ZA200308852B - Method for analysing DNA of sweetpotato. - Google Patents

Description

“ v WO 02/092847 PCT/EP02/05216

Method for Analysing DNA of Sweetpotato

The invention relates to a method for analysing DNA of sweetpO- ' tato. After Columbus introduced the sweetpotato to Spain it v spread to Africa, India, Asia and Oceania and became an important “ crop in those parts of the world. It is possible that the spread of the sweetpotato outside America was restricted to a limited number of genotypes. Contrary to this supposition a wide variety of phenotypes (genotypes) can be found all over the world, which could be the consequence of the high level of heterozygoticy found in sweetpotato. The sweetpotato is an out-crossing hexap- loid and the variation due to sexual reproduction and somatic mu- tation can be kept through vegetative propagation.

Several germplasm collections exist throughout the world; the CIP (Lima) has assembled more than 4000 accessions of sweetpotato.

The maintenance of the large number of varieties is a huge ef- fort, which makes important to quantify the level of diversity of the sweetpotato accessions to enable the reduction of the number of the stored samples thus facilitating germplasm conservation. " Several marker systems were developed during the last decades for genotyping that could be applied to the sweetpotato such as RAPD (Jarret et al., 1992; Gichuki et al., SSR (Tautz 1988) and AFLP {Zabeau and Vos 1993, Gichuki et al.). The Amplified Fragment

Length Polymorphism (AFLP) and Simple Sequence Repeats (SSR) or microsatellites, have recently become popular in fingerprinting and phylogenetic studies. It has also been reported that AFLP as- says have better reproducibility across laboratories than RAPDs (Jones et al., 1997), however AFLP sites were shown to be clus- tered within the genome thus making the construction of linkage maps difficult.

Waugh and his co-workers have developed a new method, called Se- . . ‘quence-Specific Amplified Polymorphism (S-SAP) (Waugh et al., 1997). This method is similar to AFLP but the S-SAP system pro- duces amplified fragments containing long terminal repeat (LTR) sequence of retrotransposon at one end and a flanking adapter se- quence ligated to host restriction site at the other displaying individual retrotransposon insertions as bands on a sequencing fs 2 WO 02/092847 PCT/EP02/05216 - 2 = acrylamide gel (Ellis et al., 1998; Waugh et al., 1997).

Waugh et al. using the original AFLP protocol digest the barley ‘ genomic DNA with two restriction endonucleases, a rare (PstI) and tr frequent (Msel) cutter enzyme and adapt with restriction enzyme . digestion site specific adapters. The procedure consist of two consecutive PCRs (polymerase change reactions). In the first one the digested template DNA was pre-amplified to select and bulk restriction fragments of the correct size and configuration using primer homologous (P and M) to the adapter sequences. In the sec- ond selective PCR reaction y-[**P]ATP labelled Bare-1 like LTR oligonucleotide and P(, or M;, (Pst or Mse specific primers with 1-3 selective nucleotides) selective adapter primers were added.

Pi) and M(, primers had the same sequence as the P and M primers in the first reaction but included one to three additional selec-— tive nucleotides at the 3‘end. The touchdown PCR protocol of Vos et al. (1995) was followed exactly.

A considerable advantage of retrotransposon based polymorphic marker system is based on the fact that the Class I retrotrans- posons transpose via an RNA intermediate, which they convert to

DNA by reverse transcription before reinsertion whereas the pa- rental transposon remains fixed in the genome (see review Boeke 1989; Kumar 1996). This means that the inserted transposon does not change its position during the evolution of the genome but every insertion elevates the polymorphism and the size of the ge- nome. However solo LTR sequences, found in different genomes in- dicating that unequal crossing over and/or intrachromosomal recombination events could delete inserted retrotransposon se- quences (Shirasu et al., 2000).

Retrotransposons are present in the genomes of all plants, rang- . ing from single cell algae to angiosperms and gymnosperms. They de are usually present in high copy number (from hundreds to mil- . lions) and high level of heterogeneity (amino acid similaritieg between individual fragments could vary from 5-75%) was observed among them (Flavell et al. 1992a Mol Gen). Compared with the Dro- sophila copia, the fungal Tyl or even animal retrotransposons, in plants they show a considerable degree of sequence heterogeneity and insertional polymorphism, both within and between species hod WO 02/092847 PCT/EP02/05216 - 3 = (Flavell 1992; Boeke and Corces 1989). The most studied group of

LTR retrotransposons is the Tyl-copia group, named after the best-studied elements in Saccharomyces cerevisiae and Drosophila ) melanogaster (Boeke and Corces 1989, Grandbastien 1989, Schmidt ‘vr 1996) . The LTR sequences are positioned as direct repeats on both “ ends of the retrotransposons. Different retrotransposon families have different (non-cross-hybridising) LTR sequences. The 5’ and 3'LTR sequences are identical at the time of the insertion but . they can be differing through mutations during the time.

Phylogenetic analyses of the retrotransposon sequences show, with some significant exceptions, that the degree of sequence diver- gence in Tyl-copia retrotransposon populations between any pair of species is generally proportional to the evolutionary distance between those species (Flavell, 1992b). Several authors have also hypothesised that transposition could increase the genetic vari- ability necessary for organisms to adapt to different environ- mental conditions and that they may be a major factor in the evolution of higher plants (McClintock, 1984; Schwarz-Sommer and

Saedler, 1988; Wendel and Wessler 2000). The chromosomal distri- bution of the Tyl-copia group of retrotransposons in plants has been studied by in situ hybridisation on metaphase chromosomes and has revealed that these elements are dispersed throughout euchromatin and heterochromatin regions of all chromosomes in plants (Pearce 1996, Schmidt 1996, Heslop-Harrison 1997) .

Retrotransposon insertion is not a random event, but is con- trolled by the element itself and by signals depending on the host organism and on external factors. Stresses and environmental challenges are known to stimulate the expression or the transpo- ~ sition of mobile elements (Mhiri et al., 1997; Grandbastien et al., 1997). " Despite of their abundant distribution the most of the retro- . transposon sequences are inactive because of the mutations caused defective structures. The only active retrotransposons known to be mobile are the Ttol, Tntl and Tnp2 of tobacco and Tosl7 of rice (Grandbastien 1989; Vaucheret 1992; Hirochika 1993; Hiro- chika 1996; Vernhettes 1997; Okamoto 2000), Bare-1 element Of barley and PDR1 of pea (Pearce et al., 1997; Ellis et al., 1998).

'&

The ubiquitous distribution, high copy number and widespread chromosomal dispersion of the retrotransposons in plants provide " excellent potential for developing a multiplex, DNA-based marker

System.

Several retrotransposon-based marker systems have been reported recently.

Purugganan et al. (1995) restriction site polymorphism analysed on a limited region of the Magellan retrotransposon and was able to discriminate even closely related Zea mays subspecies. Waugh et al. in 1997 published the S-SAP method on barley and found that the level of polymorphism is about 25% higher than that re- vealed by AFLP. Ellis et al. (1998) amplified sequences between the polypurine track of the PDR1 retrotransposon and the 3’ Taqgl (frequent cutting enzyme) specific adapter sequence, while Pearce et al. (2000) used the same S-SAP technique with two other pea retrotransposon LTR sequences (Tpsl2 and Tpsl9) but generating amplified fragments between the 5'LTR and a flanking adapter (Tagl) sequences. Both primer contained selective nucleotides.

Both experiments resulted in a detailed picture of the intra and interspecies relationship within the Pisum genus. Gong-Xiu Yu and

RP Wisa combined the AFLP, RAPD and S-SAP markers to make a satu- rated map of diploid Avena based on a recombinant inbred popula- tion. Compared with the results of Waugh on barley they also found, that the S-SAP generated markers were more evenly distrib- uted across the Avena genome.

Although Waugh et al. have postulated that their approach may be used as a general approach to obtain linkage information on a range of other conserved sequences in the barley genome and that

N said approach could also be applied to any other species, its turned out that this S-SAP approach may not be generally applied . to phylogenetic analysis of any plant species not even to plant species being similar to barley. One reason for that is that retrotransposon approach according to Waugh et al. is highly de- pendent on the specific sequence of retrotransposon chosen and also on the general variety of “transposon” jumping.

It is an object of the present invention to provide a method for analysing DNA of sweetpotatoes allowing phylogenetic and linkage analysis of sweetpotato and to provide means for performing this . method. “. . Therefore, the present invention provides a method for analysing

DNA of a sweetpotato characterised in by the following steps: — providing DNA of a sweetpotato, — physically breaking said DNA into DNA pieces, — introducing known sequences at at least one of the two ends of each DNA piece, — providing at least two primers, a first primer according to the formula (Nx) nAGTCCTAACAN; N,N; (I) wherein Nx is selected from A, C, G and T; n is 0 to 20; Ni is G,

T, A or not present; N. is A, C, G or not present; N; is A, G, C or not present; or a complementary sequence thereto; and a second primer being able to anneal to the introduced sequence, - amplifying DNA of the DNA pieces with said primers and - analysing said amplifying DNA.

Surprisingly it turned out with the present invention that a method similar as the one applied by Waugh et al. may be used for analysing sweetpotato DNA and making a phylogenetic and linkage analysis of different sweetpotato individuals from genetically + different sweetpotato races. It turned out that a specific retro- transposon of sweetpotato, the Strl87 retrotransposon, is ex-— tremely suitable for analysing and distinguishing even otherwise very closely related sweetpotato individuals and allows a clear and distinct phylogenetic grouping of these individuals. In gen- . eral with the present method a primer designed to the 5'LTR of

N the Strl87 retrotransposon is used together with a primer which . is located 5’ to said 5‘LTR sequence on an introduced piece of

DNA. :

The Strl87 LTR primer proved to be the most polymorphic of all sequences tested and the sweetpotato individuals analysed were found to have an extreme high variability between the numbers of a WO 02/092847 PCT/EP02/05216 the inserts. Indeed, the gradual increase of the integration sites indicates that the Strl87 retrotransposon was/is in the closest past active.

The method according to the present invention further turned out ‘ to be much more reliable and specific than other methods tested for this approach in other plant genomes such as RAPD or AFLP.

It is therefore possible to distinguish closely related potato races genetically and allocate them to specific origins.

There is a number of methods known for physically breaking DNA into pieces. Most prominent are statistical or defined restric-— tion endonuclease digestion or mechanical breaking e.g. by soni- cation. According to the present invention it is preferred to break the DNA by restriction endonuclease digestion, preferably by digestion with at least a 6 bp cutting enzyme, especially

EcoRI.

The first primer to be used within the method according to the present invention efficiently amplifies the 5’LTR of retrotrans- poson Stri87. Therefore, the primer preferably comprises in its (Nx) s~region further residues being complementary to said region. (Nx)s is therefore preferably e.g. TAAGACTAAG or AGACTAAG or even longer sequences from the 5‘LTR.

Since 5’'LTR sequences are identical or at least highly similar to 3'LTR sequences, amplification of DNA pieces comprising 3'LTR se- quence might have a negative effect on the method according to the present invention. Therefore, the primers are preferably de- signed in a way that excludes amplification of sequences being 5° of 3'LTR sequences e.g. by providing G, T or A as N: (because the . first base 5’ of the 3‘LTR is a G). Such primers may also be used : in a second round of performing the present invention, e.g. if . the multiplicity of the differences is too high without such a limitation.

Preferred first primers are therefore selected from AGACTAA-

GAGTCCTAACA, AGACTAAGAGTCCTAACAG, AGACTAAGAGTCCTAACAT, AGACTAA-

GAGTCCTAACAA, AGACTAAGAGTCCTAACAGC, AGACTAAGAGTCCTAACAGA,

=! WO 02/092847 PCT/EP02/03216 .- = 7 =

AGACTAAGAGTCCTAACAGG, AGACTAAGAGTCCTAACATA, AGACTAAGAGTCCTAACATG,

AGACTAAGAGTCCTAACATC, AGACTAAGAGTCCTAACAAA, AGACTAAGAGTCCTAACAAG,

AGACTAAGAGTCCTAACAAC, or fragments thereof, said fragments op- - tionally comprising at least 10 bp of the 3’ part of these se- quences.

The introduction of known sequences at at least one of the two ends of each DNA piece (preferably of course at the 5’ end) pref- erably comprises cutting the DNA with a restriction enzyme, op- tionally making blunt ends (depending also on the restriction enzyme), and linking an adapter to the end. This adapter com- prises e.g. a known sequence whereto said second primer is de- signed to anneal. Instead of making blunt ends, of course the adapter can be constructed by a linker designed to the restric- tion site.

The analysis of the amplified DNA is preferably carried out by separating the amplified nucleic acid molecules by size e.g. with gel-electrophoresis. Such systems may be provided in a highly automated form and may be performed by roboters.

The power of the method according to the present invention lies in the fact that it may be used for defining the phylogenetic re- lationship of any two sweetpotato individuals having different genotypes. For defining this relationship a method according to the present invention is performed on each of the sweetpotato having different genotypes, thereby getting a defined result with respect to their specific amplification (S-SAP analysis). Then these results of the sweetpotato having different genotypes may be compared whit each other. Since with the method according to the present invention each sweetpotato gives a characteristic “fingerprint” in this analysis, these fingerprints may be com- , pared to each other and their phylogenetic relationship may be defined by the degree of similarity these fingerprints have. an . impressive demonstration of the power of this method is given in the example section.

Preferably the comparing step comprises analysing a size separa-— tion of the amplified nucleic acids of each sweetpotato species, potato race, potato subtypes, etc. It is therefore possible to differentiate between geographical areas and secondary distribu- tion areas of specific sweet potato specimen. - There is a number of methods for comparing these “fingerprints” preferably these comparisons are performed with computer aids. : Several computer programmes are available for such analysis e.g. genotyper. Treecon, TFPGA, Arlequin, Genographer, RFLPSCAN etc.

According to another aspect of the present invention also a kit for performing the methods according to the present invention is provided which comprises at least two primers as defined herein (a first primer and a second primer) and a nucleic acid po- lymerase for amplifying nucleic acid defined by these two primers.

Preferably, a kit according to the present invention further con- tains a restriction enzyme specific adapter with primer, a ligase enzyme for the adapter ligation, buffers, nucleotides, positive or .-negative controls and mixtures thereof.

According to another aspect the present invention also relates to a nucleic acid molecule comprising a sequence of the formula IT, (Nx) cQAGTCCTAACA (Nx) m (II), wherein Nx is selected from A, C, G and T; m and o are independ- ently from each other 0 to 1000.

Especially, the present invention provides a nucleic acid mole- cule comprising SEQ. ID. NO. 1, sequences differing in not more than 1 b/bp per 20 b/bp from this sequence, sequences hybridizing under stringent conditions {(e.g.6 x SSC, 65°C) to such sequences or complementary sequences to such sequences. preferably, the length of II is between 10 and 500, especially between 12 and 286. Preferably it contains the LTR region and op- tionally the polypurine tag according to Figs. 1 and 2.

The present invention will be described in more detail by way of the following examples and the drawing figures, yet it is not re-

-f WO 02/092847 PCT/EP02/05216 - = 9 = stricted to these particular embodiments.

Fig. 1 shows Ipomoea batatas retrotransposon partial sequence - (3’RNaseH, polypurine track and partial LTR region); : Fig. 2 shows Ipomoea batatas retrotransposon sequence and the used LTR primers;

Fig. 3 shows a comparison of the banding pattern after S-SAP analysis;

Fig. 4 shows a comparison of the S-SAP and AFLP analysis of nine sweetpotato genotypes;

Fig. 5 shows a S-SAP analysis of nine different sweetpotato re- sources;

Fig. 6 shows a regional map of Eastern Africa showing the origi- nal collection sites of sweetpotato varieties;

Fig. 7 shows a distribution of the plants in four groups with different insertion number; clear columns represent the range of the insertion number in a group while dark columns show the num- bers of the varieties in a given group; ~ Fig. 8 shows a list of adapters and primers used for AFLP pre-am- plification and selective PCR;

Fig. 9 shows a phylogenetic analysis of 173 Eastern African va- rieties by clustering.

Fig. 10 shows a dendrogram based Nei’s (1972) genetic distance method = UPGMA modified from neighbor procedure of PHYLIP Version 3.5;

Fig. 11 shows a supposed distribution of the gweetpotato in East

Africa.

Examples

Strl87 retrotransposon sequence was found and cloned with a known method (Pearce et al. 1999). After having sequenced the Strl187 clones (see SEQ. ID. NO. 1) oligonucleotide primer sequences have : been designed capable in different methods to fingerprint and distinguish sweetpotato genomes. During the procedure as outlined . in the present examples two types of primers are used:

The LTR primer or first primers are designed after the retro- transposon sequence optionally with features preventing amplifi- cation of 3'LTR. The other primers or second primers may be any : sequence which makes an adapter to the restriction site used, in- cluding a primer site. This adapter primer should match the PCR parameters of the first primer. Both primers may be extended on the 3’ end with preferably 1-3 optional nucleotides. In the method according to the present examples the primers are used in

PCR reactions with sweetpotato DNA templates. The nucleic acid polymerase used in the reactions is a commercially available thermostable DNA polymerase from the thermophilic bacterium

Thermus aquaticus (Taq polymerase) or other thermostable po- lymerases.

The nucleotide triphosphate substrates are employed as described in PCR Protocols, A Guide to Methods and Applications, M.A. Innis et al. 1989 and US Patents 4,683,195 and 4,683,204. The sub- strates can be modified for a variety of experimental purposes in ways known to those skilled in the art. : . In the first step (l.) of the present process sweetpotato genomic

DNA as template DNA is fragmented with sequence specific restric- tion endonucleases. It is possible to use one, two or even three different restriction endonucleases.

Fragmented genomic DNA is ligated with restriction size compati- ble adapter sequences with designed adapter specific primer bind- ‘ing sites.

One or more PCR reactions are performed with adapter specific and

LTR specific primers. Both primers can be extended with extra nu- cleotides to reduce the number of the amplified fragments. In the last PCR reaction the LTR primers are labelled so that the LTR-

adapter primer amplified PCR product is distinguishable from the adapter-adapter primers. : Such labelling may be performed by any method known in the art.

Preferably, labelling by isotopes or non-isotopic methods such as biotinglation, fluorescent dyes or other methods.

PCR-Products may be separated by agarose or acryl amide gel-elec- trophoresis, manual or automatic, and visualised depending on the labelling of the (LTR) primer.

Similar procedures have been presented from Waugh et al. (1997),

Ellis et al. (1998 ) and Pearce et al. (2000). The electrophore- sis of the amplified genomic fragments with the same flanking LTR sequence separates the different length of fragments according to the mobility. Smaller fragments have higher mobility as the longer ones. Different sweetpotato samples turned out to have different electrophoresis pattern in consequence with the place and number of the retrotransposon insertions. Automated gel-elec- trophoresis systems (sequencer equipment, Genotyper programme) can compare more than hundred fragments of different length, but it is of course also possible to evaluate the result with manual methods. Conversion of these electrophoresis patterns to a pres- ence/absence (yes/no) per variety matrix is possible with GENO-

TYPER or GENOGRAPHER programmes mentioned above or can of course be done manually. A clustering analysis of this matrix is possi- ble using such methods as Unweighted Pair Group Method using Ar- ithmetic Averages (UPGMA) (Sneath and Sokal, 1973) or neighbour joining (Saitou and Nei, 1987) with programmes such as TREECON.

Other ordination analysis are also possible such as multidimen- sion scaling (MDS) or principal component analysis (PCO) with programmes such as SPSS, SYSTAT, STATISTIKA or SAS. Further it is possible for the analysis of the geographical origin of the tested sweetpotato sample to compare the number of the retro- . transposon insertions in the related genotypes. Plants growing on the same area are liable to the same stress effect which could induce among Others retrotransposon activation further new inser- tions. :

ExamplectI ' Sweetpotato resources and DNA purification

Lyophilised leave samples were used for all the analysis. Sixty seven landraces were obtained from the Kenya Agricultural Re- search Institute gene banks at the University of Nairobi, field station, Kabete 59 landraces were obtained from the Ugandan Na- tional Agricultural Research Institute, Namulongeand. Forty four landraces were obtained from the Tanzania Agricultural Research

Institute, Tengeru. Individual pathogen tested clones from Colum- bia, Peru, Mexico, Brasil and Papua New Guinea were obtained from the International Potato Centre germplasm collection at Kabete,

Kenya. From this total sample 9 genotypes from different coun- tries were selected for primer comparisons and for comparison of the S-SAP system with other molecular markers (AFLPs and RAPDs).

Details of these genotypes are given in Table 1.

Table 1 = 3 codes origin genotype 1 lMatuea | [kenya |iandrace 2 |Simama Kemb 10, CIP Kenya Landrace aa hal i + vagevorice lore 040167 uganda tenarece |Camote CIP 400014 Colombia Landrace i == I ii © [¢ [santo mere lore so001t lorasit [candace 8 |Japonese CIP 420009 Peru Landrace

Guinea

3 WO 02/092847 PCT/EP02/05216

Table 1

Names, country of origin and type of genotype of the nine se- lected varieties used for testing primer combinations and for ) comparing S-SAP molecular markers with RAPD and AFLP markers . All the KARI (Kenya Agricultural Research Institute) and CIP (In- ternational Potato Centre) germplasm was sampled from field col- ‘lections. For most of the Ugandan and Tanzania germplasm, vine cuttings were sampled from the field collection and planted in pots in a green house. Four weeks later, fresh leaves were sam- pled for freeze drying. In all cases, 5-7, very young leaves were cut from vigorously growing plants, immediately dipped in liquid

Nitrogen. Freeze dried leaves were stored at 4°C until DNA was isolated. About 20 mg of freeze dried plant material in liquid

Nitrogen was ground in a bead mill for 5 minutes. Total DNA was isolated and purified with a ’Dneasy plant minikit’ (QIAGEN) fol- lowing the original protocol. After extraction, 4 nl of 10 mg/ml

RNase A was added and the sample incubated at 37°C for one hour.

DNA was quantified with a ‘TKO 100’ Mini-fluorimeter (Hoefer sci- entific instruments) and quality assessed on a (0.8% agarose gel stained with 0.5 pg/nl Ethidium Bromide in a 1X TBE buffer.

PCR amplification of Tyl-copia retrotransposon LTRs

MseIl or EcoRI restriction enzyme digested genomic DNA was ampli- fied with degenerate RnaseH gene specific and enzyme cutting site specific flanked PCR primers as written by Pearce et al. 1999.

Separation of the biotinilated first PCR products was made on streptavidin coated magnetic Dynabeads particles.

Biotinilated RNaseH primer: 5’'MGNACNAARCAYATHGA :

Nested RNaseH primer: 5’ GCNGAYATNYTNACNAA

N: A, G, T or C

M: A or C

Y: Cor 7T

H: A, Cor T

The degenerated RNaseH primers are kindly gift from the labora- tory of AJ Flavell (Department of Biochemistry, Univ. Dundee) and were designed by sequence homologies of known retrotransposon origin RNaseH genes. The amplified fragments were cloned into

Topo 4 TA cloning vector (TOPO TA Cloning Kit, Clontech K4575-01) and sequenced.

Identification of LTR sequences of Tyl-copia type transposons of . sweetpotato:

Approximately one hundred clones with variable degree of homology to Tyl-copia RNaseH gene were identified but only three (Str6,

Str85, Strl1l87) showed the characteristic RNaseH gene, stop codon, polypurine track and putative 3'LTR sequence elements (Fig. 2).

The Str6 and Strl87 sequences proved to be homologue with the ~ Tyl-copia retrotransposons. The Str85 clone was not recognised by

Blast search as copia type retrotransposon sequence despite the copia homologue primer site in the RnaseH similar sequence and the polypurine track region. The putative inverted repeat region (IR) of the LTR region is different in the three sweetpotato sequences, only the Strl87 clone contains the characteristic TGTT sequences. Although with lower frequencies other IR sequences oc- cur (Picea abies Tpa8 TAGTT) it is believed already as a muta- tion. Furthermore, in the putative LTR region of the Str6 clone, after the TATT inverted repeat sequence a 34 bp long direct re- peat was recognised which provided another proof for the unusu- ally high mutation rate in the sweetpotato retrotransposon population. The starting point of the 3'LTR sequences for the rest of the sequenced clones could not be determined, since they did not contain a recognisable polypurine-track after the RNaseH gene stop codon. In many cases the sequence was interrupted with the Msel restriction cutting site, however using the rare cutting

EcoRI enzyme to fragment the genomic DNA longer clones have been got, but the identification of the LTR sequence was further not possible.

The LTR sequence detected in the Str6 and Strl87 clones proved to be functional in the S-SAP analysis while Str85 did not produce an amplified polymorphic banding pattern. Fig. 2 shows the list of the LTR and Eco adapter primers tested in S-SAP reactions.

Discussion i WO 02/092847 PCT/EP02/05216

PCR amplification of the Tyl-copia retrotransposon LTRs

Sweetpotato DNA sequences were isolated with degenerate oligonu- : cleotide primers corresponding to conserved domains of the Tyl- copia retrotransposon RNaseH gene fragment and flanked adapter . primers. The amplified clones were cloned as written in Methods. 2-300 random clones have been sequenced but only three clones with recognisable LTR sequences were found. In these three clones the stop codon of the RNaseH genes, the characteristic polypurine ~ tracks and the putative 3’'LTR regions could be distinguished.

Every retrotransposon class has a different LTR region, which is homologue in the class, but not between classes. The fact that only two working LTR region were found between more hundred se- quenced clones one can suppose, that in the sweetpotato the muta- tion rate of the retrotransposons are very high, and also that only few classes of retrotransposon class exist. Otherwise it has to be considered, that the sweetpotato are propagated mainly vegetatively, which means, that a retrotransposon insertion in the vegetative cells has longer "life time* furthermore bigger chance for mutations. It is known that different biotic and abi- otic stresses can induce the mobility of the retrotransposon (Mhiri et al., 1997; Grandbastien et al., 1997). However plant genomes have evolved mechanisms to repress uncontrolled retro- transposon expansion, such as DNA methylation (Liu and Wendel 2000) deleterious mutations (Nuzhdin 1999; Heslop-Harrison et al. 1997), unequal crossing over and/or intrachromosomal recombina- tion between LTRs (Shirasu et al. 2000). : :

The high variability of the Strl87 retrotransposon insertion be- tween different sweetpotato clones alludes to the mobility of these retrotransposon.

After preliminary experiments the Str187 retrotransposon LTR se- quences were used to design S-SAP primers. Increasing the number of the selective nucleotide on the adapter or LTR primers the number of the detected insertions were reduced as expected. How- ever the reduction was much more effective (4-5 times per nucleo- tide) if more selective nucleotides on the LTR primer were increased the best scoring was achieved with only one nucleotide extension on the LTR primer but it has to be considered that only a 6 bp cutting enzyme was used to fragment the genomic DNA. waugh et al. fragmented the barley genomic DNA with a 6 and a 4 bp cut- ting enzyme accordingly to the AFLP procedure, generating more and shorter genomic fragments, but they had to reduce the number of the amplified fragments to a scorable amount with increasing the number of the selective nucleotides. Furthermore, they did not use the selective nucleotide on the LTR primer accordingly they amplified not only the plant specific genomic DNA but possi- bly the internal retrotransposon sequences LOO.

S-SAP method

The procedure from Waugh et al. (1997) was adopted to sweetpotato with some modification.

Genomic DNA was digested only with one rear-cutting enzyme (EcoRI) and ligated with specific adapter in one reaction. Two

PCR reactions were performed.

The first pre-selective PCR amplification was made with Dynazyme

Tag polymerase in 50 pl reactions during 30 cycles on 52°C an- nealing temperature. LTR specific primers without any extension and the E0l-adapter primer (Table 2) were used.

Table 2

LTR primers

Str187/0 5'AGACTAAGAGTCCTAACA 3

Str187/G 5’AGACTAAGAGTCCTAACAG 3’

Adaptorprimer

E01 5°GACTGCGTACCAATTCA 3°

Strl87 primers used in S-SAP analysis

First reaction: Str187/0-E01 second reaction: Strl87/G-EO1 second, selective PCR amplification was made with Quiagen Hot Tag

DNA polymerase in 25 ul reactions. Touch down from 70°C (=0.7°C/cycle) to 55°C than another 20 cycles at 55°C annealing temperature. With selective nucleotide extended FAM labelled ) transposon primer (Strl87G) was combined with the E01 adapter primer (Table 2). Reactions were loaded on acrylamide gel and separated on ABI 373 automated sequencer.

Adaptation of the S-SAP method to sweetpotato

In the original S-SAP protocol (Waugh et al.) the genomic DNA are cut with two enzymes as it is usual in AFLPs, a rare cutter and a frequent cutter (Vos et al.). However adapting the S-SAP tech- nique for sweetpotato digesting the genomic DNA with only one rare cutting enzyme instead of two improved the number and length of the polymorphic bands. Further improvement was achieved by pre-amplifying the adapted DNA with the adapter and non-labelled

LTR primers. The second specific amplification was carried out with the adapter primer and selective nucleotide extended LTR specific primer. These modifications resulted in a high number of amplified products both polymorphic and monomorphic. In prelimi- nary experiments the three sweetpotato LTR primers were tested in

S—~SAP analysis and the Str187 showed the highest level of poly- morphism. The Str6 primer produced a moderate number of polymor- phic patterns, but no amplification products were obtained with

Str85. ‘Subsequent experiments were carried out with the Strl87 LTR prim- ers.

Nine sweetpotato varieties were selected from Africa, South and

Central America and Papua New Guinea and tested with the differ- ent LTR/adapter primer combinations. Table 3 shows the results of : these comparisons.

- 18 ~

Table 3 :

E44/187 E01/187G E44/18 EO1/1

A TTT q.

[1] 25 Jes] 32 Jes] 79 las] ss 33 (2 3 [se] 4 [8] 40 [23] si |20] 3] 3 [s} a [8] 2a Jia] a1 |e] [a] a Jao] 3 Je] 31 [6] 28 [11] 5s] 3 Js] 1 J2] 20 Je] 19 |7 6] o Jo 2 [af 4 J2f 7 [3 7] o [ol 4 Jef 2 [aif 10 jaf ls] o Jol o lof 2 [a] 12 [5 ol [el ow lal 3 [a] es |e

REE EE

Table 3: Comparison of the different primer combinations in S-SAP analysis of nine sweetpotato varieties. Frequencies (Freqg.) means that the tested Strl87 retrotransposon has insertion into one, two or all of the nine genome. Column N represents the total num- ber of the insertions, which are present in the nine genome one, two or nine times.

Dates are shown also in percentage. In the row insertion (Ins.) are shown the total number of the insertions amplified with the given primer pair.

The E44 adapter primer in combination with the Str1l87GC or G : primers gave 36 and 173 polymorphic bands respectively, repre- senting individual retrotransposon insertions. Reducing the num- : ber of the selective nucleotide on the LTR primer significantly elevate the number of the amplified insertions.

The same relation was observed in case of the E01/187GC and

E01/187G primers. Reducing the selective nucleotide with one, the number of the amplified insertions elevated from 51 to 261.

The number of the selective nucleotide on the adapter specific . primer has only a minor effect on the insertion amplification.

In Table 3 there are presented the frequencies of the insertions amplified from only one, two or even all of the nine plan ge- nomes. It can be seen that the polymorphism is very high: the percentage of the monomorph bands comparing with the total number of the insertions is only 1-2%. However the number of the unique insertions - amplified from only one plant genome - is very high 33-69% of the total insertions.

A phylogenetic analysis of the nine sweetpotato varieties with the E01-Str187/G and E44-Strl87/G primer combinations are shown in Fig 5. Both primer combinations distinguish the South American varieties from the African ones. The clones from Mexico and Papua

New Guinea were associated to the African types. With the two other primer combinations where the LTR primer is extended with two nucleotides, the South American and African varieties were not differentiated from each other (data not shown) .

AFLP analysis

The AFLP methodology was essentially as described by Vos et al. (1995) but adapted for sweetpotato with fluorescent labelling and sequencer running of the gel. Two restriction enzymes, Msel and

EcoRI were used to fragment the genomic DNA. The restriction-di- gested DNA was subsequently ligated to two different synthesised double-stranded oligonucleotides that consists of a short DNA strand and the restriction enzyme recognition site (Table 4).

Pre—amplification was done using primers E01 and M0l. An anneal- ing temperature of 60°C was used for 45 cycles. Selective ampli- fication of the PCR products of the pre-amplification was done with primers identical to the pre-amplification primers with an additional 2 selective nucleotides at their 3' ends (Table 4).

Table 4: List of Adapters and primers used for AFLP pre-amplifi- cation and selective PCR

Pre-emplification primer © |selective pcr Primers

G-3

T-3

Mel - Adapters ere-amplification primer selective PCR primers

N

T-3

M40 5-GAT GAG TCC TGA GTA AAG [meme

EcoRI selective primers were ABI-FAM fluorescent labelled to pre- vent occurrence of ‘doublets’ on the gels due to unequal mobility of the two strands of the amplified fragments (Vos et al., 1995).

The samples were loaded on a 6% polyacrylamide denaturing gel and run with an ABI Prism 373 sequencer for 10 hours. The gel was scanned and samples extracted using GENESCAN 3.1 programme. The

PCR products of selective amplification were visualised. An in- ternal size standard was incorporated into the sample. Visualised peaks indicating position of amplified fragments were analysed with GENOTYPER 2.5 programme to develop a 0/1 (absence/presence) fragment by sample matrix. Peak filter conditions were set to in- clude only peaks with scaled height of at least 30. Selection of ’ categories was done as described above for the S-SAP procedure.

Informative products typically fall within 50-450 bp, (Sharbel 1999). Only categories between 50-400 bp were utilised for data analysis.

) - 21 ~-

RAPD analysis

RAPD amplifications were carried out as described by Williams et al. (1991) with a few modifications as described in Gichuki et al., (2001).

Gel and data analysis

Data were analysed with Genotyper 2.5 programme. Peaks, corre- sponding to an amplified retrotransposon insertion were desig- nated into categories. The tolerance of a category was chosen to be + 0.25-0.5 bp, which means if two amplified fragments show bigger difference than 0.5 or 1 bp, then they were selected as two different categories. Data representing insertions in bp were converted with the Genotyper programme to a presence/absence (1/0) of insertion per variety matrix for use in other phyloge- netic programmes such as Treecon.

Comparison of the RAPD, AFLP and S-SAP

The Tyl-copia transposon based S-SAP analysis is a dominant marker system yielding a multiband pattern. Each individual band of this pattern represents a unique retrotransposon integration site (Fig. 3). The objective was to test whether a genotyping system based on the consecutive integration of retrotransposon elements results in a similar genetic relatedness of accessions compared to those generated using for RAPDs and AFLPs, which are _ based on the alterations of the DNA sequence. Therefore nine sweetpotato genotypes representing different geographic regions already identified by RAPD analysis were analysed by AFLP and S-

SAP techniques respectively (Table 1). } The banding patterns were compared with UPGMA dendograms using

Nei, 1979 genetic distance (Fig. 4).

Table 5

Number Total Total Number Mean % Poly- : of geno- |number [number of |of poly- |number morphic types of as- |amplifi- |morphic |of prod- |loci : analysed |says cation products [ucts per products assay map ls [12 [nar les le.2 |s7.8 are |s Jo Jess Jair [us res sears [1 [seo [25a [260 Jor.1

Summary of each type of analysis performed

Total number of amplification products obtained per analysis type, number that were polymorphic, mean number of products per assay (primer or primer product) and overall percentage of poly- morphic loci *Only distinct bands which demonstrated polymorphism were scored for RAPDs ‘

Table 5 shows the details of the three analysis methods. The per- centage of the polymorphic loci was the highest in S-SAP analysis (97.7%) where 260 insertions were amplified with only one primer pair. In the barley genome, a 25-30% increase in the rate of polymorphism has been observed with retrotransposon-based S-SAP, as compared to standard AFLP (Kumar 1996; Waugh et al. 1997;

Gong-Xin Yu and R.P. Wise 2000). In the present case this ration . is smaller, 19% comparing with the AFLP method. Although RAPDs showed a high level of polymorphism only distinct banding pat- terns which showed polymorphism in an earlier study of 74 geno- types were included (Gichuki et al., 2001 in paper). Therefore polymorphism of the RAPD analysis is over-estimated, therefore it is not comparative with the AFLP and S-SAP data (Table 5). The ) high polymorphism observed in the three methods may be due to the vegetative propagation of the sweetpotato. 211 the three different genotyping method clearly identified two

South American clones Zapallo (Peru)/ and Camote Amarillo (Colom- bia) as a separate group (see Fig. 4). The four African clones were also identified as another group. The Mexican clone, No.221 and the Papua New Guinea, Naveto, were in all three cases related to the African clones. The Brazilian clone, Santo Amaro, was re- lated to the South American clones in both the S-SAP and the RAPD : and with the African clones in the AFLP analysis. . The important factors in choice of a genetic marker includes, de- velopment time and cost, capital outlay, amount and quality of

DNA required, prior knowledge of DNA sequence, required technical expertise, robustness, informativeness, genome coverage and re- producibility (Vos et al., 1995; Milbourne et al., 1997; Mil- bourne et al., 1998; Powell et al., 1996). The S-SAP markers require a higher initial cost of development than both RAPDs and

AFLPs due to the need to isolate the LTR repeat sequence of the retrotransposon. On the other hand the LTR sequence adaptation costs to specific genomes is comparable to that of AFLPs. The S-

SAP was demonstrated to be superior to both RAPD and AFLP in terms of number of amplification products revealed and number of polymorphic loci (Table 5). To select the 12 RAPD random primers more than 100 primers were screened and only about half produced any amplification products. Considering that 12 RAPD assay and 2

AFLP assays were required to achieve approximately the same level of analysis, it is evident that on per assay basis the S-SAP pro- cedure may be the fastest of the three methods for genetic analy- sis and characterisation of the sweetpotato at a comparable cost.

Compared to fluorescent AFLPs it was found that the S-SAP peaks were more distinct. Though both the AFLP and S-SAP markers are dominant, the high multiplex ration of the S-SAPs indicates that they are more informative. AFLP and RAPD markers target random regions of the genome. However some concerns have been expressed by some writers regarding centrometric-clustering of AFLP markers particularly for linkage studies. Most AFLP primers seem to tar- ] get the AT-rich centromere region of the chromosome. The Tyl-co- pia retrotransposon is widely distributed throughout the genome . (Pearce 1996, Schmidt 1996, Heslop-Harrison 1997). This would mean that the Ty-1 copia LTR S-SAP markers are also widely dis- tributed since they are anchored to the retrotransposon. Repro- ducibility of a marker system is quite important especially for germplasm characterisation, mapping and where results have to be exchanged between different labs and scientists. The AFLPs have been shown to be more reproducible than RAPDs (Jones et al., 1995). The sequence-specific nature of the S-SAP analysis may im- prove this reproducibility. Preliminary results indicated a high level of reproducibility using different PCR equipments (data not shown). Considering all these factors it is clear that the Ty-1 : copia S-SAP marker system is a powerful method for genetic analy- sis in sweetpotato. The usefulness of retrotransposon S—-SAP mark- ers has already been demonstrated in barley (Waugh et al., 1997 ) and in peas (Elliot et al.).

Example II

Analysis of the East-African clones

Hundred seventy-one East-African accessions from Uganda, Tanzania and Kenya were analysed using the E01_187G primer combination in the S-SAP analysis. This primer combination yielded the highest number of polymorphic bands. The PCR amplification and the analy- sis of the fragments by size were done as described in Materials and Methods.

From different areas of East Africa a total of 61 varieties from

Kenya, 44 from Tanzania and 61 from Uganda, were selected. Kenyan varieties came from the Central and Western Highlands and the

Nyanza region of the Victoria Lake basin. From Tanzania the va- rieties came from three areas, the East coast, the North-Central

Highlands and the Lake zone. Ugandan varieties were grouped into those originating from the North-east Ugandan and the rest origi- nating from Central and Western Uganda. The geographical areas of origin are shown in the Fig. 6.

In the S-SAP analysis of all the samples 242 insertions category ; of the Strl87 retrotransposon were found. Fig. 7 present all the varieties in a dendogram based the UPGMA analysis. To simplify . the analysis the samples in accordance with the geographical ori- gin or as a member of a given monophyletic group established by

Treecon UPGMA analysis were compared. The 172 varieties were first grouped by geographical origin summarised to the given country part then the analysis result was scored and established a phylogenetic tree (see Fig 10).

The phylogenetic tree shows separation of the East-African sources. East and North Tanzania are separated from the lake part : of Tanzania, which is closely related to the Central/West Ugandan samples. These results are corresponding to the geographical po- : sition. Interestingly the Northeast Ugandan samples are mapped closer to the Kenyan one than the Central/West Ugandan varieties, but taking considering the geographical localisation it is also feasible. Although the Central Kenyan samples grouped together with the other Kenyan varieties on the phylogenetic tree it is separated from Western and Nyanza part of the country.

The results are correlating with the geographical localisation. ~ Secondary distribution of the retrotransposon insertions

Comparing the 172 tested varieties with each other by UPGMA clus- ter analysis ten subgroups have been identified. The subgroups are listed in Table 6.

Table 6 Groups based on the phylogenetic analysis ores Jor. 2 Jor 5. Jor. + Jor. = Jor. & fort Jers Jers lorie

KWA104 |KWwAl00 [UB101 [KNB22 |KNB2 TEB158 |KWB1 |KNA28 |Kcall3 |TEB14 . 8 : KWA108 |KCA103 |uB102 |KNB23 |KNB16 |TEBl61 |KNB10 |TLB122 [KWA102 |TLB1l 7 hoinas [xenio fimios sets Jz |remics mi [vemos fos oman oman fosos ovens Jaeas [rests amis [reais fond omass enzo me | lowe [tems [ams [remar eemzo nasa [soos Juats | lower |meisy foes [ress ove

A TE Ee a nsz_foner fora | owes mary fos femme

PN ET ms lwo Josie | | fom lows foes fowry fom mus | [| Jews lesa

ET er rr I = honss mez [mia | | | lowes feemer hors Jmess fs | [| ows pemso jonos fmess Besa | | | fom ems

Cr I I I ye I

Ca a RE I I = I

Ee NN 2 NE Rr =r I

Clowes | ewe | |] over mse] meso | fms | [| owes fremsr | [ ovesz | fm | [1 overs fem | [ vss | Jomss | | | owes mess | wes | [| Jee | | |] oo | foo ||| ees | [ woe | fees ||| wen | [ ol ees | fee |] ew I eel TT

UB92 UNC6

I "I I 2 I I

I I = I

TT we OT ors Jor. 2 Jor 3. Jor. a for. 5 Jor. 6 or.7 Jorg Jor.s Jor.

This type of analysis shows similar results, but divergence not only between but also in the different country parts too can be observed. The details are shown in Table 7.

Table z: Distribution of the varieties in the clustered groups

Groups Percentage No. of possible insertion sites

Central Kenya 1 43% 203 nal BP I

Western Kenya 7 25% 162 ha I

Nyanza 7 48% 162

Na

Central /Western 3 84% 161 ill I a RE

E/NE-Uganda 1 30% 203

Fe EE 7 39% 162

Tanzania—-East 8 66% 82 : 6 28% 93

Tanzania-Lake 3 60% 161 8 30%

Tanzania-North 3 100%

The Kenyan varieties are grouped mostly into the Group 1, 2 and 7 together with the Northeast Ugandan ones. For example, 43% of the central Kenyan clones are in the Group 1 and 33% of them in the

Group 2. Similarly the Nyanza clones distributed mainly into the

Group 7 but with smaller percent also present in the Group 1 and 2. Western Kenyan samples show the highest diversity, the highest representation is in the Group 7 with 23%, but they can be found also in the Group 1, 2 and 5. The Northeast Ugandan clones show : similarity with the Kenyan one, they are mapped into the Group 7, 1 and 2, 39%, 30% and 14% respectively. Much more conserved the

Central-Western Ugandan clones, eighty-four percent of them are in the Group 3 together with the three North Tanzanian varieties and 60% of the Lake-Tanzanian samples. Another thirty percent of the Lake Tanzanian varieties are together with the 66% of the

East Tanzanian samples in the Group 8. The rest 28% of the East

Tanzanian varieties were separated into the Group 6.

Analysing the number of the insertions in the different groups an increasing number of possible insertion sites from the coast part of Tanzania (East) to Central Kenya has been found. The highest possible insertion number was found in the Group 1 (203).

Around 16% of the investigated clones were found in that group, with the highest representation of the Central Kenyan samples (43%). In the group 2, 3, 7 and 9 the number of the possible in- sertion sites were 164, 161, 162, and around 60-90 possible in- sertion sites and the most predominant are the East Tanzanian samples in the Group 6 and 8 (see Table 7 and Fig. 9). Table 7 shows only the most characteristic two groups (6, 7), because the others (4, 5 and 10) are too small or too diverse (see also Ta- ble 6).

As already mentioned, retrotransposons transpose via an RNA in- termediate, which means, that the parental insertion remains fixed in the genome. Therefore every further insertion must have happened later, meaning a recent change in the genome. Continuing this theory the spread of a retrotransposon in the geographical distribution can be followed. In that case one is able to follow . the spread of the Strl87 retrotransposon in space and time. It is supposed that where the number of the insertion of the given retrotransposon is lower there is the starting point of its spread on a given area. Following this theory and based on the results about the increasing number of the insertions, it is pro- posed that the sweetpotato in East-Africa occurred first in East- }

Tanzania (insertions 80-90) and spread further to Lake-, North-

Tanzania, Central/Western Uganda (ins.161), East/Northeast Uganda and Kenya (Fig. 11), coming round the Victoria Lake. In Kenya and

Northeast Uganda three distribution areas with different inser- tions rates were found. Varieties from Central, Western and

Nyanza area of Kenya are grouped into the Groups 1, 2 or 7 to- gether with the Northeast-Ugandan clones, where the number of retrotransposon insertions is 203, 164 or 162 respectively (see

Table 7.). These results could suggest that in Kenya one part of the varieties were exposed to different biotic and abiotic ef- fects, which could induce the retrotransposon expression result- ing in new insertions.

Considering the fact, that the sweetpotato was introduced into

Africa not longer than five hundred years ago and during this time the retrotransposon insertion could increase 2-3 times in the African resources it can be supposed that the Strl87 retro- transposon is a still mobile retrotransposon.

- 30 ~-

References

Boeke JD, and Corces VG (1989) Transcription and reverse tran- scription of retrotransposons. Annu Rev Microbiol 43:403-434 ) Ellis THN, Poyser SJ, Knox MR, Vershinin AV and Ambrose MJ (1998) Polymorphism of insertion sites of Tyl-copia class retro- transposons and its use for linkage and diversity analysis in pea. Mol Gen Genet 260:9-19

Flavell AJ, Smith DB and Kumar A (1992a) Extreme heterogeneity of

Tyl -copia group retrotransposons in plants. Mol Gen Genet 23 1:233-242

Flavell AJ, Dunbar E, Anderson R, Pearce SR, Hartley R and Kumar

A (1992b) Tyl-copia group retrotransposons are ubiquitous and heterogeneous in higher plants. Nucleic acid Research 20(14): 3639-3644

Gichuki ST, Berenyi M, Zhang D, Hermann M, Schmidt J, Gl6ssl J &

Burg K (in preparation) Genetic diversity of Sweetpotato [Ipomea batatas (L-) Lam] as assessed with RAPD markers in rela- tionship to geographic sources

Gong-Xiu Yu and Wise RP (2000) An anchored AFLP- and retrotrans- poson-based map of diploid Avena, Genome 43:736-749

Grandbastien MA, Spielman A, Chaboche M (1989) Tntl, a mobile retroviral-like transposable element of tobacco isolated by plant cell genetics. Nature 337:376-380

Grandbastien MA, Lucas H, Morel JB, Mhiri C, Vernhettes § and . Casacuberta JM (1997) The expression of the tobacco Tntl retro- transposon is linked to plant defense responses. Genetica : 100:241-252

Heslop-Harrison JS, Brandes A, Taketa S, Schmidt T, Versinin av,

Alkhimova EG, Kamm A, Doudrick RL, Schwarzacher T, Katsiotis Aa,

Kubis S, Kumar A, Pearce SR, Flavell AJ and Harrison GE (1997)

The chromosomal distributions of Tyl-copia group retrotranspos-

able elements in higher plants and their implications for genome evolution. Genetica 100:197-204 ’ Hirochika H (1993) Activation of tobacco retrotransposons during tissue culture EMBO J 122521-2528

Hirochika H, Sugimoto K, Otsuki J and Kanda M (1996) Retrotrans- posons rice involved in mutations induced by tissue culture. PNAS

USA 93.7783-7788

Jarret RL, Gawel N and Whittemore A (1992) Phylogenetic Relation- ships of the Sweetpotato [Ipomea batatas (L.) Lam] J Amer

Soc Hort Sci 117:633-637.

Jones CJ, Edwards KJ, Castaglione MO, Winfield MO, Sala F, van de

Wiel C, Bredemeijer G, Vosman B, Matthes M, Daly A, Brettschnei- der R, Bettin P, Buiatti M, Maestri E, Malcevschi A, Marmiroli N,

Aert R, Volckaert G, Rueda J, Linacero R, Vazquez A and Karp A (1997) Reproducibility testing of RAPD, AFL-P and SSR markers in plants by a network of European laboratories. Molecular breeding 3:381-390.

Kumar A (1996) The adventures of the Tyl-copia group of retro- transposons, TIG 12(2):41-43

Kumar A and Bennetzen J (1999) Plant retrotransposons. Annu Rev

Genet 33:479-532

Liu B and Wendel JF (2000) Retrotransposon activation followed by rapid repression in introgressed rice plants. Genome 43:874-880

McClintok B (1984) The significance of responses of the genome to . challenge. Science 226:792-801

Mhiri C, Morel J-N, Vernhettes S, Casacuberta JM, Lucas H and

Grandbastien MA (1997) The promoter of the tobacco Tnl retro- transposon is induced by wounding and abiotic stress. Plant Mol

Biol 33:257-266

Milbourne D, Meyer RC, Bradshaw JE, Baird E, Bonar N, Provan J,

Powell W, Waugh R (1997) Comparison of PCR based marker systems for the analysis of genetic relationship in cultivated potato,

Mol. Bred 3:127-136

Milbourne D, Meyer RC, Collins AJ, Ramsay LD, Gebhardt C, Waugh R (1998) Isolation and characterisation and mapping of simple se- quence repeat loci in potato. In: Karp A, Isaac PG, Igram DS (eds) Molecular Tools for Screening Biodiversity. Chapman & Hall,

London, pp 371-381

Nuzhidin SV (1999) Sure facts, speculations, and open questions about the evolution of transposable element copy number, Genetica 107:129-137

Okamoto H and Hirochika H (2000) Efficient insertion mutagenesis of Arabidopsis by tissue culture-induced activation of the to- bacco retrotransposon Ttol. The Plant Journal 23(2):291-304

Pearce SR, Harrison G, Li D, Heslop-Harrison J.S, Kumar A and

Ravell AJ (1996) The Tyl-copia group retrotransposons in Vicia species: copy number, sequence heterogeneity and chromosomal lo- calisation. Mol Gen Genet 250:305-315 ‘Pearce SR, Harrison G, Heslop-Harrison J.S, Flavell AJ, Kumar A (1997) Characterization and genomic organization of Tyl-~copia group retrotransposons in rye (Secale cereale). Genome 40:617-625

Pearce SR, Stuart-Rogers C, Knox MR, Kumar A, Ellis THN and

Flavell AJ (1999) Rapid isolation of plant Tyl-copia group retro- transposon LTR sequences for molecular marker studies. The Plant

Journal 19(6):711-717 ‘ Pearce SR, Kriox M, Ellis THN, Flavell AJ and Kumar A (2000) Pea ‘Tyl-copia group retrotransposons: transpositional activity and use as markers to study genetic diversity in Pisum, Mol Gen Genet 263:898-907 . Peterson et al., (1993) Adv. Argon. 51:79-123

Powell W, Morgante M, Andre C, Hanafey M, Vogel J, Tingey 8S,

B WO 02/092847 PCT/EP02/05216

Rafalski A (1996) The utility of RFLP, RAPD, AFLP and SSR (micro- satellite) markers for germplasm analysis. Mol Breed. 2:225-238

Purugganan MD and Wessler SR (1995) Transposon signatures: spe- cies-gpecific molecular markers that utilize a class of multiple- copy nuclear DNA. Molecular Ecology 4:265-269

Sharbel F (1999) Amplified Fragment length polymorphisms: A non- random PCR-based technique for multilocus sampling. In: Epplen JT and Lubjuhn T (eds) DMA profiling and DNA fingerprinting.

Birkhiduser Verlag, Basel Switzerland pp. 178-194

Saitou, N., Nei, M. (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406-425.

Schmidt T, Kubis S, Heslop-Harrison JS (1996) Analysis and chro- mosomal localisation of retrotransposons in sugarbect (Beta wvul- garis): LINEs and Tyl-copia-like elements as major components of the genome. Chromosome Res 3:335-345

Shirasu K, Schulman AH, Lahaye T and Schulze-Lefert P (2000) A contiguous 66-kb Barley DANN sequence provides evidence for re- versible genome expansion. Genome Research 10:908-915

Sneath, P.H.A., Sokal, R.R. (1973) Numerical Taxonomy. W.H. Free- man, San Francisco. studier, J.A., Keppler, K.J. (1988) A note on the neighbor-join- ing algorithm of Saitou and Nei, Mol. Biol. Evol. 5:729-731. swarz-Sommer Z and Saedler H (1988) Transposition and retrotrans- : position in plants. In: Nelson O (eds) Plant Transposable Ele- ments. Plenum Press, New York, pp 175-187

Tautz D (1988) Hypervariability of simple sequence repeats as a general source for polymorphic DNA markers. Nucleic Acids Res 17:6463-6471

Vaucheret H, Marion-Poll A, Meyer C, Faure JD, Martin E, Caboche

M (1992) Interest in and limits to the utilization of reporter genes for the analysis of transcriptional regulation of nitrate reductase. Mol Gen Genet 235:259-268

Vernhettes S, Grandbastien MA and Casacuberta JM (1997) In vivo characterisation of transcriptional regulatory sequences involved in the defence-associated expression of the tobacco retrotrans- poson Tntl. Plant Mol Biol 35:673-679

Vos P, Hogers R, Bleeker M, Reijans M, Van de Lee T, Hornes M,

Frijters A, Pot J, Peleman J, Kuiper M and Zabeau M (1995) AFLP: a new technique for DNA fingerprinting. Nucleic Acids research 23(21):4407-4414

Waugh R, Mclean K, Flavell AJ, Pearce SR, Kumar A, Thomas BBT (1997) Genetic distribution of Bare-1-like retrotransposable ele- ments in the barley genome revealed by sequence-specific amplifi- cation polymorphism (S-SAP).

Wendel JF and Wessler SR (2000) Retrotransposon-mediated genome evolution on a local ecological scale. PNAS USA 97 (12) :6250-6252

Williams JG, Kubelik AR, Livak KJ, Raflski JA, Tingey SV (1990)

DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acid Res 18:6531-6535

Zabeau M and Vos P (1993) Selective restriction fragment amplifi- cation: a general method for DNA fingerprinting. European Patent

Application 924026297 (EP 0 534 858 Al)

AMENDED SHEET

29/11/2004

Claims (13)

Claims:

1.: Method for analysing DNA of a sweetpotato, characterised in by the following steps: - providing DNA of a sweetpotato, - physically breaking said DNA into DNA pieces, - introducing known sequences at at least one of the two ends of each DNA piece, - providing at least two primers, a first primer according to the formula {Ny) nhAGTCCTAACAN; N,N, (I) wherein N, is selected from A, C, Gand T; n is 0 to 20; N; is G, T, A or not present; N, is A, C, G or not present; N; is A, C, G or not present; or a complementary sequence thereto; and a second primer being able to anneal to the introduced sequence, - amplifying DNA of the DNA pieces with said primers and - analysing said amplified DNA.

2.: Method according to claim 1, characterised in that said physically breaking is performed by restriction endonuclease di- gestion.

3. A method according to claim 2, characterised in that said physically breaking is performed by a digestion with a 6 bp cutting enzyme.

4. A method according to claim 3, characterised in that the enzyme is a rare cutting enzyme.

5.: Method according to any one of claims 1 to 4, characterised in that (Ny), residues are selected from the sequence AGACTAAG

6.: Method according to any one of claims 1 to 5, characterised in that said first primer comprising a sequence selected from AGACTAAGAGTCCTAACA, AGACTAAGAGTCCTAACAG, AGACTAAGAGTCCTAACAT, AGACTAAGAGTCCTAACAA, AGACTAAGAGTCCTAACAGC, AGACTAAGAGTCCTAACAGA, AGACTAAGAGTCCTAACAGG, AGACTAAGAGTCCTAACATA, AGACTAAGAGTCCTAACATG, AGACTAAGAGTCCTAACATC, AGACTAAGAGTCCTAACAAA, AGACTAAGAGTCCTAACAAG, AGACTAAGAGTCCTAACAAC, or fragments thereof, said fragments op- tionally comprising at least 10 bp of the 3’ part of said se- quences.

7.: Method according to any one of claims 1 to 6, characterised in that said introducing known sequences at at least one of the two ends of each DNA piece comprises cutting the DNA with a re- AMENDED SHEET 29/11/2004 striction enzyme and linking an adapter to the end, said adapter comprising a known sequence.

8.: Method according to any one of claims 1 to 7, characterised in that said analysing comprises separating the amplified nucle- ic acid molecules by size.

9.: Method for defining the phylogenetic and geographical rela- tionship of two or more sweetpotatoes having different geno- types, comprising performing a method according to any one of claims 1 to 8 on each sweetpotato and comparing the results.

10.: Method according to claim 9, characterised in that said com- paring step comprises analysing a size separation of amplified nucleic acids.

11.: Method according to claim 9 or 10, characterised in that said comparing is performed by a computer calculating the phylogenet- ic distance from a size separation of amplified nucleic acids.

12.: Kit for performing a method according to any one of claims 1 to 11, characterised in that it comprises at least two primers as defined in any one of claims 1 to 11 and a nucleic acid poly- merase for amplifying nucleic acids defined by said at least two primers.

13.: Nucleic acid molecule comprising (a) a sequence between 12 and 286 bp according to SEQ ID NO:1, or (b) sequences differing not more than 1 b/bp per 20 b/bp from the sequence of SEQ ID NO:1, or (c) sequences hybridizing under stringent conditions to the se- quence of SEQ ID NO:1, or (d) complementary sequences to (a), (b) or (c). AMENDED SHEET 29/11/2004

. in that it comprises Seq.ID.No.l.