ZA200603413B - Methods for enhancing stress tolerance in plants and methods thereof - Google Patents

Description

CROSS REFERENCE TO RELATED APPLICATIONS

This application claims bernefit under 35USC § 119(e) of United States provisional application Serial No. 60/506,717 filed 09/29/2003 and Serial No. 60/530453, filed D®ecember 17, 2003.

INCOMRPORATION OF SEQUENCE LISTING

Two copies of the sequermce listing (Seq. Listing Copy 1 and Seq. Listing «Copy 2) in a computer-readable form of the secyuence listing, all on CD-ROMs, each containing tine file named

CSP.ST25.txt, which is approxirmately 98 Mbytes (measured in MS-DOS) and waas created on "15 September 28, 2004, are hereby imncorporated by reference.

Field of the Invention

This invention relates to cold_, drought, salt, cold germination, heat, and other abmiotic stress 2@0 tolerance in plants and viral, fungal, bacterial and other abiotic stress tolerance in pl ants.

Specifically this invention relates to a method of increasing the biotic and abiotic stress tolerance of plants by expressing a cold shock protein(s) within the cells of said plant.

Background 2:5

Seed and fruit production are multi-billion dollar commercial industries andl primary sources of income for numerous. states in the United States and for many countries around the world, Commercially valuable s eeds include, for example, canola, cottonseeds and sunflower seeds, which are prized for the wegetable oil that can be pressed from the seed. The= seeds of =30 leguminous plants such as peas, beans, and lentils also are commercially valuable =as they are rich in proteins, with soybeans, for esxample, consisting of 40-45% protein and 18% fat=s and oils. In

Vv 2005/033318 PCCT/US2004/031856 addition, coffee is a valuable crop made from the dried and roasted seeds Of Coffea arabica plants, while chocolate is made from the= cacao seed or "bean." Similarly, rnany fruits and seeds are commercially valuable, including, for example, com, rice, wheat, barlesy and other cereals, nuts, legumes, tomatoes, and citrus fruits. For example, corn seeds are maade into many food s iteems or items used in cooking, such as —taco shells, corn oil, tortillas, corn flakes, corn meal, and many others. Corn is also used as raw material in many production proces ses, including but not li-mited to, feed and ethanol production.

Seed and fruit production are bosth limited inherently due to biotic and abiotic stress.

S-oybean (Glycine max), for instance, is a crop species that suffers from loss of seed germination during storage and fails to germinate wiken soil temperatures are cool (Zh=ang et al., Plant Soil 1 88: (1997). This is also true in corn and other plants of agronomic importance. Improvement oef abiotic stress tolerance in plants world be an agronomic advantage to Towers allowing imcreasing growth and/or germination imn cold, drought, flood, heat, UV stress, ozone increases, a_cid rain, pollution, salt stress, heavy metals, mineralized soils, and other abiotic stresses. Biotic stress, such as fungal and viral infectiomn, also cause large crop losses wor-ld wide.

Traditional breeding (crossing specific alleles of one genotype into another) has been umsed for centuries to increase biotic stress tolerance, abiotic stress toleramce, and yield. “I raditional breeding is limited inherengly to the limited number of alleless present in the parental plants. This in turn limits the amount of genetic variability that can be added in this manner.

Molecular biology has allowed the inventors of the instant invention to look far and wide for genes that will improve stress tolerances in plants. Our inventors sought to determine how other

Organisms react to and tolerate stressfuml conditions. The cold shock proteins are part of a system vased by bacteria and other organisms to survive cold and stressful conditJons. It was posited by tThe inventors that placing genes encodi ng the cold shock proteins, and proteins related to them, ito plants and expressing them would increase the cold, drought, heat, vwater, and other abiotic sstress tolerance of plants as well as furmgal, viral, and other biotic stress tolerance of plants. They also believe that using genes that are homologous to cold shock proteins. or have sequence ssimilarity, would also increase biotic and abiotic stress tolerance.

This invention is useful to farmers to limit their losses due to bio®tic and abiotic stress.

Summary of the invention

The preset invention provides a plant expressing a cold shock protein (Csp) in the cells of the plant. The expression of this csp leads to greater abiotic stress teolerance within said plant.

In one embodiment, a polynucleotide encoding a csp is expressed by a_n operably linked promoter that functions in plants, and a terminator that functions in plants.

More speczifically the invention provides a recombinant DNA rnolecule that comprises, in the 5° to 3° directzion, a first DNA polynucleotide that comprises a prommoter that functions in plants, operably 1 inked to a second DNA polynucleotide that encodes =a cold shock protein, operably linked to a 3’ transcription termination DNA polynucleotide providing a polyadenylation ssite. The first DNA polymcleotide is often advantageeously heterologous to the second DNA pol=ymcleotide. The invention also provides a recombinant DNA molecule having an intron inserted between the first DNA polynucleotide and the secornd DNA polynucleotide.

The invention alsso provides a recombinant DNA molecule where the ssecond DNA polynucleotide ercodes a protein comprising the motif in SEQ ID NO: 3. In specific embodiments of athe recombinant DNA of this invention the second DNA polynucleotide encodes a protein selected from the group consisting of (a) a protein —with an amino acid sequence of substantial identity teo an amino acid sequence of a cold :shock protein from gram positive bacteria, (b) a cold shock protein from Bacillus subtilis, (c) a homologsue of Bacillus subtilis cold shock protein B (CspB),. (d) a protein —with an amino acid sequence of substantial identity teo SEQ ID NO: 2, (e) a protein —with an amino acid sequence of substantial identity teo an amino acid sequence of a cold shock protein from a gram negative bacteria, (f) a protein «comprising a cold shock protein from Escherichia coli, (2) a homolozgue of Escherichia coli cold shock protein A (CspA)e, (h) a protein —with an amino acid sequence that has substantial idemntity to SEQ ID NO:1, (i) a cold shock protein from Agrobacterium tumefaciens, and

(i) & protein having an amino acid sequence of substantial identity to a_ny of SEQ ID NO: 5, ~7.,9, 11, 13, 15,17, 19, 21, 23, 25. 27, 29,31, 33, 35, 37,39, 41, 48, 45,47, 49, 51, 53, =s5, 57, 59, 61, 63, or 65.

The invention also provides a recombinarat DNA molecule wherein the pro>moter is selected from the group consisting of inducible promoters, constitutive promoters, temp ral-regulated promoteers, developmentally-regulated promoters, tissue-preferred promotes, cold enhanced promoteers, cold-specific promoters, stress enhanced promoters, stress specific promoters, drought inducib=1le promoters, water deficit inducible promoters, and tissue-specific promoters. "The invention also provides plant cells and plants containing in their genome recombinant

DNA nwlecules as described and the pro-pagules and progeny produced thaerefrom. Plant include, but are Tot limited to crop plants, monocots, and dicots. More specificallwy these could include soybeam, com, canola, rice, cotton, barlewy, oats, turf grasses, cotton, and wheat.

The invention also provides abio€ic stress-tolerant, transgenic plants that have been transfo-rmed with a recombinant DNA molecule that expresses a cold shock protein. Such plants and the=ir cells and propagules such as se<eds contain in their genome recombinant DNA molecules that expresses a cold shock protein. Such plants exhibit one or~ more of the following enhanc=ed properties: a higher growth ratee under conditions where cold temmperature would be limitinzg for growth for a non-transforme-d plant of the same species, (3) a higher growth rate under conditions where high temperature would be limiting for growth for a non-transformed pleant of the same species, (b) ahigher growth rate under conditions where water would be limit=ing for growth for a pon-transformed plant of the sane species, (c) ahigher growth rate under conditions where increased salts or iorms in the soil and/or water would be limiting for growsth of a non-transformed plant of the same species, (d) has a greater percentage of plants surviving after a cold shock thamn a non-transformed plant of the same species, (e) an increased yield when compared to a non-transformed plant of t-he same species, or (f) resistance to drought compared t-0 a nonrtransformed plant of the same species.

A metZbod of the invention comprises propagating plants of this invention, e.g. for the purpose of gemnerating seeds, by simply planting such seeds in scoil and allowing them fo grow e.g. under stre=ss constiions. More specifically, this invention pmrovides a method of producing= a plant that has enhanced tratit such as abiotic stress tolerance, inecreased yield or increased rook mass. The m ethod comprises the steps of a) inseerting into the genome of a plant cell or cells a recombinant DNA molecule comprising CDNA encoding a cold schock protein, b) obtaining a transformed plant cell or cells, ¢) reg=enerating plants from said transformed plant cell(=s); and d) selecting plants which exhibit the enhance trait.

In one aspectt of the invention plants are selected which exhibitt enhanced abiotic stress toleraance selected fron the group consisting of heat tolerance, salt toleramnce, drought tolerance, and survival aftemr cold shock.

The i _nvention also provided isolated proteins which aree at least 40% identity to a pro—tein having an anmino acid sequence selected from the group consis=ting of SEQ ID NOS: 5,7,9, A 1, 13, 15,17, 1 9,21, 23,25,27,29, 31, 33, 35, 37, 39, 41, 43, 458, 47, 49, 51, 53, 55, 57,59, 61. , 63, and 65. In ceertains apects comparable traits can be achieved bey substituting a pcold shock protein with a protein having higher homology than 40% identity, e.g. with a protein that is =xt least 50%, 6%Q%, 70 %, 80%, 90% or at least 95% identical to =a cold shock protein specifical 1y disclosed he—rein. Likewise, this invention also provides an isOlated nucleic acid encoding a =cold shock protei—n motif which hybridizes to a nucleic acids with a. DNA sequence selected from the group compmrising SEQ ID NOs: 4, 6,8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36,. 38, 40, 42, 44, 45-6, 48, 50, 52, 54, 56, 58, 60, 62, 90 and 92.

The Sinvention also specifically provides isolated nucle=ic acids encoding a cold shock=. protein whicsh has a DNA sequence that is substantially identiacal to a sequience in the group consisting o=f SEQ ID NOs: §, 7,9, 29, 31, 33,35, 37, 39, 41, 43,53, 55, ,57, 59, 61,63, and 65.

The - invention also provides propagules containing the= above recombinant DNA molecules, vovhen they are planted or otherwise caused to germinate, and a field of plants germinated ~from said propagules, e.g. where such propagule aare seeds.

The in-vention also provides a method of produmcing seed comprising planting ea seed of claim 59 in soil; b) harvesting seed from said plants; aned the seed produced therefrom.

A method of producing a transgenic plant is al.so provided, the method comprising the 5s steps of: (i) imtroducing into the genome of a plant cella DNA molecule comprising ea DNA polynucleotidiie at least 40% homologous to a protein “having an amino acid sequence selected from the grovap consisting of SEQ ID NOs:5,7,9,11L,13,15,17,19, 21, 23, 25,27, 29,31,33, 35,37, 39, 41,43, 45, 47,49, 51, 53, 55, 57, 59, 61, €33, and 65, or fragment, or cis eSement thereof, wherein said DNA polynucleotide is operably linked to a promoter and opersably linked to a 3 transcmription termination DNA polynucleotide 3 and (ii) selecting said transgermic plant cell; and (iii) regenerating said transgenic plant cell into a transgenic plant; also provided are the plants made “by this method.

Brief descri_ption of the drawings

Figure 1 shows a plasmid map of pMONS57396.

Figure 2 shows a plasmid map of pPMON23450. "Figure 3 shows a plasmid map of pMONS7397.

Figure 4- shows a plasmid map of pMONS57398.

Figure 5- shows a plasmid map of pMON23450.

Figure 68 shows a plasmid map of pMONS57399.

Figure 7° shows a plasmid map of pMON48421.

Figure 8 shows a plasmid map of pMONS56609.

Figure © shows a plasmid map of pMONS56610.

Figure E 0 shows a plasmid map of pMONT7360'A~.

Figure BR 1 shows a plasmid map of pMONG61322.

Figure M2 shows a plasmid map of pMON736083.

Figure M3 shows a plasmid map of pMONG651541.

Figure M4 shows a plasmid map of pMONT72472.

Figure W 5 shows a plasmid map of pENTRI.

~ WO 2005/033 318 PCT/US2004/031856

Figure 16 s"hows the growth pattern of plants expressirng the indicated gene=, and controls, showing that the genes introduced provide abiotic stre=ss tolerance.

Figure 17 sshows a plasmid map of pMON42916.

Figure 18 sshows a plasmid map of pMON73983.

Figure 19 sshows a plasmid map of pMON73984.

Detailed Desc=ription of Specific Embodiments

The in stant invention provides a plant with increzased tolerance to bio®tic and abiotic stress. The pl_ant provided has increased stress tolerance due to the expressiosn of cold shock protein (csp) Hn the cells of said plant. The invention provides examples of s:everal embodiments and contemplates other embodiments that are expected t-o function in the inv--ention.

The following definitions and methods are provieded to better define @the current invention and to guide @those of ordinary skill in the art in the prac#tice of the present in—wention. Unless otherwise notaed, terms are to be understood according tc conventional usage= by those of ordinary skill in the art. For example, definitions of common terr—ms used in molecular— biology and molecular genetics can be found in Lewin, Genes VII, Oxford University Preess and Cell Press,

New York, 2 000; Buchanan, et al., Biochemistry and Molecular Biology of - Plants, Courier

Companies, WUSA, 2000; Lodish, et al., Molecular Cell _Biology, W.H. Freerman and Co., New

York, 2000. Common terms in genetics can be found imm the prior references as well as Lynch, et al., Genetics and Analysis of Quantitative Traits, Sinauzer and Associates, S underland, MA, 1998; Hartwell, et al., Genetics: From Genes to Genon-aes, McGraw-Hill Companies, Boston,

MA, 2000; F-artl, et al., Genetics: Analysis of Genes ar=zd Genomes, Jones a-nd Bartlett

Publishers, S—udbury, MA, Strachan, ef al., Human Molezcular Genetics, Johmn Wiley and Sons,

New York, J 999.

The mnomenclature for DNA bases as set forth irn 37 CFR § 1.822 is used. The standard one- and three-letter nomenclature for amino acid resiclues is used.

Many agronomic traits can affect “yield”. For eexample, these could include, without limitation, pelant height, pod number, pod position on tIhe plant, number of “internodes, incidence of pod shatteer, grain size, efficiency of nodulation and nitrogen fixation, ef=ficiency of nutrient assimilation, resistance to biotic and abiotic stress, carbon assimilation, pl ant architecture, resistance to lodging, percent seed germination, seedling vigor, and juvenile traits.

For example, these could also include, without limitation, efficiency of germination (including germination in stressed conditions), growth rate of any or all plant parts (including growth rate in stressed conditions), ear number, seed number per ear, seed size, composition of seeed (starch, oil, protein), characteristics of seed fill. “Yield can be measured in may ways, these might include test weight, seed weight, seed number peer plant, seed weight per plant, seed number or weight per unit area (i.e. seeds, or weight of seexds, per acre), bushels per acre, tonness per acre, tons per acre, kilo per hectare.

Inan embodiment, a plant of the present invention exhitbits an enhanced trait ioe that is a component of yield. “Nucleic acid (sequence)” ox “polyrmcleotide (sequence)” refers teo single- or double- stranded DNA (deoxyribonucleic acid) or RNA (ribonucleic acid) of gencomic or synthetic origin,

i.e., a polymer of deoxyribonucleoti_de or ribonucleotide bases, respective=ly, read from the 5’

(upstream) end to the 3° (downstreeam) end.

The nucleic acid can represe=nt the sense or

1s complementary (antisense) strand.

“Native” refers to a naturally occurring (“wild-type”) nucleic aciad sequence.

“Heterologous” sequence re-fers to a sequence which originates from a foreign source or species or, if from the same source, is modified from its original form.

Foor example, a native promoter could be used to cause the transcription of a heterologous gene from the same or from a different species.

“Parts” of a plant include al parts or pieces of a plant including, Ebut not limited to, roots, shoots, leaves, stems, pollen, seeds, flowers, stamen, pistils, eggs, embry=os, petal, filaments, carpels (including stigma, ovary, aradstyle), cell(s) or any piece of the ab..ove.

“Propagule” includes all products of meiosis and mitosis, includimng but not limited to,

ass seed and parts of the plant able to peropogate a new plant.

For example, p-ropagule includes a shoot, root, or other plant part that Xs capable of growing into an entire pMant.

Propagule also includes grafts where one portion o fa plant is grafted to another portion ofa different plant (even one of a different species) to create a living organism.

Propagule also inc=ludes all plants and seeds produced by cloning or by bringing together meiotic products, or allowing meiotic products to come together to form an embryo or fertilized egg (naturally or with h—uman intervention).

An "isolated" nucleic acid sequence is substantially separated or gourified away from other nucleic acid sequences with vwhich the nucleic acid is normally associated in the cell of the organism in which the nucleic acid naturally occurs, i.¢., other chromoso=tnal or extrachromosomal DNA. The term embraces nucleic acids that are biockaemically purified so as s to substantially remove contaminating nucleic acids and other cellular components. The term also embraces recombinant nucleic acids and chemically synthesized nucleic acids. “Identity” or “identical” as used herein, when referring to comparisons between protein(s) or nucleic acid(s) means 98% or greater identity.

A first nucleic acid omr protein sequence displays “substantial idertity™ or “substantial similarity” to a reference nuc=leic acid sequence or protein if, when optinmally aligned (with appropriate nucleotide or amino acid insertions or deletions totaling less than 20 percent of the reference sequence over the wvindow of comparison) with the other nucleic acid (or its complementary strand) or preotein, there is at least about 60% nucleotide sequence equivalence, even better would be 70%, pareferably at least about 80% equivalence, nmare preferably at least about 85% equivalence, and most preferably at least about 90% equivalence over a comparison window of at least 20 nucleotide or amino acid positions, preferably at least 50 nucleotide or amino acid positions, more pereferably at least 100 nucleotide or amino amcid positions, and most preferably over the entire len=gth of the first nucleic acid or protein. Optimal alignment of sequences for aligning a coormparison window may be conducted by the 1_ocal homology algorithms), preferably by ceomputerized implementations of these algomrithms (which can be found in, for example, Wisconsin Genetics Software Package Release 7-0, Genetics Computer

Group, 575 Science Dr., Maclison, WI). The reference nucleic acid may be a full-length molecule or a portion of a lomger molecule. Alternatively, two nucleic acids have substantial identity if one hybridizes to the other under stringent conditions. Appro—priate hybridization conditions can be determinecl empirically, or can be estimated based, for example, on the relative

G+C content of the probe anad the number of mismatches between the probe and target sequence, if known. Hybridization conclitions can be adjusted as desired by varyingz, for example, the temperature of hybridizing or the salt concentration (Sambrook et al., M=olecular Cloning: A

Laboratory Manual, 2 Edit-ion, Cold Spring Harbor Press, 1989).

A first nucleic acid sesquence is "operably linked” with a second anucleic acid sequence when the sequences are so arranged that the first nucleic acid sequence affe=cts the function of the second nucleic acid sequence. Preferably, the two sequences are part of a single contiguous nucleic acid molecule and more preferably are adacent. For example, a pr omoter is operably linked to a gene if the promoter regulates or mediates transcription of the g=ene in a cell. For s example, a transcriptional termination region (terminator) is operably linke=d to a gene when said terminator leads to a RNA polymerase ending a transcript containing said ggene at or near the terminator. For example, an exahancer is often not adjacent to the promoter that it is exhibiting its effect on, but is generally in fme same nucleic acid molecule. = A "recombinant" nuclesic acid or DNA, or RNA molecule is made Eby an artificial combination of two otherwise separated segments of sequence, e.g., by cheemical synthesis or by the manipulation of isolated segments of nucleic acids by genetic engineering techniques.

Techniques for nucleic-acid manipulation are well-known (see, e.g., Sambrook et al., Molecular

Cloning: A Laboratory Manuel, 2* Edition, Cold Spring Harbor Press, 15389). Methods for chemical synthesis of nucleic acids are discussed, for example, in Beaucagge and Carruthers,

Tetra. Letts. 22:1859-1862, 1981, and Matteucci et al,, J. Am. Chem. Soc_. 103:3185, 1981.

Chemical synthesis of nucleic acids can be performed, for example, on co-mmercial automated oligonucleotide synthesizers. “Expression” of a gene refers to the transcription of a gene to produce the corresponding mRNA and translation of this mRNA to produce the corresponding gene gproduct, i.e., a peptide, polypeptide, or protein. Gene: expression is controlled or modulated by re=gulatory elements including 5? regulatory elememts such as promoters.

The terms “recombinant DNA construct”, “recombinant vector”, “expression vector” or “expression cassette” refer to any agent suchasa plasmid, cosmid, virus, . BAC (bacterial artificial chromosome), autonomously replicating sequence, phage, or linezar or circular single- stranded or double-stranded IDNA or RNA nucleotide sequence, derived from any source, capable of genomic integration or autonomous replication, comprising 2a TONA molecule in which one or more DNA sequences Thave been linked in a functionally operative manner. “Complementary” refers to the natural association of nucleic acid sequences by base- pairing. Complementarity between two single-stranded molecules may bee partial, if only some of the nucleic acids pair are com plementary; or complete, if all bases pair aree complementary. The degree of comple-mmentarity affects the efficiency and stre=ngth of hybridization and amplification reactions. “Homology” refers to the level of similarity between nucleic acid or armnino acid sequences in terms of nucleotide or amino acid identity or similarity, respectively, ie., sequence similarity or idertity. Homology, homologue, and homologous also refers to he concept of similar functionam] properties among different nucleic acids or proteins. HomoRogues include genes that are orthologous and paralogous. Homologuess can be determined byw using the coding sequence for a geere, disclosed herein or found in appropriate database (such ams that at NCBI or others) in one or~ more of the following ways. For a protien sequence, the seqiences should be compared using algorithms (for instance see section on “identity” and “substamntial identity”). For nucleotide sequences the sequence of one DNA molecuale can be compared tos the sequence of a known or putati=ve homologue in much the same way. F-lomologues are at leasst 20% identical, more preferably - 30%, more preferably 40%, more preferably 50% identical, rmore preferably 60%, more prefeerably 70%, more preferably 80%, morse preferably 88%, mor-e preferably 92%, most preferably 95%, across any substantial (25 nucleostide or amino acid, moore preferably 50 nucleotide or anmino acid, more preferably 100 nucleotide or amino acid, or nenost preferably the entire length of the shorter sequence) region of the moMecule (DNA, RNA, or protein molecule).

A lternat=ively, two sequences, or DNA or RNA molecules that encode, or can encode, amino acid seq ences, are homologous, or homologuess, or encode homologous sequences, if the two sequences, or the complement of one or both sequ_ences, hybridize to eacsh other under stringent conditions nad exhibit similar function. Thus if one were to determ=ine whether two protein sequenc=es were homologues, one would both Ao the computer exerci ses described herein, and create dege=nerate coding sequences of all possibles nucleic acid sequence=s that could encode the proteins ancl determine whether they could hybridize under stringent cons ditions. Appropriate stringency concitions which promote DNA hytridizati on, for example, 6.0 xx sodium chloride/sodiunm citrate (SSC) at about 45°C, followed by a wash of 2.0 x SSSC at 50°C, are known to those skilled in the art or can be found in Ctesrrent Protocols in Moolecular Biology,

John Wiley & SSons, N.Y. (1989), 6.3.1-6.3.6. For exaample, the salt concentration in the wash step can be selected from a low stringency of about 2.80 x SSC at 50°C to the= high stringency of about0.2 x SSC at 50°C. In addition, the temperature= in the wash step can Boe increased from low stringency conditions at room temperature, about 22°C, to high stringency conditions at about 65°«C.. Both temperature and salt may be varied, or either the temperature or the salt concentration may be held constant while the othesr variable is changed. Inone preferred embodiment, a nucleic acid encoding a protein de=scribed in the present invention will specificalaly hybridize to one or more of the nucleic acid molecules or complements thereof or fragments of either under highly stringent conditions, for example at about 2.0 x SSC and abowut 65°C. Thne hybridization of the probe to the targe=t DNA molecule can be detected by any nurrxber of metho-ds known to those skilled in the art, these can include, but are not limited to, fluorescent tags, rad iioactive tags, antibody based tags, and cBhemiluminescent tags. s¢ Cold shock protein(s)” (Csp(s) or CSP(ss)) are proteins that have greater than 40% identity to Escherichia coli CspA protein (SEQ MD NO: 1) or Bacillus subtilis CspB protein (SEQ TDW NO: 2), or, alternatively, cold shock preoteins can be found by using the conserved domain sas determined in the literature. For example, as used herein a cold shock protein is 40% identical, more preferably 50% identical, more preferably 60% identical, more preferably 702% identical, more preferably 80% identical, more oreferably 90% identical, more preferably 954 identica™} to E. coli CspA or B. subtilis CspB across the entire length of E. coli CspA or B. subtilis

CspB. SSeveral databases are available that allow one skilled in the art to determine whether a new or e=xisting protein contains a cold shock domain or is a cold shock protein, from Genbank to protein eclatabases designed to allow the determi-nation of protein relationships, and/or find re=lated proteinss. Included herein within the definition =are all known cold shock proteins, including but opt linmited to CspA, CspB, CspC, CspD, CspEE, CspF, CspG, CspH, and Cspl (U.S. Patent 6,610,533) from Escherichia coli. ~The conserved cold shock domain is sheown in SEQ ID NO: 3 ([FY1-G-F-1-x(6,7)-[[ER]- [LIVM_1-F _x-H-x-[STKR]-x-[LIVMFY]) (Pros ite motif PS00352; Bucher and Bairoch, (In) ISMB-S4; Proceedings 2nd International Confesrence on Intelligent Systerns for Molecular

Biology, Altman R., BrutlagD., Karp P., Lath—op R., Searls D., Eds., pp53-61, AAAIPress,

Menlo Park, 1994; Hofmann et al., Nucleic Ac=ids Res. 27:215, 1999). Alternatively, cold shock protein_s can be found using the Sprint database (a relational protein fingerprint database) (Attwowod et al., Nucleic Acids Res. 28(1):225, 2000; Attwood, et al., Nucleic Acids Research, 30(1), in press, 2002). Alternatively, cold shocek proteins can be found using a matrix based descriptiosn, or Pfam. Pfam is a large collection of multiple sequence alignments and hidden

Markov nnyodels covering many common prote in domains (Bateman et al. Nucleic Acids

Research 28:263, 2000). At this writing (November 2001; Pfam release 6) there are 3071 families. Cold shock proteins are included as WPF0031 3, The species trees showing the distribution s of cold sMhock proteins as determined in the P£7am database. “aC old shock proteins” as used herein also include, but are not limited to, any protein that is found in a search, using a Cold shock prote-in as a query sequence, o=f a database using the “Blink” «(Blast Link) function that can be fournd at the National Center for Biotechonology

Information. “Blink” is a quick search function used to find proteins with similar sequences.

This deSinition of “cold shock protein” or “cold shock domain” is in acidition to those used above, and does not replace said definition. «Cold shock proteins or proteins containing cold shock d-omains include, but are not limited to, all currently known pro-teins in public and private databasees as well as those that have yet to be= discovered that are similar enough to the claimed proteinss (for example, E. coli CspA and B. s=btilis CspB) to be “hits” under the standard blast search settings currently used in Blast Link Cas of November 1, 2001) . As of this writing Blast 2 is being run, and Blast Link (“Blink”) is runaning the default paramete=rs for protein-protein blast searche=s. As of this writing we believe the d_efault settings used in Blank are as follows; a

BLOSU M62 matrix is being run, using the «<r database, CD search is selected, as are compo: sition based statistics, with the comp#exity selected as “low cosmplexity”, expect is 10, witha word size of 3, the gap costs are; existence 11, and extension 11. The list in Table 1 shows the firsst 200 hits for E. coli CspA using these standard settings, but wwe do not limit our claim to the first 200 hits. One skilled in the art would note that under these fairly stringent criteria 167 proteirs of bacterial origin are found, but aliso 28 Metazoan and 5 pl=ant proteins. These proteins includ~e a broad range of proteins that, do to their homology to CspA., would be expected by the inventors to function in the present invention. This is by no means am all inclusive list, and other proteimns would be expected to function in tThe present invention.

Table 20. Some cold shock proteinss and proteins containing a cold shock domain found by similarity to E. Coli CspA. This list wass compiled using the stanedard Blast Link settings at the

National Center for Biotechnology informzation. The Genbank ID ard name of each protein is shown. Note: Due to the way proteins are named, some proteins and sequences will have several. entries, as proteins, cDNAs, alleles, etc. Genbank ID can bee considered to be specific identifiers of each entry. Entries are in the approximate order of higheest to lowest identity, in comparison with thes query sequence.

ID ?

Sinorhizobium ) Sinorhizobium 10003 opB Myxocooows wants) 69115 [COLD SHOCK-LICEPROTENCOSPD 151 50913 JAGR _C_3315p [Agrobacterium bmmefaciens] ___________

Sinorhizobium 7755447 [0G 17334 gene product [DrosophiMamelonogaster] 3850772 Jrold shock protein A [Lastococouss actis]

Bacillus subtilis (B. subtilis) CspB is a protein that accumulates in response to old shock (Willimsky, et al. Journal of Bacteriology 174:63226 (1992). It has homology to CspA from

E.coli (see Table I) and contains a single stranded nucleic acid binding domain (Lopez, et al., The

Journal of Biological Chemistry 276:15511 (2001)). Using the same bwasic Blast search at NCBI. (Blink) the following proteins are designated as “hits”. The number off hits shown here is limited to 200, but many other proteins- would be expected function in the invwention. s Table 21. Some cold shock proteins and proteins containing ¢ old shock domains found searching with B. subtilis CspE3. This list was compiled using the staradard Blast Link (Blink) settings at the National Center for Biotechnology Information. The Genbank ID and name of each protein is shown. Note: [Due to the way proteins are named, some proteins and sequences will have several entries, as proteins, cDNAs, alleles, etc. Genbank ID can be considered to be specific identifiers of each entry. Entries are in the approximate ordesr of highest to lowest identity to the query sequence —

ID # 1421212]Major Cold Shock Protein (Cspb) [1405476(CspD protein [Bacillus cereus] [ 729217|COLD SHOCK PROTEIN CSPB _456240major cold shock gorotein (CspB) {Sporosarcina globispora] [1256629cold-shock proteira [Bacillus subtilis] —7ago0Bod shock proterm [ 456238(cold shock proteira (Bacillus subtilis] [12054788cold shock protelr (CspLB) [Listeria monocytogenes] ajor cold-shock protein homolog CspB [Listeria monocyto-genes] 1405472|CspB protein [Bacillus cereus] 8101860major cold shock protein CspA [Staphylococcus aureus) [ 16411332similar to_cold shock protein [Listeria monocytogenes] [—10176234fcold-shock proteim [Bacillus halodurans] [ 2493766COLD SHOCK-LL KE PROTEIN CSPLA (CSPL) 1001878iCspA protein [Listeria monocytogenes) 1405470[CspA protein [Bacillus cereus] [1405474[CspC protein [Ba cillus cereus] 13623066iputative cold shock protein [Streptococcus pyogenes M1 GSAS] [ 729220COLD SHOCK P> ROTEIN CSPC 2226349CspC [Staphylococcus aureus) 9968446Kcold shock protein [Lactobacillus plantarum) 1402739major cold-shocks protein [Bacillus subtilis} 3892590k0ld shack protein E [Lactococcus lactis} 2226347|CspB [Staphylococcus aureus) 3850776(cold shock protein D [Lactococcus lactis] 140274 1major cold-shocl protein [Bacillus subtilis] 15978774jcold shock protein [Yersinia pestis]

iar hock fie pole [Steppes nodose] eesti sho ke pro [Streptomyces ygroscopousl ——eessreod shook proloin [Lactoocseue ects] — Sao choc ike profs [Esclherichiacoll

— 57330 shock proloin [Sreptorryces coelicolor AS]

— SeE7576kid shook DNA-binding domain protein [Vibrio choersel —C75T0Thisjor Cold Shook Protein 7.4 (Capa (Cs 7.4]) Of (Escherichia Cold —— 72 fmalor cold shock protein cmph -Escherichiacol ——3537558imalor cold shock protein [ESnierococcus feecalsl — 2475768jmajor cold-shock protein {Alroooccus tutews] 740275 {mejor colo shock protein [ESeclls cereus) 73807 3bold shock doman family rolein [Neisseria meningtde Mss] ——5557243mall cold-shock prolein MAycobecterum leprae) —5T05040kepA [Mycobacterium ube roulosls FO7RYl —375745putalive transcriptional reg ulator [Neisseria meningitis 22401] —3348054jc0d shack prolen CspB [Wersina enterocolitica] —1573081kold acclimation protein B Pseudomonasfrag]

eo haeiog of SmimEonela cold shock protein (Escherichia col O67 7 EDLOSS]

TT EE —— ata: coH shock prolen [Pedocosousportosaoeusl

Ey rT E—— ora ok proton (Steplomycss coslloolo ASAT bah chodk dormain potsin [Sreplomyces coaldor ABEL ers That Bamonolibphmurum) 553191 agor cad shook prot [Laciocooous ols subsp lectsl —e5033350i shook protein [Samonelia enlerica subsp. enterica serovar Tyo 167 bold hod fie poten Slgmateleaurantacl — 74285000 shook ke poten Cspb. Escherchiacoll sora Fasourestamaocidal —enolsAhowacanthuel —iTsoeriiemb Pasteurelamitoodel — 9507 hold shack proton Allactococousleee] —Gssce ojo shociclike proton CepD Vbriocholerasl {4c Toimajor od shock proieh [Bacilvs abropheeus]

— re de pen Eee ee —— es Ta0LD SHOCKIRE PROTENG=SPD

TS 40LD SHOGKLUIKEPROTEN C SPD G80) meliloti 3821925major cold shock protein [Streptamcoccus thermophilus} aretha cold shock protein [Siepicococous dysgalactiae] old shock protein B [Streptomyces coelicolor A3(2)] ethics rich protein 2 Arebidopesisthalana adooRPS Netra geste] oga0kap Miycobeciorum mberoviomBAER_____

Teor shock protein Mesorhizobium loll — wena RheommepNoRZSl —Si7e7e0d shook protein (Mesorhizebimumio — Terie Sinomizbummeniotl

Sinorhizobium meliloti ) 452317 Tputalive cold shock protein [Sinomizoblummeliol] — ried Renopis laevis ____________ eliloti

RANSCRIPTION FACTOR) ( MRNP4 —75157349AGR_C_ 4003p [Agrobacterumn umefecens] —— 7455371 box protein [Dugesiajeponicsl_______________

[ 15306095hypothetical protein XP_0530828 [Homo sapiens) ete Song ctor [us musousl

IDNA

BINDING PROTEIN NF-GMsB

ST I eto pole [Cassese] farsa Thibpk murine homologue Ms muscusl

BL TT I

—SSosaoNA binding pron A [owe sapere] ——eRaRvBsRafusrovegousk ——&7 25 shuciesss sensitive elemen-Chindng proton] [lomosaplens] —— 530 chuciease sensitive clemen-thindigprotein {human (CCAAT-BINDING TRAN SCRIPTION FACTOR | SUBUNIT A) (CBF-A) (ENHIANCER

FACTOR | SUBUNIT A)

EF1-A) (DNA-BINDING P ROTEIN B) (DBPB

CSPs are a group of proteins that may or not be increased in amount when thme temperature is lowered or other stress is applied. In fact, in the best studied organism with respect to the cold shock proteins, E. coli, some cold shock proteins are constitutively expre=ssed while others are induced by cold, still others seem to be specific for specific stresses and/cor growth conditions or stages. A review of thilis is Yamanaka, et al., Molecular Microbiology, 27:247

(1998). In this review Yamanal=ca and colleagues detail how the maine cold shock proteins in E. coli (CspA through Cspl) are expressed. CspA, CspB, and CspG are cold inducible. CspD is induced at the stationary phase of the cell cycle and during sterv-ation. CspC and E have been implicated in cell division.

CspA is the major cold. shock protein from [Escherichia «coli (E. coli) (SEQ ID NO:D).

CspA is also called Major Colad Shock Protein 7.4. CspA is highly induced in response to cold shock (Goldstein, etal., Proceedings of the National Academy ©f Science (USA) 87:283 (1990).

In some conditions of slower growth, ribosomes are slowed due to RNA or DNA secondary structure formation, and this nay act as a signal for the increased synthesis of CSPs in their native organism. CSPs bind tos ssDNA and RNA under in-vitro conditions (Phadtare, et al.,

Molecular Microbiology 33:1€04 (1999). CSPs are thought to bind to RNA in a relatively non-— specific manner during translamtion and prevent secondary structure formation and stabilize the

RNA (this function is sometinmes referred as an RNA chaperone). The ribosome can then easily™ displace the CSPs and initiate translation on a linear RNA tempplate. We believe that the presermt 1S invention might involve the single stranded nucleic acid bindirg function of these proteins, ancl this function can come from amny cold shock protein or protein containing a cold shock domain, which includes, for example, prokaryotic cold shock proteins, «<cukaryotic Y-Box containing genes, some glycine rich proteins (GRP), and other proteins cosntaining the cold shock domain

These proteins include, but are not limited to, those shown in Figure 4, Trends in Biochemical

Science, 23(8):289 (1998) (paper included, herein incorporateci by reference). This figure clear—ly shows the evolutionary relationship between these proteins. The origin of these proteins likely precedes the divergence of meodern day bacteria and eukaryote-s, and it has been postulated that these proteins may have been. present at the advent of single cell evolution, 3.5 billion years ag=o.

We have selected two proteirms to transform into plants as exarmples, as shown in the figure cite=d 2-5 above these proteins are more greatly divergent from each otheer than from many of their eukaryotic counterparts. We expect that the ectopic expressior of these proteins may improve tolerance to biotic and abiotic stresses which could include bu-t are not limited to the growth, vigor, yield, and health of plasnts under a variety of stressful conditions that may include cold, drought, salt stress, heat, survival after cold shock, fungal infection, viral infection, microbial 3e0 infection, and cold germinatieon.

Anot her possible explanation for the increased growth rate Of plants under stress could be the elicitation of pathogen-associated molecular patterns (PAMP) perovided by the expression of

CSPs. In this model a plant would develop a PAMP response that wwould elicit a plant response somewhat 1iTke systemic acquired resistance (SAR) (much like SARS. works for biotic stresses) as the plant wo=uld be “prepared” for the stress prior to its application. For this model to work the plant must bee signaled that the CSP is present, this mechanism may have recently been provided through a pl=ant receptor that binds CSP (Felix, et al, Journal of Biological Chemistry 278(8):6201.-8 (2003)). This mechanism would mean that any genes that bound a receptor which elicited a PA MP-type response would function in the invention. Elficitation of PAMP-type responses hzas generally been studied for biotic stresses, and has oftzen been elicited through exogenous administration of agents. Herein we could be eliciting the PAMP-type response to the

CSP produc -ed from the CSP transgene. The transgene transformec] into a plant cell as part of a recombinant DNA construct, through a particle gun or agrobacterivaim mediated transformation.

This in turn could be creating a systemic acquired resistance type r-esponse in the plant, in turn increasing reesistance to abiotic stress. This response could work imn both monocots and dicots, including buat not limited to com, soybean, wheat, rice, Arabidopsis, canola, and cotton. If the above PAMP method is the mode of action for the CSPs, then the ®CSP might be expected to provide biotic stress protection as well as abiotic stress protection. None of these mechanisms are meant toe be limiting and one or both, or myriad others, could bee involved in the phenotype manifested.

MF2®=, a Csp-like protein from Bacillus thuringensis, has beeen purported to give some protection aggainst viral infection in a plant. United States Patent 6,528,480 shows this tolerance to biotic stress via rubbing the leaves of a plant with an extract conatsaining the protein and infecting thes plant with a virus. They contemplate, but do not create, transgenic plants therein. “Nom-transformed plant of the same species” is meant to bes inclusive of all plants of the same specie- s as a transformed plant. In one embodiment the transfformed plants is of the same species and strain as the transformed plant. In another embodiment the plant is as identical as possible to t-he transformed plant.

The ~*cold shock domain” (CSD) is a protein sequence that is homologous to the cold shock proteins. For the purposes of this invention, a cold shock domain containing protein is a

¢ <cold shock protein”. Greater than 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 98% amino acid #& dentity is seen between E. coli €CspA or B. subtilis CspB and the cold= shock domains of cold shock domain containing proteims (Wistow, Nature 344:823 (1990); a’ amanaka, et al., Mol.

Micro., 27:247, specifically see Figure 1B in the Yamanaka reference ; Graumann, et al. TIBS 223:286).

As used herein “yeast” regularly refers to Saccharomyces cere=vissige but could also include Schizosacchoramyces prombe and other varieties (from the genus Pichia, for example). «Com refers to Zea Mays and all species and varieties that can be bred with it. “Wheat” refers to all of Triticum aestivum varieties including but not limited to spring, winter, and all facultative wheat varieties. “Wheat” inclucles any other wheat species, including= but not limited to durum wheat (Triticum durum), spelt CTriti cum spelta), empmet (Triticum diccoccum), and wild wheat (Triticum monococcum). “Wheat” also includes any species that can “be bred with any of the aforementioned wheat species znd offspring of said crosses (includinag triticale, a hybrid of wheat and rye). “Soybeans” refers to Glycine max or Glycine soja and any Species or variety that can be bred with them. “Rice” refers ®o Oryza sativa and any species or variety that can be bred with it. “Barley” refers to Hordeum vu#gare and any species or variety that can be bred with it. “Oats” : refers to Avena sativa and any =species or variety that can be bred withh it. “Canola” is a coined pame recently given to seed, oi 1, and meal produced by genetically n—yodified rapeseed plants, oilseed rape (Brassica napus L .) and turnip rape (B. campestris L), h_erein canola includes all rapeseed plants and organisms that can be bred with them. E. coli aned Escherichia coli as used herein includes organisms of thae Escherichia coli species and all stramins of that this organism; i.e,

E. coli K12. E. coli and Eschep-ichict coli as used herein can also includes any organism that caan : conjugate with any E. coli strain when one is an F* or Hf strain, and... the other is not. B. subtilis and Bacillus subtilis refers to a_1l organism of the genus Bacillus, spe-cies subtilis.

Agrobacterium tumifaciens as ~used herein includes all strains and tygpes of this species. “Turf grasses” include all species ancl strains of grass ever planted, or that «could be planted, to produce a turf, including but not limited to; a lawn, a field for playing a game= (i.e. football, baseball, or- soccer), and all areas of a golf «course (i.c. tee, fairway, green, rough, efc.). “Cotton” refers to all] plants in the genus Gossypium and all plants that can be bred with thmem.

“Heat tolerance” is meant herein as a measure cf a plants ability to grow undeer conditions where heat, or warmer temperature, would detrimental ly affect the growth, vigor, yie=ld, size, of the a polant of the same species. Heat tolerant plants greow better under conditions of “heat stress than mmon heat tolerant plants of the same species. “Salt tolerance” refers to the ability of some pl=ants to grow under osmotic stsress, or stress causee by salts or ions in the water and soil. For exam ple, a plant with increased growth rate, comp=ared to a plant of the same species and/or variety, when watered with a liquid, or planted in a media, containing a mix of water and ions that detrirmentally affect the growth of eanother plant of the= same species would be said to be salt tolerant. Some transformed plants have a greater tolerammce for these types of conditions than non-transformed plants of the same species and strain...

All numbers used herein should be modified bey the term “about”, about mes that the numboer can vary, in either direction, by up to 10 percent and still retain the same meeaning. For exam_yple, a 1 M solution should include all solutions Of that type less than, and inclaading, 1.1 M and nmore than 0.9 M. For example, a percentage can zalso be modified, 10% is incliasive of all perce=ntages from 9% to 11%. Terms defined by the adjective “exactly” are not defi—med by the term ~“‘about”.

A “glycine rich protein” is defined as a proteir in a eukaryote that is, or has substantial identity with, or is a homologue of, a protein containi-ng a cold shock domain. “Survival after cold shock” is defined as the ability of a plant to continue gr—owth fora signizficant period of time after being placed at a temperature below that normally exmicountered by a plamnt of that species at that growth stage. It should t>e noted that some plants, evemn those of the same : species, have been selected for growth under co-1d conditions. The inbred Wigzor strain of corn - can tolerate cold conditions and has a significan®tly higher survival rate when polaced in those conditions than most commercial lines sold in the U.SS. Wigor is sold commercially= in Poland.

Thus - cold tolerance for transgenic plants must be conmpared within plants of the sarzme strain at the s=ame relative age, as well as plants of the same species, to gain meaningful scie=ntific data.

Plant=s would then be scored immediately, or some day(s) or week(s) later to detern—ine their viabi™ lity, growth rate, and other phenotypes after the sshock.

“Drought” or “water would be limiting for growth” is defined as a perfiod of dryness that, ~especially when prolonged, can cause damage to crops or prevent their succes-sful growth. Again different plants of the same species , and those of different strains of the same species, may have different tolerance for drought, drymess, and/or lack of water. In the laborator=sy drought can be simulated by giving plants 95% or Less water than a control plant and looking for differences in vigor, growth, size, root length, ancl myriad other physiologic and physical meeasures. Drought can also be be simulated in the fieled by watering some plants, but not others, and comparing their growth rate, especially where wate is severely limited for the growth of that —plant.

Abiotic stress tolerance inc Judes, but is not limited to, increased yielda, growth, biomass, health, or other measure that indicates tolerance to a stress which includes bumt is not limited to heat stress, salt stress, cold stress (including cold stress during germination), water stress (including but not limited to drougtht stress), nitrogen stress (including high aand low nitrogen).

Biotic stress tolerance incliades, but is not limited to, increased yield, growth, biomass, health, or other measure that indicates tolerance to a stress which includes buat is not limited to fungal infection, bacterial infectiox, and viral infection of a plant.

Certain of the gene sequences disclosed as part of the invention are b=acterial in origin, for example, certain prokaryotic cold shock proteins. It is known to one skilled i—n the art that unmodified bacterial genes are sormetimes poorly expressed in transgenic plamnt cells. Plant codon usage more closely resembles that of humans and other higher organisms thaan unicellular organisms, such as bacteria. Several reports have disclosed methods for improving expression of recombinant genes in plants. These reports disclose various methods for engTincering coding sequences to represent sequences which are more efficiently translated based on plant codon frequency tables, improvements in. codon third base position bias, using recosmbinant sequences which avoid suspect polyadenylati on or A/T rich domains or intron splicing «consensus sequences. While these methods for synthetic gene construction are notable, the inventors have contemplated creating synthetic genes for cold shock proteins or proteins comtaining cold shock domains according to the method of Brown et al. (US Pat. No. 5,689,052 19997, which is herein incorporated in its entirety by reference) and/or by the above cited, as well ass other methods.

Thus, the present invention provides a method for preparing synthetic plant genes express in planta a desired protein product. Briefly, according to Brown et al., the freq uency of rare and semi-rare monocotyledonous codons in a pedlymucleotide sequence encodimng a desired protein are reduced and replaced with more preferred monocotyledonous codons. En”hanced accumulation of a desired polypeptide encoded by a modifie=d polynucleotide sequence in & monocotyledonous plant is the result of increasing the frequency of preferred codons by analyerzing the coding =S sequence in successive six nucleotide fragments and altering the sequence= based on the frequency of appearance of the six-mers as to the frequency of appearance of the rar-est 284, 484, and 664 six-tners in monocotyledonous plants. Fur-thermore, Brown et al. disclose= the enhanced expression of a recombinant gene by applying the method for reducing th-e frequency of rare codons with methods for reducing the occiarrence of polyadenylation sigrmals and intron splice 1 © sites in the nucleotide sequence, removing self-complementary sequencess in the nucleotide sequence and replacing such sequences wisth ponself.complementary nucHeotides while maintaining a structural gene encoding the polypeptide, and reducing the frequency of occurrence of 5-CG-3' dinucleotide pairs in the nucleotide sequence. These steps aree performed sequentially and have a cumulative effect resulting in a nucleotide sequence containing a preferential 1 5 utilization of the more-preferred monocotyledonous codons for monocot®yledonous plants for a majority of the amino acids present in the edesired polypeptide. Specifica:1ly all the protein mentioned herein are contemplated to be nmade into synthetic genes as disscussed above, or using similar methods, including but not limited to Eschirichia coli CspA and Bacillus subtilis CspB.

The work described herein has identified methods of potentiating in planta expression of cold shock proteins and proteins containin_g cold shock domains, which ray confer resistance to many plant stresses, which can include bu are not limited to cold, heat, Clrought, salt, and other stresses, or stress related phenotypes (cold . germination, survival after cold stress, and other abiotic stresses) when ectopically expresse=d after incorporation into the rmuclear, plastid, or chloroplast genome of susceptible plants. U. S. Patent 5,500,365 (specifically incorporated herein by reference) describes a method fomr synthesizing plant genes to o~ptimize the expression level of the protein for which the synthesizzed gene encodes. This methoed relates to the modification of the structural gene sequeneces of the exogenous transgene=, to make them more “plant-like” and therefore more likely to b-e translated and expressed by t=he plant, monocot or dicot. However, the method as disclosed £n U. S. Patent 5,689,052 provides for enhanced 20 expression of transgenes, preferably in mo=nocotyledonous plants.

In developing thes nucleic acid constructs of this invention, the - various components of the construct or fragments thereof will normally be inserted into 2 convenient cloning vector, e.g, a plasmid that is capable of replication in a bacterial host, e.g., E. coli. Numerous vectors exist that have been described in the literature, many of which are commerecially available. After each cloning, the cloning vecstor with the desired insert may be isolated ancl subjected to further manipulation, such as restriction digestion, insertion of new fragment=s or nucleotides, ligation, deletion, mutation, resection, etc. so as to tailor the components of thes desired sequence. Once the construct has been completed, it may then be transferred to an appropriate vector for further manipulation in accordance with the manner of transformation of the host cell.

A double-stranded DNA molecule of the present invention co. ntaining, for example, a cold shock protein in ar expression cassette can be inserted into the gmenome of a plant by any suitable method. Suitable plant transformation vectors include those derived from a Ti plasmid of Agrobacterium tume faciens, as well as those disclosed, e.g., by HerreraEstrella et al. (1983),

Bevan (1984), Klee et zal. (1985) and EPO publication 120,516. In acldition to plant 1s transformation vectors «derived from the Ti or root-inducing (Ri) plasmids of Agrobacterium, alternative methods cara be used to insert the DNA constructs of this Finvention into plant cells.

Such methods may involve, but are not limited to, for example, the u:se of liposomes, electroporation, chemic=als that increase free DNA uptake, free DNA delivery via microprojectile bombardment, and tran sformation using viruses or pollen.

A plasmid expression vector suitable for the introduction of az gene coding for a cold shock protein, or protein containing a cold shock domain in monocot=s using electroporation could be composed of the following: a promoter that functions in pla-nts; an intron that provides a splice site to facilitate expression of the gene, such as the Hsp70 intron (PCT Publication

W093/19189); and a 3” polyadenylation sequence such as the nopalire synthase 3' sequence (NOS 3%. This expression cassette may be assembled on high copy r-eplicons suitable for the production of large quamtities of DNA.

An example of & useful Ti plasmid cassette vector for plant tr=ansformation is pMON- 17227. This vector is diescribed in PCT Publication WO 92/04449 ard contains a gene encoding an enzyme conferring glyphosate resistance (denominated CP4), whiech is an excellent selection marker gene for many plants. The gene is fused to the Arabidopsis EZ PSPS chloroplast transit peptide (CTP2) and expressed from the FMV promoter as described ther ein. When an adequate sumbers of cells (or protoplasts) containing tie sedoheptulose-1,7-bispheosphatase gene or cDNA are obtained, the cells (or protoplasts) are regwenerated into whole plants. Choice of methodolo=gy for the regeneration step is not critical, with ssuitable protocols being available for hosts from

Leguminosae (alfalfa, soybean, clover, etc.), “Umbelliferae (carrot, celery”, parsnip), Cruciferae (cabbage, radish, canola/rapeseed, etc.), Cuc Larbitaceae (melons and cuctamber), Gramineae (wheat, barley, rice, maize, etc.), Solanaceae (potato, tobacco, tomato, peeppers), various floral crops, such as sunflower, and nut-bearing tre=es, such as almonds, cashevovs, walnuts, and pecaras.

Plants that can be made to express co 1d shock proteins by practice of the present invention include, but are not limited to, dcar=cia, alfalfa, aneth, apple, apricot, artichoke, arugula, asparagus, avocado, banana, barley, beans, beset, blackberry, blueberry, toroccoli, brussels sprouts, cabbage, canola, cantaloupe, carrot, cassava, cauliflower, celery, cherry. cilantro, citrus, clementines, coffee, corn, cotton, cucumber, Douglas fir, eggplant, endi=ve, escarole, eucalyptus, fennel, figs, gourd, grape, grapefruit, honey lew, jicama, kiwifruit, lettuce, leeks, lemon, lime,

Loblolly pine, mango, melon, mushroom, nu—¢, oat, okra, onion, orange, -an ornamental plant, papaya, parsley, pea, peach, peanut, pear, pejOper, persimmon, pine, pineapple, plantain, plum, pomegranate, poplar, potato, pumpkin, quinc=e, radiata pine, radicchio, radish, raspberry, rice, Tye, sorghum, Southern pine, soybean, spinach, seaquash, strawberry, sugarbeet, sugarcane, sunfloweer, sweet potato, sweetgum, tangerine, tea, tobacco, tomato, turf, a vine, watermelon, wheat, yams, zucchini, or any other plant. “Promoter” refers to a DNA sequence= that binds an RNA polymerase (and often other transcription factors) and promotes transcription of a downstream DNA_ sequence. Promoters are often provide enhanced or reduced expression in some tissues when cormapared to others.

Promoter selection, specifically selecting prosmoters that increase expression when a plant is undergoing abiotic stress could be particular By useful in the instant inve=ntion.

It has been observed in the art that so ame stress responses have s@milar effects on the plant, and resistance to one may provide resistance to another. This is seen, fo-x example, between th=e responses to dehydration and low temperatur—e (Shinozaki, ef al., Currermt Opinions in Plant

Biology 3(3):217, 2000). Many other papers show the general interrelatTonship between diffex=ent abiotic stresses, and might indicate that tolerance to one stress might lezad to greater tolerance of several other abiotic stresses (Pernss, 1 al., FEBS Lett 467(2-3):206, 2000; Knight, Int Rev

Cytol 195:269, 2000; Didierjean, ef al ., Planta 199: 1, 1996; Jeong, et al., Mol Cells 12:185, 2001).

Expression cassettes and regulatory elements found in the DNA segment outsside of the plant expression elements contained iz the T-DNA are common in many plasmid DINA backbones and function as plasmid maintenance elements, these include, but are not limited to, the aad (Spc/Str) gene for bacterial sprectinomycin/streptomycin resistance, the pPBR=322 ori (ori322) that provides the origin of replication for maintenance in E. coli, the bom si_te for the conjugational transfer into the Agrobacterium tumefaciens cells, and a DNA segmermt is the 0.75

Mo kb oriV containing the origin of replication from the RK2 plasmid. In addition, thosse plasmids intended for transformation into plants often contain the elements necessary for the e=ndogenous

DNA integration proteins of Agrobac#erium to function to insert the element. Theses include borders (right (RB) and left (LB) borders).

The laboratory procedures in recombinant DNA technology used herein are tthose well #5 known and commonly employed in thie art. Standard techniques are used for cloning, DNA and

RNA isolation, amplification and puri fication. Generally enzymatic reactions involv~ing DNA ligase, DNA polymerase, restriction endonucleases and the like are performed accoreding to the manufacturer's specifications. These techniques and various other techniques are ger—ierally performed according to Sambrook et al., Molecular Cloning - A Laboratory Manual, 2nd. ed,, =0 Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1989).

All publications and published patent documents cited in this specification ame incorporated herein by reference to the same extent as if each individual publication or patent application is specifically and individeaally indicated to be incorporated by reference—

The following examples are included to demonstrate embodiments of the invention. It »5 should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventors to function well in the poractice of the invention. However, those of skill in the art should, in light of the present discloesure, appreciate that many changes can be made in the specific embodiments which are di _sclosed and still obtain a like or similar result without departing from the spirit and scope of the Tinvention,

tiyetefore all matter set forth o ¥ shown in the accompanying dravovings and examples isto be iraterpreted as illustrative and mot in a limiting sense.

Examples

Example 1. pMON57396 (Figure 1)is a binary vector for Agrobactezrium-mediated tran=sformation and constitutive expression of a protein (SEQ ID NO: 56) simil_ar to Escherichia coli Csp4 in ~lrabidopsis. To clone the E.coli CspA gene, two gene specific primers, MF1 and M~1F2, were designed based on the Csp4 sequence information (Genbank Ma#30139, G1:409136) from the

T=Jational Center for Biotechnology Information, which is part o=T the National Libraxxy of

Medicine, in turn part of the National Institutes of Health (NCE3]). The sequence fox MF! is

AA GGTAATACACCATGGCSCGGTAA (SEQ ID NO: 66), whi ch anneals at the translational start ssite of Cspd and introduces an Ncol site at the 5° end, while thes sequence of MF2 izs

BW TAAGCAGAGAATTCAGEGCTGGTT (SEQ ID NO: 67), winch anneals at the lamst codon of

CspA and introduces an Eco RU site at the end of the primer. PC_R was performed to isolate £.coli

CCspA. Specifically, E.coli DF 5a cells were lysed and a small amount of the lysate wwas used as a template to amplify the CspAn gene using MF1 and MF2 primes, Taq polymerase =and dNTPs rom Roche Molecular Biochmemicals (Indianapolis, IN). The thmermal cycling conditions were as

Follows: 94°C, 1 min, followed by 30 cycles of 94°C, 16 seconads; 55°C, I minand 72°C, 1 min. “HE he amplified Cspd DNA waas purified by gel-electrophoresis, digested with NcoI sand EcoRI and

Liigated to a binary vector pML ON23450 (Figure 2) that had prev=iously been linearizeed by

Sigestion with NcoI and EcoaRl. Ligation was performed using T4 ligase and folloveving procedures recommended by the manufacturer (BRL/Life Techmnologies, Inc., Gaittaersburg, MD).

Whe ligation mix was transfoxrmed into £. coli cells for plasmid propagation (Sambmrook et al.,

Molecular Cloning: A Laboratory Manual, 2% Edition, Cold S-pring Harbor Press, 1989). The teransformed cells were platecd on appropriate selective media (Sambrook et al, Mo®ecular

Cloning: A Laboratory Mant4dl, 2™ Edition, Cold Spring Harb- or Press, 1989) and ecolonies were sscored hours or days later. PL.asmids were prepared from indivieciual colonies and fu Yi-insert ssequence was determined.

W~0 2005/033318 ~ PCT/US2004/031856

The resulting plasmid was also confirmed by restriction mapping (for example, see

Griffiths, et al, An Introduction to Gene=tic Analysis, 6" Edition pp449-4851, ISBN 0-7167-2604- 1, "WH. Freeman and Co., New York) sand sequencing. As the chosen Mcol -EcoRI cloning site in the= vector was flanked by a CaMV e35:S promoter at the upstream (57) &and an epitope tag (Flag, whmich encodes the oligopeptide DYKID®DDK (SEQ ID NO: 68), SIGMA, St Louis) at the downstream (3°), the E.coli CspA in thi_s construct is thus tagged at the C-terminus by the Flag epi tope tag and will be driven transcrip~tionally by the CaMV e358 promoter upon transformation in =4rabidopsis. The above cloning resuclts in a plasmid encoding a protein similar to SEQ ID NO: 55. The resulting plasmid is called pM=ON57396.

Example 2. pMONS57397 (Figure 2) is a binsary vector for Agrobacterium-me diated transformation andl constitutive expression of a protein (SEQ ID NO: 57), like Escherichia coli CspA protein, in

Arabidopsis. To create pMONS57397, thue binary vector pMON57396 containing the Escherichia col® CspA gene (see example above) tagzged at the C-terminus by the Flag epitope tag, was digested with restriction enzymes Xho! sand Sall to cleave these sites in the vector and release the

FL AAG epitope tag (The FLAG tag encocles the oligopeptide DYKDDDKZ, SIGMA, St Louis).

Thee linearized plasmid was then purifiec and religated. Ligation was pex-formed using T4 ligase and following procedures recommended. by the manufacturer (BRL/Life Technologies, Inc.,

Gaisthersburg, MD). The ligation mix weas transformed into E. coli cells for plasmid propagation (Sarmbrook et al., Molecular Cloning: A Laboratory Manual, 2 Edition, Cold Spring Harbor

Press, 1989). The transformed cells were= plated on appropriate selective anedia (Sambrook et al.,

Moleecular Cloning: A Laboratory Mame-al, 2™ Edition, Cold Spring Har®or Press, 1989) and colonies were scored hours or days later. Plasmids were prepared from individual colonies and full-Snsert sequence was determined. The cloning above results in the creation of a plasmid enco~ding a protein similar to SEQ ID NO: 57.

The resulting plasmid was also confirmed by restriction mapping to ensure that Xho! and

Sall ssites were absent (for example, see (Griffiths, et al, An Introduction tc Genetic Analysis, 6

Editieon ppd49-451, ISBN 0-7167-2604-1 , W.H. Freeman and Co., New Y ork) and sequencing.

The E. coli Cs=pA gene in this construct is untagged at the C-terminus and is driven _ transcriptionaRly by the CaMV 358 promoter.

Example 3. pMOMI57398 (Figure 4) is a binary vector for Agrobacterium-medlliated transformation and constituti~ve expression of a protein (SEQ ID NO-: 59) like Bacillus s1eebtilis CspB, in

Arabidopsis. “Yo clone the B. subtilis CspB gene, two gene-specific prime=xs, MF3 and MF4a, were designe based on the CspB sequence information (Genbank U588559, gi:1336655) from the

National Censter for Biotechnology Information, which is part of the Naticonal Library of

Medicine, in ®urn part of the National Institutes of Health (NCBI). The se=quence for MF3 is

AGGAGGAMATTCCATGGTAGAAG (SEQ ID NC: 69), which annealzs at the translational start site of C7.spB and introduces an NcoI site at the Se” end, while the sequuence of MF4a is

TCAATTTA=YGAATTCGCTTCTTTAGT (SEQ ID NNO: 70), which annaeals at the last codon of CspB and intmroduces an EcoRI site at the end of the primer. PCR was per—formed to isolate

B.subtilis Csp>B. Bacills subtilis cells were obtained from Carolina Bioloegical Supply (Burlington, INC), the cells were lysed and a small armount of the lysate wavas used as a template to amplify the CspB gene using MF3 and MF4a primerss, Taq polymerase arad dNTPs from Roche

Molecular Bi ochemicals. The thermal cycling condit=ions were as followss: 94°C, 1 min, followed by 30 cycles =of 94°C, 16 seconds; 55°C, 1 min and 772°C, 1 min. The ampplified CspB DNA was purified by ge=l-electrophoresis, digested with Ncol and EcoRI and ligatec to a binary vector pMON23450® (Figure 5) that had previously been lineearized by digestion with Neol and EcoRI.

Ligation was performed using T4 ligase and followirg procedures recom _mended by the manufacturer= (BRL/Life Technologies, Inc., Gaitherssburg, MD). The ligation mix was transformed &into E. coli cells for plasmid propagation. The transformed ells were plated on appropriate selective media (Sambrook et al., Molecwular Cloning: 4 Lab-oratory Manual, bi

Edition, Cold Spring Harbor Press, 1989) and coloni_es were scored a day. later. Plasmids were prepared frorm individual colonies and full-insert seqa uence was determined.

The reesulting plasmid was also confirmed by restriction mapping (for example, see

Griffiths, et aml, Arn Introduction to Genetic Analysis, 6" Edition ppd49-4551, ISBN 0-7167-2604-

1, W.H. Freeman and Co., New York) and sequencing. As the chosen Neol -EcoRI cloning site in the vector was flanked by £a CaMV €35S promoter at the upstream (5°) and an epitoepe tag (Flag, which encodes the oligopegptide DYKDDDK (SIGMA, St E_ouis) at the downstrean— (3°), the

B.subtilis CspB like gene in this construct is thus tagged a®t the C-terminus by the Flag epitope tag and will be driven transscriptionally by the CaMV ¢35S promoter upon transforrmation in

Arabidopsis. This cloning results in a plasmid with the seq uence encoding a proteir similar to

SEQ ID NO: 59 being inserted into said plasmid.

Example 4. pMONS57399 (Figure 6) is a binary vector for Agrodacterium-mediated tran_sformation and constitutive expressiora of a protein (SEQ ID NO: 61) E ike Bacillus subtilis CspmB in

Arabidopsis. To create pM_ON37399, the binary vector pM_ON57398 containing the Bacillus subtilis CspB gene (see exeample above) tagged at the C-terminus by the Flag epitope tag, was digested with restriction enzymes Xhol and Sall to cleave these sites in the vector a-nd release the

FLAG epitope tag (The FL._AG tag encodes the oligopeptide DYKDDDK, SIGMA, St Louis).

The linearized plasmid wass then purified and religated. Ligation was performed us—ing T4 ligase and following procedures recommended by the manufacturer (BRL/Life Technologies, Inc.,

Gaithersburg, MD). The ligation mix was transformed into E. coli cells for plasmic propagation (Sambrook et al., Molecular Cloning: A Laboratory Manucal, 2 Edition, Cold SpriZng Harbor

Press, 1989). The transformed cells were plated on appropriate selective media (Sarmbrook et al.,

Molecular Cloning: A Laboratory Manual, 2™ Edition, Cold Spring Harbor Press, 1989) and colonies were scored hours or days later. Plasmids were prepared from individual eeolonies and full-insert sequence was destermined. This cloning results ime a plasmid with a sequerce encoding 225 a protein similar to SEQ ID- NO: 61 being inserted into saickE plasmid.

The resulting plasmid was also confirmed by restriction mapping to ensure t hat Xho! and

Sail sites were absent (for example, see Griffiths, et al, An #ntroduction to Genetic ~dnalysis, 6*

Edition ppA49-451, ISBN 0 -7167-2604-1, W.H. Freeman awd Co., New York) and sequencing.

As the chosen Neol -EcoRI cloning site in the vector was flzanked by a CaMV e358 gpromoter at =3¢ the upstream (5°) N-terminas, the B.subtilis CspB gene in this construct is untagged at the C-

V0 2005/033318 PC" T1/US2004/0318856 €erminus and is driven transcriptionally by the Ca"MV 35S promoter uporn transformation in ~4rabidopsis. Said plasmids were transformed intom Agrobacterium tumefaciens.

Fxample S.

Arabidopsis plants may be transformed by any one of many availallble methods. _ For e=xample, Arabidopsis plants may be transformed wusing Jn planta transforrnation methoed by wacuum infiltration (see, Bechtold ef al., In plarita= Agrobacterium mediate=d gene transf¥er by imnfiltration of adult Arabidopsis thaliana plants. =CR Acad. Sci. Paris Sciesnces de la vi ellife s-ciences 316: 1194-1199 (1993). This example illwastrates how Arabidopsi—s plants may “be taransformed.

SStock Plant Material and Growth Conditions

Prepare 2.5 inch pots with soil and cover tiem with a mesh screen, making sure that the saoil is not packed too tightly and the mesh is in comntact with the soil surfac=e (this ensure=s that the geemminating seedlings will be able to grow through the mesh). Sow seeds and cover witkha geermination dome, Vernalize seeds for 3-4 days. (Grow plants under condi—tions of 16 hours light / 3B hours dark at 20-22° C, 70% humidity. Water t=wice weekly, and fertilize from belovev with 1/2 3X (half of the strength recommended by the manufacturer) Peters 20-20-20® fertilizer (frcom

H ummert International, Earth City, MO). Add micronutrients (Hummert’=s Dyna-grain Soluble Tmrace Elements) (in full strength recommended by the manufacturer) every - other week. ~After atovout 1-2 weeks, remove the dome and thin the pots to one or two plants per pot. Clip thae pr-imary bolt, when it develops, to encourage more =secondary bolt formatiomn. In 5-7 days=s the plaants will be ready for infiltration.

Agzrobacterium Preparation (Small scale and Larges scale cultures):

Agrobacterium strain ABI is streaked onto <an LB plate containing SSpectinomycimm 100 mgz/L, Streptomycin 100 mg/L, Chloramphenicol 25mg/L, and Kanamycin 250mg/L (dencoted

SSSCK). Two days prior to infiltration, a loop of Agrobacterium is placed imnito a tube cor—1taining 10 mls LB/SSCK and put on a shaker in the dark at 28°C to grow ovemight_. The following day, thes Agrobacterium is diluted 1:50 in 400 mls YEP/ SSCK and put on a shak—er at 28°C to grow for 16-20 hours. (Note: we have found the transEComation rate is significartly better when IB is used for the first overnight growth and YEP is us ed for the large scale overnight culture).

Infiltration

Harvest the Agrobacterium cells by pourfing into a 500 ml centrifuge bottle and spin ning at 3500 rpm for 20-25 minutes. Pour off the supesmatant. Dry the pellet armd then resuspend . in 25 ml Infiltration Medium (MS Basal Salts 0.5%, Gamborg’s B-5 Vitamins 1924, Sucrose 5%, MES 0.5 g/L, pH 5.7) with 0.44 nM benzylaminopurinee (BAP) (10 pl of 2 1.0 mg/L stock in DMSS0 per liter) and 0.02% Vac-In-Stuff (Silwet 1-77) farom Lehle Seeds (Round ERock, TX). The BAP and Silwet L-77 are added fresh the day of infiltration. Add 200 pul of Silw—etL-77, and 20 pl of

BAP (0.5 mg/L stock). Using Infiltration Medium as your blank, take the CODgpp of 2 1:10 dilution of the Agrobacterium suspensions. Calc-ulate the volume needed For 400 ml of

Agrobacterium suspension/infiltration medium, ©OD600 = 0.6, for the vac 1um infiltration.

Equation: (final volume) * (final OD600Y = Volume needed for final OD600 om £0.6 0DG00

Place resuspended culture in a Rubbermaicd container inside a vacuumm dessicator. Imewvert pots containing plants to be infiltrated into the solution so that the entire plant is covered, including the rosette, but not too much of the soil -is submerged. Soak the pM ants with water feor at least 30 min. prior to infiltration. (This keeps the soil from soaking up the ~4grobacterium suspension).

Draw a vacuum of ~ 23-27 in. Hg for 10 main. Quickly release the vaacuum. Briefly d rain the pots, place them on their sides in a diaper-linecd tray , cover the tray with a dome to maintain humidity, and return to growth chamber. The following day, uncover the pcots, set them upright, and remove the diaper. Do not water plants for ~ S days. After the 5 days a-xe up, allow the plants to be watered and to continue to grow under- the same conditions as beefore. (The leave=s that were infiltrated may degenerate but the plant should survive until it is fi—mished flowering).

Harvesting and Sterilizing Seed

Cone the plants, individually, by using the M.ehle Aracons (Lehle Sees ds, Round Rock,

TX) approximately 2 weeks after infiltration. Afiemr all of the seed is matured and has set (~ 4 weeks post-infitration), remove the plants from water to dry down the seeds. Approximately 2 weeks later harvest the seeds by cutting the branche=s below the cone. Clean - the seed by using: a sieve to catch thee silique and branch material and allow tine seed to go through. Place the see=din an envelope or imn 15ml conical tubes.

Transfer desired amount of seeds to 15ml conical ~tubes prior to sterilization. Loosen the lid to the conicalls and place them on their side in a vacuum dessicator with a beaker containimng 400 ml of bleackh Clorox (Clorox Company, Oakland, CA_) and 4 ml of Hydrochloric Acid. (Add the HCl to the C=lorox in a fume hood). Pull a vacuum jusst to seal the dessicator, and close thae suction (i.e. so that the dessicator is still under 8 vacuum Wbut the vacuum is not still being directly pulled) for ~ 16 “hrs. After sterilization, release the vacuurm and place tubes containing seed ina sterile hood (kee=p caps loose so gas can still be released).

Plate (“sprinkle”) the seed on selection plates cont=aining MS Basal Salts 4.3 g/L,

Gamborg’a B-5 «(500 X) 2.0 g/L, Sucrose 10 g/L, MES 0.5 g/L, and 8 g/L Phytagar (Life

Technologies, In:c., Rockville, MD) with Carbenicillin 2560mg/L, Cefotaxime 100 mg/L.

Selection levels ~will either be kanamycin 60 mg/L, Glyphmosate 60M, or Bialaphos 10mg/L.

A very stall amount of seed can be first plated out to check for contamination. If ther—e is contamination, re>-sterilized seeds for ~ 4 more hours and echeck for contamination again. The= second sterilizati_on is usually not necessary, but sometime=s the seed harbors a fungal contaminant and repeat sterilizations are needed. (The ste=rilization duration generally is shorter than 16 hours because of significantly decreased germination rates starting at 24 hr. sterilizatioon duration). Seal pelates with parafilm and place in a cold ro-om to vernalize for ~ 2-4 days. After seeds are vernaltizzed, place in percival with cool white bulls.

Transfer to Soil

After 5-10 days at ~26°C and a 16/8 light cycle, th_e transformants will be visible as green plants. After another 1-2 weeks, plants will have at least o~ne set of true leaves. Transfer plants to soil, cover with a germination dome, and move to a grosasth chamber with normal 4rabidop=sis growth conditionss. Keep covered until new growth is appaarent (usually 5-7 days).

Example 6.

In order to compare the growth of wildtype non-trarsgenic and CspA or CspB transgenic

Arabidopsis plantss, verticle growth was allowed in sterile Petri dishes:

W-Q 2005/033318 PaCT/US2004/031856=

Wildtype or transgenic seeds were liq uid sterilized using the follow—ing method: eS minute incubation in 702% ethanol following vortex milixing e 5 minute incubation in 302% Chlorox (6.15 % sodium hy=pochiorite) + 0.01% Triton X-100 following vortex mixing ¢ 5 consecutive sterile water~ washes

Seeds were plated onto plastic, 100 x 15 mm square petri dishes (Beecton Dickinson —

Falceon # 35-1112), each containing 40 ml of agar media made as follows: 0.5X Murashige and Skoog media with macronutrients, micronutriesnts and vitamins (Sigmua #M5519), adjusted to pH 5.8 with annmonium hy droxide and contexining 1% Phytag=el (Sigmma # P8169) for solid support.

Ten wild type Arabidopsis seeds weres plated across one half of a pe=tri dish, appr-oximately 1 cm from the edge and evenls/ spaced. This was done with a Gilson P-200 Pipetteman using sterile tips. Ten CspA or C2spB transgenic Arabidopsis seeds were similarMly plate=d across the other half of the petri dish, e>venly spaced. The plates wer—e labeled with a marking pen to indicate which half contained the transgenic seeds.

The petri dishes were put at4 °C for 3 days in the dark to stratify thee seeds and then placesd in a Percival incubator (model AR-36I_)at 8 °C for 6 weeks at 24 hosur constant light «of 120 emicroeinsteins/square meter. At the end «of this incubation, the size of sthe CspA and CspoB roset=tes were compared to that of wildtype and found to be larger. This can be seen in Figure= 16.

This can be seen in the first, second, and last pictured plate where the above assay was used. In figuree 16, the third picture (CspB + Flag, pMCON57399) displays a plate wheerein the plants wasere put tkarough a cold shock assay similar ta that described below.

Cold shock seedling vigor assessment of tramnsgenic Arabidopsis thalian_a seeds: horizon tal plate= assay.

Intromduction:

This Wsa procedure for assessing the ability of” transgenic Arabidopsis seeds that have germinzated at nor-mal temperatures on media agar in horizontal petri plates to continue t=© grow upon a sh_ift to chilling. Tn short, seeds from control plants and seeds from teester transgenic plants are sterilized, stratified, and plated in 6 x 8 grids on either half of a petri dish. The plate is incubested - at normal termperature in a horizontal position for one week andk then shifted to chilling temperature for two additional weeks, maintaining the horizontzal position of the plate. The canopy area eof seedlings is recorded by digital photography and. quantitated using imaging software. Tle ratio of the total canopy area of the tester seedlin.gs to that of the control seedlings can be used as a quantitative parameter to compare the cold tolesrance potential of various germes of interest in transgenic tester lines.

Materials: tlhe following assumes the normal capital equipment available in a standard biotechnologzy laboratory (autoclave, balance, laminar flow hood, etc.) - Arabidopsis seed: the protocols here have been used with Arabidopsis thaliana cv.

Colurmbia, but ought to be suitable for other Arabidopsis species as well. - Petri edishes:Ralcon #35-1112 (100 mm square x 15min cleep) - Medi=ma: Sigma M5519 = Murashige & Skoog Basal Melia : - Phyta gel (Sigma #P-8169) - 1-litzer glass bottles in which to autoclave media agar amnd from which to pour plates.

We usse Corning glass bottles with the orange screw capss. - Magnetic stirrers and magnetic stir bars - Electric pipettor usable with 50 ml plastic pipettes. - Small fluorescent light box with plastic magnifying lense for plating seeds. - P1000® Gilson pipetor (or equivalent) and sterile tips -" P200 «Gilson pipetor (or equivalent) and sterile tips } - 70% Ethanol, sterile - 30% Chlorox bleach + 0.1% Tween 20 - Sterile= filtered deionized water - Sterile: microcentrifuge tubes aud tube racks = 4°C ccold room, cold box or refrigerator, preferably dark - 22 degrees C Percival plant growth chamber or equivalent with ~150 pE/m?/sec light source

- "8 degress C Percival plant growth chamber or equivalent with ~150 ES /m*/sec light source - Semipermeable surgical tape 3M Micropore tape (3M #1530-1) - Black (Shmarpie) marker - Vacuum aspirator with trap - Glassine balance weighing paper (VWR #12-578-165) - Calculato - Notebook= - IBM compatible computer - Image-Pro Plus software, version 4.1.0.0 - Microsoft= Excel software .

Protocol: 1- Aliquot seeds for storage vials or envelopes ®o sterile microcentrifuge —tubes 2- Label tubees with sharpie to retain identity of seeds 3. Surface sterilize seeds in tubes by successive= washing with the followi_ng solutions and waiting tires listed below. Note, invert tube=s during washings at leastk twice to ensure good surface contact of solutions on seeds. Seeds will fall down to the= bottom of the tube, making a soft pellet: a. 70"% Ethanol, sterile, for 3 to 5 minutees b. 30%2% Chlorox bleach + 0.1% Tween 220, for 3 to 5 minutes c. Sterile filtered deionized water, for 30 seconds d. Repeat c. four more times and on the Jast time, leave ~ 0.5 ml owf sterile water remaining over the seed pellet. 1- Place microcentrifuge tubes in the dark at 4°CC for three daysto stratify the seeds for more uniform gesrmination upon plating. [Alternatihvoely, the seeds can be directly plateed onto media agar petri dishes, taped sealed and the petri dish ~can be put at 4°C in the dark for tfzree days prior fo the 8°C cold incubation — see below.]

- 2- Make plates by preparing 1-liter aliquots c>f0.5 X Murashige and Skoog r-nedia in the glass bottles, adjust pH to 5.8 with ammor ium hydroxide, then add 10 greams of Phytagel.

Use a magnetic stirrer when adjusting the pH and to mix in the phytagel umniformly, then autoclave on liquid setting (slow exhaust) for 45 minutes. = 3- Pour plates in the laminar flow hood using the electric pipettor with the 5: O ml sterile pipette to deliver 40 ml of media to each plate, immediately covering the _ plate with the lid. 4- Allow plates to cool in laminar flow hood for at least 2 hours with the blower off and store in dated plastic bags at 4 °C. 5- Label plates and plate seeds: 1- Tape all four edges of the plate with semipermeable micropore tape, labelL with the date and put plates in a Percival incubator set a_t 22C and 16 hour day light cycle at ~ 100 uE/m’ sec. Place the plates in a horizontal position only one layer thick and incubate for 7 days. Photograph each plate with a digit®al camera and store the data to -& compact disk. 2- Transfer plates to a Percival incubator set at 8°C and 24 hour day light cycle at~ 100 pE/m? sec, Place the plates in a horizontal position only one layer thick ard incubate for upto 3 additional weeks. Photograph each. plate with a digital camera and store the data to a compact disk. 3- Observe plates every 2 to 3 days to see howw testergermplasms are procee=ding compared 257 to controls and digitally photograph at time=s that are representative of the general performance of the germplasms. This should take less than 2 weeks (3 weeks at the most) of incubation at § °C. Those germphiasms that take longer to show ea difference need to be plated at a lower seed density tow avoid overcrowding at the time= the digitial photograph is taken.

4- Measure roseite canopy area using digital camera photography and Imagze-Pro Plus software. Calculate the average seedling canopy for control and tester peopulations, eliminating seeds from the analysis that never germinated. Calculate the= ratio between the average seedling canopy area post tem_perature shift for the control sezedlings and the tester seedlings, the standard deviation anc standard error for control anc tester seedling sets. Ascertain if there is a statistical difference between the tester seedlings and the control seedlings. Record results in a notezbook. 5 Discard plates and seedlings in appropriafite disposal containers for transgenic plant materials (gray bins with clear plastic waste bags).

Example 7. .

PCR products of the CspA and CspB genes were ligated to vector pCR-"IOPO 2.1 according to the manufacturer's protocol (Invitrogzen, Carlsbad, CA). The Ncol/ EcoRI fragments of the pCR-TOPO 2.1 derivatives were subcloned into pMON48421 (Figure 7), linearized by the sarme restriction enzymes. The Notl fragments of “the pMON48421 derivatives e=ncompassing the 35S promoter, Csp genes, and the 9 terminator were subcloned into pMON429 16 (Figure 17) at the Not! site to create pMON56609 (Figure 8) ancl pMON56610 (Figure 9) whic=h contain the

Csp A and CspB genes, respectively. Said plasmid. s were transformed into Agrobmacterium tumefaciens by known methods. pMONS56609 is thought to contain a nucleotide sequence encoding a protein similar to SEQ ID NO: 7. pMCONS56610 is thought to contain a nucleotide sequence encoding a protein similar to SEQ ID N&O: 9.

Example 8.

Agrobacterium Preparation:

Agrobacterium strain EHA 105 is streaked aon LB plate containing Kaname ycin 50mg/L and FHygromycin 50 mg/L (denoted LB/KH). Two days prior to co-cultivation, a “loop of

Agrobacterium is transferred to a tube containing 80 ml LB/KH and incubated or a shaker in dark at 28 C for 24 hours. This culture is diluted tos 1: 100 in 20 mi LB/KH and imncubated on a as shaker in dark at 28 C overnight. The following day 1ml of 1:2 dilution of this cralture is taken in a cuvette and OD600 is taken with LB/KH as blank. . Calculate the volume needead for Sml of agrobacterium suspension of 0.D 1.0 for co-cultivat=jon.

Equation: (final volume) * (final 0D600) == Volume needed for final COD600 of 1.0 0D600

Take the required volume of agrobacterium culture in a 40ml centrifuge twabe and spin at 7000 rpm for 7 minutes. Discard the supernatant andl dry the pellet. Resuspend th_e pellet in Sml of co-cultivation media (CC MEDIA-MS Basal saltss, Sucrose 20 g/L, Glucose 10Bg/L, thiamine

HCl 0.5 mg/L, L-Proline 115 mg/L, 2,4-D 2mg/L) with 20 mg/L of acetosyringomne.

Transformation of rice embryos:

Panicles were harvested from greenhouse groswn Nipponbare and Taipai 3 09 rice 1s varieties. The panicles were sterilized by immersing in 50% commercial bleach for 10 minutes followed by rinsing in sterile distilled water. The parmicles were given a 70% alcolol treatment for 3 mins. The seeds were then removed from the pamnicles and dehusked individt sally and atransferred to a falcon tube containing 0.1% tween 23 solution. The seeds were the=n treated with ~70% alcohol in the laminar air flow chamber. Then tiie seeds were rinsed with sterile water. This was followed by a 50% bleach treatment for 45 minutes. The seeds were rinsed 5 vtimes in sterile

Histilled water. Finally the seeds are given 0.1% mercuric chloride treatment for 5 minutes. The sseeds were again washed 8 times with sterile distilled water.

The embryos were excised aseptically from thee sterile seeds in the laminar flow chamber aand placed on solid co-cultivation media (CC MEDIAa. with 2g/L phytagel). 50uL. «drops of the a_grobacterium suspension were placed on a sterile pet-ri-plate. 10 embryos were transferred to e. ach drop. The infection was allowed for 15 minutes. “The agrobacterium suspensicon was removed with a sterile pipette tip. The infected embryeos were transferred to a fresh . solid CC

MEDIA plate and kept in dark for 2 days. On the third day the embryos were washaed with ce=fotaxime 500mg/L. The embryos were then dried omn sterile filter paper and place=d on Delay mmedia (MS Basal salts, Thiamine HCl 1mg/L, Glutamine 500mg/L, Magnesium Chaloride

750mg/L, casein ¥nyrolysate 100mg/L, Sucrose 20 mg/L, 2,4-D- 2mg/L, Pichloram 2.2mg/L.,

Cefotaxime 250m g/L). the embryos are kept on delay medium in dark for a period of 7 days.

During this period calli are formed. The calli are transferred toe selection media (Delay medium with 50mg/L, Hy gromycin) and stored in dark for 10 days. The= calli are sub-cultured to fresh s selection media afer this 10 day period. After another 10 dayss the calli are transferred to regeneration med ia (MS Basal salts, sucrose 30mg/L, Kinetin 2mg/L, NAA 0.2 mg/L,

Cefotaxime 250nmg/L, hygromycin 25mg/L) and kept in dark for 7 days. The calli are then transferred to fressh regeneration media and moved to a 16-hovar photoperiod at 30 C. The sk=moots developed on thiss callus are transferred to rooting media (half strength MS Basal salts, sucrose g/L, Cefotaxirme 250mg/L, Hygromycin 25mg/L). The rooted shoots are transferred to tesst- tubes containing ‘water and placed in a mist chamber for harde=ning.

Plants we=re selected as positive. This could be done, feor example, using methods sinmilar to those described in examples 12-14, and 26-29. Including breeding methods described to c=rteate the next generatieon of transgenic plants. 15

Example 9.

Cold stress response at three leaf stage — CspB and CspA rice transgenic plants

Plant material preparation:

Germination: Seeds were sterilized by treating with 0 .01 per cent mercuric chloride for 3 minutes and washed thoroughly for ten times in milique watewr to remove the traces of mercuric chloride. Sterilized seeds were allowed to imbibe by soaking Jin milique water for 3 hours. T he imbibed seeds were germinated on a sterilized moist filter paper at 30 °C temperature and 660 %

RH using a seed germinator (Serwell Instruments Inc.).

Establishament of three leaf stage seedlings: The three day old germinated seedlings waere transferred to portrays (52.5 mm (length) x 26 mm (depth) x 5.2 mm (diameter)) in the greenhouse havirg light intensity of 800 micro mol. / mt2/sec -.and 60 % RH. The seedlings were grown till three-1 eaf stage (Approximately for 12 days) in portrays containing red sandy loarm soil. Fertilizer so lution was applied to the seedlings once a we=ek till the completion of the

WO» 2005/033318 PCT/US2004/031856 expe-riments (N- 75 PPM, P-32 PPM, K-32 PPM, Zn-8 PPM, Mo-2 PPM, Cu-0.04 PPM, B-0.4

PPM and Fe-3.00 PPM).

Csp¥B- R2 plant analysis

Protocol: Three leaf stage rice seedlings (12 damy old) were subjected to a camld stress of 10 9 C For 4 days in presence of 100 micro mol. / mt¥/sec. ight and 70 % RH (Percival growth chanmber). After the stress treatment the plants were al “Jowed to recover in the greerahouse for 10 days= and on the 10® day the growth observations for survived plants and photographic evidences were recorded. Each treatment had 10 replications per line and they were complete ly randomized.

Results: Among eight different lines tested fomr cold stress tolerance six lines exhibited significantly higher cold tolerance compared to the wi 1d type. The lines including IR2-226-6-9-3,

R2-226-29-1-1, R2-257-20-2-1, R2-238-1-1-3, R2-23 ®0-4-4-2 and R2-257-3-1-3 sh.owed high cold tolerance by exhibiting high recovery growth and less percent reduction in growth (over non—stressed control) compared to the wild type (table ~1, plate-1). The line R2-230-4-42, has performed extremely well, it exhibited 100 per cent sumrvival and maintained good ggrowth during reco=very (Table 1).

Table 1. Three leaf stage cold stress recavery growth observations of CspB R2 transgenic lines.

Lines % Plant height {(c=m) %

Survival at | Stressed Non-stress sed Reduction in end of plant height recovery over non- amessy | ow |wsw |mmwes | ww

Ea IL LoL cr a a LC Co Cat RN WI

(index: WT = Wild type) ~~

CspB- R3 plant analysis

S

Protocol; Three leaf stage seedlings were exposed to cold stress of 8 edegree Celsius for 1 day in presence of 1000 micro mol. / mt2/sec. of light. Later the seedlings were allowed to recover at 28 degree Celsius in thes greenhouse for 15 days and at the end of &recovery the plant height was recorded. 170 Results: Eight different limes tested for cold stress tolerance and all the eight lines showed improved tolerance comprared to wild type (non-transgenic) plants. These results confirmed the R2 analysis data stmowing improved cold tolerance (Table 2).

Table 2:Three leaf stage ceold stress recovery growth observations of &CspB R3 transgenic 1=S lines. height (cm) at end of plant height (cm) at end | reductions in plant height recovery” of recovery over— non-stress a IE I NL

Ea I 0 I J

CspA- R2 plant analysis

Protocol: Three leaf stage rice seedlings (12 day old) were subjected teo a cold stress of 10 ® C for 3 days in presence of 1000 micro mol. / mt2/sec. and 70 % RH in a greowth chaxmber.

After the stress treatment the plants were allowed to recover in the green heouse for 15 days and on the 15™ day the growth observations were= recorded. Each value is an av—erage of 12 observations and the experiment was conducsted by following completely raandomized (CRD) experimental design.

Results; Out of seven independent CsspA transgenic lines tested 6 lines showed improved cold tolerance compared to wild type. In this experiment plant height was mreduced to close to 50% in cold treated control plants (WT) commpared to non-stressed plants. “Where as in transgenic plants with CspA gene reduction in plant heigght upon cold treatment varie 4.5% to 22.50% among different independent lines (except ore line where reduction in growth was 47.09%).

These results suggest that Cspd improves thes cold tolerance of rice (Table 3).

Table 3: Three leaf stage cold stress recovery growth observations eof Csp4 R2 transgenic rice lines. reductiion in plant height

Stressed Non-stressed oveer non-stressed

LCE NC I. I

I

Nipponbare

CspA- R3 plant analysis

Experiment I

Protocol: Three leaf stage seedlings were exposed to cold stress of 10 degree Celsius foor 3 days in pressence of 1000 micro mol. of light. Later the seedlings were allowed to recover at 28 degree Cels=ius in the greenhouse for 30 days and at the end of recovery the plant height and percent seedling survival were recorded. (In this exgperiment 8 replications were used for each transgenic Mine and 10 replications were used for wild type.)

Res ults: The six transgenic lines subjected to cold stress performed better under cold stress than ~wild type. These results further confirmed the R2 analysis data by showing improv-ed cold tolerarmace (Table 4).

Tabole 4: Three leaf stage cold stress recovemy growth observations of CspA R3 trans geenic rice lines. plant beight (cm) at | plant height (cm) stthe | reduction in plant seedling Survival the end of recovery end of recov ery height over non- stress eer [mew | wees | ww |W ec CE I I

Tere [maw | wees | wm |W a CLE Ru I NL rw | was we | mw |e

Note: Plant height was recorded only for starvived plants and their averages are given above.

Expgperiment II

Protocol: Three leaf stage seedlings were exposed to cold stress of 10 degree Celsius for 1 day in pressence of 1000 micro mol. of light. Later ~the seedlings were allowed to recover at2 8 degree Celsius in the green house for 30 days and aat the end of recovery the plant height and percent see=dling survival were recorded.

Resulis-: The five transgenic lines subjected to old stress performed toetter under cold stress than wilc type.

These results further confirmed th_e R2 analysis data by sshowing improved cold tolerance {Table 5).

Table 5: ‘Three leaf stage cold stress recovery growth observations of CspA R3 transgenic rice lines.

Lines Stressed - Non-stresse~d - Per cent plant height (cm) at } plant height (cm) at emnd | reduction in plant end of recovery of recovery height over non- stress

Ea Ee Iu NLU a LC Lo

Heat stares response at three leaf stage

Plant nmaterial preparation:

Germirmation: Seeds were sterilized by treatingy with 0.01 per cent mercuric chloride for 3 minutes and wzashed thoroughly (~ ten times in deioni=zed water) to remove the traces of mercur3c chloride. Steril_jzed seeds were allowed to imbibe by s oaking in milique water for 3 hours. The imbibed seeds were germinated on a sterilized moist f=ilter paper at 30 °C temperature and 60 %%

RH using a see=d germinator (Serwell Instruments Inc.7).

Establizshment of three leaf stage seedlings: Thme three day old germinated seedlings were transferred to portrays (52.5 mm (length) x 26 mm (d_epth) x 5.2 mm (diameter)) in the green house having 1 ight intensity of 800 micro mol. / mt2/s :ec.and 60 % RH. The seedlings were grown till threee-leaf stage (Approximately for 12 dayss) in portrays containing red soil. Fertilizer solution was spgorayed to the seedlings once a week till the completion of the experiments (N- 75

PPM, P-32 PPM,. K-32 PPM, Zn-8 PPM, Mo-2 PFPM, Cu-0.04 PPM, B-0.4 P_PM and Fe-3.00

PPM).

CspA-R2 plant analysis

Protocol= Three leaf stage rice seedlings (112 day old) were subjected to the heat stress of 50°Cfor 3 hours in presence of 70 % RH. After time stress treatment the plant=s were allowed to recover in the green house for 15 days and on the 15 day the growth observ=ations were recorded. Each w alue is an average of 12 observations.

Results: Out of seven independent CspA transgenic lines tested 6 lin_es showed improved heat tolerance compared to wild type. In this experiment plant height was re=duced by more than 50% in heat-trezated control plants (WT) compare=d to no stressed plants. Wlnere as in transgenic plants with Csp—4 gene reduction in plant height -1pon heat treatment varied from 9.5% to 35% among differen independent lines. These results. suggest that CspA improvees the heat tolerance of rice (Table 61).

Table 6= Three leaf stage plant heat stresss recovery growth observat¥ions of CspA R2 transgenic rice Wines. reduction in plant height

Stressed Non-stressed ove=r non-stressed wear | wesw | mma | w]

Nipponbare=

CspB-R3 plant an alysis

Protocol: Three-leaf stage seedlings were exposed to high temperature stress of 53 degree § Celsius for 2 hours and later the seedlings were allowed to recover at 28 degree= Celsius in the greenhouse for 15 clays and at the end of recovery the plant height was recordecl.

Results: Out of eight transgenic lines tested seven lines performed better under heat stress tested cormpared to wild type. These results suggest that CspB improwres heat tolerance of rice (Table 70.

Table 7: Three= leaf stage plant heat stress recovery growth observations of CspB R3 tr-ansgenic rice lines.

Lines Suessed -plant Non-stressed plant P-er cent reduction in height (cm) at end of height (cm) at end of plant heig=sht over non-stress recovery recovery

EEE | mew | wees [ma]

CspA-R3 plant analysis

Experiment 1

Protocol: Threse-leaf stage seedlings were exposed to high temperature stress of 53 degree

Celsius for 3 hours amd later the seedlings were allowed to recover at 28 degree Celsius in the greenhouse for 30 dayrsand at the end of recovery the plant height was recorded.

Results: These results confirmesd the R2 analysis data by shova~ving improved heat tolerance (Table 8).

Table 8: Three leaf stage plant Ineat stress recovery growth otoservations of CspA R3 transgenic rice lines. ' plant height (¢m) at | plant height (cm)atend | reduction izn plant : end of recovery of recovery height ove=r non- streses

Ea Ce A IL Ll

Experiment 11

Protocol: Three leaf stage seedlirags were exposed to high tempgperature stress of 50 degree

Celsius for 1 hour in the presence of 100 0 micro mol. of light and late—r the seedlings were allowed to recover at 28 degree Celsius in the greenhouse for 30 days and at the end of recovery —the plant height was recorded.

Results: These results confirmed she R2 analysis data by showiing improved heat eolerance (Table 9).

Table 9: Three leaf stage plant heat stress recovery growth obse=rvations of CspA R3 transgenic rice lines.

ETE end of recovery of recovery height over non- . stress a UE RCL

Ee LE ER NL

Em [pes | wens | en

Water stress response

Plant material preparation:

Germination: Seeds were sterilize-d by treating with 0.01 per cent nercuric chloride for 3 min later washed thoroughly for ten times in milique water to remove the tr—aces of mercuric chloride. Sterilized seeds were allowed to imbibe by soaking in milique watter for 3 hours. The imbibed seeds were germinated on a sterilized moist filter paper at 30 °C temperature and 60 %

RH using a seed germinator (Serwell Instruments Inc.).

CspB-R2 plant analysis

Experimental Protocol

The germinated seedlings (3 day old) were transferred to two differe=nt levels of water stress, created in PVC pots containing verrmiculite, which is measured in terms of field capacity (FC). The FC- 100 % is a saturated condition (i.e. 100g vermiculite requires 350ml of water) (Sharp et.al., 1988, Plant physiol. 87: 50 ~57). The different levels of water stress (i.e. 50%FC and 25%FC) were created in a PVC pots containing vermiculite by adding required amount of water. The water status in different stress lezvels was constantly maintained, Wy adding each day the amount of water lost du-e to evapotranspiration, through out the experiment. The seedlings were allowed to grow for 12S days in the water stress condition in the gre-enhouse in presence of 800 micro mol. / mi2/sec.Jig2ht intensity and 60 % RH. At 15™ day the growth of root and shoot were recorded and photograaphs were taken. Each treatment had 10 replications per line and they were completely randomized.

The percent reductiosn in growth was computed by adopting following formula.

Growth of root! shoot of absolute cantrol — Growth of root / shoot of FC2255 %

TEI Pp USERS. 41] absoluke cantrot Growth of root / shoot of absolute control

Results: Four different CspB transgenic lines were analyzed for warater stress tolerance. All the CspB transgenic lines tessted exhibited significantly higher growth during stress compared to the wild type plants. The trarsgenic lines including R2-257-15-1-1, R2-238-1-1-3, R2-257-3-1-6 and R2-226-6-9-3 exhibited least per cent reduction in root and shoot gro—wth over non-stress control (FC —100%). The recYuction in root and shoot growth in these line=s ranged between 11 to %. Where as, the wild type plants exhibited maximum reduction in growth, which is close to 50%. These results suggest that Csp4 improves the water stress tolerances of rice (Table - 10 and

Table - 11). 25 Table 10: Compar-ison of root and shoot growth at the end of ~water stress of cspB transgenic lines and the wild type.

NE FE I Fl I) wil 19%

Root Shoot Root Shoot Roos Shoot

I LL TP

37 37 A3

All SVR I FP Fl ld IY +13.8 36 | £1.56 1.26 36 39

R2-257-3-1-6 | 7.35%22 [26.1 6.4% 1.15 |23.0¢ 6.9+-107 | 19.5

Al FT I ld tl I lr Pl dE PY +1.82 xl.6 RS 2.24 38 2.15 41 ll IP iF I dl PO +1.58 37 0.97 33 S1 (index : WT = wild type, R:S = R-0ot to Shoot ratio)

Table 11: Comparison of pe-reent reduction in growth of root and shoot of cspB transgenic lines and the wild type. root growth shoot growth rocotand shoot growth

I I A EL RR

IL I BI

0 SL NC EC mms | ® [ws | ws]

CspA-R2 plant analysis a. Plant material preparation=

Germination: Seeds were ste=rilized by treating with 0.01 per cent~ mercuric chloride for 3 minutes and washed thoroughly for #en times in milique water to remove the traces of mercuric chloride. Sterilized seeds were allowed to imbibe by soaking in milique vevater for 3 hours. The m5 imbibed seeds were germinated on a. sterilized moist filter paper at 30 °C ~temperature and 60 %

RH using a seed germinator (Serwel® Instruments Inc.).

Establishment of three leaf st_age seedlings: The three day old germinated seedlings were transferred to portrays (52.5 mm (lemngth) x 26 mm (depth) x 5.2 mm (dizameter)) in the green 2.0 house having light intensity of 800 micro mol. / mt2/sec.and 60 % RH. Tiae seedlings were grown till three-leaf stage (Approxinmaately for 12 days) in portrays contairming red sandy loam soil. Fertilizer solution was sprayed t=o the seedlings once a week till the completion of the experiments (N- 75 PPM, P-32 PPM, K-32 PPM, Zn-8 PPM, Mo-2 PPNA, Cu-0.04 PPM, B-0.4

PPM and Fe-3.00 PPM).

Protocol: One- month- old seedlings were subjected to water stress for three days in presence of 800 micro mol. / mt2/sec. light and 60 % RH in the greenhomuse, Water stress was imposed by withholdirg irrigation. At the end of three days, plants starteed showing the wilting symptom. The stress vovas alleviated by irrigating the plants with water and 24 hours later the observations on percert plants showing wilting symptoms were recorde-d. A minimum of 12 plants was maintained per line per treatment.

Results: Out of seven independent CspA transgenic lines tested &5 lines showed improved water stress tolerance «ompared to wild type. Sixty six percent of contro} plants did not recover from wilting after irrigmation where as in CspA transgenic plants percent=age of plants showing wilting symptoms after irrigation varied from 5% to 43% among differe=nt independent lines (except one line wheres percentage of plants showing wilting was 85%). These results suggest that

CspA improves the wa_ter stress tolerance in rice (Table 12).

Table 12: Water stress response of CspA R2 transgenic rice lines. plants showing wilting

ECC IR ch DL

ILC NL

La

Nipponbare

Salt streess response

CspB-IR3 plant analysis

Protocol: Germinated seedlings (48 h. old) - were subjected to salinity stress by transferring thesm to PVC pots with vermiculite con_taining 200 mM of NaCl zand grown for 10 days. After 10 days of stress the seedlings were allomwed to recover for 15 day~s by transferring them to a frest trays of vermiculite containing wate=r. The growth observatiora such as plant height was rec orded at the end of recovery. This experiment was conducted im the greenhouse by "following Conmpletely Randomized Design (CRD) sand maintained eight repli cations per treatment. }

Resultss: Seven CspB transgenic lines and wavild type plants were subje=cted to 200 mM

NaCl stress. UJnder this condition five transgenic }i_nes performed better compared to wild type.

These results ssuggest that CspB improves tolerance = of rice plants to salt stress (Table 13).

Table 13: Salt stress recovery growth obser—vations of CspA R2 transgenic rice lines.

Lines Stressed -plant height Non-stressed Per cent (cm) at end of recovery pla_nt height (cm) atend | reduction in plant height of recovery over non-stressed

R3 water stress assay

Germinated seedlings (3 day old) from four independent transgenic lines (1,2,3,4) of csspA and wild type (Nipponbare - Numbe=r.5) were subjected to water stress by transferrimng them im. to a pot containing vermiculite. Three levels of water regimes were maintained, they aree 100 % field capacity (FC-100 = 3.72 ml of water o g vermiculite) 25 % field capacity (FC25 = 0.93 ml of water/ g vermiculite) 15% field capacity CFC15 = 0.558 ml/g vermiculite). The seedlings v-vere grown in different water regimes for 30 dagys in presence of 800 micro mol. / mt2/sec.light intensity and 60 % RH in the greenhouse. The water status in different stress levels was constantly maintained, by adding each day the amount of water lost due to vapotranspiration, throug=h out the experiment. At the end of 30th day plants were allowed to recover by adding water to bring it the level of FC100 and maintained for=— 15 days. During the experiment the growth observations such as plant height (pl. ht.) at he en=d of stress (ES) and root (R) shoot (S) length ard dry weight at the end of the recovery were re=corded.

Rach treatment had 10 replications per line and they were completely randomized.

Talo £4 Amapsiodtadratiegh(n ateencidrecoey | — Tro-oob | lies | FORD Jock | FORD Swot | FoSRoot | Rosso | FOG Root | WFOS Shoot = | reaebta2]| 233813 | 4561.5 | 175318 | 95x15 | ®6x23 | 20407 = | roanriad] 25:13 | 476%3m0 | 178320 | Gabts | 160317 | HOA

Table ~15; Average shoot and root dry welght (rg) at thse end of recovery 2 | Reau6te2| 2biW2 | 682-6 | 72151 | tee: | 86:70 | _ w83:211

Ta ble 16: Average shoot length (cm) at the end of stress _ linecode | Lines | Fcoio0 | FC26 |] 00 FCiS : 2 |R23626122| 40mxz21 | 261x11 | 262222 3 [Ra36e-7-1-33 | 40. Wz27 | 2720 1 26314 4 IRo-365101-2-1] 38.9223 | 26316 | 233224 [5 [Wi-Nipponbare] 39.5 £105 | 24220 | 24718 |]

Example 10. cspA s Construction of pMON73607 (Figure 10) 1. Vector pMON 61322 cut with Ncol and Apal to open up backbone and drop out Csp A gene. Backbone fragment isolated by gel purification. 2. E. coli cspA gene PCR amplified from pMONS56609 (Figure 8) vector. PCR primers : used left the Ncol site at the S' end of the gene and created a Sv=val and an Apal site at the 3'end. 3. Ligated PCR fragment and pMON61322 (Figure 11) backbone. Transformed into library efficiency DH5a. cells. Screened colonies using Apal arnd Nol to identify clones vith inserts. 4. Sequenced vector to confirm fidelity of the cspA germe and other selected regions of the plasmid. cspB

Construction of pMON73608 (Figure 12) 1. Vector pMONI61322 cut with Ncol and Apal to oper up backbone and drop out HVA1 gene. Backbone fragmerat isolated by gel purification. 2. Bacillus subtilis cspB gene PCR amplified from pMEON56610 vector. PCR primers used left the Nol site at the 5' end of the gene and created a Swwal and an Apal site at the 3'end. 3. Ligated PCR fragment and pMONG61322 backbone. “Transformed into library efficiency

DHS, cells. Screened colonies using Apal and Neo! to identifssy clones with inserts. 4. Sequenced vector to confirm CspB gene and other selected regions of the plasmid.

Example 11. Maize plant transformation.

Maize plants ca be transformed by methods known in the art, for e>~ample, see Examples 20-25 herein.

Example 12.

Analysis of transgenic plants for copy number will be done in the foellowing manner.

Leaf tissue is comllected from a young leaf, from as close to the base aas possible and from one side of the leaf. Sarnples are placed in 96-well plates lyophilized overnmight. Tissues are homogenized by placin g three 3 mm metal balls in each well and shaking u: sing a Mega Grinder at 1200 rpm for 2 minu tes. DNA is extracted using standard buffers contairming beta- mercaptoethanol, Tris buffered to pH 8, EDTA, NaCl, and sodium dodecyl sulfate. Extraction is performed with potassium acetate followed by chloroform and precipitatiora is performed with isopropanol. Followings centrifugation, washing with ethanol solution, and crying, DNA is resuspended in Tris-EIDTA buffer prior to further analysis.

DNA is digestesd with multiple restriction endonucleases and fragmeents are separated by non-denaturing agarose gel electrophoresis. DNA is denatured by NaOH solution. The gel is neutralized in NaCl-comtaining Tris buffer and blotted to nylon filters by campillary action. Nylon filters are pre-hybridize=d in buffered solution containing salmon sperm DNA prior to addition of appropriate probes, either radioactive or DIG-labeled. Following hybridizat=ion, blots are washed and detected by exposumre to autoradiography film or detection of DIG with anti-DIG antibody conjugates and appropriate substrates.

Example 13.

We are ussing the full length open reading ficame of cspA and cspB for expression in E. coli using vectorss (Novagen, an affiliate of Merck KX gaA, Darmstadt, Germarny) that allow synthesis and pur-ification of His-tagged antigen. Puarified antigen will be use d to generate polyclonal antibasdies using a commercial provider, for example Strategic Bi~osolutions.

Antibodies prodizaced will be used to test plants for expression of CSP proteimns.

Example 14.

Transgeric maize line advancement. Prim ary transformants are gen_erated in germplasm such as CORN OF GERMPLASM A, CORN OF (GERMPLASM C, and CORN OF

GERMPLASM ID. Primary transformants are selfe-d as well as backcrossed fo non-transgenic plants of the sare inbred genotype. Seed from selfed plants is planted in the= field and assayed by

Taqman zygositsy assay to identify putative homozzygous selections, putative : heterozygous selections, and nmegative selections, Putative hetero-zygous selections are cro=ssed with multiple plants of appropriate testers, e.g. CORN OF GERMPLASM B and CORN OF GERMPLASM D.

Hybrid seed is h_arvested, band shelled, and pooled by selection. Other breeclling methods may also be employe d, for example, see example 29 he rein.

Example 15.

Seedlingzs will receive a treatment that limits available water to a sullb-optimal level such that the treatment results in a measurable phenotypic response. For example=, this treatment could take the form of restricting the amount of water ower a number of days leading to a progressive water deficit, or the form of an acute deficit by oserotically stressing the see=dlings hydroponically or with a salt treatment. Transgene positive plants will be screened for an irmproved phenotypic response to the atreatment. The phenotypic respons:es measured may include shoot growth rate or dry weight accumulation during the treatment or feollowing a post-treatment= recovery period, wilting or wilt reecovery, and root growth rates ancl dry weight accumulatiorn. Those with improved response will be advanced to a field efficacy trial. Screens will require a nicumber of transgene positive and transgene regative plants to be grown in small pots in a controlled environment such as a growth chamber or greenhouse. The number of plants screenwed is dictated by the variance associated with treatments applied and phenotypes measured.

Example 16.

Field grown plants will receive a treatment that limits available water to a sub-optimal level such that the treatment resunlts in a measurable phenotypic response. For example, this treatment could take the form of restricting the amount of water available to the pleants over a number of days leading to a progzressive water deficit either during late vegetative cor early reproductive development of the: plants. Transgene positive plants will be screened for an improved phenotypic response to the treatment relative to transgene negative plant=s. The phenotypic responses measured may include shoot growth rate during the treatmermt, leaf wilting, grain yield, and ear yield compo nents such as kernel number and kernel weight. Thinose events with improved response will be advanced to a first year yield trial. Screens will be= applied at typical planting densities at two dryland field locations with controllable irrigatiorm. The number of plants screened is dictated by~ the variance associated with treatments applied ard phenotypes measured,

Example 17.

Several of the genes described will be cloned, transformed into plants, ancl be phenotyped in a marmer similar to the following (Examples 17-30). For example, nucleotides and nucleotides encoding SEQ ID NOS: 4-53.

Construction of the destination vector.

A GATEWAY™ Destination (Invitrogen Life Technologies, Carlsbad, C.A) plant expression vector was constructed (h)MONG65 154, Figure 13) using methods knov=vn to those of skill in the art. The elements o f the expression vector are summarized in Table 1 7. The backbone of the plasmid pMOEN65154 comprising the bacterial replication functi ons and an ampicillin resisteance gene expressed in E. coli were derived “from the plasmid pSK-. The plant expression elements in pMONG64154 are available to those of skill in the art and references are provided for each element in Table 17. All references in Talble 17 to location refer to base pair coordinates for e=ach element on the plasmid map disclosed im Figure 13. Generally, pMONG65154 coxnprises a selectable marker expression cassette comprising a Cauliflower

Mosaic Virus 35 S promoter operablly linked to a gene encocling neomycin phosphotransferase II (nptil). The 3’ region of the selectable marker expression ceassette comprises the 3’ region of tie

Agrobacterium #umefaciense nopaline synthase gene (nos) followed 3° by the 3’ region of the potato proteinases inhibitor II (pirIl) gene. The plasmid pMON 65154 further comprises a plant expression casse=tte into which a gene of interest may be inserted using GATEWAY™ cloning methods. The GGATEWAY™ cloning cassette is flanked 5° by a rice actin 1 promoter, exon and intron and flankeed 3° by the 3° region of the potato pinll gerae. Using GATEWAY™ methods, the cloning casseette was replaced by a gene of interest. The vector pMON65154 and derivaties= thereof comprising a gene of interest, were particularly useful in methods of plant transformation via direct DNA «delivery, such as microprjectile bombardment. One of skill in the art could construct an expmression vector with similar features using methods known in the art.

Furthermore, one of skill in the art would appreciate that otkner promoters and 3’ regions would be useful for expression of a gene of interest and other selectable markers may be used.

Table 17.

Elements of Plasmid pMON65154 [casseTTE | B TJFONCIION | ELEMENT =—TTOCATION | REFERENCE |} interest expression i . 1, intron 1

GATEWAY™ Recombination AnR1 3188-3312 GATEWAY ™Cloning ; cloning Technology Instruection

Manual (Invitrogen Life i Technologies, Carl=sbad, ! - CA :

Bacterial CmR gene 3421-4080 GATEWAY™Cloning chloramphemmnical Technology Instru- ction } resistance geene Manual (Invitrogen Life

Technologies, ~~ Carl=sbad, i CA :

Bacterial negative | ccdA, cedB | 4200-4727 GATEWAY™C Cloning L selectable markers genes Technology Instru=ction ! Manual (Invitrogen Life §

Technologies, ~~ Carlzsbad,

CA)

GATEWAY 4768-4892 GATEWAY ™Cloning

T™ recombiration site ‘| Technology Instnmction

Manual (Invitrogen Life §

Technologies, Carl_sbad, &

Kk Plant gene of | 3’ region Potato pinll 4907-5846 Anetal., 1989 interest expression 1 cassette

Plant selectable | Promoter Cauliflower 5895-6218 US Patent # 5352605 marker gene Mosaic ~~ Virus expression cassette 358

Selectable marker mr 6252-7046 US Patent # 6174724 ! gene : [| 3oregion [mos | 7072-7327 Bevan et al, 1983 j 1 3 wyegion | pill |7339-8085 Anetal., 1989 Mainenance in E.| Origin of re :plication | ColE1 858-1267 Oka et al, 1979 coli

Origin of replication 8273-3673 Ravetch et al., 1977 l coli

Maincerance in Ampicillin resistance bla 8909-551 Heffron et al., 1979 2 I NE S— oe]

A separate plasmid vector ((MON72472, Figure 14) was consstructed for use in

Agrobacterium mediated metzhods of plant transformation. The plasnmnid pRG76 comprises thme ge=ne of interest plant expression, GATEVWWAY™ cloning, and plant selectable marker -expression ca_ssettes present in pMONG65154. In addition left and right T-DNA border sequences from

Agrobacterium were added to the plasmic. The right border sequence is located 5’ to the rice ac=tin 1 promoter and the left border seque=nce is located 3’ to the pinll 3° sequence situmated 3° to thee npfl gene. Furthermore the pSK- bac=kbone of pMONG65164 was replaced by a pleasmid bamckbone to facilitate replication of the pRasmid in both E. coli and Agrobacterium turmefaciens.

Tie backbone comprises an oriV wide hawst range origin of DNA replication functional in

Agzrobacterium, the rop sequence, a pBR=322 origin of DNA replication functional in E.coli and a sspectinomycin/stretptomycin resistance gene for selection for the presence of the pla smid in bowth E. coli and Agrobacterium.

The elements present in plasmid v—ector pRG81 are described in Table 18.

Table 18. Genetic Elements of Plaasmid Vector pRG81 [CASSETTE [FUNCTION | ron | ESLEMENT | LOCATION | REFERENCE _

Et Plazant gene of Promoter Rice actin 1 5610-6452 Wangz et al., 1992 int=erest expression

Enhancer Rice actin 1 6453-6984 Wangs et al., 1992 § : e=xon 1, intron 1 ;

GAATEWAY™ Recombination A nRl 7002-7126 GATEWAYT™™(Cloning cloning Technology Irastruction ; Manual (Invitarogen Life §

Technologies, Carlsbad, }

CA i Bacterial C=mR gene 7235-7894 GATEWAY™ (Cloning ! chloramphenical Technology Imstruction resistance gene Manual (Invitrogen Life §

Technologies, Carlsbad,

CA

Bacterial negative | ccdA, ccdB 8014-8541 GATEWAY™4Cloning selectable markers | genes Technology Inestruction

Manual (Invitrogen Life

Technologies, Carlsbad,

CA

GATEWAY™ atfR2 8582-8706 GATEWAY™3Cloning : recombination site Technology In=struction

Manual (Invitrogen Life ! Technologies, -Carlsbad,

CA i 69 A

Tay arr ayee— _— OR — eT Car CCT CT REFER NCE 1 [Plant gene of 3 region Potato pinll | 8721-9660 An ef al., 1989 interest § expression : cassette

Plant selectable | Promoter Cauliflower 1-324 US Patent # 5352605 marker gene Mosaic Virus expression 358 cassette

Selectable marker ol 358-1152 US Patent # 6174724 : gene

I [3regon _____ |mes | 1781433 |Bevanetal, 1983 [oregon |pmmr | 14452191 |Anelal,1989

Agrobacterium DNA transfer Left border 2493-2516 Zambryski et al., 1982; mediated GenBank Accession ; fb transformation AJ237588

Maintenance of Origin of replicatiorx | Ori-V 2755-3147 Honda er al., 1988 plasmid in E. coli d or Agrobacterium ror dl a ki } plasmid in E. coli

Maintenance of Spectinomycin/ststr-ep | Spe/Str 4242-5030 Fling et al. , 1985 plasmid in E. coli tomycin resistance or Agrobacterium

Agrobacterium DNA transfer Right 5514-5538 Zambryski et al., 1982; mediated border GenBank Accession ronsformation | A lasses]

Example 18.

Coding sequences were amplified by PCR prior to insertion in a GATEWAY™

Destination plant expression vector such as pMON65154 (F igure 13). All coding sequences were available as either a cloned full length sequence or as DNA sequence information which allowed amplification of the desired sequence from a cDNA library. Primers for PCR amplification were designed at or ne=ar the start and stop codons of the coding sequence, in order to eliminate most of the 5’ and 3° urmtranslated regions. PCR products were tailed with atfB1 and 1@0 atB2 sequences in order to allow cloning by recombination into GAT EWAYT™ vectors (Invitrogen Life Technologies, Carlsbad, CA).

Two methods were used to produce atB flanked PCR amplified sequences of interest.

Both methods are described in detail in the GATEWAY™ Cloning Technology Instruction

Manu_al (Javitrogen Life Technologies, Carlsbad, CA). In_ the first method, a single primer set compmrising arB and template specific sequences was usec. The primer sequences are as followss: anB1 forward primer: 5? GC3G CAC TTT GTA CAA GAA AGC TGG GTN template specific sequence 3’ (SEQ ID

NO: 771) attB2 reverse primer 5° GC3GG CAC TTT GTA CAA GAA AGC TGG GTN template specific sequence 3° (SEQ ID

NO: =72)

Alternatively, atfB adapter PCR was used to prepare attB flanked PCR products— atBR adapter PCR uses two sets of primers, i.e., gene specific primers and primers to install thes aiB sequences. Desired DNA sequence primers were de=signed which included 12 base pairs 0° f the a~zB1 or atB2 sequences at the 5° end. The primers #that were used were as follows: atiB1 gene specific forward primer 5° C@CTGCAGGACCATG forward gene specific primer 3’ (SEQ ID NO: 73) atiB2 gene specific reverse primer 5" C@CTGCAGGCTCGAGCTA reverse gene specific prizmer 3’ (SEQ ID NO: 74)

The second set of primers were at/B adapter printers with the following sequences: arfB1 adapter forward primer 5" G-GGGACAAGTTTGTACAAAAAAGCAGGCTCC TGCAGGACCATG 3° (SEQ ID NO: 75) atfB2 adapter reverse primer 5'GESGGACCACTTTGTACAAGAAAGCTGGGTCCCTGCAGGCTCGAGCTA 3’ (SEQ IID

NO: 76) atB1 and atB2 flanked sequences were amplified by PCR according to the methods descstibed by Invitrogen Life Technologies (Carlsbad, CA). atB flanked PCR products were puri=fied and recovered from a gel as described above.

In some instances, atfB flanked sequences were mrecovered from PCR, but could not be insezxted into the Donor Vector using GATEWAY™ techhnology. Conventional cloning metho-ds usin_g ligases were used to insert a DNA sequence into an Entry Vector (Invitrogen Life

TecBonologies, Carlsbad, CA) when GATEWAY™ recommbination into the Donor Vector failed.

WED 2005/033318 E2CT/US2004/031856

The clhoice of Entry Vector depended om the compatibility of restriction endonuclease sites in the

Entry Vector and desired insert sequence. The Entry Vector was digested wilth a selected restrication endonuclease to remove the «cdB gene, dephosphorylated and gel purified. The selecteed restriction endonuclease depen.eded on the Entry Vector used and th-.e sequence of the desire=d insert sequence. For example, the ccdB gene was removed from pEMNTR11 (Figure 15) using FcoR1 or other combinations of restriction endonucleases such as Eco_ RV, and Xmal or

Neol =and Xhol. Other restriction nucleases could be used with other Entry \/ectors for use in the

GATESWAY™ process. To use restriction endonuclease digested Entry Vectors, it was necessary to be sable to produce compatible sticky ends on the desired PCR product. Sticky ends could be produ_ced by a number of methods known to those of skill in the art, such as restriction endormuclease digestion, adapter ligation or addition of restriction sites durinzg PCR.

In some instances, it was not po ssible to produce compatible sticky ends on a PCR fragm_ent and an Entry Vector. Alternatively, compatible sticky ends could te produced directed by restriction enzyme digestion of a cDNA clone. It was possible, however, to blunt end ligate

PCR Fragments into an Entry Vector. Using this method, the Entry Vector was cut with a restric=tion endonuclease to remove the «cdB gene. A gel purified linear Entery Vector was made blunt eended with T4 DNA polymerase. One of skill in the art is aware of otlmier methods of makirmg blunt ended DNA molecules, such as the use of Klenow DNA polymerase. The PCR produect was made blunt ended and preferably dephosphorylated by incubaticn with T4 DNA polynmerase, or another suitable polymewase, T4 polynucleotide kinase and a —phosphatase enzyme.

The E-ntry Vector and PCR product were blunt end ligated using methods kn-.own in the art.

Ligatieon products were transformed into E. coli and plasmids from individuaml colonies analyzed for pre=sence of the insert DNA and the «desired orientation relative to the atl. sites in the Entry

Vectomr. Clones with the azL1 sequence next to the amino end of the open re=ading frame were selected.

Preferably, the TA method of cloning PCR products (Marchuk ef al., 1991) was used when eB flanked PCR products could mot be inserted into a plasmid using CGATEWAY™ methoeds. The TA method takes advantage of Taq polymerase terminal trans—ferase activity. An

Entry “Vector was cut with a restriction endonuclease and made blunt ended 1asing the methods descritoed herein. The blunt ended linear Entry Vector was incubated with dI'TP and Taq polymerase resulting in the addition of a single thymidine residue at the 3’ end - of each DNA strand. Since Taq polyrmerase has a strong preference for dATP, PCR productss are most often produced with a single adenosine added to the 3° end. Therefore, the Entry Vesctor and PCR product have complime=ntary single base 3° overhangs. Following ligation under conditions 5s known to those of skill in the art, plasmids were transformed into E. coli. Plassmids were isolated from individual colonies and analyzed to identify plasmids with the desired in=sert in the correct orientation. Alternativeely, PCR products, tailed with artB sites were TA clone=d into a commercial TA cloningg vector, such as pGEM-T EASY (Promega Corporatio-n, Madison, WI).

All PCR ampliffication products were sequenced prior to introduction i_nto a plant. PCR inserts in Destination e=xpression vectors produced by GATEWAY™ methods were sequenced to confirm that the insertezd sequenced encoded the expected amino acid sequenc=e. If Entry Vectors were produced using ligation methods, the inserted sequence was sequenced i—n the Entry Vector prior to production of @the Destination expression vector using GATEWAY™ technology. Point mutations which did neot affect the amino acid coding sequence, i.e., silent mutations, were accepted.

Example 19. C onstruction of Expression Vectors

GATEWAY™ cloning methods (Invitrogen Life Technologies, Carlsbad, CA) were used to construct expressiora vectors for use in maize transformation. The GATEVWAY™ methods are fully described in the CGATEWAY™ Cloning Technology Instruction Manual (Invitrogen Life

Technologies, Carlsbad, CA). Use of the GATEWAY™ system facilitates hiigh throughput cloning of coding sequiences into a plant expression vector. Gene sequences flanked by attB1 and arfB2 sequences vevere produced by PCR as described above. Depending on which recombination sequenece, atfB1 and atB2, was placed 5’ and 3’ to the coding sequence, sense or antisense expression v—ectors were produced. A plant expression vector, pMCON65154 (Figure 13), into which any cosding sequence could be inserted in a sense or antisense= orientation was constructed as described in Example 1 and was used as a destination vector im the GATEWAY™ cloning process.

Two alternative processes were used for inserting a PCR amplified cosding sequence into a plant expression vector. In the first method, a PCR product comprising the coding sequence of interest flanked b=y a##B1 and a2 sequences at the 5° and 3’ eends was incubated with the donor vector (pDONR2@01™, Invitrogen Life Technologies, Carlsbadll, CA) in the presence of BP

CLONASE™. Ga ATEWAY™ entry clones were produced frosm this reaction and transformed into E. coli. Plasmmid DNA was isolated from entry clones. Inserted coding sequences could be sequenced from entry vectors in order to confirm the fidelity o»f PCR amplification. Plasmid

DNA, isolated freom entry clone E. coli colonies, was incubate d with linearized destination vector, preferably, pMONG65154, in the presence of LR CLON_ASE™ to produce plant expression vectors comprisimng the coding sequence of interest. DNA froem the LR CLONASE™ reaction was transformed into E. coli. Plasmid DNA from destination expression vectors was isolated and sequenced im order to determine correct orientation and se>quence of the plant expression vector.

In the sec=ond method of generating plant expression v-ectors, a PCR product flanked by arB1 and atfB2 -sequences was incubated with a donor vector= (PDONR201™, Invitrogen Life

Technologies, Caarlsbad, CA), and BP CLONASE™ as descri bed above. Following incubation, analiquot of the reaction mix was further incubated with linearized destination vector and LR

CLONASE™., Whe resultant DNA was transformed into E. ceoli and plant expression vectors containing the coding sequence of interest selected using PCIR or Southern blot analysis techniques knowwn in the art. Both methods of producting plant expression vectors comprising a coding sequence= of interest were described by Invitrogen Lifes Technologies (GATEWAY™

Cloning Technology Instruction Manual).

Alternati—vely, Entry Vectors were produced using restriction endonucleases and ligases.

Entry Vectors ar-eavailable from Invitrogen Life Technlogies (Carlsbad, CA). Each entry vector, e.g., pPENTR1A, pENTR2B, pENTR3C, pENTR4, and pENT R11, has unique cloning and expression features. pENTR11 was preferably used in the practice of te present invention.

Those of skill in the art will recognize the usefulness of the other Entry Vectors. Before using restriction endoraucleases and ligases to insert desired sequeneces into one of the Entry Vectors, it was necessary to restriction digest the Entry Vector on each sside of the ccdB gene. A number of different combirmations of restriction endonucleases were usec depending on the restriction sites present on the D*NA sequence to be inserted into the Entry Veector. Preferably the Entry Vector was dephosphor=ylated and gel purified after restriction digestzion. The desired DNA sequence was inserted irtito the Entry Vector using conventional mmethods of molecular ESiology known to those of skill i-m the art. TA cloning (US Patent No. 5,8=27, 657) is a preferable method of clonin=

PCR fragment=s into an Entry Vector.

Vectors (designated as pMON and a 5 digit number) aned coding sequence S contained ther~ein that were produced using the GATEWAY ™ cloning methods are, for example,

SEQ ID NOS : 4-28. It is expected that some of the ¢ oding sequences of tile present inventiomn may be cloned into a plant expression vectors using the methods described herein.

Example 20.

CORNI OF GERMPLASM A plants were growrm in the greenhouse. F=ars were harvested from plants when the embryos were 1.5 to 2.0 mm in lemngth, usually 10 to 15» days after pollination, ard most frequently 11 to 12 days after poll ination. Ears were starface sterilized by spraying or so-aking the ears in 80% ethanol, followed bey air drying. Alterna®ively, ears were surface sterilized by immersion in 50% CLOROX™ containing 10% SDS fo-r 20 minutes, followed by timaree rinses with sterile water.

Immature embryos were isolated from individua-1 kernels using methomds known to those of skill in the sart. Immature embryos were cultured on mmedium 211 (N6 salt=s, 2% sucrose, 1 mg/L 2,4-D, 0+.5 mg/L niacin, 1.0 mg/L thiamine-HCl, .91 g/L. L-asparagine -, 100 mg/L myo- inositiol, 0.5 gm/L MES, 100 mg/L casein hydrolysate, 1.=6 g/L MgCl, 0.69 g/I__ L-proline, 2 g/L

GELGRO™, oH 5.8) containing 16.9 mg/L AgNO3, (designated medium 21M V) for 3-6 days, preferably 3-4 days prior to microprojectile bombardme-=mnt.

Example 21.

Methocds of Agrobacterium mediated transforma tion of maize cells armd other monocots are known (Hi_ei et al, 1997; U.S. Patent No. 5,591,616= U.S. Patent No. 5,983 1,840; published

EP patent appl: ication EP 0 672 752). Although various strains of Agrobacter=~ium may be used (see referencess above), strain ABI is used preferably by the present inventors... The ABI strain of Agrobacteriun-2 is derived from strain A208, a C58 nopa._1line type strain, from which the Ti plasmid was eliminated by culture at 37°C, and further containing the modified Ti plasmid pMP90RK (Koncz and Schell, 198 6). An Agrobacterium tumefaciens binary vector ssystem (An et al., 1998) is preferably used to transform maize. Alternative cointegrating Ti plasmid vectors have been described (Rogers ef al. 1988) and could be used to transform maize. A toinary vedor comprising one or more genes of imnterest may be introduced into a disarmed Agrobacterium strain using electroporation (Wen~jun and Forde, 1989) or triparental mating (Ditta e # al., 1980).

A binary vector may contain a selectable marker gene, a screenable marker gene and/or one or more genes that confer a desirable phenotypic trait on the transformed plant. An exe=mplary binary vector, pMON30113, is shown in FIG. 4. Other binary vectors may be used aund are known to those of skill in the art.

Prior to co-culture of maize cells, Agrobacterium cells may be grown at 28°C in LB (DIFCO) liquid medium comprisirig appropriate antibiotics to select for maintenance of the modified Ti plasmid and binary vector. For example, ABI/pMON30113, may be grown inlB medium containing 50 ug/ml kanamycin to select for maintenance of the pMPIORK modified Ti plasmid and 100 ug/ml spectinomy/cin to select for maintenance of the binary vector pMON30113. It will be obvious to one of skill in the artto use appropriate selectior agents to maintain plasmids in the host Agrobacterium strain. Prior to inoculation of maize cells,

Agrobacterium cells are grown overnight at room temperature in AB medium (Chilteon ez al, 1974) comprising appropriate antibiotics for plasmid maintenance and 200 uM acetoasyringone.

Immediately prior to inoculation of maize cells, Agrobacterium are preferably pelleted by centrifugation, washed in 4 MSV medium (2.2 g/L. GIBCO (Carlsbad, CA) MS saluts, 2 mg/L glycine, 0.5 g/L niacin, 0.5 g/L L-pyridoxine-HCl, 0.1 mg/L thiamine, 115 g/L L-prosline, 10 g/L

D-glucose, and 10 g/L sucrose, pHE 5.4) containing 200 uM acetosyringone, and resu=spended at 0.1 to 1.0 x 10° cells/ml in ¥2 MSPPL medium (2.2 g/L GIBCO (Carlsbad, CA) MS salts, 2 mg/L glycine, 0.5 g/L niacin, 0.5 g/L L~pyridoxine-HCI, 0.1 mg/L thiamine, 115 g/L L-pramline, 26 g/L

D-glucose, 68.5 g/L sucrose, pH 5-4) containing 200 uM acetosyringone. One of ski” 1l in the art may substitute other media for 2 MSVI or /2 MSPL.

Immature maize embryos are isolated as described previously. Embryos are - inoculated with Agrobacterium 0-7 days after excision, preferably immediately after excision.

Alternatively, immature embryos may be cultured for more than 7 days. For examplee,

embryogenic callus may be imifiated as described above and eco-cultured with Agrobacter=ium.

Preferably, immature maize eambryos are excised, immersed —in an Agrobacterium suspension in % MSPL medium prepared ass described above and incubatec at room temperature with

Agrobacterium for 5-20 minuktes.

Following inoculatiom embryos are transferred to one=-half strength MS medium (Murashige and Skoog, 1962) containing 3.0 mg/L 2,4-dichl_orophenyoxyacetic acid (2,4—D), 1%

D-glucose, 2% sucrose, 0.115 g/L L-proline, 0.5 mg/L thianzine-HCl, 200 uM acetosyrirmgone, and 20 uM silver nitrate or silver thiosulfate. Immature emt>ryos are co-cultured with

Agrobacterium for 1 to 3 day~s at 23°C in the dark. One of s kill in the art may substitute other media for the described medi a.

Co-cultured embryos are transferred to medium 15A. A (462 mg/L (NH4)SO4, 400 mg/L

KH2PO4, 186 mg/L. MgS04—7H20, 166 mg/L CaCI2-2H20_, 10 mg/L MnS04-H20, 3 mg/L

H3B03, 2 mg/l. ZnS04-7H2€0, 0.25 mg/L. NaMo04-2H20, 3.025 mg/L. CuS04-5H20, 0.025 mg/L CoCI2-6H20, 0.75 mgL KI, 2.83 g/L KNO3, 0.2 mg/L niacin, 0.1 mg/L thiamines-HCl, 0.2 mg/L pyridoxine-HCl, 0.1 m g/L D-biotin, 0.1 mg/L choline chloride, 0.1 mg/L calcium pantothenate, 0.05 mg/L folic acid, 0.05 mg/L p-aminobenz=oic acid, 0.05 mg/L riboflav-in, 0.015 mg/L vitamin B12, 0.5 g/L caasamino acids, 33.5 mg/L Na2BEDTA, 1.38 g/L L-proline, 2.0 g/L sucrose, 10 g/L D-glucose), or MS medium containing 1.5 ng/L 2,4-D, 500 mg/L. carbe-micillin, 3% sucrose, 1.38 g/L, L-proli ne and 20 uM silver nitrate or ssilver thiosulfate and culture d for 0 to 8 days in the dark at 27°C without selection. Culture media= used for selection of transfcomants and regeneration of plants preferably contains 500 mg/L carrbenicillin. One of skill in tte art may substitute other antibiotics thmat control growth of Agrobactezrium. Other culture media ®that support cell culture may be 13sed alternatively. In the absenece of a delay of selection (0 «day culture), selection may be initiated on 25 mg/L paromomyc in. Selection medium may comprise medium 211 (described above) or a variant of medium 211 in which N6 salts are replaceed by MS salts. After two weeks, embaryogenic callus are transferred unto culture medium containin_g 100 mg/L paromomycin and subcultured at about two week intesrvals. When selection is delayed following co-culture, embryos are initially cultured on med®um containing 50 mg/L paromomycin followed by stabsequent culture of embryogemnic callus on medium contaiming 100- 200 mg/L paromomycin. Orae of skill in the art will culture= tissue on concentrations of q7 paromomycin which inhibit growth of cells lacking the selectable marker gene, but= a concentration on which transformed callus will proliferate. Alternatively, one may= use other selectable markers to identify transformed cells. It is believed that initial culture om 25 to 50 mg/L paromocyin for about two weeks, followed by culture on 50-200 mg/L parormoycin will result in recovery of transformed callus. Transformants are recovered 6 to 8 week=s after initiation of selection. Plants are regenerated from transformed embryogenic calhas as described above for transformants recovered following microprojectile bombardment.

Example 22. Agro=bacterium Mediated Transformation of Maize Callus

This examyple describes methods for transformation of maize callus using ~4grobacterium.

The method is exesmplified using an npfII selectable marker gene and paromomycHn selective agent. One of skill in the art will be aware of other selectable marker and selectiv—e agent combinations that could be used alternatively.

Callus wass initiated from immature embryos using methods known to thosse of skill in the art. For example, 1.5 mm to 2,0 mm immature embryos were excised from develeaoping maize seed of a genotype such as CORN OF GERMPLASM A and cultured with the enmbryonic axis side down on medllium 211V, usually for 8-21 days after excision. Alternatively, established an established callus culture may be initiated and maintained by methods known to t#hose of skill in the art.

Agrobacte rium was prepared for inoculation of plant tissue according to tthe methods described in Example 21. Fifty to 100 pieces of callus was transferred to a 60 mm X 20 mm petri dish containing atoout 15 ml of Agrobacterium suspension at 0.1 to 1.0 x 10° cfu/rml. A piece of callus was usually all of the callus produced by an immature embryo in up to 21 dllays of culture or a piece of established callus of 2 mm to 8 mm in diameter. Callus was incubat=ed for about 30 minutes at room temperature with the Agrobacterium suspension, followed by removal of the liquid by aspiratiown.

Abwout 50 pL of sterile distilled water was added to a Whatman #1 filter paper in a 60 mm x 20 mm poetri dish. After 1-5 minutes, 15 to 20 pieces of callus were trarnsferred to each filter paper and th_e plate sealed with PARAFILM®, for example. The callus and Agrobacterium were co-cultured #for about 3 days at 23°C in the dark.

Calli were transferred from filter paper to mec3ium 211 with 20 pM silver nitrate and 500 mg/B_ carbesicillin and cultured in the dark at 27°C €028°C for 2-5 days, preferably 3 days. Selection was initiated by transferring callus to medium 211 containing 20 pM sil ver nitrate, 500 rmg/L carbenicillin and 25 mg/L, paromomycin. ~After 2 weeks culture in the dark at 27°C to 28°C , callus was transferred to medium 211 with 20+ pM silver nitrate, 500 mg/ML carbenicillin_ and 50 mg/L, paromomycin (medium 21 1QRG)s. Callus was subcultured after two weeks to fre=sh medium 211 QRG and further cultured for two weeks in the dark at 27°C to 28°C.

Callus was tBhen transferred to medium 211 with 20uM silve=r nitrate, 500 mg/L carbenic=illin and 75 mg/L par-omomycin. After 2-3 weeks culture in the dark at 27°C to 28°C, paromom>=y cin resistant calBus was identified. Ope of skill in the art would recognize that times between subcultures wof callus are approximate and one may be able t~o accelerate the selection process by transferring tissue at more frequent intervals, e.g., weekly ramther than biweekly.

Plansts were regenerated from transformed callus, tra- nsferred to soil and grown in the greenhouse -as described in Example . Following Agrobactezrium mediated transformation, 15° medium 2137 (see Example 9) further contained 500 mg/L cearbenicillin and medium 12777 (see

Example 9) further contained 250 mg/L carbenicillin. Transsformed maize plants comp-xising genes of the= present invention that were produced using Agmrobacterium mediated transformation are summar_ized in table Y.

Example 23. Methods of microprojectile bombardment

App=roximately four hours prior to microprojectile beombardment, immature embryos were transferred ®o medium 211SV (medium 211V with the addiwtion of sucrose to 12%). Tvoventy five immature embryos were preferably placed ina 60 x 15 mm petri dish, arranged ina 5 >< 5 grid with the col. eoptilar end of the scutellum pressed slightly in&to the culture medium at a 220 degree angle. Tisswue was maintained in the dark prior to bombardment. . Prior to microprojectile bombardment, a suspension. of gold particles was prepasred onto which the d=esired DNA was precipitated. Ten milligrams coef 0.6 um gold particles (BioRad) were suspermaded in 50 pL buffer (150mM NaCl, 10 mM Tris-HCl, pH 8.0). Twenty fiwwe pL ofa 2.4 nM solution of the desired DNA was added to the suspe=nsion of gold particles and gently vortexed fomr about five seconds. Seventy five pL of 0.1M sspermidine was added and tlhe solution vortexed ge=ntly for about 5 seconds. Seventy five pL of a 225% solution of polyethylerme glycol

(3000-4000 molecular weight, American Type Culture Collection) was adde=d and the solution was gently vortexed for five seconds. Seventy five pL of 2.5 M CaCl, was - added and the solution vortexed for five seconds. Following the addition of CaCly, the soRution was incubated at room temperature for 10 to 15 minutes. The suspension was subsequently centrifuged for 20 seconds at 12,000 rpm (Sorval MC-12V centrifuge) and the supernatant dis-carded. The gold particle/DNA pellet was washed twice with 100% ethanol and resuspended. in 10 mL 100% ethanol. The gold particle/DINA preparation was stored at-20°C for up to t=wo weeks.

DNA was introduced into maize cells using the electric discharge p article acceleration gene delivery device (US Patent No. 5,015,580). The gold particle/DNA swuspension was coated on Mylar sheets (Du Pont My lar polyester film type SMMC2, aluminum cated on one side, over coated with PVDC co-polymesr on both sides, cut to 18 mm square) by dispoersionof 310 to 320 pL of the gold particle/DNA suspension on a sheet. After the gold particle= suspension settled for one to three minutes, excess ethanol was removed and the sheets were air dried. Microprojectile bombardment of maize tissue was conducted as described in U.S. Patent N&o. 5,015,580. AC 1S voltage may be varied in the electric discharge particle delivery device. Foor microprojectile bombardment of CORN OF GERMPLASM A pre-cultured immature embmryos, 35% to 45% of maximum voltage was preferably used. Following microprojectile bomba-rdment, tissue was cultured in the dark at 27°C. 2a» Example 24. Selection of trans formed cells

Transformants were selected on culture medium comprising paromomycin, based on expression of a transgenic neomycin phosphotransferase II (nprII) gene. Twenty four hours after

DNA delivery, tissue was transferred to 211V medium containing 25 mg/[_ paromomycin (medium 211HV). After three weeks incubation in the dark at 27°C, tissuze was transferred to 2S medium 211 containing 50 mg/L paromomycin (medium 211G). Tissue v=vas transferred to medium 211 containing 75 mg/L. paromomycin (medium 211XX) after thmree weeks.

Transformants were isolated following 9 weeks of selection. Table Y disk: coses results of transformant experiments using the methods of microprojectile bombardnent disclosed herein.

Example 25. Regeneration of fertile transgenic plants

Fertile transgenic plants were produced from transformed maize cells. Transformed callus was transferred to medium 217 (N6 salts, 1 mg/L thiamine-HCI, 0.5 mg/L. niacin, 3.52 mg/L benzylaminopurine, 0.91 mg/L- L-asparagine monohydrate, 100 mg/L myo—inositol, 0.5 g/L

MES, 1.6 g/L MgCl,-6H,0, 100 mg/”L casein hydrolysate, 0.69 gL L-proline, 20 g/L sucrose, 2 g/L GELGRO™, pH 5.8) for five to seven days in the dark at 27°C. Somatic emabryos mature and shoot regeneration began on meclium 217. Tissue was transferred to medivwrw 127T (MS salts, 0.65 mg/L niacin, 0.125 mg/L ~pyridoxine-HCI, 0.125 mg/L thiamine-HCl, 0.125 mg/L Ca pantothenate, 150 mg/L L-asparaginee, 100 mg/L myo-inositol, 10 g/L glucose, 2-0 g/L L-maltose, 100 mg/L paromomyecin, 5.5 g PHY TAGAR™, pH 5.8) for shoot development. Tissue on medium 127T was cultured in the light at 400-600 lux at 26°C. Plantlets are tramsferred to soil, preferable 3 inch pots, about four to 6 weeks after transfer to 127T medium wheen the plantlets are about 3 inches tall and have roots. Plants were maintained for two weeks in a growth chamber at 26°C, followed by two ~weeks on a mist bench in a greenhouse before transplanting to 5 gallon pots for greenhouse grov=vth. Plants were grown in the greenhouse toe maturity and reciprocal pollinations were made vavith the inbred CORN OF GERMPLASM A... Seed was collected from plants and used for fRurther breeding activities.

Example 26. Isolation of Nucleic Acids from Plants

Nucleic acids were isolated from leaf tissue of RO plants, collected and —flash frozen in a 96 well collection box, 0 to 2 weekss after plantlets were transferred to soil. Approximately 100 milligrams of tissue was collected from each plant and stored at —80°C until analysis.

DNA and RNA were isolate=d from a single tissue sample using the Qiaggen Rneasy 96™ kit (Qiagen Inc., Valencia, CA) witTh modifications. One hundred milligrams of" frozen tissue was homogenized in 700 pL Rneasy™ BRTL buffer (Qiagen Inc., Valencia, CA) usimng a Bead

Beater™ (Biospec Products, Bartlesville, OK). Samples were centrifuged at 3200 rpm for 15 minutes and all of the supernatant transferred the wells of a Promega WIZARI™ clearing plate (Promega Corporation, Madison, WI). The sample solutions were clarified by wacuum filtration through the clearing plate, The cleared supernatant was used for nucleic acid extractions.

For DNA extractions, 70 uL of the cleared sample vwas transferred to a v-well PCR plate, covered with a_dhesive foil, and heated to 95°C for 8 minutess. The samples were incubated at 0°C for five m-inutes, followed by centrifugation for 3 minutes to remove insoluble materials. A

Sephadex G-5%0 gel filtration box (Edge Biosystems, Gaithe=rsburg, MO) was conditioned for 2 min at 2000 rpem. Forty pL of the heat-treated supernatant was loaded into each well and the box centrifuged fom two minutes at 2500 rpm. An additional 20 pL of TE buffer was added to the column effluemnt and the sample plate was stored at ~20°C umntil analysis.

For RJA extractions, five hundred microliters of cleeared solution was transfer to a clean 96 well samplee box. Two hundred and fifty microliters of 1 00% ethanol was added to each sample and thes sample was thoroughly mixed. All of the agpproximately seven hundred and fifty microliters of : solution was then loaded into the wells of a (Qiagen Rneasy™ binding plate in a

Promega WIZ. ARD™ filtation unit. Five hundred microliters of RW1 buffer (Qiagen Inc.,

Valencia, CA» was added to each well and the buffer remowed by vacuum filtration. Eighty microliters of “RN Aase free DNAase (Qiagen Inc., Valencien, CA) was added to each well, incubated at rc>om temperature for 15 minutes the DNAase solution drawn through the wells by vacuum filteramtion. An additional five hundred microliters RW1 buffer (Qiagen Inc., Valencia,

CA) was adde-d to the wells and the buffer removed by vacmuum filtration. The sample was further washed by vacuum filtration with 500 uL RPE buffer 2X (Qiagen, Valencia, CA). The extraction plate was placed on a microtiter plate and centrifuged for three minutes at 3000 rpm to remove any residual RPE buffer solution in the filter. Eighaty microliters of RNA grade water (DNAse free) was added to each well, followed by incubation at room temperature for two minutes. The extraction plate and microtiter plate were certrifuged for three minutes at 3000 rpm and the R_NA preparation stored frozen in the collectiosn plate at —80°C.

Example 27. Assays for copy number

Copy number of transgenes in RQ plants wa_s determined using TAQMAN® methods. The -pMON65154 and pRG76 GATEWAY ™ destination vectors were constructed with _ a sequence der—ived from the 3’ region of the potato pinll geene which could be used to assay copy pumber of trarasgene insertions. The pinll forward and reverse primers were as follows:

Forward primer 5’ ceccaccetgeaatgtga 3’ (SEQ ID NO: 77)

Reve=rse primer 5’ tgtgcatccttttatttcantacattaattaa 3° (SEQ ID N@O: 78)

The gpinll TAQMAN® probe sequence was 5° cotagacttgtccatctictggattggeca 3 * (SEQ ID NO: 79)

The probe was labelled at the 5’ end with the fluorescent dye FAM (C6 carboyxfluo-rescein) and the quencher dye TAMR A (6-carboxy-N,N,N N°. tetramethylerhodamine) was attached via a linker €o the 3° end of the probe. The TAQMAN® probe was aebtained from Applied Biosystems (Foster City, CA). __ SAT, -asingle copy maize gene was ussed as an intemal control in TAQMATN® copy number assays. Che SAT primers were as follows

Forward primer 5° gectgecgocagaccaa 3° (SEQ ID NO: 80)

Reverse primer 5° atgcagagactcagcttcate 3° (SEQ ID MO:81)

The SAT TAQMAN® probe sequence was 5° tecagtacgtgeagteectectee 3° (SEEQ ID NO: 82) the gorobe was labelled at its 5’ end with tthe fluorescent dye VIC™ e{ Applied Biosystems,

Foster City, CA) and the quencher dye TAMRA at is 3’end.

TACOMAN® PCR was performed according to the manufacturer’s instructions (Applied

Biosystems: , Foster City, CA). Five to 100 nanograms DNA was used in exch assay. PCR amplification and TAQMAN® probe detection wvere performed in 1X TACQMAN® Universal

PCR Maste=r Mix (Applied Biosystems, Foster C ity, CA) which contains A" mpliTaq Gold® DNA polymerase=, AmpErase® UNG, dNTPs with dUTP, Passive Reference 1, a-nd optimized buffer.

Eight hundmred nM each forward and reverse pink primers and 150 nM pinR1 TAQMAN® probe were used in the TAQMANG® assay. 200 nM each Sat forward and reverse= primers and 150 nM

Sat TAQM_AN® probe were used in the TAQM.AN® copy number assay. TAQMAN® PCR was carried out for 2 minutes at 50°C, 10 minutes at 95°C, followed by 40 cycles of 15 seconds at 95°C ancl one minute at 60°C. Real time TAQMAN® probe fluorescence was measured using an ABI Prissm 7700 Sequence Detection System or ABI7900HT Sequence “Detection System (Applied Biosystems, Foster City, CA). Cr values were calculated accordi ng to the TAQMAN®

EZ RT-PCIR kit instruction manual (Applied Biosystems, Foster City, CA). The AA Crvalue was calculamted as Cy (internal control gene (Sat))) - Cr (transgene) - Cr (inte=mal control gene (Sat)

in nontransgenic plant). The copy number vovas assigned as follows according to the criteria in

Table 12.

Table 19. Critera for Copy Number Determination by TAQMAN® sa —

SN Es

Plants comprising genes of the present invention will be any alyzed by TAQMAN® methods for copy number. Southern blot analysis to confirm the TACQMAN® copy number determination in ambout 80% of the plants that were analyzed by both. TAQMAN® and Southern blot hybridization .

Example 28. Assays for gene expression : Expressior of a trausgene of the present invention was assayed by TAQMAN® RT-PCR using the TAQMAAN® EZ RT-PCR kit from Applied Biosystems (Foster City, CA). RNA expression was as-syed relative to expression in a transgenic standarcl, a transgenic maize event designated DBT4 18, comprising a B. thuringiensis crylAl gene oper-ably linked to a pinll 3° untranslated region. The DBT418 event expresses the crylAl gene at a level which confers commercial levels of resistance to lepdiopteran insects such as European Corn Borer and was commercially solc3 by DEKALB Genetics Corporation under the brand name DEKALBt®. The pMONG65154 and pRG76 GATEWAY™ destination vectors were constructed with a sequence derived from the 3B’ region of the potato pinll gene which could be used to assay transgene transcript levels for any coding sequence inserted into the Destination Vector. The pinlI primers and probe previou_sly described in were used for TAQMAN® RT-PCR. Ubiquitin fusion protein (UBI) RNA was u_sed as an internal control in all TAQMAN® RT-PCR assays. The UBI primers used were as follows:

For-ward primer 5° cgtetacaatcagaaggegtaate 3° (SEQ ID NO: 83)

Rew/erse primer 5’ ccaacaggtgaatgettgatagg 3° (SEQ ID NO: 84) ' The sequer—ace of the UBI TAQMAN® probe was

: 5° catgegecgctttgmactte 3° (SEQ ID NO: 85)

The UBI TAQMAN® probe was labeled at its 5’ end with tine fluorescent dye VIEC™ (Applied Biosystems, Foster CRty, CA) and the quencher dye TAMIR A atis 3° end

Reverse transcription, PPCR amplification and TAQMAN® probing were performed according to the one step proce=dure described in the TAQMAN® E-Z RT-PCR kit (AppRied

Biosystems, Foster City, CA). Five to 100 nanograms total RNA w~as used in each assawy. In vitro transcribed control RNA from the DBT418 event was includes as a control on evecry plate and run over a concentration range from 0.01 picograms to 10 picogzrams. Total RNA farom

DBT418 leaf and from the norm-transgenic inbred CORN OF GERMPLASM A were rusn as positive and negative controls respectively. RT-PCR was performe=d in TAQMAN® EZ Buffer (50 mM Bicine, 115 mM potasssium acetate, 0.01 mM EDTA, 60 nM Passive Referenc-e 1, 8% glycerol, pH 8.2, Applied Biossystems, Foster City, CA) containing 3 mM manganese acetate, 300 uM each dATP, dCTP, dGTP, and dUTP, 100 units rTth™ (Applie=d Biosystems, Foster City,

CA) DNA polymerase, and 25= units AmpErase UNG (Applied Bio sytems, Foster City, CA). RT-

PCR was carred out as followss: 2 minutes at 50°C, 30 minutes at 6-0°C, 5 minutes at 95 °C, followed by 40 cycles of 20 seconds at 95°C and 1 minute at 60°C 400 nM each forwzard and reverse primers were used for amplification of the pinll sequence a-nd 200 nM TAQMARN® pinll probe used for detection. UBE RNA was amplified using 400 nM each forward and rev—erse primers and 200 nM UBI TACOQMAN® probe was used for detectiosn. TAQMAN® flucorescence was measured using an ABI Prism 7700 Sequence Detection Syste 1m or ABI7900HT Se=quence

Detection System (Applied Biosystems, Foster City, CA). Expresssion of transgenes of the present invention was quantiteated relative to transgene expression Jin DBT418 and repo=xted as a ratio of transgene expression to DBT418 expression, i.e., 242Cy) (@ransgene) / 244*Cy) (CDBT418).

Example 29. Plant Breeding

Backcrossing can be u_sed to improve a starting plant. BacE«crossing transfers a specific desirable trait from one source= to an inbred or other plant that lacks that trait. This can be accomplished, for example, by first crossing a superior inbred (A) (recurrent parent) to a donor inbred (non-recurrent parent), which carries the appropriate gene(ss) for the trait in quesstion, for example, a construct prepared im accordance with the current invention. The progeny of this cross first are selected in the ressultant progeny for the desiredtrait to be transferred from the rmon- recurrent parent, then the selected progeny are mated back to the superior recurrent parent (Ap.

After five or more backcross gesnerations with selection for the desired trait, the progeny are = hemizygous for loci controlling the characteristic being transferred, but are like the superior parent for most or almost all other genes. The last backcross generation would be selfed to give progeny which are pure breedirg for the gene(s) being transferred, i.e. one or more transformation events.

Therefore, through a se Xies of a breeding manipulations, a selected transgene may be 1 0 moved from one line into an extirely different line without the need for further recombinant manipulation. Transgenes are valuable in that they typically behave genetically as any other gene and can be manipulated by bre eding techniques in a manner identical to any other corn gene.

Therefore, one may produce irmbred plants which are true breeding for one or more transgenes.

By crossing different inbred pL ants, one may produce a large number of different hybrids with ®m5 different combinations of transgenes. In this way, plants may be produced which have the desirable agronomic properties frequently associated with hybrids (“hybrid vigor”), as well asthe desirable characteristics impar-ted by one or more transgenes).

It is desirable to introg-ress the genes of the present invention into maize hybrids for characterization of the phenotsype conferred by each gene in a transformed plant. The host genotype into which the transgzene was introduced, preferably CORN OF GERMPLASM A, isan elite inbred and therefore only~ limited breeding is necessary in order to produce high yieldin g maize hybrids. The transformmed plant, regenerated from callus is crossed, to the same genotype, e.g., CORN OF GERMPLASIM A. The progeny are self pollinated twice and plants homozygous for the transgene are identifiecl. Homozygous transgenic plants are crossed to a testcross parent =5 in order to produce hybrids. The test cross parent is an inbred belonging to a heterotic group which is different from that off the transgenic parent and for which it is known that high yielading hybrids can be generated, for «example hybrids are produced from crosses of CORN OF

GERMPLASM A to either CORN OF GERMPLASM E or CORN OF GERMPLASM B. -30 Example 30. Methods of EvaRuating Phenotype

WE) 2005/033318 } PCT/US2004/031856

Expression of the genes of the present invemtion leads to various phenotypes as disclosed hereir in transformed cells and plants. Phenotypic data is collected during the transformation proce:ss in callus as well as during plant regeneratieon, as well as in plants and progeny.

Phencotypic data is collected in transformed callus —relating to the morphological appearance as well zs growth of the callus, e.g., shooty, rooty, starchy, mucoid, non-embryogenic, increased growth rate, decreased growth rate, dead. It is expected that one of skill in the art may recognize other= phenotypic characteristics in transformed ca lus.

Phenotypic data is also collected during thwe process of plant regeneration as well as in regemnerated plants transferred to soil. Phentoypic data includes characteristics such as normal plansts, bushy plants, narrow kaves, striped leavess, knotted phenotype, chlorosis, albino, antheocyanin production, buggy whipped (a phenosmenon known to the art in which the most recemntly emerged leaves are elongated and wrap around each other), or altered tassels, ears or rootss. It is expected that one of skill in the art ma-y recognize other phenotypic characteristics in transsformed plants.

A wide variety of phenotypes are monitomred during the process of plant breeding and testing in both inbred and hybrid plants. For example, in RO and R1 plants (plants directly regenerated from callus and the direct progeny o—fthose plants), plant type (general morphological chamracteristics such as those described above for plantlets) and nutritional composition of grain pro=duced by the plants are recorded. Nutritional composition analysis may include amino acid comnmposition, amount of protein, starch and oil, Characteristics of protein, starch and oil, fiber, ash __ mineral content may all be measured. It is e=xpected that one of skill in the art may include anaalyses of other components of the grain. InR=2 and R3 plants, days to pollen shed, days to silkzing, and plant type are observed. Furthermore, metabolite profiling of R2 plants is corducted. Using methods available to those off skill in the art, 50 to 100 or more metabolites may be analyzed in a plant, thereby establishing a metabolic fingerprint of the plant. In addition in MR3 plants, leaf extension rate is measured uneder field conditions. A variety of phenotypes will be assayed in hybrids comprising a transgene of the present invention. For example, yield, moisture, test weight, nutritional composition, echlorophyll content, leaf temperature, stand, see=dling vigor, plant height, leaf number, tilleri_ng, brace roots, stay green, stalk lodging, root locdging, plant health, barreness/prolificacy, gre=en snap, pest resistance (including diseases,

virmses and insects) and metabolic profiles will be recorded. In addition, phenotypic chamgoteristics of grain harvested from hybrids will be recorded, incltading number of kernels per row on the ear, number of rows of kernels on the ear, kernel abortion, kernel weight, kernel size, kerrel density and physical grain quality. Furthermore, characteristics such as photosynthesis, leaf area, husk structure, kemel dry down rate and internode length nay be measured in hybrids or imbreds. It is expected that transcriptional profiling may be performed on transgenic plants expressing genes of the present invention.

In order to determine hybrid yield in transgenic plants expres=sing genes of the present invesntion, it is recognized that hybrids must be tested at multiple locations in a geographical location where maize is conventionally grown, e.g., Iowa, Illinois or other locations in the mid® western United States. It is expected that more than one year of wield testing is desirable in order to identify transgenes which contribute to improvement of a maize hybrid. Therefore, trammsgenic hybrids will be evaluated in a first year ata sufficient number of locations to identify at least an approximately 10% yield difference from a non-transgenic hybrid counterpart. A second year of yield tests is conducted at sufficient locations and witth sufficient repetitions to be ables to identify a 4-5% yield difference between two hybrids. Furthesrmore, in the second year of yiel d tests, hybrids will be evaluated under normal field conditions a=s well as under stress conditions, e.g., under conditions of water or population density stresss. One of skill in the art kno-ws how to design a yield trial such that a statistically significant wield difference canbe dete=cted between two hybrids at the desired rate of precision.

Exa-mple 31. Surface sterilization and imbibition of corn seeds.

For each transgenic lot, surface sterilize about 50 corn seeds by putting them in a sterile 500 ml Eirlenmyer flask with 50 ml of 30% bleach (sodium hypochlorite solution = Chlorox or equi valent) solution containing 0.01 % triton X-~100 and rotating the flask on an orbital shaker for 5 minutes. Then pour off the bleach solution and wash with about 1000 ml of sterile deionized watesr and pour off the water wash. Repeat the sterile water wash 4 nore times, leaving the last water wash on the seeds. Incubate the seeds in this water at room termperature for 24 h for imbibition under air bubbling (pass through 0.2 pm filter).

LL Preparation of media in Phyto®rays.

Prepare water — agar media for several Phytotray=s. We are using Phytotray II (or _plastic box: 60 x 30x 15 cm) in the inverted position so that thes larger depth side of the vessel izs on the s bottom and the smalle-r side is used as the lid. Prepare emnough water — agar media for 1040 ml per

Phytotray by autoclaving 0.3% BactoAgar in deionized water for 45 minutes on the liqui-d cycle.

Cool the media to the extent it can be handled easily ancl pour approximately 100 ml per

Phytotray while still molten.

JL Corn cold seedling vigor assazy. e When the media has solidified, bring_ it and the sterile seeds to a lamimnar flow hood. e Ussing sterile forceps, select 20 healtiy, most uniform seeds and place the seeds in each TPhytotray used for the assay, spacing the seeds evenly so that any individuals camn be easily removed later. e Plzace seeds so that the embryo side i=s diagonally inserted downward and the seed is just urader the surface of the agar. In thiss position, the emerging shoot anad root will be able to directly elongate without crampimg. e Inacubate the seeds in the media at 222°C for one week, or until most o -f'the seeds have ex—truded radicles and are beginning ~to emerge from the agar. e Remove all but the 10 most uniformly grown seedlings in a laminar low hood. « Shift the Phytotrays to a cold plant growth chamber set at 10°C with 16 hour day cycle andl incubate there for 2 weeks. 255 ¢ Shift the Phytotrays back to 22°C fomr one week. e R_emove seedlings, measure root lergth and shoot length for every seedling, and measure fresh weight g/3 seedlings record iin notebook.

Adaptaticon for cold germination and emergeence assay. 380 Same as abowe with the following exceptions:

o Afier the last water wash in I, place the flasks at 10°C during the overnight imbibition step. Also prechill the Phytotrays with solidified media at 10°C. e After seeding the chilled Phytotrays with cold imbibed seeds, they are put directly into the 1 O°C chamber. eo After about 5 days, remove all but the 10 most uniformly germinated seeds, those whose radiczles are about the same length. Return Phytotrays to 10°C chamber for 1-2 weeks. Remove seedlings, measure root length and shoot length for every seedling, and measure fresth weight from every 3 seedlings, record in notebook. e Shift the the 2™ set Phytotrays to 22°C for | week.

Remove seedlings, measure root length and shoot length for every seedling, record in notebook.

Example 31. Creation of plasmids for transformation of soybean.

ExampkRe (for CspA and B constructs — pMON73983 and 73984)

PMON73983 (Figure: 18) is a binary vector for Agrobacterium-mediated transformation and constitutive expression of a protein (SEQ ID NO: 1) like Bacillus subtilis CspA in Soybean. To clone the B. subtilis CspA gene, two gene-specific primers, MSA452 and MSA453 were designed based on the Cspd sequence information (Genbank # M30139) from the National

Center for Biotechnology” Information, which is part of the National Library of Medicine, in turn part of the National Instit-utes of Health (NCBI). The sequence for MSA452 is

GCGCAGGCCTAGATGTACCATGTCCGGTAAAATGACTGGTATCGTAAAATGG (SEQ

ID NO: 86), which annea ls at the translational start site of Csp4 and introduces Stw/ and Bgl! sites at the 5° end, while gthe sequence of MSA453 is

CGCGAATTCGGATCCTTATTACAGGCTGGTTACGTTACCAGCTGCC (SEQ ID NO: 87),

which ameals ave the last codon of CspA and introducess BamHI and EcoRI sites at the end of the primer. The reve=rse primer MSA453 was designed to natch the 3° end of the Geenbank gene sequence. The F>CR reaction was carried out using primers MSA452 and MSA4-53, High Fidelity

Taq Polymerase= (BRL) and pMONS57397 (Figure 3) ass the template. This tempM ate differs at the 3’end of the gerne CspA, from that of the GeneBank sequence. The amplified C=spB DNA was purified by gel- -electrophoresis and ligated to pCR-XL~TOPO vector (Invitrogemmn). The ligation reaction was treansformed into E.coli Topl0 cells (Invitrogen) as per manufactu—rer’s protocol.

Four transformsant colonies were picked and miniprep DNA was prepared usingz Qiagen Miniprep

Kit. The insertss were sequenced using M13-specific F-orward and Reverse primers. Clone with the correct sequence was named pMON73981 and used for further subcloning...

PMON738°81 DNA was digested with Stul and BamHI to isolate the CspA_ gene fragment. pMON73980 TONA was digested with Stul and BamBa1 sequentially, and then gpurified by Gene

Clean II kit. Te CspB fragment and this purified vector pMON73980 were ligated and the ligation reacticon was electrotransformed into E.coli IDHIOB cells. The transfomrmants were selected on Speectinomycin containing media. The mimniprep DNA was prepare=d from the trasformants amnd the DNA was checked for the presemnce of the insert by using : CaMV358- promoter-spec ific forward primer. The clone containing this insert was named as pMON73983.

A larger DNA. prep was made and a series of confimmatory digests were carrie=d out, including

Bglll, EcoRl, WPstl, EcoRI+BamHI, Stul+Xhol. Theses confirmed the correct c-loning. pMOTNN73984 is a binary vector for Agrobactezrium-mediated transformation and constitutive expression of a protein (SEQ ID NO: 2) like Bacillus subtilis CspwB in Arabidopsis.

To clone the a8. subtilis CspB gene, two gene-specific primers, MSA454 and MSA455 were designed base on the CspB sequence information (Genbank # X59715) from the National

Center for Biotechnology Information, which is goart of the National Library of Medicine, in turn part of the National Institutes of Health (NCBI). The sequence for MSA454 is

GCGCAGGCCTAGATGTACCATGTTAGAAGGGTAAAGTAAAATGGTTCAACTCTG (SEQ

ID NO: 88), which anneals at the translational start site of CspB and introduces Stul and Bglll sites at the 5° end, while the sequence of MSA4 55 is

CGCGAATTCGGATCCTTATTACGCTTCTT TAGTAACGTTAGCAGCTTGTGG (SEQID

NO: 89), which anneals at the last codon of Csp-B and introduces BamHI and EcoRI sites at the end of the primer. The reverse primer MSA455 was designed to match the 3’ end of the Genbank gene sequence. The PCR reaction was carried out using primers MSA454 and MSA455, High 30 Fedelity Taq Polymerase (BRL) and pMONS73 99 as the template. This template differs at the 3’end of the gene CspB, from that of the GeneEank sequence. The amplified CspB DNA was purified by gel-electrophoresis and ligated to pCCR-XL-TOPO vector (Invitrogen). The ligation reaction was transformed into E.coli Top10 cells (Invitrogen) as per manufacturer’s protocol.

Four transformant colonies were picked and miniprep DNA was prepared using Qiagen Miniprep

Kit. The inserts were sequenced using M13-spe=cific Forward and Reverse primers. Clone with the correct sequence was named pMON73982 and used for further subcloning.

PMON73882 DNA was digested with Stul and BamHI to isolate the CspB gene fragment. pMON73980 DNA was digested with Stul and BamHI sequentially, and then purified by Gene

Clean II kit. The CspB fragment and this purified vector pMON73980 were ligated and the ligation reaction was electrotransformed into E-.coli DHI0 B cells. The transformants were selected on Spectinomycin containing media. T he miniprep DNA was prepared from the trasformants and the DNA was checked for thes presence of the insert by using CaMV 35S- promoter-specific forward primer. The clone containing this insert was named as pMON73984.

A larger DNA prep was made and a series of confiscmatory digests were carried out, including - Bglll, EcoRl, Pstl, EcoRl+BamHI, Stul+Xhol. These confirmed that the cloning was correct.

Soybean plants were created, through transformation, with the pMON corstructs above stably integrated in their genome.

Example 32.

Corn plant transformed with DNA contructs from eexamples 10 and 11, above, were studied

Greenhouse o Two experiments were performed, one testing 10 cspA events and one testin_g 10 cspB events for drought tolerance. eo 24 transgene positive and 24 transgene negativ-e hybrid seedlings from each eevent were tested (all seeds derived from segregating hybrid earss). e The test was performed on benches in a greenhouse. e The treatment consisted of withholding water sand monitoring total pot weigliiat of each pot containing a plant. Fully watered pots weigh a*bout 1000 grams each and watter was withheld until each pot’s weight reached 400 grams, the=n pots were maintained at that weight during the remainder of the treatment. ’ o Throughout the treatment, plant height was determined by measuring the disstance from the soil surface in the pot to the tip of the "tallest" leaf. From these measuremen_ts LER (leaf extension rates) were determined by comparineg the heights at the intervals beetween measurements. » LER comparisons during the drought were mamde between transgene negativee and transgene positive plants within an event. » For three of ten events tested, cspA transgenics plants were significantly (p<(0O.10) improved for LER during the treatment. eo Forthree of ten events tested, cspB transgenic. plants were significantly (p<(O.10) improved for LER during the treatment.

Field Efficacy eo Three experiments were performed using hybrid seed, one testing 16 cspB events (CA); one testing 21 cspB events (KS), and one testing 1 4 cspA events (HI) for drought tole=rance during the late vegetative stage of growth.

e For the CA and HI trials, rows containing ~ 3«4 plants, segregating for presence off the transgene, were present in six and four replicates, respectively.

Segregating rows were derived from segregating ears.

+ For KS experimental rows contained ~34 plamts; as transgenic and non-transgeni_c paired "rows, with six replicates.

o The treatment consisted of withbolding watex for approximately ten days during the late vegetative phase of growth (giving a small armount as needed to maintain viable plants). At the end of the ten-day period plants were them well irrigated until harvest.

eo Throughout the treatment a number of phenowtypes were measured including LEER, chlorophyll (by SPAD meter), and photosynthesis rate.

Following the treatment additional phenotypes measured included: days to pollesn shed and silk emergence, and ear components such as kernels/ear, ears with kernels, kernel. weight, and yield.

e Phenotype comparisons were made between transgene positive and negative plaants within an event and across the construct.

o Inthe CA trial, cspB as a construct (across a ll events for vegetative traits and across the

"best" six events for reproductive traits) transgene positive plants were significamntly (p<0.10)

improved for LER, leaf temperature, and kemrnels/ear during or following the drought treatment. .

o Inthe CA trial, individual events were signi-ficantly (p<0.10) improved for LERR, average ear length, kernel mass/ear, stomatal conductanece, and days to silking during or fol. lowing the drought treatment.

eo Inthe KS trial, cspB as a construct (across all events for vegetative traits and across the "best" six events for reproductive traits) trarisgene positive plants were significantly (p<0.10) improved for LER, kernel bearing ears/row,. kernels/ear, kernels/plant, shell we=ight, and yield. e Inthe KS trial, individual events were significantly (p<0.10) improved for LERR,

photos-ynthetic rate, stomatal conductance, ears/row, and kernels-/plant. e In the "HI trial, three events were significantly (p<0.10) improve for LER (chlorophyll contemmt was the only other phenotype measured in HI)

Siummmaries of CA and KS results:

SUMMARY OF FIELD EFFICACY RESULTS FOR cspB — KSS site : 1. The fie 1d design, site uniformity, and execution of planting and s-ampling were all consistent with a higah quality experiment capable of generating informative d=ata sets. 2. The weater-limited treatment was applied in a manner that resulte-d in treatment impacts oxmn all phenotypees measured, particularly LER, chlorophyll, and photosyn-thetic rates. 3. The tresatment impacts on vegetative and reproductive phenotype=s were sufficient to be statistically real and to allow for transgene-mediated improvementss to be observed at statist=ically significarat levels. 4. One om more events were statistically improved in transgene con_taining plants for LER, chlorophyll, photosynthetic rate, stomatal conductance leaf temper: ature, days to pollen shead, days to sdlking, anthesis silking interval, ears/plot, kernels/ear, kerels/plant, shell weight, =and estimatecd yield. 5. Constmruct level statistical improvement was observed at p<0.1 0 in the dry treatment for MLER, ears/plot , kernels/ear, kernels/plant, shell weight, and estimated yie=ld, and for LER in the v=vet treatmemt.

Table 20.

Event Treatment Improved phenotype P values

Construct Dry LER (T1-T0) 0.009

Dry LER (T2-T0) 0.009

Dry LER (T2-T1) 0.096

Dry Stomatal conductance 0.150 :

Dry Photosynthesis 0.141

Dry Ears/plot 0.012

Dry Kernels/ear 0.062

Dry Kernels/plant 0.006

Dry Shell weight 0.009

Dry Est. Yield 0.008

Wet LER (T2-T1) 0.025

Wet Chlorophyll (-) 0.062

Wet Ears/plot 6) 0.185

Wet Kemels/ear O] 0.121 wet Kerrels/plant ~~ (-) 0.083

Wet Shell weight (=) 0.132

Wet Est. Yield © 0.101 s ZM M38835 Dry LER (T1-T0) 0.008

Dry Photosynthesis 0.066

Dry Stomatal conductance 0.064

Dry Transpiration 0.126

Dry Kernels/plant 0.160

Dry Shell weight 0.149

Dry Yield 0.153

Wet LER (T1-T0) 0.099

Wet LER (T2-T1) (-) 0.026

ZM_M38737 Dry Photosynthesis 0.108

SUMMARY OF FIELD EFFICACY RESULTS FOR cspB - CS site (Font clmange) 1. The field. design, site uniformity, and execution of planting and sarmpling were all consistent with a high quality experiment capable of generating informative data sets. 2. The wate=r-limited treatment was applied in a manner that resulted in treatment impacts on all vegetative phenotypes measured, particularly LER, chlorophyll, and photosynthetic rates, but not on all reprosductive phenotypes. 3. The treatment impacts on phenotypes (vegetative) of interest were sufficient to be statistically real and to allow for transgene-mediated improvements to be observed at statistically significant levels. 4. One or maore events were statistically improved in transgene containing plants for LER, chlorophylR, photosynthetic rate, stomatal conductance leaf temperature, days to pollen shed, days to silkzing, anthesis silking interval, kernels/ear, average ear length, and kernel mass/ear. 5. Construct level statisitical improvement was observed in the dry treatment for LER, leaf temperatures, and days to pollen shed, and for ASI in the wet treatment.

Table 21.

Byent Treatment Improved phenotype P value

Construct Dry LER 0.000

Dry Leaf temperature 0.027

Dry Days to pollen shed 0.192

Dry Kemels/ear 0.080

Dry Kernel mass/ear 0.197

Dry Test Wt (1b/bu) Neg 0.084

Wet LER 0.157 40 Wet Days to pollen shed 0.098

Wet Ave ear length 0.091

Wet Kernel mass/ear 0.010

Wet Test Wt (Ib/bu) Neg 0.188

Claims (1)

1. . A Woe claim:

   2 1. A drought-tolerant corn plant having recombinant DNA expressing a protein ceontaining a cold shock domain.

   2 2. A plant of claim 21 wherein said domain is characterized by Prosite Motif P~S00352 or Pfam designation PF00313.

   2.3. A com plant having recombinant DNA expressing a bacterial cold shock protein.

   2:4. A com plant of claim 23 wherein said cold shock protein is &at least 40% identical teo Escherichia coli CspA or Bacillus subtilis CspB.

   25. A corn plant of claim 23 exhibiting at least improved trait in_ the group of traits consisting of leaf extension rate, increased kernels/ear and yield as compared to a control plant when grown for 10 days without watering during the late vegetative phase of growth.

   26. Secd for growing a crop of drought tolerant corn having recombinant DNA encoding a protein with a cold shock domain wherein said seed is produced as progeny of a corn plant of claim 21.

   27. A method of improving stress tolerance in a corn line comprising crossing a corn polant of said corn line with a corn plant of claim 1 to produce a crosssed corn plant having recombinant DNA expressing a cold shock protein.

   28. A method of claim 27 further comprising collecting progeny seed from said <rossed corn plant.

   29. A method for increasing yield in a com crop subject to water deficit during its growth, said method comprising planting seeds having recombinan_t DNA encoding a protein with a cold shock domain and allowing said seeds to grow to mature corn plants ~while withholding water during at Icast one ten day period during wegetative phase of growth. 98 ARTICLE 19 ZEMENDED SHEET’

   30. A plat comprising recombinant DNA expressing a protein with a cold shock domain.

   31. A plat of claim 30 wherein said cold shock domain is characterized by Prosite Motif PS003=52 or Pfam designation PF00313.

   32. A plant of claim 30 wherein said protein is a bacterial cold shock proteira.

   33. A plamt of claim 32 wherein said cold shock protein is at least 40% identical to Escherichia coli CspA or Bacillus subtilis CspB.

   34. A plamt of claim 30 that produces an increased yield when compared to a control plant when saaid plant experiences drought during its growth.

   3S. A plamt of claim 30 selected from the group consisting of soybean, canola, rice, cotton, barley, oats, turf grasses and wheat.

   36. A meghod of producing a field crop under conditions where water would. be limiting for g_rowth, said method comprising growing said crop from seed whicha produces plants which express a bacterial cold shock protein.

   37. A me&hod of claim 36 further comprising harvesting seed containing a bacterial cold shock protein. 99 ARTICLE 19 AMENDED SHEET cold-s=pecific promoters, stress enhanced promoters, stress specific promoters, drought irxducible promoters, water deficit inducible promoters, and tissue=-specific promoters.

   6. An abiotic stress-tolerant, transgenic plant that has been transformed with a DNA molecule that expresses a cold shock protein.

   7. A propagule of a plant of claim 6.

   8. Progeny of a plant of chim 6.

   9. A plant of claim 6 which is a crop plant.

   10. Aa plant of claim 6 which is a monocot plant.

   11. Aa plant of claim 6 which is a dicot plant.

   12. Am plant of claim 6 which is a plant is selected frorm the group consisting of soybean_, corn, canoMa, rice, cotton, barley, oats, turf grass, cotton, andll wheat.

   13. A plant of claim 6 that has . (=a) a higher growth rate under conditions where cc1d temperature would be limiting for growth for a non-transformed plant of the same species, ("b) a higher growth rate under conditions where hili gh temperature would be limitinag for growth for a non-transformed plant of the samee species, Cc) a higher growth rate under conditions where water would be limiting for growth for a non-transformed plant of the same species, (Cd) a higher growth rate under conditions where irncreased salts or ions in the soil aand/or water would be limiting for growth of a non-tr—ansformed plant of the same species, Ce) has a greater percentage of plants surviving after a cold shock than a non-transfFormed plant of the same species, Cf) an increased yield when compared to a non-treansformed plant of the same species, or Cg) resistance to drought compared to a non-transfiformed plant of the same species.

   14. Apropagule of aplant of claim 13 which is a see. d.

   15. =A method wherein a seed of claim 14 is planted ir soil and allowed to grow.

   16. .A method of producing a transgenic plant comprissing the steps of: a) inserting into the genome of plant cells a recombinant DNA molecule of ckaim 1; b) obtaining transformed plant cell containing said recombinant DNA; c) regenerating plants from said plant cells; ard d) selecting a plant for increased abiotic stress tolerance or increased root growth.

   A 7. A stress tolerant plant produced by the method of claim 16.

   M 8. A method of claim 16 wherein said abiotic stress is selected from the group consisting of heat t=olerance, salt tolerance, drought tolexance, and survival after cold shock.

   719. An isolated protein which (a) is at least 40% identical to at least one protein selected from the group consisting of SEQ ID NOS: 5,7, 9,29, 31, 33, 3 5,37, 39, 41, 43, 53, 55, 57, 59, 61,63, and 685, (b) hybridizes under stringent comditions to a nucleic acid selected from the group consisting of SEQ ID NOs: 4, 6, 8, 10, 1 2, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 90, and 92. (c) has an amino acid sequence vwhich is substantially identical to any of SEQIDNOS: 5, 7, 9, 29, 31, 33, 35,37, 39, 41, 43, 53, 55,57, 59, 61,63 and 65.

   20. A field crop comprising at least 50% of plants germinated from a propagule comprising a prokaryotic cold shock protein.