Human myeloma and mouse-people's heteromyeloma cell lines have also described for generating human monoclonal antibodies (Kozbor, J.Immunol.133:3001 (1984); Brodeur etc., MonoclonalAntibodyProductionTechniquesandApplications, pp.51-63, MarcelDekker, Inc., NewYork, 1987).

The nutrient solution that can grow just wherein hybridoma measures the generation for the monoclonal antibody of Bv8.Preferably, by immunoprecipitation or by external binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA), measure the binding specificity of the monoclonal antibody generated by hybridoma.

The binding affinity of monoclonal antibody is analyzed by the Scatchard of such as Munson etc., Anal.Biochem.107:220 (1980) and is measured.

After obtaining generating the hybridoma with the antibody expecting specificity, avidity and/or activity in qualification, this clone carries out subclone by limiting dilution code and is undertaken cultivating (Goding by standard method, MonoclonalAntibodies:PrinciplesandPractice, pp.59-103, AcademicPress, 1986).The substratum being suitable for this purpose comprises such as D-MEM or RPMI-1640 substratum.In addition, hybridoma can carry out culturing in vivo as ascitic tumor in animal.

By conventional immune globulins purifying code, such as such as albumin A-Sepharose, hydroxyapatite, gel electrophoresis, dialysis or affinity chromatography, suitably separate the monoclonal antibody that subclone is secreted with nutrient solution, ascites or serum.

Anti-Bv8 antibody of the present invention can expect prepared by active synthetic antibody clone by using combinatorial library screening to have.In principle, select synthetic antibody to clone by screening phage library, described phage library contains the phage of showing and merging to the various antibody variable region fragment (Fv) of bacteriophage coat protein.By this type of phage library of affinity chromatography elutriation for expectation antigen.Expression can be adsorbed to antigen in conjunction with the clone of the Fv fragment expecting antigen, thus separates with uncombined clone in library.Then combining clone is from wash-out antigen, and can by the extra further enrichment of Antigen adsorption/elution cycles.Any anti-Bv8 antibody of the present invention can obtain as follows, namely suitable antigen selection code is designed to select interested phage clone, then the Fv sequence and Kabat etc. from interested phage clone is used, SequencesofProteinsofImmunologicalInterest, 5th edition, NIHPublication91-3242, BethesdaMD (1991), the suitable anti-Bv8 antibody cloning of constant region (Fc) sequence construct total length recorded in volume 1-3.

The antigen binding domain of antibody is formed by two about 110 amino acid whose variable (V) districts, respectively from heavy chain (VL) and light chain (VH), all presents three high change rings or complementary determining region (CDR).Variable domain can functionally be illustrated on phage, or as scFv (scFv) fragment (wherein VH with VL is connected by short, flexible peptide covalency), or as Fab fragment (wherein they merge and noncovalent interaction with constant domain separately), as Winter etc., Ann.Rev.Immunol., described in 12:433-455 (1994).When for this paper, the phage clone of coding scFv and the phage clone of coding Fab are referred to as " Fv phage clone " or " Fv clone ".

The complete or collected works of VH and VL gene can pass through polymerase chain reaction (PCR) separately clone, and recombinate at random in phage library, then can search for antigen and combine clone, as Winter etc., Ann.Rev.Immunol., described in 12:433-455 (1994).The hang oneself library of immune origin can provide antibody to the original high-affinity of immunity, without the need to building hybridoma.Or, non-immune complete or collected works can be cloned, for providing single people's antibody sources, without the need to any immunity, as described in Griffiths etc., EMBOJ, 12:725-734 (1993) for nonself and self antigen widely.Finally, non-immune library can also build with synthesis mode, namely from the V gene fragment that stem cell clone is not reset, use the PCR primer comprising stochastic sequence to come the variable CDR3 district of code level and realize in vitro resetting, as Hoogenboom and Winter, J.Mol.Biol., described in 227:381-388 (1992).

By merging with secondary coat protein pIII, filobactivirus is used to show antibody fragment.Antibody fragment can be shown as Single-Chain Fv Fragment of Murine, wherein VH and VL structural domain is connected on same polypeptide chain by flexible polypeptide spacer, such as Marks etc., J.Mol.Biol., described in 222:581-597 (1991), or be shown as Fab fragment, wherein a chain and pIII merge, and another chain is secreted in bacterial host cell pericentral siphon, in this assembling Fab-coat protein structure, it is illustrated on phage surface by replacing some wild type coat proteins, such as Hoogenboom etc., Nucl.AcidsRes., described in 19:4133-4137 (1991).

Generally speaking, obtain the nucleic acid of encoding antibody genes fragment from the immunocyte of human or animal from results.If wish that library is partial to anti-Bv8 and is cloned, individual immunity Bv8 so can be given to produce antibody response, and reclaim splenocyte and/or circulation B cell or other peripheral blood lymphocyte (PBL) for library construction.In a preferred embodiment, obtain the human immunoglobulin gene frag-ment libraries of the anti-Bv8 clone of deflection as follows, namely in the transgenic mice of carrying function human immunoglobulin gene array (and lacking functional endogenous antibody generation system), produce anti-Bv8 antibody response, make Bv8 immunity produce the B cell generated for people's antibody of Bv8.The generation of the transgenic mice of raw human antibodies has description hereinafter.

The further enrichment of the reactive cell mass of anti-Bv8 can be obtained as follows, namely suitable screening code is used to be separated the B cell expressing Bv8 specific membranes binding antibody, such as, cellular segregation by carrying out the absorption of the Bv8 of fluorochrome label and follow-up flowing activating cells sorting (FACS) with Bv8 affinity chromatography or cell.

Or, provide the better of possible antibody repertoire from the splenocyte of non-immune donors and/or the use of B cell or other PBL and represent, but also allow that use Bv8 does not have antigenic any animal (people or inhuman) species to build antibody library wherein.In order to the external library construction mixing antibody gene, from individuality results stem cell to provide the nucleic acid of non-rearranged antibody constant gene segment C of encoding.Interested immunocyte can be obtained from many animals species (such as people, mouse, rat, Lagomorpha, luprine, dog, cat, pig, ox, horse and birds etc.).

Reclaim the nucleic acid of encoding antibody variable gene segment (comprising VH and VL section) from interested cell and increase.With regard to VH and the VL gene library of resetting, required DNA can be obtained as follows, namely from separation of lymphocytes genomic dna or mRNA, then polymerase chain reaction (PCR) is carried out with the primer of 5' and the 3' terminal matching with VH and the VL gene reset, as Orlandi etc., described in Proc.Natl.Acad.Sci.USA, 86:3833-3837 (1989), build diversity V gene complete or collected works thus for expressing.Can from cDNA and genomic DNA amplification V gene, reverse primer is positioned at the 5' end of the exon of encoding mature V structural domain, forward primer based on J intra-segment, as (1989) and Ward etc. such as Orlandi, described in Nature, 341:544-546 (1989).But, in order to increase from cDNA, reverse primer also can based in leading exon (leaderexon), as described in Jones etc., Biotechnol., 9:88-89 (1991), forward primer is based in constant region, as Sastry etc., Proc.Natl.Acad.Sci. (USA), described in 86:5728-5732 (1989).In order to make complementary maximization, degeneracy can be mixed in primer, as described in (1989) or the Sastry etc. (1989) such as Orlandi.Preferably, as follows library diversity is maximized, namely the PCR primer of target each V gene family is used to increase all obtainable VH and the VL arrangement existed in immunocyte nucleic acid samples, such as Marks etc., J.Mol.Biol., 222:581-597 (1991) or Orum etc., described in the method for NucleicAcidsRes., 21:4491-4498 (1993).In order to by increased DNA clone in expression vector, rare restriction site can be introduced as label in one end of PCR primer, as as described in (1989) such as Orlandi, or carry out further pcr amplification with the primer of tape label, as Clackson etc., described in Nature, 352:624-628 (1991).

The V gene complete or collected works of the rearrangement of synthetic can derive from V constant gene segment C in vitro.Most people VH constant gene segment C is Cloning and sequencing (Tomlinson etc., J.Mol.Biol., 227:776-798 (1992)), and locates (Matsuda etc., NatureGenet., 3:88-94 (1993)); The section (comprising all main types of H1 and H2 ring) of these clones can be used for generating diversity VH gene complete or collected works, use the PCR primer of the H3 ring of encoding sequence and length diversity, as described in Hoogenboom and Winter, J.Mol.Biol., 227:381-388 (1992).VH complete or collected works also can generate as follows, and all sequences diversity concentrates on the long H3 ring of single length, as described in Barbas etc., Proc.Natl.Acad.Sci.USA, 89:4457-4461 (1992).People V κ and V λ section be Cloning and sequencing (Williams and Winter, Eur.J.Immunol., 23:1456-1461 (1993)), and can be used for the light chain complete or collected works generating synthesis.To fold based on a series of VH and VL and the V gene complete or collected works of synthesis of L3 and H3 length can encode and have the antibody of considerable structure diversity.After the DNA of amplification coding V gene, according to the method for Hoogenboom and Winter, J.Mol.Biol., 227:381-388 (1992), germ line V gene section can be reset in vitro.

Antibody fragment complete or collected works can build as follows, namely with several means by united for VH and VL gene complete or collected works.Each complete or collected works can be created in different carriers, and recombinant vectors in vitro, such as Hogrefe etc., Gene, described in 128:119-126 (1993), or carry out recombinant vectors, such as Waterhouse etc. by combination infection in vivo, Nucl.AcidsRes., the loxP system recorded in 21:2265-2266 (1993).In vivo recombination method utilizes the double stranded nature of Fab fragment to overcome the storage capacity restriction because intestinal bacteria transformation efficiency applies.Clone non-immune VH and VL complete or collected works respectively, one is cloned into phagemid, and another is cloned into phage vector.Then the bacterium by containing phagemid with phage-infect makes each cell comprise different combinations to combine two kinds of libraries, and storage capacity only exists the restriction (about 10 of number by cell ¹²individual clone).Two kinds of carriers are recombination signal in occlusion body all, makes VH and VL gene recombination on single replicon, and is packaged into phage virus grain altogether.These huge libraries provide a large amount of has excellent avidity (Kd ^-1for about 10 ^-8m) diversity antibody.

Or, complete or collected works can be cloned into identical carrier successively, such as Barbas etc., described in Proc.Natl.Acad.Sci.USA, 88:7978-7982 (1991), or be assembled together by PCR, then clone, as described in Clackson etc., Nature, 352:624-628 (1991).PCR assembling also can be used for VH with VLDNA to be connected to form scFv (scFv) complete or collected works with the DNA of the flexible peptide spacer of coding.In another kind of technology, " in cell PCR assembling " for combining VH and VL gene by PCR in lymphocyte, then clone connect the complete or collected works of gene, as described in Embleton etc., Nucl.AcidsRes., 20:3831-3837 (1992).

The antibody of non-non-immune libraries (naivelibrary) (natural or synthesis) generation can have medium avidity (Kd ^-1for about 10 ⁶-10 ⁷m ^-1), but affinity maturation can also be simulated in vitro as follows, namely build and again select secondary library, as (1994) such as Winter, described in seeing above.Such as, at Hawkins etc., J.Mol.Biol., the method of 226:889-896 (1992) or Gram etc., in the method for Proc.Natl.Acad.SciUSA, 89:3576-3580 (1992), fallibility polysaccharase is used to introduce sudden change (Leung etc. in vitro at random, Technique, 1:11-15 (1989)).In addition, affinity maturation can be carried out by the one or more CDR of random mutation, such as, in selected indivedual Fv clones, use the primer carrying the stochastic sequence of crossing over CDR interested carry out PCR and screen the clone of more high-affinity.WO96/07754 (being published on March 14th, 1996) describes for induced mutagenesis in the complementary determining region of light chain immunoglobulin to create the method in light chain gene library.Another kind of high efficiency method be by VH or the VL structural domain selected by phage display with derive from non-immune donors naturally there is V domain variants and combine, and more high-affinity is screened in several endless chain is reorganized again, as Marks etc., Biotechnol., described in 10:779-783 (1992).This technology allows that generation avidity is 10 ^-9the antibody of M scope and antibody fragment.

Bv8 nucleic acid and aminoacid sequence are known in the art, such as, see Wechselbergeretal. (FEBSLett.462:177-181 (1999)) and Lietal. (Mol.Pharm.59:692-698 (2001)).

The nucleic acid of coding Bv8 can be prepared by multiple method known in the art.These methods include but not limited to by Engels etc., Agnew.Chem.Int.Ed.Engl., the any method recorded in 28:716-734 (1989), the chemosynthesis that such as three esters, phosphorous acid ester, phosphoramidate (phosphoramidite) and H-phosphonate carry out.In one embodiment, encode Bv8 DNA design in use the preferred codon of expression host cell institute.Or the DNA of coding Bv8 can be separated from genome or cDNA library.

After building the DNA molecular of coding Bv8, by this DNA molecular and expression vector, the expression control sequenc in such as plasmid is operatively connected, and wherein said control sequence is subject to the identification of the host cell of this vector.Generally speaking, plasmid vector comprises and copies and control sequence, and it is derived from the species compatible with host cell.Carrier carries replication site usually, and coding can provide the sequence of the protein of Phenotypic Selection in transformant.The carrier being suitable for expressing in protokaryon and eukaryotic host cell is known in the art, and some further describes in this article.Most eukaryotes can be used, such as yeast or derived from multicellular organisms such as mammiferous cell.

Optional, the DNA of coding Bv8 is operatively connected with secretion leader sequence, causes expression product by host cell secretes in substratum.The example of secretion leader sequence comprises stII, ecotin, lamB, bleb GD, lpp, alkaline phosphatase, saccharase and α-factor.Be applicable to 36 the amino acid whose leader sequences (Abrahmsen etc., EMBOJ., 4:3901 (1985)) also having albumin A herein.

Host cell expression of the present invention mentioned above or cloning vector transfection, preferably transform, and cultivate in conventional nutrient culture, and substratum can be expected the gene of sequence in order to evoked promoter, selection transformant or amplification coding and suitably revise.

Transfection refers to host cell picked-up expression vector, and no matter whether any encoding sequence in fact expresses.Those of ordinary skill in the art know many transfection methods, such as CaPO ₄precipitation and electroporation.If there is any instruction of this carrier-mediated transport in host cell, then think that transfection is successful.Method for transfection is well-known in the art, and some further describes in this article.

Conversion refers to DNA to import organism, and DNA can be copied, or as extra-chromosomal element, or pass through chromosomal integration.According to host cell used, the standard technique being suitable for described cell is used to transform.Method for transforming is well-known in the art, and some further describes in this article.

Prokaryotic host cell for generating Bv8 as Sambrook etc., can be cultivated described in seeing above generally.

Mammalian host cell for generating Bv8 can be cultivated in multiple substratum, and described substratum is well-known in the art, and some has description in this article.

Host cell disclosed by the invention contains the cell in vitro culture thing and the cell in host animal body.

The purifying of Bv8 can use art-recognized method to realize, and this document describes some of them.

The Bv8 of purifying can be attached to suitable matrix, such as sepharose 4B, acrylamide pearl, granulated glass sphere, Mierocrystalline cellulose, various acrylic copolymer, hydroxymethacrylate gels, polyacrylic acid and polymethacrylic acid copolymer, nylon, neutrality and ionophore, like this, for the affinity protein purification of phage display clone.Bv8 albumen can pass through MethodsinEnzymology to the attachment of matrix, and the method recorded in volume 44 (1976) realizes.Protein ligands is attached to polysaccharide matrix, and such as agarose, dextran or cellulosic common technology relate to uses halogen cyan activated carrier, subsequently the Armeen of peptide ligand or primary aromatic amine is coupled to the matrix after activation.

Or, Bv8 can be used for bag by the hole of adsorption plate, and the host cell being attached to adsorption plate is expressed, or for cell sorting, or be coupled to vitamin H to catch with the pearl of streptavidin bag quilt, or for any other method for elutriation phage display library known in the art.

Being suitable at least part of phage particle in conjunction with under the condition of sorbent material, make the immobilized Bv8 of phage library sample contacts.Under normal circumstances, select the condition comprising pH, ionic strength, temperature etc. to simulate physiological condition.The phage being bonded to solid phase is cleaned, then takes off, such as, as Barbas etc. with pickling, Proc.Natl.Acad.SciUSA, described in 88:7978-7982 (1991), or take off, such as, as Marks etc. with alkali cleaning, J.Mol.Biol., described in 222:581-597 (1991), or by Bv8 antigenic competition wash-out, such as with Clackson etc., in the code that the antigenic competition method of Nature, 352:624-628 (1991) is similar.Phage can enrichment 20-1 in single-wheel is selected, 000 times.In addition, the phage of enrichment can be cultivated in bacterial cultures, and carries out more wheels selection.

The efficiency selected depends on many factors, comprises the kinetics of dissociating in cleaning process, and whether multiple antibody fragments on single phage can conjugated antigens simultaneously.The antibody with very fast Dissociation (with weak binding avidity) can retain by using the antigen coated density of height in the cleaning of short period of time, multivalent bacteriophage display and solid phase.High-density does not stabilize phage by means of only multivalence interacts, and the combining again of the phage being conducive to having dissociated.The selection with the antibody of slower Dissociation (with strong binding affinity) can by using long cleaning and monovalent phage display (as Bass etc., Proteins, described in 8:309-314 (1990) and WO92/09690) and low antigen coated density (as Marks etc., Biotechnol., 10:779-783 (1992) is described) promote.

Likely select between phage antibody Bv8 to different avidity, or even avidity is slightly discrepant.But the random mutation (such as affinity maturation technology as mentioned above in some is carried out) of selected antibodies likely produces many mutant, most conjugated antigen, and minority has higher avidity.By restriction Bv8, rare high-affinity phagocytosis physical efficiency competition is won.In order to retain the mutant of all higher affinity, can by phage incubation together with excessive biotinylation Bv8, but the volumetric molar concentration of biotinylation Bv8 is lower than the target mole affinity costant of Bv8.Then with the paramagnetic beads of streptavidin bag quilt catch high-affinity in conjunction with phage.This type of " balance catch " allows according to binding affinity to select antibody, and its susceptibility is allowed isolate the mutant clone that avidity only has initial value 2 times from greatly excessive low-affinity phage.The differentiation that condition that cleaning is bonded to the phage of solid phase is carried out based on Dissociation can also be operated.

Bv8 clone can carry out activity and select.In one embodiment, the invention provides the Bv8 antibody blocking and combine between Bv8 and its part (such as Bv8 acceptor PKR1 and PKR2).Fv clone corresponding to this type of Bv8 antibody can select as follows: (1) is separated Bv8 clone from phage library as mentioned above, and optionally through cultivating described colony to increase be separated phage clone colony in suitable host bacterium; (2) select wanting to block active Bv8 and want not block the second active protein; (3) anti-Bv8 phage clone is adsorbed to immobilized Bv8; (4) use the excessive any undesired clone of described second Protein elution, they identify with the Bv8 overlapping or shared in conjunction with determinant of described second protein in conjunction with determinant; And (5) are eluted in the clone that step (4) keeps adsorbing afterwards.Optionally, there is the clone of blocking characteristics of the blocking-up of expectation/not repeat selection code described herein by one or many and carry out further enrichment.

Coding hybridoma of the present invention derives DNA that monoclonal antibody or phage display Fv clone and is easy to use routine protocols to be separated and order-checking (such as by using the Oligonucleolide primers of be designed to increase from hybridoma or phage DNA template specificity interested heavy chain and light chain coding region).Once be separated, DNA can be placed in expression vector, then this expression vector is transfected into and does not originally generate in the host cell of immunoglobulin (Ig) protein, such as Bacillus coli cells, ape COS cell, Chinese hamster ovary (CHO) cell or myeloma cell, to obtain the synthesis expecting monoclonal antibody in recombinant host cell.The recombinant expressed summary paper of DNA in bacterium about encoding antibody comprises Skerra etc., Curr.OpinioninImmunol., 5:256 (1993) and Pluckthun, Immunol.Rev., 130:151 (1992).

The DNA of coding Fv clone of the present invention can the known dna sequence (such as suitable DNA sequence dna can derive from Kabat etc., sees above) of combined coding heavy chain and/or constant region of light chain to form the clone of encoding full leng or Partial heavy and/or light chain.Will be appreciated that the constant region of any isotype all can be used for this object, comprise IgG, IgM, IgA, IgD and IgE constant region, and this type of constant region can derive from anyone or animal species.Derived from the variable domain dna of a kind of animal (such as people) species, then merge with the constant region DNA of another animal species and clone in the definition being included in " chimeric " used herein and " heterozygosis " antibody with the Fv of the encoding sequence forming " heterozygosis " total length heavy chain and/or light chain.In a preferred embodiment, Fv clone and the human constant region DNA of the variable DNA of derived from human merge with formed complete people, the encoding sequence of total length or Partial heavy and/or light chain.

The DNA of coding of the present invention derived from the anti-Bv8 antibody of hybridoma can also be modified, such as by substituting, namely the encoding sequence of employment heavy chain and light-chain constant domains replaces the homologous murine sequences of cloning derived from hybridoma (such as Morrison etc., method in Proc.Natl.Acad.Sci.USA, 81:6851-6855 (1984)).Engaged the encoding sequence all or in part of immunoglobulin coding sequence and NIg polypeptide by covalency, the DNA of coding hybridoma or Fv clonal derivation antibody or fragment can be modified further." being fitted together to " or " heterozygosis " antibody of the binding specificity with Fv of the present invention clone or hybridoma clonal derivation antibody can be prepared in like fashion.

Antibody fragment

Antibody fragment is contained in the present invention.Antibody fragment can be generated by traditional means, such as enzymatic digestion, or is generated by recombinant technology.In some cases, use antibody fragment, instead of complete antibody has superiority.The reduced size of fragment allows quick removing, and can cause being easier to arrive solid tumor.The summary of some antibody fragment is see (2003) Nat.Med.9:129-134 such as Hudson.

The multiple technologies for generating antibody fragment are developed.Traditionally, these fragments derivative are carried out (see such as Morimoto etc., JournalofBiochemicalandBiophysicalMethods24:107-117 (1992) by proteolytic digestion complete antibody; And Brennan etc., Science229:81 (1985)).But, directly can generate these fragments by recombinant host cell now.Fab, Fv and scFv antibody fragment all at expression in escherichia coli with by E. coli secretion, so can be allowed and easily generates these a large amount of fragments.Can from phage antibody library discussed above isolated antibody fragment.Or, directly can reclaim Fab'-SH fragment chemical coupling to form F (ab ') from intestinal bacteria ₂fragment (Carter etc., Bio/Technology10:163-167 (1992)).According to another kind of method, directly F (ab') can be separated from recombinant host cell culture ₂fragment.Comprise salvage receptor binding epitope residue, there is Fab and F (ab') of the Half-life in vivo of prolongation ₂fragment is recorded in U.S. Patent No. 5, and 869,046.Other technology for generating antibody fragment can be apparent for skilled practitioner.In certain embodiments, antibody is Single-Chain Fv Fragment of Murine (scFv).See WO93/16185; U.S. Patent No. 5,571,894; And 5,587,458.Fv and scFv is the unique type having entire binding site, lack constant region; So, non-specific binding is reduced when they may be suitable for using in vivo.ScFv fusion rotein can be built to generate the amino of effector protein at scFv or the fusion of C-terminal.Compile see AntibodyEngineering, Borrebaeck, see above.Antibody fragment can also be " linear antibodies ", such as, as U.S. Patent No. 5, and 641, described in 870.This type of linear antibodies can be monospecific or dual specific.

Humanized antibody

Humanized antibody is contained in the present invention.The multiple method for humanizing non-human antibodies is known in this area.Such as, humanized antibody can have one or more amino-acid residue introduced from inhuman source.These non-human amino acid residues are usually called " input " residue, variable domain that they are taken from usually " input ".Substantially the method can following Winter and colleague thereof carries out humanization (Jones etc. (1986) Nature321:522-525; Riechmann etc. (1988) Nature332:323-327; Verhoeyen etc. (1988) Science239:1534-1536), the corresponding sequence of people's antibody is namely substituted with hypervariable region sequence.Therefore, this type of " humanization " antibody is chimeric antibody (U.S. Patent No. 4,816,567), is wherein significantly less than complete people's variable domain corresponding sequence of non-human species and substitutes.In practice, humanized antibody is normally as servant's antibody, and wherein the residue in some some hypervariable region residues and some possible similar site of FR residue rodent antibodies substitutes.

May be important for the preparation of people's light chain of humanized antibody and the selection of heavy chains's variable domain for reduction antigenicity.According to so-called " the suitableeest (best-fit) " method, screen with the whole library of the variable domain sequence pair known person variable domain sequence of rodent antibodies.Then to select with the immediate human sequence of rodents as people's framework of humanized antibody (see (1993) J.Immunol.151:2296 such as such as Sims; Chothia etc. (1987) J.Mol.Biol.196:901).Another kind method uses by the derivative specific frame of the consensus sequence of everyone antibody of specific light chain or heavy chain subgroup.Identical frames can be used for several different humanized antibodies (see (1992) Proc.Natl.Acad.Sci.USA89:4285 such as such as Carter; Presta etc. (1993) J.Immunol.151:2623).

General it is also desirable that, antibody retains high-affinity to antigen and other favourable biological characteristics after humanization.In order to reach this object, according to a kind of method, prepare humanized antibody by the process using the three-dimensional model of parental array and humanized sequence to analyze parental array and various conceptual humanized products.Usually can adaptive immune sphaeroprotein three-dimensional model, this be those skilled in the art be familiar with.Also can obtain the computer program of the possible three-dimensional conformation structure of diagram and the selected candidate immunoglobulin sequences sequence of display.By checking that these display images allow that analyzing residue plays may act in function in candidate immunoglobulin sequences sequence, namely analyzing influence candidate immunoglobulin sequences is in conjunction with the residue of the ability of its antigen.Like this, can from receptor sequence and list entries, select FR residue and combine, thus obtain the antibody characteristic of expectation, such as the avidity of target antigen be raised.Generally speaking, some hypervariable region residues directly and relate to the most substantially on antigen combine impact.

People's antibody

People's antibody of the present invention can be selected from people's charon phages and shows that the Fv in storehouse clones variable domain sequence and known people's constant domain sequence and builds by combining as mentioned above.Or, human monoclonal antibodies of the present invention can be generated by hybridoma method.Human myeloma and mouse-people's heteromyeloma cell lines for generating human monoclonal antibodies are on the books, such as Kozbor, J.Immunol., 133:3001 (1984); Brodeur etc., MonoclonalAntibodyProductionTechniquesandApplications, pp.51-63 (MarcelDekker, Inc., NewYork, 1987); And Boerner etc., J.Immunol., 147:86 (1991).

Such as, the transgenic animal (such as mouse) lacking and can give birth to human antibodies's full repertoire when endogenous immunoglobulin generates in immunity afterwards are likely created on now.Such as, the suppression completely of deleting and causing endogenous antibody tormation of isozygotying of antibody heavy chain joining region (JH) gene in chimeric and germ line mutant mice has been described.In this type of germ line mutant mice, shift a large amount of human germline immunoglobulin's gene can cause raw human antibodies after antigen is attacked.See such as Jakobovits etc., Proc.Natl.Acad.Sci.USA90:2551 (1993); Jakobovits etc., Nature362:255 (1993); Bruggermann etc., YearinImmunol.7:33 (1993).

Gene shuffling also can be used for deriving people's antibody from inhuman (such as rodents) antibody, and wherein people's antibody has the avidity similar to starting non-human antibody and specificity.According to this method, it is also referred to as " the epi-position marking " (epitopeimprinting), heavy chain or the light-chain variable domain employment V domain gene complete or collected works of the non-human antibody fragment obtained by display technique of bacteriophage as described herein are replaced, and produce non-human chain/human chain scFv or Fab block polymer group.Following non-human chain/human chain is caused to be fitted together to the separation of scFv or Fab with the selection that antigen carries out, wherein human chain has recovered antigen binding site eliminate corresponding non-human chain in one-level phage display clone after, namely epi-position determines the selection of (marking, imprint) human chain spouse.When repeating this process to replace the non-human chain of residue, obtain people's antibody (see PCTWO93/06213, being published on April 1st, 1993).Different from the humanization of traditional non-human antibody undertaken by HVR grafting, this technology provides the antibody of complete people, and they are containing FR or the HVR residue of non-human origins.

Multi-specificity antibody

An example of multi-specificity antibody of the present invention comprises the antibody in conjunction with Bv8 and another kind of antigen.In other embodiments, multi-specificity antibody can in conjunction with two of Bv8 kind of different epi-position.Multi-specificity antibody also can be used for the cell being positioned by cytotoxic agent to express Bv8.These antibody have Bv8 brachium conjunctivum and the arm in conjunction with cytotoxic agent (such as such as saporin, anti-interferon-α, vinca alkaloids, ricin A chain, methotrexate or radioactive isotope hapten).Multi-specificity antibody can be prepared into full length antibody or antibody fragment (such as F (ab') ₂bi-specific antibody).

This area has described the multiple method for building bi-specific antibody.One of first kind method relates to the coexpression of two pairs of heavy chain immunoglobulin-light chains, and wherein two kinds of heavy chains have different specificitys (Millstein and Cuello, Nature305:537 (1983)).Due to the random assignment of heavy chain immunoglobulin and light chain, these hybridomas (four source hybridomas (quadroma)) generate the potential mixture of 10 kinds of different antibodies molecules, wherein only have a kind ofly to have correct bispecific structure.The purifying of the correct molecule usually undertaken by affinity chromatography step quite bothers and Product yields is low.Similar code is disclosed in WO93/08829, is published on May 13rd, 1993 and Traunecker etc., EMBOJ.10:3655 (1991).

According to a kind of diverse ways, antibody variable domains and immunoglobulin (Ig) constant domain sequence are merged.Such as, with comprise at least part of hinge, the heavy chain immunoglobulin constant domain in CH2 and CH3 district merges.In certain embodiments, at least one fusions, there is the first CH (CH1).By encode immunoglobulin heavy fusions and, when needed, the DNA of light chain immunoglobulin inserts expression vector separately, and cotransfection enters suitable host organisms.There is provided in the embodiment of optimum yield when the three peptide species chain ratios for building do not wait, this is that the mutual ratio of adjustment three peptide species fragment provides great handiness.But, when at least two peptide species chains cause high yield with same ratio expression or when there is no special meaning in this ratio, likely the encoding sequence of two kinds or all three peptide species chains is inserted an expression vector.

In an embodiment of the method, bi-specific antibody is by a hybrid immunoglobulin heavy chain arm with the first binding specificity, and the hybrid immunoglobulin heavy chain-light chain on another arm is formed (providing the second binding specificity).Due to the separating pathway that the existence of light chain immunoglobulin only in half bispecific molecule is provided convenience, therefore find that this unsymmetrical structure is convenient to the bispecific compound expected to separate with undesired immunoglobulin chain combinations.The method is disclosed in WO94/04690.About generating the further details of bi-specific antibody see such as Suresh etc., MethodsinEnzymology121:210 (1986).

According to another kind of method, (knob-into-hole) or " KnH " technology of " tying into cave " refers to by two interactional interfaces of polypeptide, in a polypeptide, introduce protuberance (knot) also in another polypeptide chain, introduce cavity (cave), instruct these two polypeptide to be paired to technology together in vitro or in vivo.Such as, in the Fc:Fc bonding interface of antibody, CL:CH1 interface or VH/VL interface, KnH(such as US20007/0178552 is introduced; WO96/027011; WO98/050431; And Zhuetal. (1997) ProteinScience6:781-788).This orders about two different heavy chains and is paired to together and is particularly useful during the manufacture of multi-specificity antibody.Such as, the multi-specificity antibody in Qi Fc district with KnH can comprise single variable domain (it is connected with each Fc district) further, or comprises different heavy chains variable domain (it matches from similar or different light-chain variable domain) further.According to an embodiment, one or more p1 amino acid side chain larger side chains (such as tyrosine or tryptophane) of first antibody molecular interface are replaced.By by comparatively p1 amino acid side chain (such as L-Ala or the Threonine) replacement of large amino acid side chain, the interface of second antibody molecule produces compensatory " cavity " with the same or similar size of bulky side chain.This provide and improve the mechanism of heterodimer output than other undesired end product such as homodimer.

Multi-specificity antibody comprises crosslinked or " Heteroconjugate " antibody.Such as, a kind of antibody in Heteroconjugate thing can coupling, another kind of antibody and vitamin H coupling plain with affinity.Such as, this antibody-like has been proposed to be used in undesired for immune system cell target cell (U.S. Patent No. 4,676,980), and is used for the treatment of HIV (WO91/00360, WO92/00373 and EP03089).Any cross-linking method easily can be used to prepare Heteroconjugate antibodies.Suitable linking agent and technology are known (such as U.S. Patent No. 4,676,980).

The technology being generated multi-specificity antibody by antibody fragment is also described in document.Such as, chemistry can be used to connect and prepare bi-specific antibody.Brennan etc., Science229:81 (1985) describe by proteolysis cutting complete antibody to generate F (ab') ₂the code of fragment.By these fragments when existence two mercaptan complexing agent sodium arsenite (in order to stable vicinity two mercaptan and prevent the formation of intermolecular disulfide bond) reduction.Then Fab ' the fragment produced is changed into thionitrobenzoate ester (TNB) derivative.Then one of Fab'-TNB derivative is reverted to Fab'-mercaptan again by the reduction of mercaptoethylamine, and mix, to form bi-specific antibody with the another kind of Fab'-TNB derivative of equimolar amount.The bi-specific antibody produced can be used as the selectivity immobilized reagent of enzyme.

Fab'-SH fragment can be reclaimed from intestinal bacteria, and can these fragments of chemical coupling to form bi-specific antibody.Shalaby etc., J.Exp.Med.175:217-225 (1992) describe the bi-specific antibody F (ab') of full-length human ₂the generation of molecule.By intestinal bacteria separately secretion often kind of Fab' fragment, and carry out directed chemical coupling in vitro to form bi-specific antibody.The bi-specific antibody of formation like this in conjunction with the cell of process LAN HER2 acceptor and normal human T cells, and can trigger the lytic activity of people's cytotoxic lymphocyte for human breast tumour target thing.

Also describe and directly generate and the multiple technologies being separated bispecific antibody fragment from recombinant cell culture thing.Such as, leucine zipper has been used to generate bi-specific antibody.Kostelny etc., J.Immunol.148 (5): 1547-1553 (1992).Leucine zipper peptide from Fos with Jun albumen is connected with the Fab' part of two kinds of different antibodies by gene fusion.Antibody homodimer, is then oxidized to form antibody heterodimer to form monomer in hinge area reduction again.This method also can be used for generating antibody homodimer." double antibody " technology that Hollinger etc., Proc.Natl.Acad.Sci.USA90:6444-6448 (1993) record provides the replacement mechanism building bispecific antibody fragment.This fragment comprises the heavy chain variable domain (VH) and light-chain variable domain (VL) that are connected by joint, and described joint too short making can not be matched between on same chain two structural domains.Therefore, force complementary VL and the VH structural domain in VH and the VL structural domain in a fragment and another fragment to match, form two antigen binding sites thus.There was reported the another kind strategy by using scFv (sFv) dimer to build bispecific antibody fragment.See Gruber etc., J.Immunol.152:5368 (1994).

Contain the antibody having and tire more than two.Such as, three-specific antibody can be prepared.Tutt etc., J.Immunol.147:60 (1991).

Multivalent antibody

Multivalent antibody can be subject to the internalization (and/or alienation) of the cell of expressing this antibody institute conjugated antigen faster than bivalent antibody.Antibody of the present invention can be multivalent antibody that can easily be generated by the recombinant expressed of the nucleic acid of encode antibody polypeptides chain, that have three or more antigen binding site (such as tetravalent antibody) (beyond IgM classification).Multivalent antibody can comprise dimerization domain and three or more antigen binding site.In certain embodiments, dimerization domain comprises (or consisting of) Fc district or hinge area.In this case, antibody can comprise the aminoterminal three or more antigen binding site in Fc district and Fc district.In certain embodiments, multivalent antibody comprises (or consisting of) three to about eight antigen binding sites.In such embodiment, multivalent antibody comprises (or consisting of) four antigen binding sites.Multivalent antibody comprises at least one polypeptide chain (such as two polypeptide chains), and wherein said polypeptide chain comprises two or more variable domains.Such as, described polypeptide chain can comprise VD1-(X1) n-VD2-(X2) n-Fc, and wherein VD1 is the first variable domain, and VD2 is the second variable domain, and Fc is a polypeptide chain in Fc district, X1 and X2 represented amino acid or polypeptide, and n is 0 or 1.Such as, polypeptide chain can comprise: VH-CH1-flexible joint-VH-CH1-Fc district chain; Or VH-CH1-VH-CH1-Fc district chain.Multivalent antibody herein can comprise at least two (such as four) light chain variable domain polypeptides further.Multivalent antibody herein can comprise such as about two to about eight light chain variable domain polypeptides.The light chain variable domain polypeptide contained herein comprises light-chain variable domain, and optionally comprises CL structural domain further.

Single domain antibody

In certain embodiments, anti-Bv8 antibody of the present invention is single domain antibody (single-domainantibody).Single domain antibody comprises the heavy chain variable domain all or in part of antibody or the Single polypeptide chain of light-chain variable domain all or in part.In certain embodiments, single domain antibody is people's single domain antibody (Domantis, Inc., Waltham, MA; See such as U.S. Patent No. 6,248,516B1).In one embodiment, single domain antibody is made up of the heavy chain variable domain all or in part of antibody.

Antibody variants

In some embodiment, contain the amino acid sequence modifications of anti-Bv8 antibody described herein.Such as, the binding affinity and/or other biological characteristics that improve antibody may be wished.The amino acid sequence variation of antibody can be by the nucleotide sequence of encoding antibody being introduced in suitable change or being prepared by peptide symthesis.This type of is modified the residue comprised in such as antibody amino acids sequence and deletes and/or insert and/or substitute.Any deletion, insertion and alternative combinations can be carried out to obtain final construction, if final construction has the feature of expectation.When preparing sequence, amino acid change can be introduced the aminoacid sequence of Subject antibodies.

Can be used for identifying in antibody has " alanine scanning mutagenesis ", as described in Cunningham and Wells (1989) Science244:1081-1085 as some residue of preferred mutagenesis position or the method in region.Here, identify a residue or one group of target residue (such as charged residue, such as arg, asp, his, lys and glu) and replace with neutral or electronegative amino acid (such as L-Ala or many L-Ala), to affect the interaction of amino acid and antigen.Then pass through or more or other variant is introduced to alternate site, weighing the amino acid position to alternative display function susceptibility.Thus, although predetermine for the site of introducing variant amino acid sequence, but the essence of sudden change itself need not predetermine.Such as, in order to analyze the consequence of specifying site sudden change, carry out Alanine-scanning or random mutagenesis at target codon or region, and to the activity that the screening of expressed immunoglobulin (Ig) is expected.

Aminoacid sequence inserts and comprises the fusion of amino and/or C-terminal, and length range, and to be inserted in the sequence of single or multiple amino-acid residue to the polypeptide comprising 100 or more residues by a residue.The example that end inserts comprises the antibody with N end methionyl residue.Other insertion variant of antibody molecule comprises to be held N or C of antibody and enzyme (such as ADEPT) or the peptide fusion extending the antibody serum transformation period.

In certain embodiments, antibody of the present invention there occurs the degree changed to improve or to reduce antibody glycosylation.The glycosylation of polypeptide is typical or N-connection or O-connection.N-connects and refers to that carbohydrate moiety is attached to the side chain of asparagine residue.Tripeptide sequence asparagine-X-serine and asparagine-X-threonine (wherein X is any amino acid except proline(Pro)) are recognition sequences carbohydrate moiety enzymatic being attached to asparagine side chain.So, the existence that in polypeptide, these two kinds of tripeptide sequences are arbitrary creates potential glycosylation site.The glycosylation that O-connects refers to sugars N-aceylgalactosamine, one of semi-lactosi or wood sugar to be attached to hydroxy-amino-acid, and modal is Serine or Threonine, but also can use 5-OxoPro or 5-hydroxylysine.

Add in antibody or delete glycosylation site by changing aminoacid sequence thus creating or eliminate one or more above-mentioned tripeptide sequence and complete expediently (glycosylation site for N-connects).Described change is also undertaken (glycosylation site for O-connects) by interpolation in the sequence of original antibodies, deletion or alternative one or more Serine or threonine residues.

If antibody comprises Fc district, then can change the carbohydrate adhered on it.The natural antibody generated by mammalian cell typically comprises the oligosaccharides of branch, two feeler, and it generally connects the Asn297 (see (1997) TIBTECH15:26-32 such as such as Wright) being attached to Fc district CH2 structural domain by N-.Oligosaccharides can comprise various carbohydrate, such as seminose, N-acetyl-glucosamine (GlcNAc), semi-lactosi and sialic acid, and is attached to the Fucose of GlcNAc in two antennary oligosaccharide structure " trunk ".In some embodiments, can modify the oligosaccharides in antibody of the present invention to create there is the antibody variants that some improves characteristic.

Such as, the antibody variants that the carbohydrate structure (directly or indirectly) lacking Fucose is attached to Fc district is provided.This type of variant has the ADCC function of improvement (see such as U.S. Patent Application No. US2003/0157108 (Presta, L.); US2004/0093621 (KyowaHakkoKogyoCo., Ltd)).The example relating to the publication of " de-Fucose type " or " Fucose shortage type " antibody variants comprises: US2003/0157108; WO2000/61739; WO2001/29246; US2003/0115614; US2002/0164328; US2004/0093621; US2004/0132140; US2004/0110704; US2004/0110282; US2004/0109865; WO2003/085119; WO2003/084570; WO2005/035586; WO2005/035778; WO2005/053742; WO2002/031140; Okazaki etc., J.Mol.Biol.336:1239-1249 (2004); Yamane-Ohnuki etc., Biotech.Bioeng.87:614 (2004).The example that can generate the clone of de-fucosylated antibody comprises Lec13CHO cell (Ripka etc., the Arch.Biochem.Biophys.249:533-545 (1986) of the fucosylated defect of protein; U.S. Patent Application No. US2003/0157108A1, Presta, L; And WO2004/056312A1; Adams etc., especially embodiment 11) and knock out clone, such as α-1; the Chinese hamster ovary celI that 6-fucose transferase gene FUT8 knocks out is (see such as Yamane-Ohnuki etc., Biotech.Bioeng.87:614 (2004); Kanda, Y. etc., Biotechnol.Bioeng., 94 (4): 680-688 (2006); And WO2003/085107).

Further provide the antibody variants with decile oligosaccharides, such as, be wherein attached to two antennary oligosaccharide in antibody Fc district by GlcNAc decile.The ADCC function that this type of antibody variants can have the fucosylated of reduction and/or improve.The example of this type of antibody variants is recorded in such as WO2003/011878 (Jean-Mairet etc.); U.S. Patent No. 6,602,684 (Umana etc.); And US2005/0123546 (Umana etc.).Additionally provide the antibody variants having at least one galactose residue in the oligosaccharides being attached to Fc district.This type of antibody variants can have the CDC function of improvement.This type of antibody variants is recorded in such as WO1997/30087 (Patel etc.); WO1998/58964 (Raju, S.); And WO1999/22764 (Raju, S.).

In certain embodiments, antibody variants comprises and has the Fc district that a place or many places improve the amino acid replacement of ADCC further, and such as the 298th, 333 and/or 334 (EU residue numbering) places of Fc district substitute.This type of substitutes can exist with any altered composition mentioned above.

In certain embodiments, present invention encompasses following antibody variants, it has some but not all effector functions, and this makes it to become wherein antibody Half-life in vivo is important but the expectation material standed for of the optional or harmful many application of some effector functions (such as complement and ADCC).In certain embodiments, the Fc measuring antibody is active in guarantee the characteristic only remaining expectation.External and/or in vivo cytotoxicity assay method can be carried out to confirm the reduction/elimination of CDC and/or ADCC activity.Such as, Fc acceptor (FcR) binding assay can be carried out to confirm that antibody deficiency Fc γ R combines (from then on likely lacking ADCC active), but retain FcRn binding ability.The main cell of mediation ADCC, NK cell, only expresses Fc γ RIII, and monocytes Fc γ RI, Fc γ RII and Fc γ RIII.The FcR that RavetchandKinet, Annu.Rev.Immunol.9:457-92 (1991) the 464th page table 3 summarizes on hematopoietic cell expresses.U.S. Patent No. 5; 500; describe in 362 the vitro assay of the ADCC activity of assessment molecules of interest limiting examples (also can see Hellstrom, I., etal.Proc.Nat ' lAcad.Sci.USA83:7059-7063 (1986); Hellstrom, Ietal., Proc.Nat ' lAcad.Sci.USA82:1499-1502 (1985); 5,821,337; Bruggemann, M.etal., J.Exp.Med.166:1351-1361 (1987)).Or, on-radiation measuring method can be adopted (see such as ACTI ^tMnon-radioactive cell toxicity assay, it is for flow cytometry (CellTechnology, Inc.MountainView, CA); And CytoTox non-radioactive cell toxicity assay (Promega, Madison, WI)).The effector cell that can be used for this type of assay method comprises peripheral blood mononuclear cell (PBMC) and NK cell (NK) cell.Or/in addition, and the ADCC that can assess molecules of interest is in vivo active, such as, in animal model, such as disclosed in Clynesetal.Proc.Nat ' lAcad.Sci. (USA) 95:652-656 (1998).C1q binding assay can also be carried out to confirm that from then on antibody in conjunction with C1q and can not lack CDC activity.In order to assess complement activation, CDC assay method can be carried out (see such as Gazzano-Santoroetal., J.Immunol.Methods202:163 (1996); Cragg, M.S.etal., Blood101:1045-1052 (2003); And Cragg, M.S. and M.J.Glennie, Blood103:2738-2743 (2004)).The method that this area can also be used to know is carried out FcRn and is combined and removing/transformation period mensuration (see such as Petkova, S.B.etal., Int ' l.Immunol.18 (12): 1759-1769 (2006)) in body.

Provide the another kind of antibody variants with a place or many places amino acid replacement.The site interested of carrying out alternative mutagenesis comprises hypervariable region, but also containing FR changes.In " amino acid replacement table ", " preferably substituting " hurdle shows conservative substituting.The more substantial variations being called " illustrate and substitute " is provided in table 1, or further describe referring below to Amino Acid Classification.Immunogenicity amino acid replacement can be mixed antibody interested, and screen product, such as, screen the activity of expectation, the antigen such as improved combines, reducing, ADCC or CDC of improvement, etc.

Table 1

Original Residue	Illustrate and substitute	Preferably substitute
			Ala(A)	Val;Leu;Ile	Val
Arg(R)	Lys;Gln;Asn	Lys
			Asn(N)	Gln;His;Asp,Lys;Arg	Gln
Asp(D)	Glu;Asn	Glu
			Cys(C)	Ser;Ala	Ser
Gln(Q)	Asn;Glu	Asn
			Glu(E)	Asp;Gln	Asp
Gly(G)	Ala	Ala
			His(H)	Asn;Gln;Lys;Arg	Arg
Ile(I)	Leu; Val; Met; Ala; Phe; Nor-leucine	Leu
			Leu(L)	Nor-leucine; Ile; Val; Met; Ala; Phe	Ile
Lys(K)	Arg;Gln;Asn	Arg
			Met(M)	Leu;Phe;Ile	Leu
Phe(F)	Trp;Leu;Val;Ile;Ala;Tyr	Tyr
			Pro(P)	Ala	Ala
Ser(S)	Thr	Thr
			Thr(T)	Val;Ser	Ser
Trp(W)	Tyr;Phe	Tyr
			Tyr(Y)	Trp;Phe;Thr;Ser	Phe
Val(V)	Ile; Leu; Met; Phe; Ala; Nor-leucine	Leu

The modification of antagonist biological characteristics is by selecting to realize impact the alternative of following aspect: the structure of polypeptide backbone in (a) replacement area, such as (fold) sheet or helical conformation, the electric charge of (b) target site punishment or hydrophobicity, or the volume of (c) side chain.According to the similarity of its side chain properties, amino acid can be divided into groups as follows (A.L.Lehninger, in Biochemistry, the 2nd edition, pp.73-75, WorthPublishers, NewYork (1975)):

(1) nonpolar: Ala (A), Val (V), Leu (L), Ile (I), Pro (P), Phe (F), Trp (W), Met (M)

(2) uncharged, polarity: Gly (G), Ser (S), Thr (T), Cys (C), Tyr (Y), Asn (N), Gln (Q)

(3) acid: Asp (D), Glu (E)

(4) alkalescence: Lys (K), Arg (R), His (H)

Or according to common side chain properties, natural exist residue and can divide into groups as follows:

(1) hydrophobic: nor-leucine, Met, Ala, Val, Leu, Ile;

(2) neutral, hydrophilic: Cys, Ser, Thr, Asn, Gln;

(3) acid: Asp, Glu;

(4) alkalescence: His, Lys, Arg;

(5) residue of chain orientation is affected: Gly, Pro;

(6) aromatic: Trp, Tyr, Phe.

Non-conservative substituting needs to replace another classification with the member of one of these classifications.This type of alternative residue can also import conservative substitution sites, or imports residue (non-conservative) site.

One class alternative variations relates to one or more some hypervariable region residues of alternative parental antibody (such as humanization or people's antibody).Usually, the gained variant being used for exploitation is further selected can to have change (such as improving) biological characteristics relative to the parental antibody producing them.Exemplary alternative variations is the antibody of affinity maturation, and it can use the affinity maturation technology based on phage display and generate expediently.In brief, several hypervariable region sites (such as 6-7 site) is suddenlyd change, produces all possible amino acid replacement in each site.The antibody display of generation like this on filamentous phage particle, as bacteriophage coat protein (the such as M13 gene III product) fusions at least partially with each particle internal packing.Then its biologic activity (such as binding affinity) is screened to the variant of phage display.In order to identify the site, candidate hypervariable region for modifying, scanning mutagenesis (such as Alanine-scanning) can be carried out and to identify, the some hypervariable region residues with significant contribution is combined to antigen.Or/in addition, analyze the crystalline structure of antigen-antibody complex to identify that the point of contact between antibody and antigen may be useful.This type of contact residues and contiguous residue carry out according to technology known in the art (comprising technology detailed in this article) candidate locus that substitutes.Once produce such variant, use technology known in the art (comprising the techniques described herein) to screen this group variant, the variant in one or more relevant assay with good characteristic can be selected for further exploitation.

Prepared by the multiple method that the nucleic acid molecule of encoding antibody amino acid sequence variation is known by this area.These methods include but not limited to from natural origin be separated (when natural there is amino acid sequence variation), or to prepare by carrying out oligonucleotide mediated (or fixed point) mutagenesis, PCR mutagenesis and cassette mutagenesis to the comparatively early variant of preparation or the antibody of non-variant pattern.

May wish to introduce a place in the Fc district of antibody of the present invention or many places amino acid modified, generate Fc region variants thus.Fc region variants can be included in the people Fc region sequence (such as human IgG1, IgG2, IgG3 or IgG4Fc district) that one or more amino acid position comprises (comprising the position of hinge cysteine) amino acid modified (such as substituting).

Describe and the instruction of this area according to this, be encompassed in some embodiment, antibody of the present invention can comprise a place compared with the corresponding antibody of wild-type or many places change in (in such as Fc district).Compared with their wild type counterparts, these antibody still can identical characteristics substantially required for treatment effect.Such as, think and can carry out causing C1q to combine in Fc district and/or CDC (CDC) changes some change of (namely or strengthen or weaken), such as, described in WO99/51642.Also can see Duncan and Winter paying close attention to other example of Fc region variants, Nature322:738-40 (1988); U.S. Patent No. 5,648,260; U.S. Patent No. 5,624,821; And WO94/29351.WO00/42072 (Presta) and WO2004/056312 (Lowman) describes the antibody variants improving the combination of FcR or reduce.Also can see the J.Biol.Chem.9 such as Shields (2): 6591-6604 (2001).Increased Plasma Half-life and to neonatal Fc receptor (FcRn) (it is responsible for Maternal immunoglobulin G to be transferred to fetus) (Guyer etc., J.Immunol.117:587 (1976) and Kim etc., J.Immunol.24:249 (1994)) combination improvement antibody be recorded in US2005/0014934A1 (Hinton etc.).These antibody comprise and have a place or many places and improve the alternative Fc district that Fc district is combined with FcRn.There is the Fc region amino acid sequence of change and C1q binding ability raises or the polypeptide variants that reduces is recorded in U.S. Patent No. 6,194,551B1, WO99/51642.Also can see the J.Immunol.164:4178-4184 such as Idusogie (2000).

On the other hand, the invention provides the antibody comprising modification in the interface of the Fc polypeptide forming Fc district, wherein said modification is convenient to and/or is promoted different dimerization.These are modified to be included in a Fc polypeptide and import protuberance (protuberance) and import cavity (cavity) in the 2nd Fc polypeptide, wherein said protuberance can be arranged in described cavity, thus promotes the compound of first and second Fc polypeptide.It is known in the art for generating the method with the antibody that these are modified, such as, be recorded in U.S. Patent No. 5,731,168.

Another aspect, may expect to create cysteine engineered antibody, such as " thioMAb ", wherein substitute one or more residues of antibody with cysteine residues.In particular embodiments, replaced residue is positioned at the Accessibility site of antibody.By substituting those residues with halfcystine, thus reactive thiol group is positioned the Accessibility site of antibody, and can be used for antibody and other module (such as drug moiety or linker-drug module) coupling, as further described herein.In certain embodiments, one or more following residue can be substituted with halfcystine: the V205(Kabat numbering of light chain); The A118(EU numbering of heavy chain); With the S400(EU numbering in heavy chain Fc district).

Antibody derivatives

Can modify further anti-Bv8 antibody of the present invention with comprise that this area is known and be easy to obtain extra non-proteinaceous module.Preferably, the module being suitable for antibody derivatize is water-soluble polymers.The non-limitative example of water-soluble polymers includes but not limited to polyoxyethylene glycol (PEG), ethylene glycol/propylene glycol copolymers, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinylpyrrolidone, poly-1,3-dioxolane, poly-1,3,6-tri- alkane, ethene/copolymer-maleic anhydride, polyamino acid (homopolymer or randomcopolymer), dextran or poly-(n-VP) polyoxyethylene glycol, propropylene glycol homopolymers, propylene oxide/ethylene oxide copolymer, polyoxyethylated polyols (such as glycerine), polyvinyl alcohol, and composition thereof.Due to its stability in water, methoxy PEG-propionaldehyde may have advantage aborning.Polymkeric substance can be any molecular weight, and can be branch or unbranched.The polymkeric substance number being attached to antibody can change, and if attached to more than a polymkeric substance, so they can be identical or different molecules.Generally speaking, number and/or the type of the polymkeric substance of derivatize can be determined according to following consideration, include but not limited to the concrete property of antibody to be modified or function, treatment etc. that whether antibody derivatives will be used to specify under condition.

In another embodiment, antibody and the conjugate of the non-proteinaceous module that selectivity heats by being exposed to radiation is provided.In one embodiment, this non-proteinaceous module is carbon nanotube (Kam etc., Proc.Natl.Acad.Sci.USA102:11600-11605 (2005)).Radiation can be any wavelength, includes but not limited to harmless to ordinary cells but non-proteinaceous module is heated to the wavelength of the killed temperature of cell close to antibody-non-proteinaceous module.

Activation measurement

The many measure method known by this area is to their physical/chemical properties of Identification of the antibodies of the present invention and biological function.

On the one hand, the assay method for the identification of the anti-Bv8 antibody with biologic activity is provided.Biologic activity can comprise such as to the regulation and control of one or more aspects (Bv8 combines, Bv8 mediates endothelial cell proliferation, metastases) of Bv8 correlation effect.

In certain embodiments of the invention, to their biologic activity of immunoglobulin (Ig) analysis generated herein.In some embodiment, to their antigen-binding activity of immunoglobulin (Ig) test of the present invention.This area is known and the antigen binding assay that can be used for herein includes but not limited to use such as western blot, radioimmunoassay, ELISA(enzyme-linked immunosorbent assay), the technology such as " sandwich " immunoassay, immunoprecipitation assay, fluorescence immunoassay and protein A immunoassays any directly or competitive binding assay method.Hereafter in embodiment part, provide exemplary antigen binding assay.

By the antibody of the further purification Identification of a series of assay method, include but not limited to that N holds order-checking, amino acid analysis, non denatured size exclusion high pressure liquid chromatography (HPLC) (HPLC), mass spectrum, ion exchange chromatography and papain digestion.

In some embodiments, present invention contemplates and have some but the improvement antibody of not all effector function, this makes it be important but some effector function (such as complement and ADCC) becomes the material standed for of expectation in being unnecessary or harmful many application at antibody Half-life in vivo.In certain embodiments, measure institute generate immunoglobulin (Ig) Fc activity to guarantee only to remain the characteristic of expectation.External and/or in vivo cytotoxicity assay method can be carried out to confirm the reduction/abatement of CDC and/or ADCC activity.Such as, Fc acceptor (FcR) binding assay can be carried out to confirm antibody deficiency Fc γ R combination (therefore likely lacking ADCC active) but to retain FcRn binding ability.The main cell of mediation ADCC, NK cell, only expresses Fc γ RIII, and monocytes Fc γ RI, Fc γ RII and Fc γ RIII.The FcR that RavetchandKinet, Annu.Rev.Immunol.9:457-92 (1991) the 464th page table 3 summarizes on hematopoietic cell expresses.United States Patent (USP) 5,500,362 or 5,821, describe the example of the vitro assay of the ADCC activity for assessment of molecules of interest in 337.The effector cell that can be used for this type of assay method comprises peripheral blood lymphocytes (PBMC) and NK cell (NK) cell.Or/in addition, can the ADCC of purpose of appraisals molecule in vivo active, as in animal model, disclosed in such as Clynesetal., PNAS (USA) 95:652-656 (1998).Also can carry out C1q binding assay active to confirm that antibody can not lack CDC in conjunction with C1q and therefore.In order to assess complement activation, CDC assay method can be carried out, such as, as described in Gazzano-Santoroetal., J.Immunol.Methods202:163 (1996).The method that this area also can be used to know is carried out FcRn and is combined and removing/transformation period mensuration in body.

In some embodiment, the invention provides the improvement antibody with the effector functions of raising and/or the transformation period of prolongation.See such as U. S. application No.12/577,967.

Carrier, host cell and recombination method

In order to recombinant production antibody of the present invention, be separated its nucleic acid of coding, and be inserted into replicable vector, for cloning (DNA cloning) further or expressing.Old process can be used to be easy to be separated the DNA of encoding antibody and to check order (as used the oligonucleotide probe that can be combined with the gene specific of encoding antibody heavy and light chain).Many carriers can be utilized.The selection of carrier depends in part on the host cell that will use.Usually, preferred host cell is that protokaryon or eucaryon (normally Mammals) originate from.Will be appreciated that the constant region of any isotype all can be used for this object, comprise IgG, IgM, IgA, IgD and IgE constant region, and this type of constant region can derive from anyone or animal species.

A. prokaryotic host cell is used to generate antibody:

I. vector construction

Standard recombinant techniques can be used to obtain the polynucleotide sequence of code book invention antibody polypeptides component.Can the polynucleotide sequence of expectation be separated from antibody-producting cell such as hybridoma and check order.Or, nucleotide synthesizer or round pcr synthetic polyribonucleotides can be used.Once obtain, the sequence of coded polypeptide is inserted and can copy in prokaryotic hosts and the recombinant vectors of expressing heterologous polynucleotide.In order to the present invention, this area can be used obtainable and the many carriers known.The selection of appropriate carrier by depend primarily on will insertion vector nucleic acid size and will with the concrete host cell of vector.According to its function (increase or expressing heterologous polynucleotide, or the two furthermore) and the consistency with its concrete host cell resident wherein thereof, often kind of carrier contains multiple component.Support element generally includes but is not limited to replication orgin, selected marker gene, promotor, ribosome bind site (RBS), signal sequence, heterologous nucleic acids Insert Fragment and transcription termination sequence.

Generally speaking, the plasmid vector used together with host cell comprises derived from the replicon and control sequence with these host compatibility species.Carrier carries replication site usually, and can provide the flag sequence of Phenotypic Selection in transformant.Such as, usually with the pBR322 plasmid transformation of E. coli derived from species Escherichia coli.PBR322 comprises the gene of encoding ampicillin (Amp) and tsiklomitsin (Tet) resistance, provides the means of light identification of transformed cell thus.PBR322, its derivative or other microorganism plasmid or phage also can comprise or modified and comprise can by microorganism organism for expressing the promotor of endogenous protein.The people such as Carter, United States Patent (USP) 5,648, describes the example of the pBR322 derivative for expressing specific antibodies in detail in 237.

In addition, the phage vector comprising the replicon compatible with host microorganism and control sequence can be used as the conversion carrier of these hosts.Such as, phage such as λ GEM can be used ^tM-11 build the recombinant vectors that can be used for transform susceptible host cells such as intestinal bacteria LE392.

Expression vector of the present invention can comprise two or more promotor-cistrons pair, and they are encoded each polypeptide component.Promotor is positioned at cistron upstream untranslated regulating and controlling sequence (5'), the expression of its regulation and control cistron.Prokaryotic promoter is divided into two classes usually, induction type and composition.Inducible promoter refer to respond culture condition change (as nutraceutical existence whether or temperature variation) and start the promotor that the elevated levels by the cistron of its control transcribes.

Be subject to a large amount of promotors of multiple potential host cell identification as everyone knows.Digest by restriction enzyme the promotor that cuts in source DNA and the promoter sequence of separation is inserted carrier of the present invention, the cistron DNA of the promotor of selection with coding light chain or heavy chain can be operatively connected thus.Native promoter sequence and many allogeneic promoters all can be used for amplification and/or the expression of instructing target gene.In some embodiment, use allogeneic promoter, because compared with native target polypeptide promotor, they allow that the higher of expressed target gene is transcribed and higher output yield usually.

The promotor being applicable to prokaryotic hosts comprises PhoA promotor, beta-galactosidase enzymes and lactose promoter system, tryptophane (trp) promoter systems and hybrid promoter such as tac or trc promotor.But, in bacterium, there is other promotor of function (such as other known bacterium or phage promoter) to be also suitable.Their nucleotide sequence is delivered, skilled work personnel can use thus provides the joint of any required restriction site or adapter their cistrons with coding target light chain and heavy chain to be operatively connected (Siebenlistetal., Cell20:269 (1980)).

In one aspect of the invention, each cistron in recombinant vectors comprises the secretory signal sequence component that the expressed polypeptide of guidance wears film transhipment.Generally speaking, signal sequence can be the component of carrier, or it can be a part for the target polypeptid DNA of insertion vector.The signal sequence selected in order to the present invention should be the signal sequence being subject to host cell identification and processing (namely being excised by signal peptidase).The prokaryotic host cell of the signal sequences native of heterologous polypeptide is processed for nonrecognition, the signal sequence prokaryotic signal sequence being selected from such as lower group to be substituted: alkaline phosphatase, penicillinase, Ipp or heat-staple enterotoxin 1 I (STII) leader sequence, LamB, PhoE, PelB, OmpA and MBP.In one embodiment of the invention, the signal sequence all used in two cistrons of expression system is STII signal sequence or its variant.

On the other hand, the generation according to immunoglobulin (Ig) of the present invention can occur in the tenuigenin of host cell, does not therefore need to there is secretory signal sequence in each cistron.In that, light chain immunoglobulin and heavy chain are expressed, are folded and assemble and form Functional immunoglobulin in tenuigenin.Some host strain is (as intestinal bacteria trxB ^-bacterial strain) provide the tenuigenin condition being beneficial to disulfide formation, thus allow the correct folding and assembling of expressed protein subunit.ProbaandPluckthun,Gene159:203(1995)）。

The prokaryotic host cell being suitable for expressing antibody of the present invention comprises archeobacteria (Archaebacteria) and eubacterium (Eubacteria), such as Gram-negative or gram-positive organism.The example of useful bacterium comprises Escherichia (Escherichia) (as colon bacillus E.coli), bacillus (Bacillus) (as subtilis B.subtilis), enterobacter (Enterobacteria), Rhodopseudomonas (Pseudomonas) (as Pseudomonas aeruginosa P.aeruginosa) species, Salmonella typhimurium (Salmonellatyphimurium), serratia marcescens (Serratiamarcescans), Klebsiella (Klebsiella), proteus (Proteus), Shigella (Shigella), rhizobium (Rhizobium), Vitreoscilla (Vitreoscilla), or paracoccus (Paracoccus).In one embodiment, gram-negative cells is used.In one embodiment, use Bacillus coli cells as host of the present invention.The example of coli strain comprises bacterial strain W3110(Bachmann, CellularandMolecularBiology, the 2nd volume, Washington, D.C., American Academy Of Microbiology, 1987,1190-1219 page; ATCC preserving number 27,325) and derivative, comprise and there is genotype W3110 Δ fhuA (Δ tonA) ptr3lacIqlacL8 Δ ompT Δ (nmpc-fepE) degP41kan ^rbacterial strain 33D3(U.S. Patent number 5,639,635).Other bacterial strain and derivative thereof, such as intestinal bacteria 294(ATCC31,446), intestinal bacteria B, intestinal bacteria _λ1776(ATCC31,537) and intestinal bacteria RV308(ATCC31,608) be also suitable.These examples just illustrate and unrestricted.This area is known for building the method having and specify genotypic any above-mentioned bacterial derivation thing, see such as Bassetal., Proteins8:309-314 (1990).Usually must consider that the reproducibility of replicon in bacterial cell selects the bacterium be suitable for.Such as, when using well-known plasmid such as pBR322, pBR325, pACYC177 or pKN410 to provide replicon, intestinal bacteria, serratia or Salmonella ssp may be suitable for use as host.Usually, host cell should secrete the proteolytic ferment of minimum, and may wish to mix extra proteinase inhibitor in cell cultures.

Ii. antibody tormation

With above-mentioned expression vector transformed host cell, and cultivate in the conventional nutrient culture suitably changed expecting the gene of sequence in order to evoked promoter, selection transformant or amplification coding.

Transform and import prokaryotic hosts by DNA, DNA can be copied, or as extra-chromosomal element or pass through chromosomal composition.According to host cell used, the standard technique being suitable for these cells is used to transform.The Calcium treatment of calcium chloride is adopted to be generally used for the bacterial cell with firm cell-wall barriers.Another kind of method for transformation adopts polyoxyethylene glycol/DMSO.What use also has a kind of technology to be electroporation.

That know in this area and be suitable for cultivating in the substratum of selected host cell the prokaryotic cell prokaryocyte cultivated for generating polypeptide of the present invention.The example of suitable culture medium comprises the LB substratum (Luriabroth) that with the addition of required nutritional supplement.In some embodiment, the selective agent that substratum is also selected containing the structure of with good grounds expression vector, allows the prokaryotic cell prokaryocyte growth comprising expression vector with selectivity.Such as, in the substratum of the cell for culture expression ampicillin resistance gene, penbritin is added.

Except carbon, nitrogen and inorganic phosphate sources, also can any required fill-in containing proper concn, or to add separately or as the mixture with another kind of fill-in or substratum, such as compound nitrogen source.Optional, substratum can be selected from the reductive agent of lower group containing one or more: gsh, halfcystine, cystamine, thioglycolate salt/ester, dithioerythritol and dithiothreitol (DTT).

Prokaryotic host cell is cultivated in suitable temperature.Such as, for cultivation intestinal bacteria, preferred temperature range is about 20 DEG C to about 39 DEG C, more preferably from about 25 DEG C to about 37 DEG C, even more preferably from about 30 DEG C.Depend primarily on host organisms, the pH of substratum can be scope be about 5 to about 9 any pH.For intestinal bacteria, pH preferably about 6.8 to about 7.4, more preferably from about 7.0.

If use inducible promoter in expression vector of the present invention, be so suitable for induced protein expression under the condition activating promotor.In one aspect of the invention, PhoA promotor is used to control transcribing of polypeptide.Therefore, in order to induce, in phosphoric acid salt restriction substratum, cultivate the host cell through transforming.Preferably, phosphoric acid salt restriction substratum is C.R.A.P substratum (see such as Simmonsetal., J.Immunol.Methods263:133-147 (2002)).According to adopted vector construct, other inductor multiple can be adopted, as is known in the art.

In one embodiment, expressed polypeptide of the present invention is secreted in the pericentral siphon of host cell and also therefrom reclaims.Protein recovery is usually directed to destroy microorganisms, usually by means such as such as osmotic shock (osmoticshock), supersound process or cracking.Once cell is destroyed, by centrifugal or filter clear cell debris or whole cell.Protein can be further purified by such as affine resin chromatography.Or protein may be transported in nutrient solution and also therefrom be separated.From nutrient solution scavenger cell, and culture supernatants can be filtered and concentrates, for being further purified generated protein.Protein expressed by the method such as polyacrylamide gel electrophoresis (PAGE) and the further separation andpreconcentration of western blot analysis generally known can be used.

In one aspect of the invention, antibody producing is carried out in a large number by fermenting process.Multiple extensive fed-batch fermentation flow process can be used for Restruction albumen.Large scale fermentation has the capacity of at least 1000 liters, and preferably about 1, the capacity of 000 to 100,000 liter.These fermentor tanks use agitator paddle to distribute oxygen and nutrient, especially glucose (preferred carbon source/energy).On a small scale fermentation is often referred to and is no more than at volume capacity the fermentation carried out in the fermentor tank of about 100 liters, and scope can be about 1 rise to about 100 liters.

During the fermentation, usually cell is being cultured under suitable conditions expectation density (as OD ₅₅₀about 180-220, is in early stage stationary phase at this phase cell) start the induction of protein expression afterwards.According to adopted vector construct, multiple inductor can be used, know as this area with above-described.Can by the time shorter for cell cultures before induction.Usually cell induction is about 12-50 hour, but longer or shorter induction time can be used.

In order to improve the seed output and quality of polypeptide of the present invention, multinomial fermentation condition can be revised.Such as, in order to improve the correct assembling of secreted antibody polypeptides and fold, can overuse and express a kind of peptidyl prolyl-cis that chaperone such as Dsb albumen (DsbA, DsbB, DsbC, DsbD and/or DsbG) or FkpA(has Chaperone Activity, trans-isomerase) additional carrier carry out cotransformation host prokaryotic cell.Prove that chaperone promotes the correct folding and solubleness of the heterologous protein generated in bacterial host cell.Chenetal., J.Biol.Chem.274:19601-19605 (1999); The people such as Georgiou, United States Patent (USP) 6,083,715; The people such as Georgiou, United States Patent (USP) 6,027,888; BothmannandPluckthun, J.Biol.Chem.275:17100-17105 (2000); RammandPluckthun, J.Biol.Chem.275:17106-17113 (2000); Arieetal., Mol.Microbiol.39:199-210 (2001)).

In order to be down to minimum by the proteolysis of expressed heterologous protein (especially to the heterologous protein of proteolysis sensitivity), some host strain of proteolysis enzyme defect can be used for the present invention.Such as, can host cell strains be modified, in the gene of the known bacteria protease of coding, carry out genetic mutation, such as proteinase II I, OmpT, DegP, Tsp, proteolytic enzyme I, proteolytic enzyme Mi, proteolytic enzyme V, proteolytic enzyme VI and combination thereof.Can obtain some e. coli protein enzyme defect bacterial strain, see such as Jolyetal., (1998) see above; The people such as Georgiou, United States Patent (USP) 5,264,365; The people such as Georgiou, United States Patent (USP) 5,508,192; Haraetal., MicrobialDrugResistance2:63-72 (1996).

In one embodiment, in expression system of the present invention, proteolysis enzyme defect is used and through the coli strain of the Plastid transformation of one or more chaperones of overexpression as host cell.

Iii. antibody purification

The Standard protein purification method that this area is known can be adopted.Flow process is below the illustration of appropriate purification flow process: the chromatography on the fractionation on the affine or ion exchange column of immunity, alcohol settling, reversed-phase HPLC, tripoli or Zeo-karb such as DEAE, chromatofocusing, SDS-PAGE, ammonium sulfate precipitation and use such as the gel-filtration of G-75.

In one aspect, the albumin A be fixed in solid phase is used for the immunoaffinity purification of full length antibody product of the present invention.Albumin A is the 41kD cell wall protein from streptococcus aureus (Staphylococcusaureas), and it is with high-affinity binding antibody Fc district.Lindmarketal.,J.Immunol.Meth.62:1-13(1983)）。The solid phase that albumin A is fixed thereon preferably has the pillar of glass or quartz surfaces, more preferably controlled pore glass post or silicic acid post.In some applications, pillar, with pack quilts such as such as glycerine, attempts the non-specific adhesion of preventing pollution thing.

As the first step of purifying, the prepared product derived from cell culture described above is applied in albumin A immobilization solid phase, makes object antibody Specific binding proteins A.Then solid phase is cleaned to remove the pollutent with solid phase non-specific binding.Object antibody is reclaimed from solid phase finally by wash-out.

B. eukaryotic host cell is used to generate antibody:

Support element generally include but be not limited to following one or more: signal sequence, replication orgin, one or more marker gene, enhancer element, promotor and transcription termination sequence.

(i) signal sequence component

The carrier used in eukaryotic host cell also can comprise signal sequence at the N end of object mature protein or polypeptide or have other polypeptide of special cleavage site.Preferably be subject to host cell identification and process the Heterologous signal sequences of (namely being excised by signal peptidase).In mammalian cell expression, can utilize mammalian signal sequences and viral secretory leading, such as herpes simplex gD signal.

The DNA of these prosomas is connected in the reading frame of the DNA of encoding antibody.

(ii) replication orgin

Usually, mammalian expression vector does not need replication orgin component.Such as, SV40 starting point may only just use because comprising early promoter usually.

(iii) Select gene component

Cloning and expression carrier can comprise Select gene, also referred to as selection marker.Typical Select gene is encoded following protein: (a) gives the resistance to microbiotic or other toxin, as penbritin, Liu Suanyan NEOMYCIN SULPHATE, methotrexate or tsiklomitsin; B () supplies corresponding auxotrophy; Or (c) provides the critical nutrients that can not obtain from complex medium.

An example of selection scheme utilizes medicine to block the growth of host cell.Those Hemapoiesis through heterologous gene successful conversion give the protein of drug resistance, thus survive selection scheme.The example of this type of dominant selection uses drug neomycin, mycophenolic acid and Totomycin.

Another example being suitable for the selection marker of mammalian cell is the selection marker of the cell can identifying picked-up antibody nucleic acids of having the ability, such as DHFR, thymidine kinase, the preferred primate metallothionein gene of metallothionein(MT) I and II, adenosine deaminase, ornithine decarboxylase etc.

Such as, first by all transformants being carried out in the substratum containing methotrexate (a kind of competitive antagonist of Mtx, DHFR) cultivate to identify the cell transformed through DHFR Select gene.Adopt wild-type DHFR time, suitable host cell be DHFR active defects Chinese hamster ovary (CHO) clone (as cRL-9096).

Or, by containing for the selective agent such as aminoglycoside antibiotics of selection marker as the substratum of kantlex, Liu Suanyan NEOMYCIN SULPHATE or G418 in culturing cell select the DNA sequence dna of encoded antibody, wild type DHFR protein and another kind of selection marker such as aminoglycoside 3'-phosphotransferase (APH) to transform or the host cell (particularly comprising the wild-type host of endogenous DHFR) of cotransformation.See United States Patent (USP) 4,965,199.

(iv) promotor component

Cloning and expression carrier comprises the promotor being subject to host organisms identification usually, and is operatively connected with antibody polypeptides nucleic acid.Known eukaryotic promoter sequence.In fact, all eukaryotic genes all have and are rich in AT district, and it is positioned at site upstream about 25 to 30 base places of initiation transcription.Be CNCAAT (SEQIDNO:206) district permitting the another kind of sequence that 70 to 80 base places, polygenic transcriptional start point upstream find, wherein N can be any Nucleotide.Holding at the 3' of most of eukaryotic gene is AATAAA (SEQIDNO:207) sequence, and it may be the signal of 3' end interpolation polyadenylic acid (polyA) tail to encoding sequence.In the insertion carrier for expression of eukaryon that all these sequences are suitable.

Be subject to such as obtaining from virus (such as polyomavirus, fowlpox virus, adenovirus (such as 2 type adenovirus), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, retrovirus, hepatitis B virus and simian virus 40 (SV40)) genome by carrier Antibody transcription polypeptide in mammalian host cell, from heterologous mammal promotor (as actin promoter or immunoglobulin promoter), from the control of the promotor of heat-shock promoters, if the words that these promotors are compatible with host cell systems.

Obtain the early stage of SV40 virus and late promoter with the form of SV40 restriction fragment easily, this fragment also comprises SV40 virus origin of replication.The immediate early promoter of human cytomegalic inclusion disease virus is obtained easily with the form of HindIIIE restriction fragment.United States Patent (USP) 4,419, discloses the system using bovine papilloma virus as carrier expressible dna in mammalian hosts in 446.United States Patent (USP) 4,601, describes the one amendment of this system in 978.Or, Rous sarcoma virus long terminal repeat can be used as promotor.

(v) enhancer element component

Often through inserting enhancer sequence in the carrier to improve higher eucaryotic cells transcribing the DNA of code book invention antibody polypeptides.It is now know that from many enhancer sequence of mammalian genes (sphaeroprotein, elastoser, white protein, α-fetoprotein and Regular Insulin).But, usually use the enhanser from eukaryotic cell virus.Example comprises the enhanser (bp100-270) of SV40 replication orgin side in late period, the sub-enhanser of cytomegalovirus early promoter, the enhanser of polyomavirus replication orgin side in late period and adenovirus cancers.Also can see Yaniv, Nature297:17-18 (1982) about the enhancing element activating eukaryotic promoter.Enhanser can montage in carrier, be positioned at 5' or the 3' position of antibody polypeptides encoding sequence, but be preferably placed at the 5' site of promotor.

(vi) Transcription Termination component

The expression vector used in eukaryotic host cell usually also comprises termination and transcribes the necessary sequence with stable mRNA.This type of sequence can obtain from the 5' end of eucaryon or viral DNA or cDNA non-translational region with 3' end once in a while usually.The non-translational region transcription that these regions are included in the mRNA of encoding antibody becomes the nucleotide segment of polyadenylated fragments.A kind of useful Transcription Termination component is Trobest polyadenylation district.See WO94/11026 and disclosed in expression vector.

(vii) selection of host cell and conversion

The host cell being suitable for the DNA cloning or express in this paper carrier comprises higher eucaryotic cells described herein, comprises vertebrate host cell.The breeding of vertebrate cells in cultivation (tissue culture) becomes old process.The example of useful mammalian host cell line have transform through SV40 monkey kidney CV1 system (COS-7, cRL1651), human embryo kidney (HEK) system (293 cells or for suspension culture and 293 cells of subclone, Grahametal., J.Gen.Virol.36:59 (1977)), baby hamster kidney cell (BHK, cCL10), Chinese hamster ovary cell/-DHFR(CHO, Urlaubetal., Proc.Natl.Acad.Sci.USA77:4216 (1980)), mouse Sai Tuoli (Sertoli) cell (TM4, Mather, Biol.Reprod.23:243-251 (1980)), monkey-kidney cells (CV1 cCL70), African green monkey kidney cell (VERO-76, cRL1587), human cervical carcinoma cell (HELA, cCL2), Madin-Darby canine kidney(cell line) (MDCK, cCL34), ox mouse (buffalorat) liver cell (BRL3A, cRL1442), human pneumonocyte (W138, cCL75), human liver cell (HepG2, HB8065), mouse mammary tumor (MMT060562, cCL51), TRI cell (Matheretal., AnnalsN.Y.Acad.Sci.383:44-68 (1982)), MRC5 cell, FS4 cell and human liver cell knurl (hepatoma) are (HepG2).

In order to generate antibody, with expression mentioned above or cloning vector transformed host cell, and cultivate in the conventional nutrient culture suitably changed expecting the gene of sequence in order to evoked promoter, selection transformant or amplification coding.

(viii) cultivation of host cell

The host cell for generating antibody of the present invention can be cultivated in multiple substratum.Commercially available culture medium is HamShi F10(Sigma such as), minimum essential medium (MEM, Sigma), RPMI-1640(Sigma) and DulbeccoShi revise EagleShi substratum (DMEM, Sigma) be suitable for cultivate host cell.In addition, any substratum of recording in following documents can be used as the substratum of host cell: Hametal., Meth.Enz.58:44 (1979); Barnesetal., Anal.Biochem.102:255 (1980); United States Patent (USP) 4,767,704; 4,657,866; 4,927,762; 4,560,655; 5,122,469; WO90/03430; WO87/00195; Or United States Patent (USP) review 30,985.These substratum any can hormone supplemented and/or other somatomedin (such as Regular Insulin, transferrin or Urogastron), salt (such as sodium-chlor, calcium, magnesium and phosphoric acid salt), buffer reagent (such as HEPES), Nucleotide (such as adenosine and thymidine), microbiotic (such as GENTAMYCIN as required ^tMmedicine), trace elements (be defined as usually exist with the final concentration of micro-molar range mineral compound) and glucose or the equivalent energy.Can also suitable concentration contain those skilled in the art will know that any other must fill-in.The host cell that culture condition such as temperature, pH etc. are expression and select is previously used, and this is obvious for those of ordinary skill.

(ix) purifying of antibody

When using recombinant technology, antibody can be generated in cell, or direct secretion is in substratum.If generate antibody in cell, so first need to remove particle debris by such as centrifugal or ultrafiltration, or host cell or crack fragment.If antibody-secreting is in substratum, first commodity in use protein concentration filter (such as Amicon or MilliporePellicon ultra filtration unit) concentrates the supernatant liquor from these expression systems so usually.Proteinase inhibitor such as PMSF can be comprised in any above-mentioned steps to be hydrolyzed with arrestin, and microbiotic can be comprised to prevent the growth of external contaminant.

The antibody compositions that such as hydroxyapatite, gel electrophoresis, dialysis and affinity chromatography (preferred purification technique is affinity chromatography) can be used to carry out purifying prepare from cell.Albumin A depends on kind and the isotype of any immunoglobulin Fc domain existed in antibody as the suitability of affinity ligand.Albumin A can be used for the antibody (Lindmarketal., J.Immunol.Meth.62:1-13 (1983)) of purifying based on people γ 1, γ 2 or γ 4 heavy chain.Protein G recommends to be used for all mouse isotypes and people γ 3(Gussetal., EMBOJ.5:1567-1575 (1986)).What the matrix accompanying by affinity ligand was the most frequently used is agarose, but can use other matrix.The matrix of physically stable such as controlled pore glass or poly-(styrene divinyl) benzene can obtain than agarose flow velocity and shorter process period faster.If antibody comprises C _h3 structural domains, then can use BakerbondABX ^tMresin (J.T.Baker, Phillipsburg, NJ) carries out purifying.According to antibody to be recycled, the chromatography on the fractionation on other oroteins purification technique such as ion exchange column, alcohol settling, reversed-phase HPLC, tripoli, heparin SEPHAROSE also can be used ^tMon chromatography, negatively charged ion or Zeo-karb (such as poly aspartic acid post) on chromatography, chromatofocusing, SDS-PAGE and ammonium sulfate precipitation.

After any any preliminary purification step, the mixture containing object antibody and pollutent can be carried out low pH hydrophobic interaction chromatography, use pH to be about the elution buffer of 2.5-4.5, preferably carry out at low salt concn (according to appointment 0-0.25M salt).

Immune conjugate

The present invention goes back providing package has the immune conjugate of the antibody of one or more cytotoxic agents (interchangeable be called " antibody-drug conjugates " or " ADC ") containing coupling, described cytotoxic agent is chemotherapeutics, medicine, growth inhibitor, toxin (such as archon such as, the enzyme activity toxin of bacterium, fungi, plant or animal origin, or its fragment) or radio isotope (namely radiating conjugate).

Immune conjugate in cancer therapy for the topical delivery cytotoxic agent medicine of cell growth inhibiting or propagation (namely kill or) (Lambert, J. (2005) Curr.OpinioninPharmacology5:543-549; Wu etc. (2005) NatureBiotechnology23 (9): 1137-1146; Payne, G. (2003) i3:207-212; Syrigos and Epenetos (1999) AnticancerResearch19:605-614; Niculescu-Duvaz and Springer (1997) Adv.DrugDeliv.Rev.26:151-172; U.S. Patent No. 4,975,278).Immune conjugate is allowed drug moiety targeting Delivery to tumour; and carry out thin intracellular accumulation there; and systemic application without coupling medicine may attempt eliminate tumour cell beyond cause unacceptable to Normocellular toxic level (Baldwin etc., Lancet (on March 15th, 1986) 603-05 page; Thorpe, " AntibodyCarriersOfCytotoxicAgentsInCancerTherapy:AReview ", in " MonoclonalAntibodies'84:BiologicalAndClinicalApplication s ", the people such as A.Pinchera compile, 475-506 page, 1985).Polyclonal antibody and monoclonal antibody all have report to can be used for these strategies (Rowland etc., CancerImmunol.Immunother.21:183-87 (1986)).The medicine used in these methods comprises daunomycin (daunomycin), Dx (doxorubicin), methotrexate (methotrexate) and vindesine (vindesine) (Rowland etc., 1986, see above).The toxin used in Antibody-toxin conjugate comprises bacteriotoxin such as diphtheria toxin, plant poison such as ricin, small molecule toxins such as geldanamycin (geldanamycin) (Mandler etc., J.Nat.CancerInst.92 (19): 1573-1581 (2000); Mandler etc., Bioorganic & Med.Chem.Letters10:1025-1028 (2000); Mandler etc., BioconjugateChem.13:786-791 (2002)), maytansinoid class (EP1391213; Liu etc., Proc.Natl.Acad.Sci.USA93:8618-8623 (1996)) and calicheamicin (Lode etc., CancerRes.58:2928 (1998); Hinman etc., CancerRes.53:3336-3342 (1993)).Toxin by comprising tubulin binding, DNA combines or its cytotoxic effect of mechanisms play of topoisomerase enzyme level.Some cell toxicity medicament be tending towards inactivation when large antibody or protein receptor ligand coupling or active reduce.

(ibritumomabtiuxetan, Biogen/Idec) be antibody-radioisotope element conjugate (Wiseman etc., Eur.Jour.Nucl.Med.27 (7): the 766-77 (2000) be made up of with 111In or the 90Y radio isotope combined by thiourea linker-chelator the mouse IgG1 κ monoclonal antibody for the CD20 antigen found on the surface in normal and malignant B; Wiseman etc., Blood99 (12): 4336-42 (2002); Witzig etc., J.Clin.Oncol.20 (10): 2453-63 (2002); Witzig etc., J.Clin.Oncol.20 (15): 3262-69 (2002)).Although ZEVALIN has the activity for B cell non-Hodgkin's (Hodgkin) lymphoma (NHL), but dispenser causes serious and long hemocytopenia in Most patients.MYLOTARG ^tM(gemtuzumabozogamicin; WyethPharmaceuticals); namely be connected with calicheamicin by people CD33 antibody and the antibody-drug conjugates that forms, be used for through injection for curing acute myelogenous leukemia (DrugsoftheFuture25 (7): 686 (2000) approval in 2000; U.S. Patent No. 4970198; 5079233; 5585089; 5606040; 5693762; 5739116; 5767285; 5773001).Cantuzumabmertansine(ImmunogenInc.), namely be connected with maytansinoid drugs module DM1 through disulfde linker SPP by huC242 antibody and the antibody-drug conjugates that forms, the II phase carrying out being used for the treatment of cancer such as colorectal carcinoma, carcinoma of the pancreas, cancer of the stomach and other cancer of expressing CanAg tests.MLN-2704(MillenniumPharm., BZLBiologics, ImmunogenInc.), namely be connected with maytansinoid drugs module DM1 by anti-prostate specific membrane antigen (PSMA) monoclonal antibody and the antibody-drug conjugates formed, carrying out the exploitation for the potential treatment of tumor of prostate.By the synthetic analogues auristatin peptide of dolastatin (dolastatin), auristatinE (AE) and monomethyl auristatin (MMAE) and chimeric mAb cBR96(are special to the LewisY in cancer knurl) and cAC10(special to the CD30 on haematological malignancies) coupling (Doronina etc., NatureBiotechnol.21 (7): 778-784 (2003)), and carry out therapeutic exploitation.

In certain embodiments, immune conjugate comprises antibody and chemotherapeutics or other toxin.(such as above) describes the chemotherapeutics that can be used for generating immune conjugate herein.Spendable enzyme activity toxin and fragment thereof comprise diphtheria toxin A chain, the nonbinding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa (Pseudomonasaeruginosa)), ricin (ricin) A chain, toxalbumin (abrin) A chain, capsule lotus root toxalbumin (modeccin) A chain, α-broom aspergillin (sarcin), tung oil tree (Aleutitesfordii) toxalbumin, Dianthus caryophyllus L. (dianthin) toxalbumin, dyers' grapes (Phytolacaamericana) toxalbumin (PAPI, PAPII and PAP-S), balsam pear (Momordicacharantia) inhibition, curcin (curcin), crotin (crotin), Saponaria officinalis (sapaonariaofficinalis) inhibition, gelonin (gelonin), NSC-69529 (mitogellin), restrictocin (restrictocin), phenomycin (phenomycin), enomycin (enomycin) and trichothecin (trichothecenes).See the WO93/21232 such as announced on October 28th, 1993.Multiple radionuclide can be used for generating radiation coupled antibody.Example comprises ²¹²bi, ¹³¹i, ¹³¹in, ⁹⁰y and ¹⁸⁶re.The conjugate of antibody and cytotoxic agent can use multiple bifunctional protein coupling agent to prepare, such as N-succinimido-3-(2-pyridyl dithio) propionic ester (SPDP), iminothiolane (IT), imido-ester (all example hydrochloric acid hexanedioyl imido acid dimethyl esters), active ester class (such as suberic acid two succinimido ester), aldehydes (such as glutaraldehyde), double azido compound (such as two (p-azido benzoyl base) hexanediamine), dual azepine derivatives (such as two (p-diazoniumbenzoyl) quadrol), vulcabond (such as toluene 2, 6-vulcabond), with double activated fluorine cpd (such as 1, 5-bis-fluoro-2, 4-dinitrobenzene) dual-function derivative.Such as, ricin immunotoxin can be prepared as described in Vitetta etc., Science238:1098 (1987).The 1-isothiocyanic acid phenmethyl-3-methyl diethylene triaminepentaacetic acid(DTPA) (MX-DTPA) of carbon-14 mark is for the exemplary sequestrant by radioactive nucleotides and antibody coupling.See WO94/11026.

Also contain antibody herein and one or more small molecule toxins such as calicheamicin (calicheamicin), maytansinoid class (maytansinoids), dolastatin class (dolostatins), aurostatins, trichothecin (trichothecene) and CC1065 and these toxin have the conjugate of the derivative of neurotoxin active.

maytenin and maytansinoid class

In some embodiment, immune conjugate comprises the antibody (total length or fragment) that coupling has one or more maytansinoid molecule.

Maytansinoid class is the mitotic inhibitor by suppressing tubulin polymerization to play a role.Maytenin is separated from East Africa shrub tingia Caulis Mayteni (Maytenusserrata) at first and obtains (United States Patent (USP) 3,896,111).Find that certain micro-organisms also generates maytansinoid class, such as maytansinol and C-3 maytansinol ester (United States Patent (USP) 4,151,042) subsequently.Such as followingly U.S. patents disclose synthesis maytansinol and derivative and analogue: 4,137,230; 4,248,870; 4,256,746; 4,260,608; 4,265,814; 4,294,757; 4,307,016; 4,308,268; 4,308,269; 4,309,428; 4,313,946; 4,315,929; 4,317,821; 4,322,348; 4,331,598; 4,361,650; 4,364,866; 4,424,219; 4,450,254; 4,362,663; And 4,371,533.

Maytansinoid class drug moiety is attractive drug moiety in antibody drug conjugates, because they: (i) is relatively prepared easily through the chemically modified of fermentation or tunning, derivatize; (ii) the functional group's derivatize with the coupling be suitable for by non-disulfde linker is easy to; (iii) stable in blood plasma; And (iv) is effectively for kinds of tumor cells system.

Such as following patent discloses immune conjugate comprising maytansinoid class and preparation method thereof and therepic use: United States Patent (USP) 5,208,020; 5,416,064; And European patent EP 0425235B1.Liuetal., Proc.Natl.Acad.Sci.USA93:8618-8623 (1996) describes the immune conjugate being called the maytansinoid of DM1 comprising and be connected with the monoclonal antibody C242 for human colorectal cancer.Find that this conjugate has the high cell toxicity of colon cancer cell for cultivating, and show anti-tumor activity in tumor growth assay method in vivo.Charietal., CancerResearch52:127-131 (1992) describes the wherein maytansinoid immune conjugate through disulfde linker and the murine antibody A7 in conjunction with antigen in CCL188 or the another kind of mouse monoclonal antibody TA.1 coupling in conjunction with HER-2/neu oncogene.The cytotoxicity of TA.1-maytansinoid conjugate is tested in vitro, each cell expressing 3x105 of this clone HER-2 surface antigen on human breast cancer cell system SK-BR-3.Drug conjugates reaches the cytotoxicity to a certain degree similar to free maytansinoid drugs, and this improves by the maytansinoid molecule amount increasing each antibody molecule coupling.A7-maytansinoid conjugate shows low systemic cellular toxicity in mouse.

Antibody-maytansinoid conjugate is by be connected antibody with maytansinoid molecular chemistry and prepared by the biologic activity significantly not weakening antibody or maytansinoid molecule.See such as U.S. Patent No. 5,208,020.Each antibody molecule coupling average 3-4 maytansinoid molecule shows effect in enhancing is for the cytotoxicity of target cell, and the function of antagonist or solubleness do not have negative impact, although estimate that the use than naked antibody is also strengthened cytotoxicity by the toxin/antibody of an even molecule.Maytansinoid class is well known in the art, and synthesizes by known technology or be separated from natural origin.Such as United States Patent (USP) 5,208,020 and other patent mentioned above and non-Patent Publication thing in disclose suitable maytansinoid class.Preferred maytansinoid class is aromatic nucleus or other position maytansinol analogue through modifying of maytansinol and maytansinol molecule, such as various maytansinol ester.

This area knows that many linking groups can be used for Dispersal risk-maytansinoid conjugate, comprises such as United States Patent (USP) 5,208,020 or European patent 0425235B1; Charietal., CancerResearch52:127-131 (1992); The U.S. Patent application No.10/960 that on October 9th, 2004 submits to, disclosed in 602.The U.S. Patent application No.10/960 that the antibody-maytansinoid class conjugate comprising joint member SMCC can be submitted to as on October 8th, 2004, preparing disclosed in 602.Linking group comprises disulphide group, sulfide group, acid-unstable group, photo-labile group, the unstable group of peptase or the unstable group of esterase, disclosed in as mentioned previously in patent, preferred disulphide and sulfide group.Herein describe and exemplified with other linking group.

Multiple bifunctional protein coupling agent can be used to carry out the conjugate of Dispersal risk and maytansinoid, such as N-succinimido-3-(2-pyridyl dithio) propionic ester (SPDP), succinimido-4-(N-Maleimidomethyl) hexanaphthene-1-carboxylicesters (SMCC), iminothiolane (IT), imido-ester (all example hydrochloric acid hexanedioyl imido acid dimethyl esters), active ester class (such as suberic acid two succinimido ester), aldehydes (such as glutaraldehyde), double azido compound (such as two (p-azido benzoyl base) hexanediamine), dual azepine derivatives (such as two (p-diazoniumbenzoyl)-quadrol), vulcabond (such as toluene 2, 6-vulcabond), with double activated fluorine cpd (such as 1, 5-bis-fluoro-2, 4-dinitrobenzene) dual-function derivative.Particularly preferred coupling agent comprises N-succinimido-3-(2-pyridyl dithio) propionic ester (SPDP) (Carlssonetal., Biochem.J.173:723-737 (1978)) and N-succinimido-4-(2-pyridylthio) valerate (SPP), provide disulfide linkage to connect thus.

According to the type connected, joint can be attached to multiple positions of maytansinoid molecule.Such as, conventional coupling techniques can be used by forming ester bond with the reaction of hydroxyl.Reaction can occur in there is hydroxyl C-3 position, through methylol modify C-14 position, through the C-15 position of hydroxyl modified and the C-20 position with hydroxyl.In a preferred embodiment, key connection is formed in the C-3 position of maytansinol or maytansinol analogue.

auristatin and dolastatin

In some embodiment, immune conjugate comprises antibody (U.S. Patent No. 5,635,483 with dolastatin class (dolastatins) or dolastatin peptide analogs and derivative, the coupling of auristatin class; 5,780,588).Dolastatin class and auristatin class have demonstrated to be disturbed microtubule dynamics, GTP hydrolysis and core and cell fission (Woykeetal (2001) Antimicrob.AgentsandChemother.45 (12): 3580-3584) and has anticancer (US5,663,149) and anti-mycotic activity (Pettitetal (1998) Antimicrob.AgentsChemother.42:2961-2965).Dolastatin or auristatin drug moiety can be amino via the N(of peptide drug moiety) end or C(carboxyl) end is attached to antibody (WO02/088172).

Exemplary auristatin embodiment comprises monomethyl auristatin drug moiety DE and DF that N-end connects, be disclosed in " MonomethylvalineCompoundsCapableofConjugationtoLigands ", the U.S. Serial numbers 10/983,340 submitted on November 5th, 2004.

Typically, based on the drug moiety of peptide by forming peptide bond to prepare between two or more amino acid and/or peptide fragment.This type of peptide bond can be prepared (see E. according to the such as well-known liquid phase synthesizing method in chemistry of peptides field andK.L ü bke, ThePeptides, volume1, pp76-136,1965, AcademicPress).Auristatin/ dolastatin drug moiety can be prepared according to the method in Publication about Document: US5,635,483; US5,780,588; Pettitetal (1989) J.Am.Chem.Soc.111:5463-5465; Pettitetal (1998) Anti-CancerDrugDesign13:243-277; Pettit, G.R., etal.Synthesis, 1996,719-725; Pettitetal (1996) J.Chem.Soc.PerkinTrans.15:859-863; And Doronina (2003) NatBiotechnol21 (7): 778-784; " MonomethylvalineCompoundsCapableofConjugationtoLigands ", U.S. Serial No.10/983, on November 5th, 340,2004 submits (disclose and such as prepare joint and the method that such as MMAE and MMAF is coupled to the monomethyl α-amino-isovaleric acid compound of joint) to.

calicheamicin

In other embodiments, immune conjugate comprises the antibody that coupling has one or more calicheamicin molecules.Calicheamicin microbiotic family can generate double-strand DNA cleavage at sub-picomolar concentrations.About the preparation of calicheamicin family conjugate see United States Patent (USP) 5,712,374; 5,714,586; 5,739,116; 5,767,285; 5,770,701; 5,770,710; 5,773,001; 5,877,296(authorizes Cyanamid company of the U.S.).Available calicheamicin analog includes but not limited to γ 1 ⁱ, α 2 ⁱ, α 3 ⁱ, N-ethanoyl-γ 1 ⁱ, PSAG and θ ⁱ1(Hinmanetal., CancerResearch53:3336-3342 (1993); Lodeetal., CancerResearch58:2925-2928 (1998); And the above-mentioned United States Patent (USP) authorizing Cyanamid company of the U.S.).Can be QFA with the another kind of antitumor drug of antibody coupling, it be a kind of antifolic thing.Calicheamicin and QFA have action site in born of the same parents, and not easily through plasma membrane.Therefore, these reagent greatly strengthen their cytotoxic effect via the cellular uptake of antibody-mediated internalization.

other cytotoxic agent

BCNU, streptozocin (streptozoicin), vincristine(VCR) (vincristine), 5 FU 5 fluorouracil, United States Patent (USP) 5 can be comprised with other antineoplastic agent of antibody coupling, 053,394,5,770, the reagent family being referred to as LL-E33288 mixture recorded in 710 and Ai Sibo mycin class (esperamicins) (United States Patent (USP) 5,877,296).

Available enzyme activity toxin and fragment thereof comprise diphtheria toxin A chain, the nonbinding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa Pseudomonasaeruginosa), ricin (ricin) A chain, toxalbumin (abrin) A chain, capsule lotus root toxalbumin (modeccin) A chain, α-broom aspergillin (sarcin), tung oil tree (Aleutitesfordii) toxalbumin, Dianthus caryophyllus L. (dianthin) toxalbumin, dyers' grapes (Phytolacaamericana) toxalbumin (PAPI, PAPII and PAP-S), balsam pear (Momordicacharantia) inhibition, curcin (curcin), crotin (crotin), Saponaria officinalis (sapaonariaofficinalis) inhibition, gelonin (gelonin), NSC-69529 (mitogellin), restrictocin (restrictocin), phenomycin (phenomycin), enomycin (enomycin) and trichothecin (trichothecenes).See the WO93/21232 such as announced on October 28th, 1993.

Present invention further contemplates antibody and there is the compound of nucleolysis activity (as rnase or DNA endonuclease, such as deoxyribonuclease; DNA enzymatic) between formed immune conjugate.

In order to selective destruction tumour, antibody can comprise high radioactive atom.Multiple radio isotope can be used for generating radiation coupled antibody.Example comprises At ²¹¹, I ¹³¹, I ¹²⁵, Y ⁹⁰, Re ¹⁸⁶, Re ¹⁸⁸, Sm ¹⁵³, Bi ²¹², P ³², Pb ²¹²with the radio isotope of Lu.When conjugate is used for detecting, radioactive atom can be comprised and study for scitiphotograph, such as Tc ^99mor I ¹²³, or comprise spin label for nucleus magnetic resonance (NMR) imaging (also referred to as nuclear magnetic resonance, MRI), such as iodo-123, iodine-131, indium-111, fluoro-19, carbon-13, nitrogen-15, oxygen-17, gadolinium, manganese or iron.

In a known way radioactivity or other marker can be mixed conjugate.Such as, can biosynthesizing peptide, or by chemical amino acid synthesis method synthetic peptide, wherein use and relate to the suitable amino group acid precursor that such as fluoro-19 replace hydrogen.Marker can be adhered to by cysteine residues in peptide, such as Tc ^99mor I ¹²³, Re ¹⁸⁶, Re ¹⁸⁸and In ¹¹¹.Yttrium-90 can be adhered to through lysine residue.IODOGEN method (Frakeretal. (1978) Biochem.Biophys.Res.Commun.80:49-57) can be used for mixing iodo-123." MonoclonalAntibodiesinImmunoscintigraphy " (Chatal, CRCPress, 1989) describe other method in detail.

Multiple bifunctional protein coupling agent can be used to carry out the conjugate of Dispersal risk and cytotoxic agent, such as N-succinimido-3-(2-pyridyl dithio) propionic ester (SPDP), succinimido-4-(N-Maleimidomethyl) hexanaphthene-1-carboxylicesters (SMCC), iminothiolane (IT), imido-ester (all example hydrochloric acid hexanedioyl imido acid dimethyl esters), active ester class (such as suberic acid two succinimido ester), aldehydes (such as glutaraldehyde), double azido compound (such as two (p-azido benzoyl base) hexanediamine), dual azepine derivatives (such as two (p-diazoniumbenzoyl)-quadrol), diisothio-cyanate (such as toluene 2, 6-vulcabond), with double activated fluorine cpd (such as 1, 5-bis-fluoro-2, 4-dinitrobenzene) dual-function derivative.Such as, ricin immunotoxin can be prepared as described in Vitettaetal., Science238:1098 (1987).The 1-isothiocyanic acid phenmethyl-3-methyl diethylene triaminepentaacetic acid(DTPA) (MX-DTPA) of carbon-14 mark is for the exemplary sequestrant by radioactive nucleotides and antibody coupling.See WO94/11026.Joint can be convenient to release cells cytotoxic drug in cell " can cut joint ".Such as, sour unstable joint, peptidase-sensitive linker, photo-labile joint, dimethyl linker can be used or contain disulfde linker (Charietal., CancerResearch52:127-131 (1992); United States Patent (USP) 5,208,020).

Compound is clearly contained but is not limited to the ADC for preparing with following linking agent: commercialization is (as purchased from PierceBiotechnologyInc., Rockford, IL, U.S.A.) BMPS, EMCS, GMBS, HBVS, LC-SMCC, MBS, MPBH, SBAP, SIA, SIAB, SMCC, SMPB, SMPH, sulfo-EMCS, sulfo-GMBS, sulfo-KMUS, sulfo-MBS, sulfo-SIAB, sulfo-SMCC and sulfo-SMPB and SVSB(succinimido-(4-vinyl sulphone) benzoic ether).See 2003-2004 year application manual and products catalogue (ApplicationsHandbookandCatalog) 467-498 page.

the preparation of antibody-drug conjugates

In antibody-drug conjugates (ADC), by antibody (Ab) such as, through joint (L) and one or more drug moiety (D) coupling, each antibody coupling about 1 to about 20 drug moiety.Organic chemical reactions, condition and the reagent that those skilled in the art will know that can be adopted by several paths to be prepared the ADC of general formula I, comprise: the nucleophilic group of (1) antibody is through covalent linkage and bivalent linker reagent react, form Ab-L, react with drug moiety D subsequently; (2) nucleophilic group of drug moiety is through covalent linkage and bivalent linker reagent react, forms D-L, reacts subsequently with the nucleophilic group of antibody.There is described herein the method for distinguishing for the preparation of ADC.

Ab-(L-D)pI

Joint can be made up of one or more joint member.Exemplary joint member comprises 6-maleimidocaproyl (" MC "), maleimide propionyl (" MP "), valine-citrulline (" val-cit "), alanine-phenylalanine (" ala-phe "), to aminobenzyloxycarbonyl (" PAB "), 4-(2-pyridylthio) valeric acid N-succinimido ester (" SPP "), 4-(N-maleimidomehyl) hexanaphthene-1 carboxylic acid N-succinimido ester (" SMCC'), (the iodo-ethanoyl of 4-) benzaminic acid N-succinimido ester (" SIAB ").Other joint member is known in this area, also illustrates herein.Also can see " MonomethylvalineCompoundsCapableofConjugationtoLigands ", U.S. Serial No.10/983, on November 5th, 340,2004 submits to.

In some embodiment, joint can comprise amino-acid residue.Exemplary Amino acid linker component comprises dipeptides, tripeptides, tetrapeptide or pentapeptide.Exemplary dipeptides comprises: valine-citrulline (vc or val-cit), alanine-phenylalanine (af or ala-phe).Exemplary tripeptides comprises: glycine-valine-citrulline (gly-val-cit) and Gly-Gly-Gly (gly-gly-gly).The amino-acid residue forming Amino acid linker component comprises those naturally occurring amino acid, and the amino acid analogue of secondary amino acid and non-natural existence, such as citrulline.The selectivity aspect that Amino acid linker component can cut at the enzymatic of their certain enzyme (such as tumor correlated albumen enzyme, cathepsin B, C and D, or fibrinolytic enzyme enzyme) carries out designing and optimizing.

The nucleophilic group of antibody includes but not limited to: (i) N-terminal is amino; (ii) side-chain amino group, as Methionin; (iii) side chain thiol, as halfcystine; (iv) sugared in glycosylated antibodies hydroxyl or amino.Amino, sulfydryl and hydroxyl are nucleophilics, can react with the electrophilic group on shank and form covalent linkage, and linker reagents comprises: (i) active ester class, such as NHS ester, HOBt ester, haloformate and acid halide; (ii) alkyl and benzyl halide, such as Haloacetamide; (iii) aldehydes, ketone, carboxyl and maleimide base group.Some antibody has reducible interchain disulfide bond, i.e. halfcystine bridge.By reductive agent such as DTT(dithiothreitol (DTT)) process make antibody have the reactive behavior with linker reagents coupling.Each halfcystine bridge is in theory by reactive for formation two nucleophilic thiol body.Can, via the reaction of Methionin and 2-iminothiolane (TrautShi reagent), cause amine to change mercaptan into, thus extra nucleophilic group is introduced antibody.Can pass through importing one, two, three, four, or more cysteine residues (such as preparation comprises the Mutant Antibodies of one or more non-natural cysteine amino) and reactive thiol group is imported antibody (or its fragment).

Also generate antibody-drug conjugates by modified antibodies, namely introduce can with the electrophilic part of the nucleophilic substitution radical reaction on linker reagents or medicine.The sugar of available such as periodate oxidation agent oxidative glycosylation antibody, thus form the aldehydes or ketones group that can react with the amine groups of linker reagents or drug moiety.Gained imines Schiff base can form stable key, or available such as borohydride reagent reduces and forms stable amine connection.In one embodiment, the reaction of the carbohydrate portions of glycosylated antibodies and galactose oxidase or sodium metaperiodate can generate carbonyl (aldehyde and ketone) group in protein, it can react (Hermanson, BioconjugateTechniques) with the suitable groups on medicine.In another embodiment; the protein comprising N-terminal Serine or threonine residues can react with sodium metaperiodate; cause generating aldehyde (Geoghegan & Stroh, BioconjugateChem.3:138-146 (1992) at first amino acid place; US5362852).This type of aldehyde can react with drug moiety or joint nucleophile.

Equally, nucleophilic group on drug moiety includes but not limited to: amine, mercaptan, hydroxyl, hydrazides, oxime, hydrazine, thiosemicarbazone, hydrazinecarboxylate and aryl hydrazide group, they can react with the electrophilic group on shank and form covalent linkage, and linker reagents comprises: (i) active ester class, such as NHS ester, HOBt ester, haloformate and acid halide; (ii) alkyl and benzyl halide, such as Haloacetamide; (iii) aldehydes, ketone, carboxyl and maleimide base group.

Or, the fusion rotein comprising antibody and cytotoxic agent is prepared by such as recombinant technology or peptide symthesis.The length of DNA can comprise the region of each own coding conjugate two parts, or abuts one another or separated by the region of encoding linker peptide, and this joint peptide does not destroy the desired characteristic of conjugate.

In still another embodiment, can by antibody with " acceptor " (such as Streptavidin) coupling thus for tumour target in advance, wherein to patient's administration of antibodies-receptor conjugate, then use scavenging agent to remove unconjugated conjugate in circulating, then use and " part " of cytotoxic agent (as radionuclide) coupling (as affinity element).

Composition of the present invention

The present invention also contains composition, comprises pharmaceutical composition, and it comprises anti-Bv8 antibody, and comprises the polynucleotide of sequence of anti-Bv8 antibody of encoding.As used in this article, composition comprises one or more antibody in conjunction with Bv8, and/or comprises one or more polynucleotide of one or more sequences in conjunction with the antibody of Bv8 of coding.These compositions can comprise suitable carrier further, and such as pharmaceutical acceptable excipient, comprises buffer reagent, and they are well known in the art.

By expecting that the antibody of purity can accept carrier, vehicle or stablizer with optional physiology and mix the treatment preparaton prepared and comprise the anti-Bv8 antibody of the present invention by having, store (Remington:TheScienceandPracticeofPharmacy20thedition (2000)) with the form of the aqueous solution, freeze-drying or other dry formulation.Acceptable carrier, vehicle or stablizer are nontoxic in adopted dosage and concentration to recipient, and comprise buffer reagent, such as phosphoric acid salt, Citrate trianion and other organic acid; Antioxidant, comprises xitix and methionine(Met); Sanitas (such as octadecyl dimethyl benzyl ammonium chloride; Hexamethonium chloride; Benzalkonium chloride, benzethonium chloride; Phenol, butanols or phenylcarbinol; Alkyl paraben, such as methyl p-hydroxybenzoate or propyl ester; Pyrocatechol; Resorcinol; Hexalin; 3-amylalcohol; And meta-cresol); Lower molecular weight (being less than about 10 residues) polypeptide; Protein, such as serum albumin, gelatin or immunoglobulin (Ig); Hydrophilic polymer, such as polyvinylpyrrolidone; Amino acid, such as glycine, glutamine, l-asparagine, Histidine, arginine or Methionin; Monose, disaccharides and other carbohydrate, comprise glucose, seminose or dextrin; Sequestrant, such as EDTA; Carbohydrate, such as sucrose, N.F,USP MANNITOL, trehalose or sorbyl alcohol; Salify counter ion, such as sodium; Metal composite (as Zn-protein complex); And/or nonionogenic tenside, such as TWEEN ^tM, PLURONICS ^tMor polyoxyethylene glycol (PEG).

Preparaton herein also a kind of can treat the necessary active compound of concrete indication containing exceeding, preferred complementary activities and do not have disadvantageous effect each other.It is suitable that, this quasi-molecule is effectively to measure combination for predetermined object.

Activeconstituents also can wrap be loaded in such as by (being such as Walocel MT 20.000PV or gelatin-microcapsule and poly-(methyl methacrylate) microcapsule respectively) in condensation technique or the microcapsule prepared by interfacial polymerization, in colloidal drug delivery systems (such as liposome, albumin microspheres, microemulsion, nano particle and Nano capsule) or in macro emulsion.This type of technology is disclosed in such as Remington:TheScienceandPracticeofPharmacy20thedition (2000).

Preparaton for using in body must be aseptic.This can be easy to realize by using sterilised membrane filter to filter.

Sustained release preparaton can be prepared.The suitable example of sustained release preparaton comprises the solid hydrophobic polymers semipermeable matrices containing immunoglobulin (Ig) of the present invention, and this matrix exists with the form of standardized product, as film or microcapsule.The example of sustained-release matrix comprises polyester, hydrogel (such as poly-(2-hydroxyethyl-methacrylic ester) or poly-(vinyl alcohol)), polylactide (United States Patent (USP) 3,773,919), multipolymer, nondegradable ethene-vinyl acetate copolymer, the degradable lactic acid-ethanol copolymer such as LUPRONDEPOT of Pidolidone and γ-ethyl-L-glutamate ester ^tM(the Injectable microspheres body be made up of lactic acid-ethanol copolymer and leuprorelin acetate) and poly-D-(-)-3-hydroxybutyrate.Although the such as polymkeric substance such as ethane-acetic acid ethyenyl and lactic acid-ethanol can sustained release molecule 1 more than 00 day, the time of some hydrogel release protein is shorter.When encapsulated antibodies maintains in vivo for a long time, they may, owing to being exposed to the wet environment of 37 DEG C and sex change or gathering, cause loss of biological activity and immunogenicity to change.Stabilization strategy reasonable in design can be carried out according to related mechanism.Such as, if find that aggregation of multiple is exchanged via thio-disulfide and forms intermolecular S-S key, so by modifying sulfhydryl residue, being suitable for additive and developing specific polymer matrix composition to realize stablizing by acidic solution freeze-drying, controlling moisture, employing.

Purposes

Antibody of the present invention can be used for such as external, ex vivo (exvivo) and interior therapeutic method.

The invention provides the method and composition that can be used for regulating and controlling the morbid state relevant with the expression of Bv8 and/or activity (expression such as raised and/or active or undesired expression and/or activity), described method comprises the anti-Bv8 antibody of effective dose is applied to this type of individuality for the treatment of of needs.

On the one hand, the invention provides the method for useful treatment or prophylaxis of tumours, cancer and/or cell proliferative disorders, the method comprises the individuality anti-Bv8 antibody of significant quantity being applied to this type for the treatment of of needs.

On the one hand, the invention provides the method for suppressing blood vessel to occur, the method comprises the individuality anti-Bv8 antibody of significant quantity being applied to this type for the treatment of of needs.

On the one hand, the invention provides the method for Tumor suppression transfer, the method comprises the individuality anti-Bv8 antibody of significant quantity being applied to this type for the treatment of of needs.

On the one hand, the invention provides the method for inhibition of endothelial cell proliferation, the method comprises the individuality anti-Bv8 antibody of significant quantity being applied to this type for the treatment of of needs.

On the one hand, the invention provides the method for the effect for strengthening another kind of antiangiogenic agent, the method comprises the individuality anti-Bv8 antibody of significant quantity being applied to this type for the treatment of of needs.In some embodiments, individuality has tumour, cancer and/or cell proliferative disorders.In some embodiments, another kind of antiangiogenic agent target VEGF, such as VEGF antibody.

Be appreciated that in methods for the treatment of and can use any suitable anti-Bv8 antibody, comprise mono-clonal and/or polyclonal antibody, people's antibody, chimeric antibody, the antibody of affinity maturation, humanized antibody and/or antibody fragment.In some embodiments, any anti-Bv8 antibody described herein is used to treat.

In any method in this article, can use the selected medicine (wherein anti-Bv8 antibody be the first medicine) herein of significant quantity together with anti-Bv8 antibody herein to experimenter or patient, this selected medicine is the promoting agent of the another kind of situation can treat in the experimenter that needs treat.Such as, antibody of the present invention can be used altogether with another kind of antibody, chemotherapeutics (comprising chemotherapeutics cocktail), antiangiogenic agent, immunosuppressor, cytokine, cytokine antagonist and/or growth inhibitor.The type of this type of the second medicine depends on multiple factor, comprise the type of illness, the severity of disease, the situation of patient and age, the type of the first medicine of employing and dosage, etc.

Such as, when antibody inhibiting tumor of the present invention grows, other therapeutic combination it and one or more also Tumor suppression grown may be wished especially.Such as, can in treatment plan, such as combine antibody of the present invention and antiangiogenic agent when treating any disease described herein (comprising colorectal carcinoma, lung cancer, hepatocellular carcinoma, mammary cancer and/or carcinoma of the pancreas), such as VEGF antibody is (such as ) and/or anti-ErbB antibody (such as trastuzumab Anti-HER 2 or EGFR inhibitor (such as erlotinib ) or in conjunction with the Anti-HER 2 of HER2 domain II, such as OMNITARG ^tMpertuzumab Anti-HER 2).Or/in addition, patient can accept combined radiotherapy (such as the therapy of external beam irradiation or use radio-labeling medicament such as antibody).This type of conjoint therapy mentioned above comprise co-administered (wherein comprising two or more medicaments at same preparaton or the preparaton that separates) and separate administration (in this case, antibody of the present invention use can betide the using of adjuvant therapy before or after).In addition, with combination antibody of the present invention with cell is produced compared with the chemotherapeutics in other medicament of high toxicity, combine this antibody and expect with the medicament such as another kind of biological molecule such as another kind of antibody of relative no cytotoxicity and reduce cytotoxicity.

The combined therapy of antibody and one or more the second medicines preferably causes the improvement of cancer S or S herein.Such as, relative to the patient only using the second medicine (such as chemotherapeutics) to treat, this type of therapy can cause survival (overall survival and/or progresson free survival) to improve, and/or can cause objective response (part or completely).In addition, the combined therapy of antibody and one or more the second medicines preferably produces superposition to patient herein, more preferably collaborative (or be greater than superposition) treatment benefit.In certain embodiments, the second medicine use at least one times and time herein between the using at least one times of antibody is about 1 month or shorter.In certain embodiments, the second medicine use at least one times and time herein between the using at least one times of antibody is about 2 weeks or shorter.In certain embodiments, antibody and the second concurrent are used herein.

For the treatment of cancer, the second medicine is preferably another kind of antibody, chemotherapeutics (comprising chemotherapeutics cocktail), antiangiogenic agent, immunosuppressor, prodrug, cytokine, cytokine antagonist, cytotoxic radiotherapy agent, reflunomide, antiemetic, cancer vaccine, pain killer, anti-angiogenic dose and/or growth inhibitor.Cytotoxic agent comprises with DNA interactional medicament, metabolic antagonist, topoisomerase I or II inhibitor or spindle poison or stablizer (such as preferred vinca alkaloids, more preferably vinealeucoblastine(VLB), deoxidation vinealeucoblastine(VLB), vincristine(VCR), vindesine, vinorelbine, vinepidine, vinfosiltine, vinzolidine and Vinflunine is selected from), or any medicament used in chemotherapy, such as 5-FU, Taxan, Dx or dexamethasone.

In some embodiments, second medicine is the antibody that another kind is used for the treatment of cancer, (the such as trastuzumab) of such as those extracellular domains for HER2/neu acceptor, one of or its functional fragment, general HER inhibitor, Src inhibitor, mek inhibitor, or EGFR inhibitor (such as anti-egfr antibodies (such as suppressing the tyrosine kinase activity of EGFR) such as Cetuximab (cetuximab) hexichol amido phthalimide, pyrazolo or pyrrolopyridine pyrimidine, quinaziline, gefitinib, erlotinib, cetuximab, ABX-EFG, canertinib, EKB-569 and PKI-166), or dual EGFR/HER-2 inhibitor such as lapatanib.Other second medicine comprises alemtuzumab(CAMPATH ^tM), FavID(IDKLH), the CD20 antibody that glycosylation changes, such as GA-101/GLYCART ^tM, oblimersen(GENASENSE ^tM), Thalidomide and analogue thereof, such as lenalidomide(REVLIMID ^tM), imatinib, sorafenib, ofatumumab(HUMAX-CD20 ^tM), anti-cd40 antibody, such as SGN-40, and anti-CD-80 antibody, such as galiximab.

Antiemetic is preferably ondansetron hydrochloride, Granisetron Hydrochloride, metoclopramide (metroclopramide), domperidone, haloperidol, cyclizine, lorazepam, prochlorperazine, dexamethasone, Levopromazine or tropisetron.Vaccine is preferably vaccine, dendritic cell vaccine, recombinant viral vaccine, heat shock protein(HSP) (HSP) vaccine, homogenic or autologous tumor vaccine based on GM-CSFDNA and cell.Pain killer is preferably Ibuprofen BP/EP, Naproxen Base, choline magnesium trisalicylate or oxycodone hydrochloride.Anti-angiogenic dose is preferably rhuMAb-VEGF or rhuMAb-VEGF.Other second medicine comprises antiproliferative, such as farnesyl protein transferase inhibitor, anti-vegf inhibitor, p53 inhibitor or PDGFR inhibitor.The second medicine herein also comprises biology targeted therapies such as Antybody therapy and small molecules targeted therapies such as some acceptor.

This area has been identified and has been known many antiangiogenic agents, comprises those listed by this paper, such as, in definition listed by, also can see such as Carmeliet and Jain, Nature407:249-257 (2000); Ferrara etc., NatureReviews:DrugDiscovery, 3:391-400 (2004); SatoInt.J.Clin.Oncol., 8:200-206 (2003).Also can see U.S. Patent application US20030055006.In one embodiment, anti-Bv8 antibody and anti-vegf neutrality antibody (or fragment) and/or another VEGF antagonist or vegf receptor antagonist (include but not limited to such as soluble VEGF-receptor (such as VEGFR-1, VEGFR-2, VEGFR-3, neuropilin (such as NRP1, NRP2)) fragment), can blocking VEGF or VEGFR fit, neutrality anti-vegf R antibody, the low-molecular-weight depressor of VEGFR Tyrosylprotein kinase (RTK), the Antisense Strategies of VEGF, for the ribozyme of VEGF or vegf receptor, the Antagonism variant of VEGF, and arbitrary combination conbined usage.Or/in addition, and optional, outside VEGF antagonist and other medicament, two or more angiogenesis inhibitor can be used altogether to patient.In certain embodiments, can one or more other therapeutical agent, such as carcinostatic agents co-administered with anti-Bv8 antibody, VEGF antagonist and antiangiogenic agent.

Above (in the definition of such as " chemotherapeutics ") describe chemotherapeutics useful in this article.

This type of second medicament using herein after antibody in 48 hours, or can be used in 24 hours or in 12 hours or in 3-12 hour after described medicament, or can use in the following period of time selected in advance, and it is about 1-2 days preferably.In addition, the dosage of this type of medicament can be sub-curative.

Antibody herein can with the second medicament simultaneously, sequential or alternately use, or when non-responsiveness with other therapies while, sequential or alternately use.So, second medicament co-administered comprises and uses using altogether (simultaneously using) of preparaton separately or single pharmaceutical formulation, and the sequential of arbitrary order is used, wherein preferably have for some time all (two or more) medicaments and play its biologic activity simultaneously.All these second medicaments can combination with one another or use together with the first medicament separately, therefore states " the second medicament " for not meaning that during this paper that it is the sole agent beyond the first medicament.So, the second medicament needs not to be a kind of medicament, but can comprise exceed this type of medicament a kind of or consisting of.

These second medicaments herein use with about 1-99% of the dosage of the dosage identical with the first medicament and route of administration or the first medicament usually.If really use this type of second medicament, so preferably they are to use lower than amount when there is not the first medicament, in the subsequent dose especially after the initial administration of the first medicament, to eliminate or to reduce the side effect caused thus.

Present invention also offers the method and composition for suppressing or prevent refractory tumor, relapse tumor growth or relapse cancer cell growth.In certain embodiments, relapse tumor growth or relapse cancer cell growth are used for description and are accepting one or more current available therapy (such as cancer therapies, the such as standard regimens of chemotherapy, radiotherapy, operation, hormonotherapy and/or biological therapy/immunotherapy, VEGF antibody therapy, particularly particular cancers) or be not enough to treatment patient clinically with the patient that one or more current available therapy for treating are crossed or patient no longer obtains by this therapy the situation that any beneficial effect makes other effective therapy of these needs of patients.In certain embodiments, cancer is relapse tumor growth or relapse cancer cell growth, wherein cancer cell count does not reduce significantly, or increase, or tumor size does not reduce significantly, or increase, or the size of cancer cells or number fail anyly further reduce or reduce.In certain embodiments, the patient with relapse tumor growth or relapse cancer cell growth creates the resistance to one or more current available therapies.In certain embodiments, term intractable/refractoriness is used for description and is accepting one or more current available therapy (such as cancer therapies, the such as standard regimens of chemotherapy, radiotherapy, operation, hormonotherapy and/or biological therapy/immunotherapy, VEGF antibody therapy, particularly particular cancers) or be not enough to the situation for the treatment of patient clinically with the patient that one or more current available therapy for treating are crossed.In certain embodiments, be have therapy respond but suffer side effect, do not respond therapy or the patient unsatisfactory etc. to the response of therapy without response/refractory patient.In certain embodiments, cancer is non-responsiveness/refractory tumor, and wherein tumour has not responsiveness or resistance inherently to previous treatment.In certain embodiments, intractable/refractoriness refers to that disease or situation are to the inherence not responsiveness of therapy comprising VEGF antagonist.Determine that whether cancer cells is that obstinate, relapse tumor growth or relapse cancer cell growth can carry out in vivo or in vitro, by this area know for measuring any method for the treatment of to cancer cells validity, in such linguistic context, use the implication of art-recognized " recurrent " or " intractable " or " without response ".

The invention provides the method for blocking-up or reduction relapse tumor growth or relapse cancer cell growth in experimenter, it is realized with the relapse tumor growth blocked or reduce in experimenter or relapse cancer cell growth by the anti-Bv8 antibody using significant quantity.The invention provides the method for the treatment of to the patient that the therapy comprising VEGF antagonist is not answered, it is undertaken by anti-Bv8 antibody patient being used to significant quantity.In certain embodiments, anti-Bv8 antibody can be used after other cancer therapeutic agent.In certain embodiments, use anti-Bv8 antibody with cancer therapy simultaneously.Or/in addition, anti-Bv8 antibody therapy and another cancer therapy are alternately implemented, and this can carry out with any order.The present invention is also contained and is used one or more inhibiting antibodies and carry out the method that preventing cancer shows effect or recur in the patient having cancer procatarxis.Usually, experimenter is current accepts cancer therapy.In one embodiment, cancer therapy is the treatment using antiangiogenic agent such as VEGF antagonist.Antiangiogenic agent comprises listed those in those and definition herein that this area knows.In one embodiment, antiangiogenic agent be anti-vegf neutrality antibody or fragment (such as humanization A4.6.1, (Genentech, SouthSanFrancisco, CA), Y0317, M4, G6, B20,2C3 etc.).See such as United States Patent (USP) 6,582,959,6,884,879,6,703,020; WO98/45332; WO96/30046; WO94/10202; EP0666868B1; U.S. Patent application 20030206899,20030190317,20030203409,20050112126; Popkov etc., JournalofImmunologicalMethods288:149-164 (2004); And WO2005012359.Other medicament can be treated refractory tumor, blocking-up with VEGF antagonist and antibody combined the using of anti-Bv8 or reduce relapse tumor growth or relapse cancer cell growth.

Anti-Bv8 antibody of the present invention (and additional therapeutical agent), by any applicable mode administration, comprises parenteral, subcutaneous, intraperitoneal, lung interior and intranasal administration, and look topical therapeutic needs, damage zone administration.Parenteral infusions comprises intramuscular, intravenously, intra-arterial, intraperitoneal or subcutaneous administration.In addition, anti-Bv8 antibody is suitable for, by pulsatile infusion administration, particularly using the antibody of attenuated dosage.Whether be short-term or long-term, can be that any applicable approach such as, as passed through injection, vein or subcutaneous injection if depending in part on administration.

Preparing and giving the position in conjunction with target will considering antibody of the present invention in antibody.When being intracellular molecules in conjunction with target, wherein provide certain embodiments of the present invention in conjunction with the antibody in the cell residing for target or its Fab for being imported into.In one embodiment, anti-Bv8 antibody of the present invention can as intracellular antibody at cell inner expression.As used herein, term " intracellular antibody " refers to as such as Marasco, GeneTherapy4:11-15 (1997); Kontermann, Methods34:163-170 (2004); U.S. Patent number 6,004,940 and 6,329,173; Described in U.S. Patent Application Publication No. 2003/0104402 and PCT publication number WO2003/077945, a kind of at cell inner expression and can with the antibody of target molecule selective binding or its antigen-binding portion thereof.Also can see the WO96/07321 such as announced on March 14th, 1996, it produces intracellular antibody about use gene therapy.

The cell inner expression of intracellular antibody can by coding is expected antibody or its antigen-binding portion thereof nucleic acid (lack wild-type leader sequence and usually and the secretion signal of the gene-correlation of encoding antibody or Fab) import impact in target cell.Can, by all or part of delivery of nucleic acids of one or more code book invention antibody to target cell, one or more intracellular antibodies (intrabody) be expressed, thus can be combined and regulate the activity of target polypeptide by target polypeptide in cell.Can use any by the standard method in nucleic acid into cells, include but not limited to microinjection, ballistic injection (ballisticinjection), electroporation, calcium phosphate precipitation, liposome and use carry the retrovirus of object nucleic acid, adenovirus, adeno associated virus and vaccinia virus vector and carry out transfection.

In certain embodiments, can by making nucleic acid enter (optionally comprising in the carrier) cell of patient with ex vivo (exvivo) method in body.In the example sent in vivo, such as, needing the position of therapeutic intervention to be injected directly in patient body by nucleic acid.In another example sent in vivo, use virus vector (such as adenovirus, I herpes simplex virus type or adeno associated virus) and make nucleic acid enter cell based on the transfection of the system (the useful lipid of transgenosis for lipid mediation has such as DOTMA, DOPE and DC-Chol) of lipid.About the summary of some genetic marker and gene therapy protocol see Andersonetal., Science256:808-813 (1992) and WO93/25673 and the reference wherein quoted.In an example of ex vivo therapy, take out cell from patient, nucleic acid is imported the cell that those are separated, and will pass through the cell of modification or directly be applied to patient, or it be interior (see such as U.S. Patent No. 4,892 such as to load the interior also patients with implantation body of porous-film, 538 and 5,283,187).The carrier being usually used in ex vivo delivery nucleic acid is retroviral vector.

In another embodiment, the antibody of internalization is provided.Antibody can have some and strengthen the characteristic entered by antibody delivery in cell, or can be modified to have above-mentioned characteristic.Technology for realizing it is known in the art.Such as, the cationization of known antibodies can promote that it is by cellular uptake (see such as U.S. Patent number 6,703,019).Lipofection or liposome also can be used for antibody delivery to enter in cell.When using antibody fragment, may be favourable with the minimum inhibition fragment of target protein specific binding.Such as, based on the variable region sequences of antibody, the peptide molecule retained with target protein sequence binding ability can be designed.Above-mentioned peptide can chemosynthesis and/or produced by recombinant DNA technology.See such as Marasco etc., Proc.Natl.Acad.Sci.USA, 90:7889-7893 (1993).

Increase antibody by other method known in the art and enter target cell.Such as, some sequence those sequence directs heterologous proteins as derived from HIVTat or feeler foot (Antennapedia) homeodomain protein pass cytolemma thus effectively take in.See such as Chen etc., Proc.Natl.Acad.Sci.USA (1999), 96:4325-4329.

When the target of antibodies is arranged in brain, some embodiment of the present invention provides the antibody through hemato encephalic barrier.There are some for transport molecule through the methods known in the art of hemato encephalic barrier, include but not limited to physical method, the method based on lipid, the method based on stem cell and the method based on acceptor and passage.

The physical method of antibody delivery through hemato encephalic barrier is included but not limited to walk around hemato encephalic barrier completely or pass through to produce opening in hemato encephalic barrier.The method of walking around includes but not limited to be injected directly in brain (see such as Papanastassiou etc., GeneTherapy9:398-406 (2002)), interstitial infusion/convection current strengthen send (convection-enhanceddelivery) (see such as Bobo etc., Proc.Natl.Acad.Sci.USA91:2076-2080 (1994)) and in brain, insert delivery apparatus (see such as Gill etc., NatureMed.9:589-595 (2003); And GliadelWafers ^tM, GuildfordPharmaceutical).The method producing opening in barrier includes but not limited to ultrasonic wave (see such as U.S. Patent Publication No. 2002/0038086), osmotic pressure is (as by giving the N.F,USP MANNITOL (Neuwelt that height oozes, E.A., ImplicationoftheBlood-BrainBarrieranditsManipulation, Vols1 & 2, PlenumPress, N.Y. (1989))), by such as bradykinin or thoroughly agent A-7 thoroughly change (see such as U.S. Patent number 5, 112, 596, 5, 268, 164, 5, 506, 206 and 5, 686, 416) and cross over the neurocyte (see such as U.S. Patent Publication No. 2003/0083299) of hemato encephalic barrier with the carrier transfection of the gene containing encoding antibody.

Antibody delivery to be included but not limited in the liposome of the antibody binding fragment entering to be connected with receptors bind on the blood vessel endothelium with hemato encephalic barrier by antibody packing (see such as U.S. Patent Application Publication No. 20020025313) through the method for hemato encephalic barrier based on lipid, and antibody is coated in low-density lipoprotein particle (see such as U.S. Patent Application Publication No. 20040204354) or apo E (see such as U.S. Patent Application Publication No. 20040131692).

The method based on stem cell of transport antibody penetration hemato encephalic barrier needs genetically engineered neural precursor (NPC) to express interested antibody, is then implanted by stem cell in the brain of individuality to be treated.See Behrstocketal. (2005) GeneTher.2005 December 15 formerly open (report through genetically engineered and NPC that is that express neurotrophic factor GDNF reduces Parkinsonian symptom after the brain implanting rodents and primate model) in advance.

Include but not limited to use glucocorticosteroid blocker to increase the perviousness (see such as U.S. Patent Application Publication No. 2002/0065259,2003/0162695 and 2005/0124533) of hemato encephalic barrier through the method for hemato encephalic barrier antibody delivery based on acceptor and passage; Activating potassium channel (see such as U.S. Patent Application Publication No. 2005/0089473), suppresses abc drug vehicle (see such as U.S. Patent Application Publication No. 2003/0073713); The activity (see such as U.S. Patent Application Publication No. 2003/0129186) of one or more TfRs is regulated with Transferrins,iron complexes coated antibody, and cationized antibodies (see such as U.S. Patent number 5,004,697).

Anti-Bv8 antibody of the present invention should be prepared, determine dosage and administration in a kind of mode meeting good medical practice.The factor considered about this point is included in the particular condition for the treatment of, specific Mammals in treatment, the clinical state of individual patients, the cause of disease, drug delivery position, medication, administration schedule and other factor known to practitioner.Anti-Bv8 antibody without the need to but optionally prepare together with the medicine that prevents or treat described illness at present with one or more.The significant quantity of above-mentioned other medicines depend on antibody existing in formula amount, the factor of sanatory type and other above-mentioned discussion.These medicines usually use with identical dosage and have route of administration described herein, or use with the dosage described herein of about 1-99%, or used by any approach with any dosage, described dosage and approach be to determine by rule of thumb/suitable through clinical assays.

In order to prevent or disease therapy, the suitable dose of antibody of the present invention (when separately or when using with one or more other other therapeutic agent) should depend on the type of the disease that will treat, the kind of antibody, the seriousness of disease and the course of disease, give the prevention of antibody or therapeutic purpose, treatment before, the clinical history of patient and the response of antagonist and attending doctor consideration determine.Antibody is suitable for once or in a series for the treatment of giving patient.Depend on type and the seriousness of disease, the antibody of about 1 μ g/kg-15mg/kg (such as 0.1mg/kg-10mg/kg) can be used as candidate's consumption first and gives patient, no matter is such as independent by one or many administration or passes through continuous infusion.Depend on and give the above-mentioned factor mentioned, a typical per daily dose can in the scope of about 1 μ g/kg-100mg/kg or more.For several days or repeat administration for more time, depend on the state of an illness, treatment should continue usually till occurring that illness obtains the suppression expected.An illustrative dosage of antibody should be about 0.05mg/kg-and is about 50mg/kg.Therefore, patient can be given by the dosage of one or more about 0.5mg/kg, 2.0mg/kg, 4.0mg/kg, 10mg/kg, 15mg/kg, 20mg/kg or 25mg/kg (or their any combination).Above-mentioned dosage can intermittently give, as weekly or within every three weeks, give once (as make patient obtain about 2-about 20, or the antibody of such as about 6 dosage).Initial higher loading dose can be given, then give one or more lower dosage.An illustrative dosage regimen comprises the initial loading dose giving about 4mg/kg, succeeded by all maintenance doses of about 2mg/kg antibody.But, other dosage regimen can be used.The progress of monitoring this treatment is easy to by routine techniques and measuring method.

Diagnostic method and detection method

Anti-Bv8 antibody of the present invention can be used for the assay method (such as diagnosis or prognostic assays) detecting the Bv8 expression in specific cells or tissue, and as described below carrying out marks and/or be immobilized on insoluble matrix wherein said antibody.

On the other hand, the invention provides the method for detecting Bv8, the method comprises the anti-Bv8 antibody complex of Bv8-detected in sample.Term " detection ", for comprising qualitative and/or detection by quantitative (measurement level) during this paper, having or contrasting without reference.

On the other hand, the invention provides any anti-Bv8 antibody described herein, wherein said anti-Bv8 antibody comprises detectable marker.

On the other hand, the invention provides the mixture of any anti-Bv8 antibody described herein and Bv8.In some embodiments, mixture is in body or external.In some embodiments, described mixture comprises cancer cells.In some embodiments, described anti-Bv8 antibody is detectable label.

Anti-Bv8 antibody (such as any Bv8 antibody described herein) can be used for the Bv8 of any one in a large amount of known detection assay method and detects.

Such as, Bv8 can be measured as follows to biological sample, namely obtain sample from expectation source, sample is mixed to allow any Bv8 existed in antibody and mixture to form antibody/Bv8 mixture with anti-Bv8 antibody, and detects any antibody/Bv8 mixture existed in mixture.Biological sample can be prepared for assay method by the method being suitable for specific sample known in the art.Select the method for biased sample and antibody according to the type of used assay method and detect the method for antibody/Bv8 mixture.This type of assay method comprises immunohistochemistry, competitiveness and sandwich/sandwich assay and steric inhibition assay method (stericinhibitionassay).For sample preparation, the tissue from Mammals (typically people patient) or cell sample can be used.The example of sample includes but not limited to cancer cells, such as colorectal carcinoma, mammary cancer, prostate cancer, ovarian cancer, lung cancer, cancer of the stomach, carcinoma of the pancreas, lymphoma and leukaemia cancer cell.Also the Bv8 in serum can be measured.Sample can be obtained by multiple code known in the art, include but not limited to excision, suction or biopsy.Tissue can be fresh or freezing.In one embodiment, sample is fixing and is embedded in paraffin or analogue.(namely preserving) tissue sample can be fixed (see such as " ManualofHistologicalStainingMethodoftheArmedForcesInstit uteofPathology, " 3 by ordinary method ^rdedition (1960) LeeG.Luna, HT (ASCP) Editor, TheBlakstonDivisionMcGraw-HillBookCompany, NewYork; TheArmedForcesInstituteofPathologyAdvancedLaboratoryMeth odsinHistologyandPathology (1994) UlrekaV.Mikel, Editor, ArmedForcesInstituteofPathology, AmericanRegistryofPathology, Washington, D.C.).Those of ordinary skill in the art will understand, and the selection of fixing agent is decide for histological stain or other object analyzed by sample.Those of ordinary skill in the art also will understand, the size that fixing duration depends on tissue sample and the fixing agent used.Such as, the formalin of neutral buffered, BouinShi liquid or paraformaldehyde can be used to fix sample.Generally speaking, sample is first fixing, then dewatered by alcohol ascending series, with paraffin or other sectioning media infiltration and embedding this tissue sample can be cut into slices.Or, tissue can be carried out cutting into slices and gained section is fixed.Such as, can by conventional methodologies tissue sample be embedded in paraffin and process (see such as " ManualofHistologicalStainingMethodoftheArmedForcesInstit uteofPathology ", seeing above).The example of operable paraffin includes but not limited to Paraplast, Broloid and Tissuemay.Once tissue sample is embedded, just can with slicing machine etc. by sample sections (see such as " ManualofHistologicalStainingMethodoftheArmedForcesInstit uteofPathology ", seeing above).For this code, such as, the thickness range of section can be about 3 microns to about 5 microns.Once section, just by Several standard method, section can be attached to slide glass.The example of slide glass tackiness agent includes but not limited to silane, gelatin, polylysine etc.Such as, paraffin-embedded section can be attached to the slide glass of positively charged slide glass and/or polylysine bag quilt.If use paraffin as embedded material, then general tissue slice is taken off paraffin and rehydration.By several standard methods, tissue slice can be taken off paraffin.Such as, dimethylbenzene and alcohol descending series (see such as " ManualofHistologicalStainingMethodoftheArmedForcesInstit uteofPathology ", seeing above) gradually can be used.Or, can the de-paraffin non-organic reagent of commodity in use, such as Hemo-De7 (CMS, Houston, Texas).

The analytical procedure of Bv8 all uses one or more following reagent: through the Bv8 analogue of mark, immobilized Bv8 analogue, the anti-Bv8 antibody through mark, immobilized anti-Bv8 antibody and space conjugate.Reagent through mark is also called " tracer agent ".

The marker used does not disturb Bv8 and anti-any of Bv8 antibodies to detect functional group.Many markers become known for immunoassay, and example comprises can the module of direct-detection, such as fluorescence dye, chemoluminescence and radioactively labelled substance, and must react or module that derivatize could detect, such as enzyme.

The marker used does not disturb Bv8 and anti-any of Bv8 antibodies to detect functional group.Many markers become known for immunoassay, and example comprises can the module of direct-detection, such as fluorescence dye, chemoluminescence and radioactively labelled substance, and must react or module that derivatize could detect, such as enzyme.The example of this type of marker comprises radio isotope ³²p, ¹⁴c, ¹²⁵i, ³h and ¹³¹i, fluorophore such as Rare Earth Chelate or fluorescein and derivative thereof, rhodamine and derivative thereof, dansyl, Umbelliferone, luciferase, such as Fluc and bacteriofluorescein enzyme (U.S. Patent No. 4, 737, 456), luciferin, 2, 3-dihydro phthalazine diketone, horseradish peroxidase (HRP), alkaline phosphatase, beta-galactosidase enzymes, glucoamylase, N,O-Diacetylmuramidase, Carbohydrate oxidase is glucose oxidase such as, galactose oxidase, and glucose-6-phosphate dehydrogenase (G6PD), Heterocyclic oxidases such as uriKoxidase and XOD, coupling has the enzyme such as HRP using hydrogen peroxide to carry out oxidation dye precursors, lactoperoxidase, or microperoxisome, vitamin H/affinity element, spin label, bacteriophage labels thing, stabilized radical, etc..

There is the ordinary method these markers being covalently bond to protein or polypeptide.Such as, coupling agent such as dialdehyde, carbodiimide, bismaleimides, two imido-ester, bis-diazotized-benzidine etc. can be used for fluorescence above-mentioned on antibody labeling, chemoluminescence and enzyme marker.See such as U.S. Patent No. 3,940,475 (fluorometry) and 3,645,090 (enzyme); Hunter etc., Nature, 144:945 (1962); David etc., Biochemistry, 13:1014-1021 (1974); Pain etc., J.Immunol.Methods, 40:219-230 (1981); And Nygren, J.Histochem.andCytochem., 30:407-412 (1982).Preferred marker is enzyme herein, such as horseradish peroxidase and alkaline phosphatase.A kind of standard operating procedure by this type of marker (comprising enzyme) and antibody coupling for the those of ordinary skill being familiar with immunoassay.See such as O'Sullivan etc., " MethodsforthePreparationofEnzyme-antibodyConjugatesforUs einEnzymeImmunoassay ", in MethodsinEnzymology, J.J.Langone and H.VanVunakis compiles, volume 73 (AcademicPress, NewYork, NewYork, 1981), pp.147-166.

Some assay method needs the immobilization of reagent.Anti-Bv8 antibody and still free in the solution any Bv8 can divide out by immobilization.For this reason, or by being adsorbed to water-fast matrix or surface (Bennich etc., US3,720,760), before assay method code, anti-Bv8 antibody or Bv8 analogue is made not to dissolve by covalent coupling (such as utilizing glutaraldehyde cross-linking), or such as by immunoprecipitation, after assay method code, make anti-Bv8 antibody or Bv8 analogue not dissolve.

The protein expression that immunohistochemistry and Staining Protocol come in sample for reference can be utilized.The immunohistochemical staining of tissue slice has proved a kind of assessment or has detected the reliable method that in sample, protein exists.Immunohistochemistry (" IHC ") technology utilizes antibody to detect and manifests cells in situ antigen, usually by colour developing or fluorescent method.For sample preparation, the tissue from Mammals (typically people patient) or cell sample can be used.Sample can be obtained by multiple code known in the art, include but not limited to excision, suction or biopsy.Tissue can be fresh or freezing.In one embodiment, sample is fixing and is embedded in paraffin or analogue.(namely preserving) tissue sample can be fixed by ordinary method.Those of ordinary skill in the art will understand, and the selection of fixing agent is decide for histological stain or other object analyzed by sample.Those of ordinary skill in the art also will understand, the size that fixing duration depends on tissue sample and the fixing agent used.

IHC can dye with other technology such as morphology and/or implement together with fluorescence in situ hybridization.Existing two kinds of conventional IHC methods: directly and Indirect Determination.According to the first assay method, directly measure the combination of antibody and target antigen (such as Bv8).This direct measuring method uses the reagent through mark, the first antibody (primaryantibody) of such as fluorescence labels or enzyme labelling, and it does not need the interaction of further antibody just can manifest.In the typical Indirect Determination of one, the first antibody of non-coupling is bonded to antigen, and the second antibody (secondaryantibody) then through mark is bonded to first antibody.If second antibody coupling has enzyme marker, then interpolation chromogenic substrate or fluorogenic substrate are to provide manifesting of antigen.Because several second antibody can be reacted from the different epi-positions on first antibody, amplify so there is signal.

For immunohistochemical first and/or second antibody usually with marking by detection module.Existing multiple marker.

Outside sample preparation code discussed above, may also need before IHC, period or afterwards tissue slice is further processed.Such as, epi-position repairing method can be implemented, such as in citrate buffer, tissue sample be heated (see Appl.Immunohistochem.4 (3) such as such as Leong: 201 (1996)).

After optional closed step, tissue slice is exposed to first antibody enough time under suitable conditions, makes first antibody be bonded to target protein antigen in tissue sample.The suitable condition realizing this purpose can be determined by normal experiment.The combination degree of antibody and sample measures by using any one detectable discussed above.Preferably, marker is enzyme marker (such as HRPO), the chemical transformation of its catalyzed coloration substrate such as 3,3'-diaminobenzidine chromogens.Preferably, enzyme marker is coupled to the antibody (such as first antibody is rabbit polyclonal antibody, and second antibody is goat antirabbit antibody) of specific binding first antibody.

The sample so prepared can be placed and covered.Then carry out slide glass assessment, such as, utilize microscope, and the staining intensity criteria that this area routine uses can be adopted.

Be called that other assay method of competitiveness or sandwich assay has clearly been set up and has been widely used in business diagnostic industry.

Competitive assay depends on the ability that handwriting displaying substance Bv8 analogue and testing sample Bv8 compete limited amount anti-Bv8 antibody antigen-binding site.Before and after competition, anti-Bv8 antibody is normally undissolved, is then separated with Bv8 with unconjugated handwriting displaying substance with Bv8 by the handwriting displaying substance in conjunction with anti-Bv8 antibody.By pouring out (wherein binding partners is undissolved in advance) gently or realizing this separation by centrifugal (wherein binding partners is at competing reaction postprecipitation).The amount of the amount of testing sample Bv8 and the handwriting displaying substance of combination is inversely proportional to, and the described amount in conjunction with handwriting displaying substance is by the flow measurement of mark substance.Draw the dose response curve of Bv8 known quantity, compare the amount of the Bv8 quantitatively determining to exist in testing sample with test-results.When using enzyme as detectable, these assay methods are called as ELISA system.

Be called that the another kind of competitive assay of " homogeneous phase " assay method does not need to be separated.Herein, prepare and use the conjugate of enzyme and Bv8, like this as anti-Bv8 antibodies Bv8, the existence change enzymic activity of anti-Bv8 antibody.In this case, Bv8 or its immunoreactive fragments and difunctional organic bridge are coupled on enzyme such as peroxidase.Select conjugate to use together with anti-Bv8 antibody so that the combination of anti-Bv8 antibody suppresses or strengthens the enzymic activity of marker.The method is widely used itself, is called EMIT.

Space conjugate is used for the steric hindrance method of homogeneous assay method.These conjugates are synthesized, so that substantially can not with anti-Bv8 antibody simultaneously in conjunction with conjugate for haptenic antibody by lower molecular weight haptens being covalently attached to little Bv8 fragment.The Bv8 existed in testing sample under this determination step will in conjunction with anti-Bv8 antibody, thus allow antihapten in conjunction with described conjugate, cause the change of the haptens characteristic of conjugate, such as, and the change of fluorescence when haptens is fluorophor.

Sandwich assay especially can be used for the mensuration of Bv8 or anti-Bv8 antibody.In sandwich assay (sequentialsandwichassays) in turn, immobilized anti-Bv8 antibody is for adsorbing testing sample Bv8, testing sample is removed by washing, in conjunction with Bv8 for adsorbing the second anti-Bv8 antibody through mark, the then material of separation and combination from remaining handwriting displaying substance.Amount in conjunction with handwriting displaying substance is directly proportional to testing sample Bv8.Before adding the anti-Bv8 through marking, testing sample is not separated in " parallel " sandwich assay.Anti-Bv8 monoclonal antibody is used to can be used for detecting the Bv8 in sample as a kind of antibody and the Anti-TNF-α Bv8 antibody sandwich assay in turn as another kind of antibody.

Only the exemplary detection analytical method of Bv8 above.Now or after this other method of the anti-Bv8 TPPA Bv8 of the use developed includes within the scope of the present invention, comprises bioassay method described herein.

In one aspect, the invention provides the method detecting polynucleotide (such as Bv8 polynucleotide) (such as exist or lack or amount) in the biological sample from individual (such as people experimenter).The multiple method for detecting polynucleotide can being adopted, comprising such as RT-PCR, taqman, TRAP, polynucleotide microarray, like this.

Well-known for detecting the method for polynucleotide (such as mRNA), comprise and such as use the hybridisation assays of complementary DNA probe (such as using the in situ hybridization through marking Bv8RNA probe, Northern trace and correlation technique) and various nucleic acid amplification assay method (such as to use the RT-PCR to the specific complementary primer of Bv8, and other amplification type detection method, such as such as branched DNA, SPIA, Ribo-SPIA, SISBA, TMA etc.).

Northern, dot blotting or pcr analysis such as can be used to measure Bv8mRNA to from mammiferous biological sample.Such as, RT-PCR assay method (such as quantitative PCR assay) is well-known in the art.In an exemplary embodiment of the present invention, the method for detecting the Bv8mRNA in biological sample comprises use at least one primer and generates cDNA by reverse transcription from sample; Use cDNA that Bv8 polynucleotide so generate as sense and antisense primer amplification with amplification Bv8cDNA wherein; And detect the existence of the Bv8cDNA that increases or disappearance.In addition, these class methods can comprise one or more following steps, and it allows the amount (level) (such as by checking the level of the comparative contrast mRNA sequence of " running one's home " gene such as Actin muscle family member simultaneously) measuring Bv8mRNA in biological sample.Optional, the sequence of increased Bv8cDNA can be measured.

Probe and/or primer can use detectable label substance markers, such as such as radio isotope, fluorescent chemicals, bioluminescent compound, chemiluminescence compound, metal chelator or enzyme.This type of probe and primer can be used for the existence detecting Bv8 polynucleotide in sample, and are used as the means detecting the cell of expressing Bv8 albumen.Will be understood that as technician, such as, based on provided sequence, a variety of different primers and probe can be prepared herein, and be effective to increase, clone and/or measure the existence of Bv8mRNA or disappearance and/or amount.

Optional approach of the present invention comprises following scheme, and it comprises the polynucleotide used in microarray technology detection tissue or cell sample, such as Bv8 polynucleotide.Such as, use nucleic acid microarray, the test of in the future self-test and control tissue sample and contrast mRNA sample reverse transcription and mark are to generate cDNA probe.Then by the immobilized nucleic acid array of described probe hybridization extremely on solid support.This array configurations described becomes the sequence of each member of array and position to be known.Such as, the gene selected works of likely expressing in some morbid state can be formed array on solid support.Hybridization through label probe and specific array member indicates the sample of this probe derivative to express this gene.The differential genes expression analysis of diseased tissue can provide valuable information.Microarray technology utilizes nucleic acid hybridization technique and computing technique in single experiment, to assess the mrna expression sequence type (expressionprofile) of thousands of gene (see the WO01/75166 such as announced October 11 calendar year 2001; See such as US5,700,637, United States Patent (USP) 5,445,934 and United States Patent (USP) 5,807,522; Lockart, NatureBiotechnology, 14:1675-1680 (1996); Cheung, V.G.etal., NatureGenetics21 (Suppl): 15-19 (1999), the discussion about array makes).DNA microarray is the miniature array comprising gene fragment, described gene fragment or on glass or other matrix directly synthesis or point on glass or other matrix.Usually thousands of genes is presented in single array.A typical Microarray Experiments relates to following steps: 1. self-separation prepares fluorescently-labeled target thing from the RNA of sample; 2. the target thing through mark is hybridized to microarray; 3. clean, dyeing, and scanning array; 4. analysis scan image; And 5. generate genetic expression sequence type.The DNA microarray of current use two kinds of main Types: the gene expression arrays and oligonucleotide (the usual 25-70 polymers) array that comprise the PCR primer prepared from cDNA.When forming array, oligonucleotide can be prefabricated and put on surface, or (original position) of directly synthesizing from the teeth outwards.

Affymetrix system comprises by directly synthetic oligonucleotide and the commercialization microarray system of array that makes on the glass surface.Probe/Gene Array: oligonucleotide (usual 25 polymers) is directly synthesized on chip glass by the photoetching and solid-state chemical reaction method technology of combining based semiconductor.Each array comprises as many as 400,000 kind of different oligomer, and often kind of oligomer exists with millions of copy.Because oligonucleotide probe is known location synthesis on array, hybridization pattern and strength of signal can be interpreted to gene identities and relative expression levels by AffymetrixMicroarraySuite software.Often kind of gene is presented on array by a series of different oligonucleotide probe.Each probe is to by mating oligonucleotide completely and mismatched oligonucleotides forms.Mate probe completely and there is the sequence with specific gene exact complementarity, thus measure the expression of this gene.Mismatch probe is different from mates probe completely because the single base of central base positions substitutes, thus has upset the combination of target gene transcript.This contributes to the mensuration to facilitating the background and non-specific hybridization of mating the signal that oligomer records completely.The intensity for hybridization of mismatch probe is deducted by MicroarraySuite software from the intensity for hybridization of mating probe completely, to determine the absolute of each probe sets or specific intensity.The selection of probe based on with the current information in other Nucleotide storehouse.Think the distinct regions of its recognition sequence gene 3 ' end.Use hybrid heater (" electricity turns baking oven ") is hybridized while carrying out as many as 64 arrays.Cleaning and the dyeing of probe array are implemented in jet station.It is full automatic, comprises four modules, and each module holds a probe array.Each module independently controls via MicroarraySuite software application pre-programmed jet scheme.Scanner is confocal laser Fluorescence Scanner, and it is measured by the fluorescence intensity of launching through mark cRNA being bonded to probe array.Computer workstation control jet station and the scanner of MicroarraySuite software are installed.MicroarraySuite software can control as many as eight jet stations, uses the hybridization of the pre-programmed of probe array, cleaning and Staining Protocol.This software also obtain intensity for hybridization data and use suitable algorithm be converted into often kind of gene with/without calling (presence/absencecall).Finally, this software detects the change of genetic expression between each experiment by comparative analysis, and output format is turned to .txt file, and it can be used from further data analysis with other software program one.

In some embodiments, treatment is selected from the cancer of lower group: colorectal carcinoma, lung cancer, ovarian cancer, hypophysis cancer, carcinoma of the pancreas, adenofibroma of breast, prostate cancer, head and neck squamous cell carcinoma, soft tissue sarcoma, mammary cancer, neuroblastoma, melanoma, breast malignant tumor, cancer of the stomach, colorectal carcinoma (CRC), epithelial cancer, the cancer of the brain, carcinoma of endometrium, carcinoma of testis, cholangiocarcinoma, carcinoma of gallbladder, and hepatocellular carcinoma knurl.

Herein (in the definition of biological example sample) describe biological sample.

Goods

In another aspect of the present invention, provide the goods comprising and can be used for the material treating, prevent and/or diagnose illness mentioned above.Goods comprise container and label on the container or be connected with it or package insert.Suitable container comprises such as bottle, tubule, syringe etc.Container can be made from a variety of materials, such as glass or plastics.Himself is housed in container or effectively treats, prevent and/or diagnose the composition of illness when combining other composition, and sterile access port (such as container can be intravenous solution bag or the tubule with the stopper that hypodermic needle can be pierced through) can be had.At least one promoting agent in composition is antibody of the present invention.Label or package insert instruction said composition are used for the treatment of the illness of selection, such as cancer.In addition, goods can comprise the first container that (a) is wherein equipped with composition, and wherein said composition comprises antibody of the present invention; (b) second container of composition is wherein housed.Goods in this embodiment of the present invention also can comprise the package insert that instruction first and second antibody compositions can be used for treating specific illness such as cancer.Or/in addition, goods also can comprise second (or 3rd) container, and the acceptable buffer reagent of pharmacy is wherein housed, such as injection bacteriostatic water (BWFI), phosphate buffered saline (PBS), woods grignard (Ringer) solution and dextrose solution.It also can comprise other material required in business and user's position, comprises other buffer reagent, thinner, filter, syringe needle and syringe.

Here is the embodiment of the inventive method and composition.Should be appreciated that according to general description provided above, other embodiment various can be implemented.

Embodiment

The commercial reagents mentioned in embodiment uses according to the instruction of manufacturers, except as otherwise noted.

embodiment 1: the generation of anti-Bv8 antibody

The demonstration of this embodiment is for the humanization of the mouse-anti Bv8 antibody of Bv8.Residue numbering is according to Kabat (Kabatetal., Sequencesofproteinsofimmunologicalinterest, 5thEd., PublicHealthService, NationalInstitutesofHealth, Bethesda, MD (1991)).Use one letter amino is abridged.

Generate the anti-Bv8 antibody that hybridoma is derivative

By generating anti-Bv8 antibody with recombinant human B v8 extracellular domain polypeptide (PeproTech, RockHill, NJ) immune mouse or hamster.Have selected from Mouse Hybridoma Cells generate, comprise clone 2G9,2B9,3F1 of light-chain variable domain shown in Fig. 2 A, 2B, 3A, 3B, 4A and 4B (VL) and heavy chain variable domain (VH) sequence.Also have selected derivative from hamster hybrid knurl, comprise the clone 2D3 of VH and VL sequence shown in Fig. 5 A and 5B.

The anti-Bv8 antibody that clone hybridization knurl is derivative and generation chimeric antibody

Use the mini test kit (Catalog74104 of RNeasy; QIAGEN; Valencia, CA) extract total serum IgE from the hybridoma generating little mouse-anti Bv8 monoclonal antibody 2B9,3F1 and 2G9 and the anti-Bv8 monoclonal antibody 2D3 of hamster respectively.RT-PCR amplification light-chain variable domain (VL) and heavy chain variable domain (VH) is used with following degenerated primer:

2B9 light chain (LC) forward:

5’GTCAGATATCGTKCTSACMCARTCTCCAGCAATMA3’(SEQIDNO:225)

2B9 heavy chain (HC) forward:

5’GATCGACGTACGCTCAGGTGACKCTGAARGAGTCWGG3’(SEQIDNO:226)

3F1 light chain (LC) forward:

5’GTACGATATCGTKCTSACCCARTCTCC3’(SEQIDNO:227)

3F1 heavy chain (HC) forward:

5’GATCGACGTACGCTCAGGTGACKCTGAARGAGTCWGG3’(SEQIDNO:228)

2G9 light chain (LC) forward:

5’GTACGATATCGTKCTSACCCARTCTCC3’(SEQIDNO:229)

2G9 heavy chain (HC) forward:

5’GATCGACGTACGCTGAGGTYCAGCTSCAGCAGTCTGG3’(SEQIDNO:230)

2D3 light chain (LC) forward:

5’GATCGATATCCARATGACNCARACNCC3’(SEQIDNO:231)

2D3 heavy chain (HC) forward:

5’GATCGACGTACGCTGARGTGCARYTGGTGGARTCTGG3’(SEQIDNO:232)

Light chain is reverse: 5 ' GCTGTAGGTGCTGTCTTTGCT3 ' (SEQIDNO:233)

Heavy chain is reverse: 5 ' CTGGWCAGGGMTCCAGAGTTCCA3 ' (SEQIDNO:234)

Shown primer sequence is according to following IUB code:

iUB code

G guanine

A VITAMIN B4

T thymus pyrimidine

C cytosine(Cyt)

R (A or G)

Y (C or T)

M (A or C)

K (G or T)

S (C or G)

W (A or T)

H (A or C or T)

B (C or G or T)

V (A or C or G)

D (A or G or T)

N (A or C or G or T)

Forward primer is specific to the N terminal amino acid sequence in VL and VH district.Respectively, light chain (LC) and heavy chain (HC) reverse primer are designed to and light-chain constant domains (CL) and heavy-chain constant domains 1(CH1) between species the regional annealing of high conservative.

Subsequently the PCR primer of amplification and TA cloning vector (Invitrogen, Carlsbad, CA) are connected and check order.Then the VLDNA sequence subclone through qualification is entered the pRK mammalian cell expression vector (Carteretal., Proc.Natl.Acad.Sci.USA, 89,4285-4289 (1992)) containing people Ka Pa constant domain.VHDNA sequence insertion encoding total length people γ 1 constant domain entered pRK carrier.

Fugene transfection reagent (Roche, Mannheim, Germany) is used to enter LC and HC expression vector cotransfection through adenovirus transfected human embryonic kidney cell line 293.In serum free medium, generate antibody and carry out antibody purification by Protein A Chromatography.

The direct grafting in hypervariable region has on framework to acceptor people

Phagemid for this work is unit price Fab-g3 display carrier, and is made up of 2 open reading-frame (ORF)s under controlling in single phoA promotor.The stII signal sequence that first open reading-frame (ORF) is merged by VL and the CH1 territory with acceptor light chain forms, and second stII signal sequence merged by VH and the CH1 territory (being then pnagus secundarius coat protein P3) with acceptor heavy chain forms.

Before the CDR grafting variant generating anti-Bv8 antibody, the light-chain variable domain (VL) of mouse antibodies and heavy chain variable domain (VH) are carried out sequence alignment with people's consensus sequence.

For clone 2B9 and 3F1, people has light chain card handkerchief 1 (huKI) and people, and to have heavy chain subgroup III (huGIII) be immediate people's framework, and respectively the hypervariable region grafting of mouse 2B9 (m2B9) and mouse 3F1 (m3F1) light chain and sequence of heavy chain is entered huKI and huGIII and has acceptor framework to generate direct CDR grafting variant, be called h2B9.v1(Fig. 6 A and 6B) and h3F1.v1(Fig. 4 A and 4B).

What is interesting is, for clone 2G9, be that people has light chain card handkerchief IV (huKIV) and people has heavy chain subgroup I (huGI) with the immediate people's framework of mouse 2G9.Therefore, first respectively the hypervariable region grafting of mouse 2G9 (m2G9) light chain and heavy chain is entered huKI and huGIII and huKIV and huGI and have acceptor framework to generate four kinds of different CDR grafting variants, be denoted as h2G9.K1G1, h2G9.K1G3, h2G9.K4G1 and h2G9.K4G3(Figure 14 and 15).People VL card handkerchief subgroup IV has Frame sequence and deducts Kabat light chain HVR sequence and be shown in SEQIDNO:240.People VH subgroup I has Frame sequence and deducts heavy chain HVR sequence and be shown in SEQIDNO:241.See Fig. 1 G.In VL territory, the grafting of following district is had acceptor to people: the position 24-34 in L1, the position 89-97 in position 50-56 and L3 in L2.In VH territory, the position 49-65 in position 26-35, H2 in grafting H1,71 and 73 and H3 in position 95-102.

The oligonucleotide separated for each hypervariable region is used to generate direct CDR grafting variant (h2B9.v1, h3F1.v1, h2G9.K1G1, h2G9.K1G3, h2G9.K4G1, h2G9.K4G3), as the Fab at phage display with as both IgG by Kunkel mutagenesis.Correct clone is identified by DNA sequencing.

Select and improve (polishing) humanization 2G9.K4G1

Use BIAcore as described herein ^tM-3000 instruments measure the binding affinity of four kinds of CDR grafting anti-Bv8 antibody variants h2G9.K1G1, h2G9.K1G3, h2G9.K4G1 and h2G9.K4G3 by Biacore.In addition, suprarenal gland cortex endotheliocyte (ACE) proliferation assay is implemented as described herein to investigate the Bv8 Neutralization effect of four kinds of variants.

The result that BIAcore analyzes shows variant h2G9.K1G1 with h2G9.K1G3 to be had in high density analysis and as compared to h2G9.K4G1 with h2G9.K4G3 dissociation rate significantly faster.In addition, ACE proliferation assay shows in four kinds of variants, and variant h2G9.K4G1 has best activity, because it almost blocks Bv8 completely to the combination of ACE cell.But BIAcore analyzes and ACE proliferation assay indicates the binding affinity of h2G9.K4G1 anti-Bv8 antibody and Neutralization effect still lower than the anti-Bv8 antibody of chimeric 2G9.Therefore, anti-Bv8 antibody h2G9.K4G1 is selected to carry out affinity maturation to improve its binding affinity further.

Before the affinity maturation starting anti-Bv8 antibody h2G9.K4G1, the stability problem potential to HVR sequential analysis, it relates to the deacylated tRNA amine during isomerization, unpaired halfcystine and manufacturing process.Potential problem is identified: the residue near (i) light chain variable sequence position 28 and 29 in following site; (ii) variable heavy chain sequence position 52a; (iii) variable heavy chain sequence position 54; (iv) residue near variable heavy chain sequence position 95 and 96.

Generate anti-Bv8 antibody h2G9.K4G1, at resi-dues mentioned above, there is the alternative variant of single amino acid, and often kind of variant is shown as Fab on phage.Generate 12 kinds of variants that there is following single amino acid and modify altogether, and be have evaluated their binding affinity by phage competitive ELISA: CDR-L1-D28E, D28S, G29A, G29S; CDR-H2-C52aA, C52aS, N54A, N54S; CDR-H3-D95E, D95S, G96A, G96S.Compared with h2G9.K4G1, the binding affinity of 12 kinds of variants is shown in Figure 14 A and 14B.Described figure shows most of variant and keeps binding affinity that is similar or that slightly improve.Surprisingly, there is the variant that in CDR-H3, D95S substitutes and completely lose combination at 1 μM of people Bv8.In addition, there is variant that in CDR-H3, D95E substitutes display remarkable binding affinity of 100 times compared with h2G9.K4G1 decline.

The clone being denoted as h2G9.K4G1.Polish is generated: CDR-L1-D28S by combining all following four amino acid replacements; CDR-H2-C52aS, N54S; CDR-H3-G96S.BIAcore analyzes chimeric 2G9Fab with h2G9.K4G1.PolishFab of display and has similar binding affinity, and chimeric both 2G9IgG and h2G9.K4G1.PolishIgG show the ACE cell proliferation (Figure 21) blocking Bv8 induction completely.In addition, CDR-L1-D28S; CDR-H2-C52aS, N54S; CDR-H3-G96S(anti-Bv8 antibody h2G9.K4G1.Polish) amino acid replacement at place recovers binding affinity unexpectedly to the binding affinity close to the anti-Bv8 antibody of chimeric 2G9.

The soft randomization of hypervariable region

The soft randomized strategy of the Preference maintaining trend mouse hypervariable region sequence is used sequence polymorphism to be introduced each hypervariable region to improve the avidity of clone h2G9.K4G1.Polish further.This uses the pollution oligonucleotide synthesis strategy (poisonedoligonucleotidesynthesisstrategy) recorded by Gallopetal., J.Med.Chem.37:1233-1251 (1994) at first to realize.For the given position in the hypervariable region that will suddenly change, pollute the amino acid whose codon of encoding wild type with 70-10-10-10 mixture of ribonucleotides, cause the mutation rate of each position average 50%.Soft randomized oligonucleotides imitates (patternafter) mouse hypervariable region sequence, and contains the same area limited by direct hypervariable region grafting.

Generate phage library

Randomized oligonucleotides set for the design of each hypervariable region is separately contained 660ng oligonucleotide, 50mMTrispH7.5,10mMMgCl at six ₂, 1mMATP, 20mMDTT and 5U polynucleotide kinase 20 μ l react in 37 ° of C phosphorylations 1 hour.Then by the oligonucleotide set of six phosphorylations and 50mMTrispH7.5,10mMMgCl ₂in 20 μ gKunkel form assemblies, final volume 500 μ l, obtains oligonucleotide: template is than 3.Annealed by mixture, 90 ° of C4 minute, 50 ° of C5 minute, then in cooled on ice.The scheme for preventing the excessive sex change of DNA of annealing from improveing is used to remove excessive unannealed oligonucleotide with QIAquickPCR purification kit (Catalog28106, QIAGENInc., Valencia, CA).150 μ lPB are added to 500 μ l annealing mixtures, and split mixture in the middle of 2 silica column.Clean each post with 750 μ lPE and additionally rotate with after dry post, with each post of 110 μ l10mMTris, 1mMEDTApH8 wash-out.Then by adding 1 μ l100mMATP, each 25mM of 10 μ l25mMdNTP(dATP, dCTP, dGTP and dTTP in room temperature), 15 μ l100mMDTT, 25 μ l10XTM damping fluid (0.5MTrispH7.5,0.1MMgCl ₂), 2400UT4 ligase enzyme and 30UT7 polysaccharase fill annealing for 3 hours and clean template (220 μ l).

Product (Sidhuetal., MethodsinEnzymology328:333-363 (2000)) is filled at Tris-acetate-EDTA/ analysed on agarose gel.Usually visible three bands: the band of bottom correctly fills and the product be connected, middle band fills but does not connect, and the band at top is displacement (displaced) band.The band at top is generated by the secondary activity in the inherence of T7 polysaccharase, and be difficult to avoid (Lechneretal., J.Biol.Chem.258:11174-11184 (1983)); But this band transformation efficiency is lower than the band at top 30 times, and usually less to the contribution in library.Middle band is the disappearance of 5' phosphate radical needed for final ligation; This band transformation efficiency is high, and unfortunately, mainly provides wild-type sequence.

Then will fill product to clean, electroporation enters SS320 cell, and breeding under M13/KO7 helper phage exists, as described in Sidhuetal., MethodsinEnzymology328:333-363 (2000).The scope of storage capacity is 1 – 2x10 ⁹individual independent cloning.To the Random clones order-checking from initial libraries to assess storehouse quality.

Phage is selected

People Bv8 (PeproTech) is used for phage as target thing and selects.At the upper bag of MaxiSorp microtiter plate (Nunc) by the PBS containing 10 μ g/ml people Bv8, take turns elutriation for the 1st.The first round is selected, uses the target thing in 8 holes; For the selection of subsequent passes, use the target thing in a hole.SuperBlocker (Pierce) is used in hole to close 1 hour.From culture supernatants results phage, and at the middle resuspension of the PBS (PBST) containing 1%BSA and 0.05%Tween20.To hole in conjunction with after 2 hours, by with the PBS (PBT) containing 0.05%Tween20 thoroughly cleaning remove unconjugated phage.By hole incubation together with 50mMHCl, 0.5MKCl is carried out the phage of elution of bound for 30 minutes.Phage uses XL1blue cell (Strategene) and M13/KO7 helper phage (NewEnglandBioLabs) breed and increase, and in 37 ° of C overnight incubation in 2YT, 50 μ g/ml Gepcillins, for next round elutriation.The titre of the phage of the titre of the phage of the hole wash-out from target thing bag quilt being reclaimed with the hole from non-target thing bag quilt compares to assess enrichment condition.

Taking turns sorting from the 2nd, solution sorting method is used to carry out sorting phage library (Lee, C.V., etal. (2004) J.Mol.Biol340 (5): 1073-93), it allows the clone that the severity that we improve selection is improved to be separated avidity.Use Sulfo-NHS-LC-vitamin H (b-Bv8, Pierce, Rockford, IL) by people Bv8 biotinylation.The PBS of microtiter well containing the neutral Streptomycin sulphate of 10 μ g/ml is spent the night in 4 ° of C bags, then uses SuperBlocker (Pierce) to close 1 hour.Take turns selection for second, the phage suspended in PBST damping fluid by 200 μ l mixes 2 hours with 5nMb-Bv8 in room temperature (RT).The phage being bonded to b-Bv8 catches 15 minutes in RT on the hole of neutral affinity element bag quilt, and washes unconjugated phage off with PBT damping fluid.Phage uses 100mMHCl wash-out 30 minutes, neutralization, and breeds, as mentioned above.The selection and the 2nd of round is below taken turns selection and is implemented similarly, just: in the 3rd and 4 are taken turns, b-Bv8 final concentration is 0.1nM; In taking turns the 5th, b-Bv8 final concentration is 0.05nM.Start the 4th and 5 when taking turns, after phage is in conjunction with b-Bv8, the non-biotinylation people Bv8 excessive by 500 and 1000 times respectively in RT is added into described mixture-2 hours and falls dissociation rate binding substances faster with competition before catching on neutral affinity element.

Phage IC50 is measured by phage competitive ELISA

By MAXISORP ^tMthe PBS bag of microtiter plate containing 2 μ g/ml recombinant human Bs v8 (PeproTech) is spent the night, and then uses PBST damping fluid (PBS containing 0.5%BSA and 0.05%Tween20) to close 1 hour in room temperature (RT).By the phage from culture supernatants together with the people Bv8 of serial dilution in PBST damping fluid in tissue culture microtiter plate in RT incubation 1 hour, afterwards 80 μ l mixtures are transferred to the hole 15 minutes of target thing bag quilt to catch unconjugated phage.With PBT damping fluid (PBS containing 0.05%Tween20) clean plate, and add the anti-M13 (AmershamPharmaciaBiotech) (in PBST damping fluid 1:5000) 40 minutes of HRP coupling.Plate is used PBT buffer solution for cleaning, and manifest by adding tetramethyl benzidine substrate (KirkegaardandPerryLaboratories, Gaithersburg, MD).450nm absorbancy is hit the function plotting of substrate concentration to determine phage IC50 as solution.Use this as the avidity valuation of the Fab clone shown on phage surface.Figure 14 A and 14B depicts the result from phage competition assay, demonstrates modified version h2G9.K4G1 variant (L1:D28E, D28S, G29A, G29S, H2:C52aA, C52aS, N54A, N54S, H3:D95E, D95S, G96A and G96S) for the combination of people Bv8.Figure 16 and 17 depicts the result from phage competition assay, demonstrates the h2G9.K4G1.Polish variant of avidity improvement (from h2G9.K4G1.v27, v52, v55, v63, v64, v67, v77, v80 of the soft randomised libraries of L1/L2; H2G9.K4G1.v19, v25, v37, v65, v73, v75, v77.v92 from the soft randomised libraries of H1/H2) for the combination of people Bv8.

Affinity of antibody is measured by BIAcore

Binding affinity for anti-Bv8 antibody (Fab or IgG) measures, and uses BIAcore ^tM-3000 instruments carry out the measurement of surperficial plasmon resonance (SRP).In brief, according to directions for use EDC and the NHS reagent activation CM5 biologic sensor chip of supplier, and coupling people Bv8 (PeproTech) or macaque (Genentech; PUR21590) to realize about 150 response units (RU), then unreacted radical is closed with 1M thanomin.For kinetic measurement, inject anti-Bv8Fab(0.19nM to 25nM at 25 ° of C with the flow velocity of 30 μ l/min) or IgG(0.019nM to 10nM) twice serial dilutions in HBS-P damping fluid (0.01MHEPESpH7.4,0.15MNaCl, 0.005% tensio-active agent P20).Simple Langmuir combination model (BIAcoreEvaluationSoftwareversion3.2) is one to one used to carry out calculations incorporated speed (k _on) and dissociation rate (k _off).As than k _off/ k _oncarry out calculated equilibrium dissociation constant (Kd).See Figure 18-21.Result display humanization anti-Bv8 antibody h2G9.K4G1.v19 and h2G9.K4G1.v55 in conjunction with the tightness degree of people and macaque Bv8 than chimeric 2G9 anti-Bv8 antibody height at least twice.

ACE proliferation assay

In 6 orifice plates, ACE cell is inoculated with the density of 5000 cells/well in growth medium.For suppression assay method, first add anti-Bv8 antibody with prescribed concentration (μ g/mL).After 0.5-1 hour, then add people Bv8 (Peprotech) to final concentration 10nM.After 6 days, by adding 1ml2x trypsin GIBCO to each hole) make cell dissociation, and use Z2Coulter grain count and Size Analyzer (BeckmanCoulter) to count bipartite hole.See Figure 12,13,15,23 and 24.Figure 23 shows humanization anti-Bv8 antibody h2G9K4G1.v19, h2G9K4G1.v52, h2G9K4G1.v55 and h2G9K4G1.v73 and is presented at the remarkable improvement blocked in the ACE propagation of people Bv8 induction.

Bv8 antibody epitope is located by competitive ELISA

By NUNC ^tM96 hole Maxisorp immunity plate (NUNC; Roskilde, Denmark) spent the night with the PBS bag being fitted together to 2B9IgG containing 1 μ g/mL, then use PBST damping fluid (PBS containing 0.5%BSA and 0.05%Tween20) room temperature to close 1 hour.With mol ratio 1:4(HuBv8: vitamin H) use EZ-linkSulfo-NHS-LC-vitamin H (Catalog21335; Pierce; Rockford, IL) reagent carries out the biotinylation of people Bv8.

In order to determine the amount of biotinylation people Bv8 in competition assay, the biotinylation people Bv8 of three of 100nM to 0.04nM times of serial dilutions is added into the plate 15 minutes of antibody bag quilt.Then, with PBT damping fluid (PBS and 0.05%Tween20) clean plate.In conjunction with biotinylation use strepto-affinity usually to detect, its coupling horseradish peroxidase (Catalog21126; Pierce; Rockford, IL) and 1:2500 dilution in PBST damping fluid.Incubation is after 45 minutes, clean plate, and adds 100 μ L tetramethyl benzidines (R & DSystems) to each hole and manifest with inducement signal for about 5 minutes.When occurring blue, 100 μ L1M phosphoric acid are added to stop manifesting process to each hole.450nm optical density(OD) is read by spectrophotometry.

In order to locate Bv8 antibody epitope with chimeric 2B9, first IgG(is fitted together to 2B9, chimeric 3F1, chimeric 2D3, chimeric 2G9 and contrast IgG) three times of serial dilutions with determined by binding assay above, 2nM biotinylation people Bv8 mono-in PBST damping fluid arises from incubation at room temperature 1-2 hour, then it is transferred to antibody and (is fitted together to 2B9IgG; 1 μ g/mL) wrap plate upper 15 minute of quilt.Then, with PBT buffer solution for cleaning plate, and detected the amount of the biotinylation people Bv8 being attached to chimeric 2B9IgG on plate by scheme mentioned above.

In competition assay, chimeric 3F1 and chimeric 2G9 antibody compete the combination to people Bv8 with chimeric 2B9, point out these two kinds of antibody to have overlapping epitope with chimeric 2B9.But ground, chimeric 2D3 display section is with chimeric 2B9 antibody competition to the combination of people Bv8, and the chimeric 2D3 antibody of prompting can have the epi-position (Figure 11) different with chimeric 2G9 antibody from chimeric 2B9 and chimeric 3F1.

embodiment 2: efficacy study in body

People HT-55, Colo-205(colorectal carcinoma), A673(rhabdosarcoma), HPAC(carcinoma of the pancreas) and Calu-6(lung cancer) cell derives from American type culture collection (Manassas, VA).Human colorectal cancer HM7 clone is the derivative of LS174T.Calu-6, A673, HPAC and HM7, at HamShi F12, cultivate in low dextrose DMEM1:1.Colo-205 and HT-55 cultivates in RPMI1640 substratum.These two kinds of substratum all supplement 10%v/vFBS, 1%v/v penicillin/streptomycin (Invitrogen, Carlsbad, CA), 2mML-glutamine (Invitrogen, Carlsbad, CA) and 1 μ g/mlFUNGIZONE ^tM(Invitrogen, Carlsbad, CA).Cell in 37 ° of C at 5%CO ₂middle cultivation, until converge, is gathered in the crops, and with 15x10 ⁶individual cell/ml is resuspended in aseptic Matrigel.1.5x10 is injected by every mouse dorsal subcutaneous (S.C.) ⁶individual cell is at 6-8 BALB/c nude mouse (CharlesRiver in age in week; Hollister, CA) in inoculation heterograft allow that it grows.Within 24 hours after tumor cell inoculation, start twice, 10mg/kg dosage weekly, anti-Bv8 antibody chimeric 2D3, chimeric 3F1, chimeric 2B9 and chimeric 2G9; The i.p. process of humanization 2G9 variant 19, humanization 2G9 variant 55 and humanization 2G9.K4G1.Polish.In contrast, we adopt weekly the anti-GP-120 monoclonal antibody of twice 10mg/kg and anti-VEGF mAb G6.31 or B20 (Liang, W.C., etal., JBiolChem281,951-961 (2006)) of twice 5mg/kg weekly.All experiments, use for twice weekly calipers to measure the tumour of transplanting along the longest axle with vertical axle.Use ellipsoid volume formula (0.5xLxWxW) to calculate gross tumor volume, and show on figure from the gross tumor volume average of 10 mouse of each group in all process and standard error.When combinationally using with VEGF antibody, anti-Bv8 antibody also has synergistic effect in LXFL529 people's lung non-small cell carcinoma.LXFL529 people's lung non-small cell cancer cells is implanted to cream-coloured nude mouse (n=7 ~ 9).Then after tumor inoculation, mouse is processed with the anti-artemisiifolia 1428 of contrast and anti-Bv8 mouse antibodies (3F1 and 2B9) in 24 hours.~ 400mm is reached in tumour ³afterwards with VEGF antibody process mouse.Result display causes the reduction of tumor growth in various tumour as the process of single medicament and the Qian He of combining with VEGF antibody and humanization anti-Bv8 antibody.See Figure 25-37.

Mouse LLC(Lewis lung cancer), people H460(nonsmall-cell lung cancer) and HT29(colorectal carcinoma) cell derives from American type culture collection (Manassas, VA).LLC and HM7 cell adds 1%L-glutamine and 10% foetal calf serum (Hyclone at RPMI1640 substratum; Logan, UT) middle cultivation.Cell in 37 ° of C at 5%CO ₂middle cultivation, results, centrifugal, clean once with HanksShi balanced salt solution (HBSS), and count.LLC Cell resuspension is in 50%HBSS and 50%Matrigel (BDBiosciences; SanJose, CA) in, and HM7 Cell resuspension is in HBSS (Invitrogen; Carlsbad, CA) in, the two concentration is 3.5x10 ⁷individual cell/mL, for being injected into mouse.H460 cell is cultivated in containing the RPMI-1640 substratum of 10% foetal calf serum, 100U/mL penicillin G, 100 μ g/mL Vetstreps, 1mM Sodium.alpha.-ketopropionate, 2mM glutamine, 10mMHEPES, 0.075% sodium bicarbonate and 25 μ g/mL gentamicins.Cell in tissue culture flasks humidification incubator in 37 ° of C at 5%CO ₂cultivate with in 95% air atmosphere, then gather in the crops, and with 5x10 ⁷the concentration of individual cell/mL is resuspended in phosphate buffered saline (PBS) (PBS), for being injected into mouse.HT29 cell derives from ATCC at first, and gained xenograft tumor subsequently by the continuous subcutaneous transplantation in athymic nude mice as being maintenance in body, implant for experiment afterwards.3.5x10 is injected by every mouse dorsal subcutaneous (S.C.) ⁶individual cell is inoculated LLC cell in female BAl BIc/c nude mouse (CharlesRiver, Hollister, CA) at 8-9 and allows that it grows as allograft age in week.3.5x10 is injected by every mouse back leg S.C. ⁶individual cell is at female athymic in 12 week age naked (nu/nu) mouse (HarlanSpragueDawley, Inc; Frederick, MD) middle inoculation HM7 cell, inject 1x10 by every mouse dorsal part S.C. ⁷individual cell is at 10-11 week female athymic in age naked (nu/nu) mouse (HarlanSpragueDawley, Inc; Federick, MD) middle inoculation H460 cell, at 11-12 week female athymic in age naked (nu/nu) mouse (HarlanSpragueDawley, Inc; Federick, MD) side in S.C. implant 1mm ³hT29 Tumor fragments.Anti-Bv8 antibody chimeric 2D3, mouse 3F1 and mouse 2B9 weekly twice with 10mg/kgi.p. administration, and humanization anti-Bv8 antibody 2G9 is once in a week with 30mg/kgi.p. administration.In contrast, we use anti-artemisiifolia monoclonal antibody, i.p., and 30 or 100mg/kg, weekly twice and anti-VEGF mAb B20-4.1.1, i.p., 5mg/kg, twice weekly.When the following time span after (HT29) is implanted in cell inoculation or tumour, start treatment: LLC is 7 hours, and HM7 is 8 days, and H460 is 11 days, and HT29 is 36 days.Measure tumour and body weight and implement general clinical observation for twice at least weekly during studying.Ellipsoid volume formula (0.5xLxWxW) is used to calculate gross tumor volume.In order to analyze in time from the gross tumor volume replicate measurement of same animals, use hybrid modeling way, and generating the tumor volume data (Pinheiroetal.nlme:linearandnonlinearmixedeffectsmodels of matching; 2009; VersionRpackageversion3.1-96).Depict Kaplan-Meier figure to show the per-cent of the animal stayed under study for action, as the function of time.As the survival (see Figure 41 and 43) that the process of single medicament and the mouse combined with VEGF antibody and humanization anti-Bv8 antibody causes the reduction of tumor growth in various tumour (see Figure 38-40 and 42) and extends.

embodiment 3: measure the humanization anti-Bv8 antibody blocking people Bv8 ability in conjunction with mouse 2G9 antibody competitive ELISA

Maxisorp384 orifice plate 1 μ g/ml parent mouse 2G9IgG1 antibody is spent the night in 4 ° of C bags in 50mM sodium carbonate buffer pH9.6 with 25 μ l/ holes.Plate derivative (PBS) pH7.4 of the phosphate buffered containing 0.05% polysorbate is cleaned, and closes with 80 μ l/ holes with the PBSpH7.4 containing 0.5%BSA, 10ppmProclin.In incubation at room temperature after 1 hour, clean plate.The humanization 2G9 antibody (0.11pM-180nM) of serial dilution and biotinylation people Bv8(final concentration 0.5ng/ml or 57pM in the PBSpH7.4 being added on containing 0.5%BSA, 0.05% Polysorbate 20 with 25 μ l/ holes) mixture.Incubation is after 2 hours, clean plate, and the streptavidin (GEHealthcare) adding horseradish peroxidase.Final incubation is after 30 minutes, clean plate, and adds substrate 3,3', 5,5'-tetramethyl benzidine (Kirkegaard & PerryLaboratories).Termination reaction is carried out by adding 1M phosphoric acid, and in MultiskanAscent readout instrument (ThermoScientific, Hudson, NH) upper reading 450nm absorbancy.For data analysis, use four parameter nonlinear regression curve fitting procedures to carry out matching titration curve, and determine IC50 concentration (KaleidaGraph, SynergySoftware, Reading, PA).

Result display humanization anti-Bv8 antibody h2G9.K4G1.v19, h2G9.K4G1.v52, h2G9.K4G1.v55, h2G9.K4G1.v73 have with h2G9.K4G1.v19H/v55L and compare the ability of larger blocking-up people Bv8 in conjunction with mouse 2G9 antibody with chimeric 2G9 with h2G9.K4G1.Polish anti-Bv8 antibody.See Figure 22.

Clearly will the complete income of all reference that present disclosure quotes be run through herein by addressing.

Although describe the present invention with reference to so-called specific embodiments, should be appreciated that and the present invention is not limited thereto class embodiment.In contrast, the invention is intended to cover the interior included various modification of spirit and scope and the equivalents of claims.

Run through the application, comprise claims, term " comprises " as what comprise, open transition word, it does not get rid of other, do not describe key element or method steps.

Claims

1. an anti-Bv8 antibody, it comprises light-chain variable domain and heavy chain variable domain, and wherein this antibody comprises:

(1) HVR-H1 shown in aminoacid sequence SEQIDNO:61;

(2) HVR-H2 shown in aminoacid sequence SEQIDNO:62;

(3) HVR-H3 shown in aminoacid sequence SEQIDNO:63;

(4) HVR-L1 shown in aminoacid sequence SEQIDNO:64;

(5) HVR-L2 shown in aminoacid sequence SEQIDNO:65; With

(6) HVR-L3 shown in aminoacid sequence SEQIDNO:66.

2. an anti-Bv8 antibody, it comprises light-chain variable domain and heavy chain variable domain, and wherein this antibody comprises:

(1) HVR-H1 shown in aminoacid sequence SEQIDNO:91;

(2) HVR-H2 shown in aminoacid sequence SEQIDNO:92;

(3) HVR-H3 shown in aminoacid sequence SEQIDNO:93;

(4) HVR-L1 shown in aminoacid sequence SEQIDNO:94;

(5) HVR-L2 shown in aminoacid sequence SEQIDNO:95; With

(6) HVR-L3 shown in aminoacid sequence SEQIDNO:96.

3. the anti-Bv8 antibody of claim 1, wherein this light-chain variable domain is as shown in SEQIDNO:7, and this heavy chain variable domain is as shown in SEQIDNO:8.

4. the anti-Bv8 antibody of claim 2, wherein this light-chain variable domain is as shown in SEQIDNO:11, and this heavy chain variable domain is as shown in SEQIDNO:12.

5. the anti-Bv8 antibody of any one of claim 1-4, wherein this anti-Bv8 antibody is for being selected from Fab, Fab ', F (ab ') ₂, Fv or scFv antibody fragment.

6. the anti-Bv8 antibody of any one of claim 1-4, wherein this anti-Bv8 antibody is to be less than the Kd value of 0.02nM in conjunction with people Bv8.

7. the anti-Bv8 antibody of claim 5, wherein this anti-Bv8 antibody is to be less than the Kd value of 0.02nM in conjunction with people Bv8.

8. the anti-Bv8 antibody of any one of claim 1-4, wherein the tightness degree of this anti-Bv8 antibodies people Bv8 is fitted together to 2G9 anti-Bv8 antibody height at least twice than mouse/people, and this mouse/people is fitted together to the anti-Bv8 antibody of 2G9 and comprises heavy chain variable domain shown in light-chain variable domain and SEQIDNO:2 shown in SEQIDNO:1.

9. the anti-Bv8 antibody of claim 5, wherein the tightness degree of this anti-Bv8 antibodies people Bv8 is fitted together to 2G9 anti-Bv8 antibody height at least twice than mouse/people, and this mouse/people is fitted together to the anti-Bv8 antibody of 2G9 and comprises heavy chain variable domain shown in light-chain variable domain and SEQIDNO:2 shown in SEQIDNO:1.

10. the nucleic acid of the antibody of any one of claim 1-9 of encoding.

11. carriers comprising the nucleic acid of claim 10.

The carrier of 12. claims 11, wherein this carrier is expression vector.

13. host cells comprising the carrier of claim 11 or 12.

14. compositions comprising the antibody of any one of claim 1-9.

The composition of 15. claims 14, wherein said composition comprises carrier.

The composition of 16. claims 14 or 15, it is pharmaceutical composition.

17. 1 kinds of methods for the preparation of anti-Bv8 antibody, described method comprises the carrier that (a) expresses claim 11 or 12 in Suitable host cells, and (b) reclaims this antibody.

The method of 18. claims 17, wherein this host cell is protokaryon.

The method of 19. claims 17, wherein this host cell is eucaryon.

20. the anti-Bv8 antibody of any one of claim 1-9 for the preparation for the treatment of colorectal carcinoma, lung cancer, carcinoma of the pancreas, or the purposes in the medicine of rhabdosarcoma.

21. the purposes of claim 20, wherein this treatment comprises the second medicine experimenter being used to significant quantity further, and wherein anti-Bv8 antibody is the first medicine.

The purposes of 22. claims 21, wherein this second medicine is another kind of antibody, chemotherapeutics, cytotoxic agent, antiangiogenic agent, immunosuppressor, prodrug, cytokine, cytokine antagonist, cytotoxic radiotherapy agent, reflunomide, antiemetic, cancer vaccine, pain killer or growth inhibitor.

The purposes of 23. claims 22, wherein this second medicine is antiangiogenic agent.

The purposes of 24. claims 23, wherein this antiangiogenic agent is VEGF antibody.

The purposes of 25. claims 24, wherein this VEGF antibody is rhuMAb-VEGF (bevacizumab).

The purposes of 26. any one of claim 21-25, wherein this second medicine was used before or after using anti-Bv8 antibody.

The purposes of 27. any one of claim 21-25, wherein this second medicine and anti-Bv8 antibody are used simultaneously.

The purposes of 28. claims 20, wherein this treatment comprises chemotherapeutics experimenter being used to significant quantity further.