WO2026005490A1 - 목적 유전자의 발현 조절을 위한 인공 핵산 및 이를 이용한 다수 유전자의 발현 조절 시스템 - Google Patents

목적 유전자의 발현 조절을 위한 인공 핵산 및 이를 이용한 다수 유전자의 발현 조절 시스템

Info

Publication number
WO2026005490A1
WO2026005490A1 PCT/KR2025/008926 KR2025008926W WO2026005490A1 WO 2026005490 A1 WO2026005490 A1 WO 2026005490A1 KR 2025008926 W KR2025008926 W KR 2025008926W WO 2026005490 A1 WO2026005490 A1 WO 2026005490A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
nucleic acid
sequence
target gene
artificial nucleic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
PCT/KR2025/008926
Other languages
English (en)
French (fr)
Inventor
서상우
한용희
김현진
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SNU R&DB Foundation
Original Assignee
Seoul National University R&DB Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Seoul National University R&DB Foundation filed Critical Seoul National University R&DB Foundation
Publication of WO2026005490A1 publication Critical patent/WO2026005490A1/ko
Pending legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression

Definitions

  • the present invention relates to an artificial nucleic acid (genetic component) capable of precisely controlling the expression ratio between constituent genes in an operon artificially constructed in bacteria, and more specifically, to an artificial translation control system that uses different overlapping gene pair sequences that cause a translation coupling mechanism as the artificial nucleic acid of the present invention to control operon expression.
  • an artificial nucleic acid genetic component
  • an artificial translation control system that uses different overlapping gene pair sequences that cause a translation coupling mechanism as the artificial nucleic acid of the present invention to control operon expression.
  • the present invention was developed in accordance with the research project "Development of an ultra-fast growing microbial platform chassis for a synthetic biology-based cell factory for bio-manufacturing innovation" of the Bio and Medical Technology Development Project supported by the Ministry of Science and ICT (Project Unique Number: 1711200058, Project Number: 2021M3A9I4024737), the research project “Development of eco-friendly marine bio-plastic materials as an alternative to petrochemical materials" of the Marine Bio-Industrial Materials Domestication Technology Development Project supported by the Ministry of Oceans and Fisheries (Project Unique Number: 1525014268, Project Number: 20220258), the research project “Development of synthetic biology source technology for advanced non-pathogenic vibrio cell factories and advanced chassis production” of the Synthetic Biology Core Technology Development Project supported by the Ministry of Science and ICT (Project Number: RS-2024-00352569), and the research project "Development of synthetic biology-based microbial platform chassis for advanced non-pathogenic vibrio cell factories” of the
  • Microbial cell factories are a technology that can replace petrochemical-based manufacturing processes by utilizing microorganisms with rapid growth and metabolism to mass-produce high-value metabolites and proteins.
  • practical applications of cell factories are limited due to issues such as the unstable maintenance of foreign genes introduced into microorganisms, limited substrate availability, and difficulties in controlling complex intracellular metabolic pathways.
  • advanced synthetic biology tools capable of precisely and predictably controlling biological responses, including gene expression.
  • Microorganisms known as industrial strains such as Escherichia coli and yeast, lack or have incomplete metabolic pathways for producing specific target products, making the introduction of foreign genes essential. If the host strain's metabolic pathway for the target product is incomplete, or if the goal is to produce non-natural biochemicals, two or more foreign genes, such as biosynthetic gene clusters (BGCs), must be introduced to establish a new pathway within the strain. Furthermore, even when non-model strains, which possess characteristics such as rapid growth rates, acid tolerance, and overproduction of intermediates compared to industrial strains, are used as host strains, appropriate expression control of each gene is necessary for mass production of the target product.
  • BGCs biosynthetic gene clusters
  • Regulating the expression of each gene requires genetic components such as promoters, 5' untranslated regions (5' UTRs), and terminators.
  • genetic components such as promoters, 5' untranslated regions (5' UTRs), and terminators.
  • the number of available genetic components may be limited in some cases.
  • the duplication of genetic components with identical sequences can lead to mutations or loss of the introduced foreign genes through homologous recombination mechanisms.
  • operons one of the transcriptional units of microorganisms, to introduce multiple foreign genes into host strains.
  • Operons can express multiple genes using a single promoter, making them relatively free from limitations on the number of genetic components. Furthermore, because translation of multiple genes is initiated from a single mRNA, they offer the advantage of efficiently utilizing cellular resources required for gene expression, such as nucleotides and polymerases. However, when multiple genes are expressed in an operon format, regulating the expression of individual genes is difficult. To address this, previous studies have explored methods such as altering the order of operon genes, post-transcriptional modification of mRNA, and modeling-based operon gene expression control (operon calculator). However, existing technologies still face challenges, such as discrepancies in the expression of individual genes or limitations in the application of genetic components, which limit the scope of expression control. Therefore, the development of new synthetic biology tools for operon expression control continues.
  • Translational synchronization a translation mechanism within operons, allows translation of an upstream gene to influence the translation of a downstream gene. If the stop codon of an upstream gene overlaps with the start codon of a downstream gene (e.g., TAATG, ATGA) or the distance between the two genes is very close, the ribosome that translated the upstream gene can also participate in the translation of the downstream gene. While some previous studies have attempted to develop genetic components utilizing translational synchronization, these studies utilized the sequences that induce translational synchronization as leader peptides to precisely control the expression of a single target gene, and did not utilize them to regulate the expression of multiple genes.
  • the present invention aims to develop an artificial translation control system based on translational coupling that stably controls operon expression and maintains the ratio between produced proteins at a constant, unique value.
  • the present invention provides an artificial nucleic acid that is inserted between two or more target genes to regulate gene expression.
  • the target genes of the present invention can be divided into a first target gene located upstream of the artificial nucleic acid and a second target gene located downstream.
  • the artificial nucleic acid of the present invention operably links the 3' end of the first target gene and the 5' end of the second target gene.
  • the artificial nucleic acid can link each target gene by removing the 3' end stop codon of the first target gene and the 5' end start codon of the second target gene.
  • the artificial nucleic acid for regulating the expression of a target gene may be referred to as a 'gene component' or a 'SMART component'.
  • the artificial nucleic acid of the present invention comprises ATGA, GTGA, or TTGA, in which the initiation codon and the termination codon overlap, and comprises a Shine-Dalgarno sequence upstream of the overlapping sequence.
  • the artificial nucleic acid of the present invention has a sequence of 90 to 110 bp (preferably 99 bp) upstream of the overlapping sequence, and a sequence of 10 to 40 bp (preferably 30 bp) downstream of the overlapping sequence. Accordingly, the artificial nucleic acid of the present invention has a length of about 100 to 150 bp, preferably 120 to 130 bp, and most preferably 125 bp.
  • the artificial nucleic acid comprises a sequence of any one of SEQ ID NOs: 1 to 10 or a sequence having at least 90% homology thereto.
  • the present invention also provides a gene expression control system utilizing the artificial nucleic acid.
  • the gene expression control system of the present invention comprises an artificial nucleic acid inserted between a first target gene and a second target gene, thereby connecting the first target gene and the second target gene.
  • the artificial nucleic acid of the present invention is operably linked to each target gene via a linker.
  • the artificial nucleic acid may be linked to an upstream target gene via a linker.
  • the linker gene comprises a gene sequence encoding the sequence of SEQ ID NO: 18.
  • the artificial nucleic acid can be connected to a downstream target gene through a linker, and the linker gene connected to the downstream target gene is composed of a gene sequence encoding 'amino acid AG'.
  • the present invention also provides a method for controlling the expression level of a target gene using the gene expression control system.
  • the artificial nucleic acid and system of the present invention utilize a translation synchronization mechanism to ensure that a downstream gene is translated only when an upstream gene is translated, and to ensure that ribosomes involved in the translation of the upstream gene are used in the translation of the downstream gene, thereby accurately controlling the expression ratio between operon constituent genes as predicted.
  • the artificial nucleic acid of the present invention is composed of different sequences extracted from the genome of E. coli MG1655, so that even when each genetic component is used together to construct an artificial operon, the phenomenon of homologous recombination that may occur within the host strain can be minimized.
  • the artificial nucleic acid of the present invention can control the unique gene expression ratio exhibited by the translation synchronization sequence by changing the Shine-Dalgarno sequence present in each translation synchronization sequence.
  • Figure 1 is a schematic diagram illustrating the gene expression control system of the present invention.
  • mcherry is used as the upstream target gene
  • sgfp is used as the downstream target gene.
  • Expression control nucleic acids (SMART Biopart in Figure 1) are inserted between each target gene to control the expression level of the target gene.
  • Figure 2 is an image showing the structure and mechanism of action of the gene expression control system of the present invention.
  • Figure 3 is a flow chart showing a screening process performed to determine a gene expression regulating nucleic acid of the present invention.
  • FIG. 4 is an image showing the locations of 17 candidate gene expression regulatory nucleic acids (SMART) selected from the E. coli K-12MG1655 genome according to one embodiment of the present invention.
  • SMART 17 candidate gene expression regulatory nucleic acids
  • Figure 5 is a graph showing the ratio of mcherry and sgfp proteins expressed by linking TAA to the 5' end of candidate nucleic acids (TAA + SMART cassette production). The expression levels of mcherry and sgfp proteins were both normalized to the amount of mcherry protein in each candidate group.
  • Figure 6 shows the results of comparing the amount of target protein produced by inserting a nucleic acid (SMART cassette) synthesized according to the present invention.
  • the SMART activation ratio refers to the expression ratio between two adjacent genes, mcherry and sgfp.
  • the y-axis in Figures 5 and 6 represents the relative amount of each protein, and each data point is expressed as the mean ⁇ standard deviation (SD) of three biologically independent sample measurements, with white dots representing actual data points.
  • SD standard deviation
  • Figure 7 shows the results of comparing the transcription rate of a target gene and the SMART activation rate according to TAA binding (TAA + cassette) of nucleic acids selected according to the present invention.
  • TAA binding TAA + cassette
  • Figure 8 shows the results of comparing SMART activation ratios when T7 and Tac were used as promoters in an operon into which the nucleic acid (SMART component) of the present invention was introduced. Referring to Figure 8, it can be confirmed that the SMART activation ratio is maintained within the margin of error depending on the type of promoter.
  • Figure 9 shows the results of confirming the effect of changes in the expression level of an upstream gene in an operon into which the nucleic acid (SMART component) of the present invention was introduced on changes in the expression level of a downstream gene.
  • the translation initiation rate of the mCherry gene was controlled by changing the 5' untranslated region (5' UTR) sequence of mCherry.
  • the x-axis and y-axis represent the amounts of mCherry and sGFP, respectively, normalized to cell biomass (OD600).
  • the left side of Figure 10 shows the results confirming the influence of the coding sequence of the target gene on the SMART activation rate.
  • Various synthetic cassettes with various reporter combinations were used in this example, and the mcherry, sgfp, and luc genes were representatively used as reporters.
  • the right side of Figure 10 shows the results confirming the influence of the linker sequence.
  • Three linker sequences were introduced upstream of the nucleic acid of the present invention and the results were verified.
  • Figure 11 shows the results of examining whether the SMART activation ratio changed according to the change in the host strain.
  • the SMART cassette was transcribed by the Tac promoter.
  • ECD represents BL21 (DE3); ECB represents BL21; ECN represents Nissle 1917; ECM represents K-12 MG1655; and ECW represents the W strain.
  • Figure 12 shows the results of confirming whether the SMART activation ratio by each nucleic acid can be changed by changing the Shine-Dalgarno sequence (SD sequence) present in the nucleic acid (SMART component) of the present invention.
  • SD sequence Shine-Dalgarno sequence
  • Figure 13 is an image showing a simplified biosynthetic pathway leading to the production of 3-HP, P(3HB), and lycopene.
  • dhaB123 is a gene encoding three protein subunits of glycerol dehydratase (GDHt); kgsadh is a gene encoding an improved ALDH enzyme mutant; gdrAB is a gene encoding GDHt revertase; phaA is a gene encoding 3-ketothiolase; phaB is a gene encoding acetoacetyl coenzyme A reductase; phaC is a polyhydroxyalkanoate (PHA) synthase; crtE is a gene encoding geranylgeranyl pyrophosphate synthase; crtB is a gene encoding phytoene synthase; crtI is a gene encoding phytoene desaturase.
  • GDHt glycerol dehydrata
  • FIG. 14 shows the results of confirming the 3-HP production using a synthetic operon composed of kgsadh, dhaB1, and eight different nucleic acid sequences according to one embodiment of the present invention.
  • Figure 15 shows a schematic diagram of P(3HB) production using a synthetic operon composed of phaABC and a combination of three different nucleic acids (SMART components) and the resulting results.
  • Figure 16 shows the results of lycopene production using synthetic operons composed of various combinations of crtEBI and five SMART sequences.
  • the SMART activation ratios used for each operon in Figures 14, 15, and 16 are indicated by shaded circles or semicircles below the bar graphs.
  • a base when referring to a base, they may be interpreted as adenine (A), thymine (T), cytosine (C), guanine (G), or uracil (U) themselves, respectively, and when referring to a nucleoside, they may be interpreted as adenosine (A), thymidine (T), cytidine (C), guanosine (G), or uridine (U), respectively, and when referring to a nucleotide in a sequence, they should be interpreted to mean a nucleotide including each of the above nucleosides.
  • operably linked means, in gene expression technology, that a specific structure is linked to another structure so that the specific structure can function in the intended manner.
  • a promoter sequence when a promoter sequence is said to be operably linked to a coding sequence, it means that the promoter is linked so as to affect the transcription and/or expression of the coding sequence in a cell.
  • the term includes all meanings that can be recognized by a person skilled in the art, and can be appropriately interpreted according to the context.
  • target gene or “target nucleic acid” basically refers to a cellular gene or nucleic acid that is the target of gene expression regulation.
  • target gene or “target nucleic acid” may be used interchangeably and may refer to the same subject.
  • target gene or “target nucleic acid” may refer to either a gene or nucleic acid inherent to the target cell or an exogenous gene or nucleic acid, and is not particularly limited as long as it can be the target of gene expression regulation.
  • target gene or “target nucleic acid” may be single-stranded DNA, double-stranded DNA, and/or RNA.
  • the term encompasses all meanings that can be recognized by those skilled in the art and may be appropriately interpreted depending on the context.
  • the target genes of the present invention may be located upstream and downstream of the "artificial nucleic acid (gene component or SMART component of the present invention)", respectively.
  • the first target gene may be located upstream of the artificial nucleic acid
  • the second target gene may be located downstream of the artificial nucleic acid.
  • the first target gene and the second target gene may be composed of different sequences.
  • the target genes of the present invention are not limited in type, and any gene sequence capable of expression through the translation mechanism of an operon may be included.
  • the "artificial nucleic acid" of the present invention can be inserted between different target genes (e.g., a first target gene and a second target gene) to control the expression ratio of each target gene.
  • the "artificial nucleic acid” of the present invention includes a Shine-Dalgarno sequence within a translational synchronization sequence, and the expression level of the target gene can be controlled by changing the Shine-Dalgarno sequence.
  • the binding energy of mRNA and rRNA is strengthened by changing the Shine-Dalgarno sequence, the expression ratio of the downstream (second) target gene can be increased.
  • the expression ratio of the downstream gene can be increased in the order of the artificial nucleic acid of the present invention, SEQ ID NO: 1 ( cpxRA ) , SEQ ID NO: 2 ( pcnB/folK ) , SEQ ID NO: 3 ( fecCD ) , SEQ ID NO: 4 ( pqiBC ) , SEQ ID NO: 5 ( nanEK ) , SEQ ID NO: 6 ( ybgPO ) , SEQ ID NO: 7 ( hyfHI ) , SEQ ID NO: 8 ( hisDC ), SEQ ID NO: 9 ( astDB ) , SEQ ID NO: 10 ( fumE/yggC ). That is, when the artificial nucleic acid of SEQ ID NO: 1 is used, the expression ratio of the upstream gene can be increased compared to the artificial nucleic acid of SEQ ID NO: 10.
  • the expression ratios of upstream genes (e.g., first target gene) and downstream genes (e.g., second target gene) that appear when the artificial nucleic acid of the present invention is used can be determined.
  • the SMART activation ratio represents the expression ratio of the downstream gene to the upstream gene (downstream gene expression amount/upstream gene expression amount).
  • the expression level can be controlled at a ratio of 100:8 ⁇ 10 (upstream gene expression level: downstream gene expression level, hereinafter the same), 100:12 ⁇ 14 when using pcnB/folK, 100:16 ⁇ 20 when using fecCD, 100:26 ⁇ 29 when using pqiBC, 100:32 ⁇ 37 when using nanEK, 100:40 ⁇ 49 when using ybgPO, 100:45 ⁇ 51 when using hyfH, 100:66 ⁇ 70 when using hisDC, 100:81 ⁇ 89 when using astDB, and 100:84 ⁇ 99 when using fumE/yggC.
  • Sequence name SMART activation ratio ratio range Minimum Maximum cpxRA 0.09 0.08 0.1 pcnB/folK 0.12 0.12 0.14 fecCD 0.18 0.16 0.2 pqiBC 0.27 0.26 0.29 nanEK 0.34 0.32 0.37 ybgPO 0.44 0.40 0.49 hyfHI 0.47 0.45 0.51 hisDC 0.68 0.66 0.7 astDB 0.84 0.81 0.89 fumE/yggC 0.92 0.84 0.99 yidKJ 3.17 3.00 3.40 livHM December 18 11.60 12.60
  • an artificial translation cassette was constructed using a reporter protein.
  • the artificial translation cassette contains two genes encoding the fluorescent proteins mCherry and sGFP in that order, and a T7 promoter and T7 terminator were introduced to enable transcription by T7 RNA polymerase.
  • the 3' end of the mCherry coding sequence was replaced with a stop codon to insert a linker sequence encoding 10 amino acids (DSAGSAGSAG) to prevent the translational synchronization sequence from affecting the folding of the upstream gene.
  • the 5' end of the sGFP coding sequence was replaced with a start codon to insert a linker sequence encoding 2 amino acids (AG).
  • SMART component Synthetic Module for Accurate Expression Ratio by Translational Coupling
  • a 4-bp overlapping gene pair is a form in which the stop codon of the upstream gene overlaps with the start codon of the downstream gene, and in the present invention, these correspond to ATGA, GTGA, and TTGA. From the list of 4-bp overlapping gene pairs, 17 gene pairs distributed at various locations on the E. coli genome were randomly selected (Fig. 4).
  • the length of the extracted translational synchronization sequence was 125 bp due to the 4 bp overlapping sequence of the upstream and downstream genes (see Table 1).
  • nucleic acids that induce translational synchronization using TAA + SMART cassettes
  • the selected translational synchronization sequences were inserted into a translation cassette without an artificial stop codon, and fluorescence was measured, and 10 SMART components were selected whose expression ratio of the downstream gene to the upstream gene (sGFP protein/mCherry protein, hereinafter referred to as SMART activation ratio) did not exceed 1 (Fig. 6).
  • This selection criterion was established based on the assumption that if translation of the downstream gene is initiated solely by the ribosomes used to translate the upstream gene without independent translation initiation of the downstream gene, the number of ribosomes used to translate the downstream gene cannot exceed the number of ribosomes used to translate the upstream gene.
  • the 10 SMART components finally selected showed different SMART activation ratios.
  • Fluorescence measurement experiments to confirm whether the selected sequences exhibited a translational synchronization mechanism were conducted as follows. After introducing the artificial translation cassette into the E. coli BL21 (DE3) strain, the strain was cultured overnight in LB medium supplemented with 34 ⁇ g/mL chloramphenicol to maintain the plasmid containing the artificial translation cassette. The strain was then diluted 1/100, inoculated into 5 mL of fresh medium, and cultured in a shaking incubator at 37°C and 250 rpm. Expression of the artificial translation cassette was induced by adding 0.2 mM IPTG when the absorbance (OD600) was around 0.8-1.0. After the addition of IPTG, the culture was incubated for an additional 6 hours, and the final absorbance was measured.
  • the fluorescence from each fluorescent protein (mCherry, sGFP) and the luminescence from nanoluciferase were measured using a Hidex Sense Microplate Reader.
  • the wavelength filters used for fluorescence measurements in the present invention are as follows. mCherry, 575-nm excitation filter, 616-nm emission filter; sGFP, 485-nm excitation filter, 535-nm emission filter. Luminescence by nanoluciferase was measured using the Nano-Glo ® Luciferase Assay System from Promega, using a Hidex Sense Microplate Reader, according to the user manual. The amount of fluorescent protein was estimated from each fluorescence, and the gene expression ratio by SMART components was calculated.
  • each protein was purified using the Ni-NTA method by linking a 6X His-tag to the 3' end of the fluorescent protein, and the amount of purified protein was measured using the Bradford assay.
  • the fluorescence of the quantified fluorescent proteins was measured while diluting them to different amounts, and a relationship between fluorescence value and protein amount was derived.
  • the mole number was calculated from the fluorescence value by taking the molecular weight of each fluorescent protein into account.
  • the mole number of protein was calculated from the luminescence value of nanoluciferase. All subsequent fluorescence measurement experiments were conducted according to this method.
  • SMART component selected according to the present invention does not affect the transcription levels of operon constituent genes.
  • linker sequence designation Sequence (5' -> 3') Sequence number Linker (amino acid) DSAGSAGSAG 18 Linker GAT AGT GCT GGT AGT GCT GGT AGT GCT GGT 19 Linker_S GAT TCG GCC GGA AGC GCT G6G TCC GCA GGC 20 Linker_SS GAT AGC GCT GGG TCC GCA GGA AGT GCT GGC 21
  • RNAfold web server http:/rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi
  • RBS calculator https:/salislab.net/software/design_rbs_calculator
  • SMART components selected nucleic acids
  • High-value metabolites such as 3-hydroxypropionic acid (3-HP), P(3HB) (poly(3-hydroxybutyrate), a type of polyhydroxybutyrate), and lycopene were selected as target metabolites, and their metabolic pathways were constructed in E. coli MG1655 or E. coli W strains (Fig. 13).
  • the 3-HP metabolic pathway consists of glycerol dehydratase (GDHt), which produces 3-hydroxypropionaldehyde (3-HPA) from glycerol, aldehyde dehydrogenase (KGSADH), which produces 3-HP from 3-HPA, and glycerol dehydratase reactivase (GDHt reactivase), which reactivates GDHt.
  • GDHt is a complex composed of three protein units (DhaB1, DhaB2, and DhaB3), of which DhaB1 protein is known to be the main unit that causes the enzymatic reaction.
  • the amount of 3-HP produced from an artificial operon constructed by inserting eight different SMART components between the genes encoding KGSADH and DhaB1 was compared.
  • Five SMART components derived from Escherichia coli (pcnB/folK, pqiBC, hyfHI, hisDC, astDB) and three SMART components constructed by modifying the SD sequence (hisSD1, astSD3, hyfSD14) were used.
  • the metabolic pathway for 3-HP production was constructed by modifying 3-HP production plasmids 1 and 2 used in two previous studies.
  • 3-HP production plasmid 1 expresses DhaB1 as an independent gene cassette, and DhaB2, DhaB3, and glycerol dehydratase reactivator as an operon (Lim et al., ACS Synth. Biol., 2016).
  • 3-HP production plasmid 2 expresses KGSADH (Seok et al., Metab. Eng., 2018).
  • the DhaB1 gene cassette present in 3-HP production plasmid 1 was removed, and a 10 amino acid linker-SMART component-2 amino acid linker-DhaB1 gene was placed downstream of the KGSADH gene of 3-HP production plasmid 2. After introducing the newly reconstructed 3-HP production plasmids 1 and 2 into E.
  • minimal medium [0.5 g/L MgSO4 ⁇ 7H2O, 2 g/L NH4Cl, 2 g/L NaCl, 1 g/L yeast extract, 100 mM potassium phosphate buffer (pH 7.0)] with 100 mM glycerol as a carbon source was used.
  • 34 ⁇ g/mL chloramphenicol and 80 ⁇ g/mL ampicillin were added.
  • Cells cultured overnight were subcultured into 5 mL medium when the initial absorbance reached 0.05 and cultured in a shaking incubator at 37°C and 250 rpm. When the absorbance reached 0.9–1.0, 0.1 mM IPTG and 0.2 ⁇ M B12 were added.
  • P(3HB) can be produced from acetyl-CoA in E. coli, and the metabolic pathway additionally required to produce P(3HB) consists of three enzymes (PhaA, PhaB, PhaC).
  • An artificial operon was constructed with the PhaABC genes, and a total of nine artificial operons were constructed by combining and inserting three types of SMART parts (pcnB/folK, hyfHI, astDB) between each gene. At this time, the artificial operons were expressed by the Tac promoter. After introducing the artificial operon into the E.
  • the strain was cultured overnight in LB medium supplemented with 34 ⁇ g/mL Chloramphenicol to maintain the plasmid containing the artificial operon. Afterwards, the strain was inoculated into 100 mL of fresh medium so that the initial absorbance was 0.02 and cultured in a shaking incubator at 30°C and 200 rpm. When the absorbance (OD600) was 1.0-1.2, 0.2 mM IPTG was added to induce expression of the artificial operon. P(3HB) was extracted and quantified, and the production yield (weight of P(3HB) produced per dry weight of cells) was calculated. It was confirmed that as the expression of PhaC increased due to changes in the SMART component, the yield of P(3HB) also increased (Fig. 15).
  • P(3HB) extraction the strain was cultured for 72 hours, then the cells were harvested by centrifugation and washed once with 1X PBS solution. After the cells were freeze-dried for 48 hours, methanolysis for P(3HB) extraction was performed using approximately 50 mg of freeze-dried cells. For methanolysis, 2 mL of chloroform, 1.9 mL of methanol containing 15% sulfuric acid, and 0.1 mL of methanol containing 50 mg/L benzoic acid were mixed with the freeze-dried cells and reacted at 65°C for more than 48 hours. After adding 2 mL of distilled water and vortexing, the mixture was allowed to separate into layers, and only the lower layer solution was extracted and used for GC analysis.
  • the lycopene metabolic pathway is composed of three foreign enzymes (CrtE, CrtB, and CrtI) added to the DXP metabolic pathway existing in E. coli.
  • CrtE three foreign enzymes
  • the artificial operon was expressed by the Tac promoter. After introducing the artificial operon into E.
  • the strain was cultured overnight in LB medium supplemented with 34 ⁇ g/mL Chloramphenicol to maintain the plasmid containing the artificial operon. The strain was then inoculated into 3 mL of fresh medium to an initial absorbance of 0.05 and cultured in a shaking incubator at 37°C and 250 rpm. When the optical density (OD600) was 1.0-1.2, 0.2 mM IPTG was added to induce expression of the artificial operon. After 24 h of culture, the final optical density of the culture was measured, and lycopene was extracted and quantified to calculate the production yield (weight of lycopene produced per dry weight of cells). By varying the expression ratio of the operon through combinations of different SMART components, the production yield of the target product with a difference of up to 2.2-fold was controlled (Fig. 16).
  • lycopene To extract lycopene, 1 mL of the culture medium was washed once with 1X PBS solution, and then 200 ⁇ L of acetone was added and reacted at 55°C for 15 minutes. After centrifugation to settle cell debris, the supernatant was mixed with an equal volume of DMSO, and the lycopene content was measured from the absorbance value at a wavelength of 475 nm. A NanoDrop spectrophotometer (ThermoFisher) was used for absorbance measurement. To convert the amount of lycopene from the absorbance value, the quantified lycopene was diluted to various concentrations and the absorbance was measured, and the proportional relationship between the absorbance and the amount of lycopene was determined.
  • a NanoDrop spectrophotometer ThermoFisher
  • CTGCA ACCGGTGCTGAAAACGCTCAATGAGAAGAGTAACGCGCTGGTATTTGAAGCGAAGGACAAAAAAAAGATCCAGAGCCGAAGAGGGCGAAACAATGAAAAAGTGGCTAGTGACGATTGCAGCA

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 다수의 복합 유전자의 발현 비율을 정밀하고 예측 가능하게 조절할 수 있는 신규 인공 핵산(유전자 부품)에 관한 것이다. 본 발명의 인공 핵산은 오페론 구성 유전자 간의 발현 비율을 예측한 대로 정확하게 조절할 수 있다. 또한, 인공 핵산의 번역 동조 서열에 존재하는 샤인-달가노 서열의 변화를 통해, 유전자 발현 비율을 조절할 수 있다.

Description

목적 유전자의 발현 조절을 위한 인공 핵산 및 이를 이용한 다수 유전자의 발현 조절 시스템
본 발명은 박테리아에 인공적으로 구축한 오페론에서 구성 유전자 간의 발현 비율을 정밀하게 조절할 수 있는 인공 핵산(유전자 부품)에 관한 것으로, 보다 상세하게는 번역 동조 기작 (translation coupling mechanism)을 일으키는 서로 다른 중첩 유전자 쌍(overlapping gene pair) 서열들을 본 발명의 인공 핵산으로 사용하여 오페론 발현을 조절하는 인공 번역 제어 시스템에 관한 것이다.
본 발명은 과학기술정보통신부가 지원한 바이오·의료기술개발 사업의 "바이오제조 혁신을 위한 합성생물학 기반 세포공장용 초고속 성장 미생물 플랫폼 섀시 개발" 연구과제(과제고유번호: 1711200058, 과제번호: 　2021M3A9I4024737), 해양수산부가 지원한 해양바이오 산업소재 국산화 기술개발 사업의 "석유화학 소재 대체 친환경 해양바이오 플라스틱 소재 개발" 연구과제(과제고유번호: 1525014268, 과제번호: 　20220258), 과학기술정보통신부가 지원한 합성생물학 핵심기술개발사업의 "비병원성 비브리오 세포공장 첨단화용 합성생물학 원천기술 개발 및 고도화 섀시 제작" 연구과제(과제번호: 　RS-2024-00352569), 및 과학기술정보통신부가 지원한 우수신진연구사업의 "합성생물학 기반 미생물 생물치료제 개발" 연구과제(과제번호: 　RS-2024-00345885)의 지원을 받아 수행되었다.
미생물 세포공장은 생장과 대사가 빠른 미생물을 활용해 고부가 대사산물이나 단백질을 대량 생산할 수 있어 석유화학 기반의 제조공정을 대체할 수 있는 기술이다. 그러나 미생물에 도입한 외래 유전자의 불안정한 유지, 활용 가능한 기질의 제한, 세포 내 복잡한 대사 경로 제어의 어려움 등의 문제로 인해 세포공장으로의 실질적인 활용이 제한되어 있다. 이러한 문제점을 해결하기 위해, 유전자 발현을 포함한 생체 반응을 정밀하고 예측 가능하게 조절할 수 있는 고도의 합성생물학 도구 개발이 지속되고 있다.
산업 균주로 알려진 대장균, 효모 등의 미생물에는 특정 목적 산물을 생산하기 위한 대사 경로가 전무하거나 불완전하기 때문에, 외래 유전자의 도입은 필수적이다. 호스트 균주 내에 목적 산물 대사 경로가 불완전하거나, 비천연 생화학 물질의 생산을 목적으로 할 경우, 균주 내 새로운 경로를 구축하기 위해 BGC (biosynthetic gene cluster)와 같이 둘 이상의 외래 유전자를 도입해야 한다. 한 편, 산업 균주 대비 빠른 생장속도, 내산성, 중간 단위체의 과생산 등의 특성을 보유한 비모델 균주를 호스트 균주로 사용할 때도 목적 물질을 대량 생산하기 위해서는 각 유전자들의 적절한 발현 조절이 필요하다. 각 유전자의 발현을 조절하기 위해서는 프로모터, 5’비번역 부위 (5’ UTR), 터미네이터 등의 유전자 부품이 필요하지만, 경우에 따라 활용 가능한 유전자 부품 수가 제한될 수 있다. 그리고 서열이 동일한 유전자 부품을 중복 사용할 경우, 상동재조합 기작에 의해 도입한 외래 유전자의 변형 및 소실이 발생할 수 있다. 이러한 문제를 해결하기 위해 다수의 연구에서 미생물의 전사 단위 중 하나인 오페론을 활용해 다수의 외래 유전자를 호스트 균주에 도입하고 있다.
오페론은 하나의 프로모터를 사용해 여러 유전자를 발현할 수 있으므로 유전자 부품 수의 제한으로부터 비교적 자유롭다. 또한 하나의 mRNA에서 여러 유전자의 번역이 개시되기 때문에, 뉴클레오타이드, 중합효소 등 유전자 발현에 필요한 세포 내 자원을 효율적으로 활용할 수 있다는 장점이 있다. 하지만 오페론 형태로 다중 유전자를 발현할 경우, 개별 유전자의 발현 조절이 어렵다. 이를 해결하기 위해 선행 연구들에서는 오페론 구성 유전자의 순서를 변경하거나, mRNA의 전사 후 변형 (post-transcription modification), 모델링 기반 오페론 유전자 발현 조절 (Operon calculator) 등의 방법이 연구된 바 있다. 그러나 기존 기술들은 각 유전자의 발현이 예측과 다르거나, 유전자 부품을 적용할 수 있는 조건이 한정되어 발현 조절 범위가 제한되는 등의 문제가 여전히 존재하기 때문에, 오페론 발현 조절을 위한 새로운 합성생물학 도구 개발은 지속적으로 진행되고 있다.
오페론의 번역 기작 중 하나인 번역 동조는 상류 유전자의 번역이 하류 유전자의 번역에 영향을 미칠 수 있다. 상류 유전자의 종결 코돈과 하류 유전자의 개시 코돈이 일부 중첩되어 있거나 (예를 들면 TAATG, ATGA), 두 유전자 사이의 거리가 매우 가까운 경우, 상류 유전자를 번역한 리보솜이 하류 유전자의 번역에도 관여할 수 있게 된다. 번역 동조를 활용한 유전자 부품 개발을 시도한 선행 연구가 일부 있으나, 이러한 연구들에서는 1개의 목적 유전자의 발현을 정밀하게 조절하기 위해 번역 동조를 일으키는 서열을 리더 펩타이드 형태로 활용하고, 다수의 유전자의 발현을 조절하는 형태로는 활용하지 않았다. 또한, 번역 동조를 일으키는 서열이 만드는 2차 구조에 따라 상류 유전자를 번역하지 않은 새로운 리보솜이 하류 유전자를 독립적으로 번역 개시할 수도 있는데, 선행 연구에서는 이러한 독립적인 번역 개시를 억제한 서열을 따로 스크리닝하여 사용하지 않았다. 이는 세포 독성을 띠는 유전자처럼 정밀한 유전자 발현 제어가 필요한 경우 발현 누출이 발생할 수 있어 적합하지 않다. 따라서, 다수의 유전자 발현을 한꺼번에 조절하면서도 각 유전자의 발현 비율을 예측한 대로 정확히 발현시킬 수 있는 유전자 부품의 개발이 필요하다. 본 발명에서는 하류 유전자에서 독립적으로 번역을 개시하지 않으면서, 번역 동조를 일으킬 수 있는 중첩 유전자 쌍 서열들을 발굴하여 유전자 부품으로 제작하였다.
본 발명에서는 오페론 발현을 안정적으로 조절하고, 생산된 단백질 간의 비율이 고유한 값으로 일정하게 유지되도록 하는 번역 동조 (translational coupling) 기반의 인공 번역 제어 시스템 개발을 목적으로 한다.
상기 목적을 달성하기 위하여 본 발명은 두 개 이상의 목적 유전자 사이에 삽입되어 유전자의 발현을 조절하는 인공 핵산을 제공한다. 본 발명의 목적 유전자는 상기 인공 핵산의 상류에 위치하는 제1 목적 유전자, 하류에 위치하는 제2 목적 유전자로 나눌 수 있다. 본 발명의 상기 인공 핵산은 제1 목적 유전자의 3' 말단 및 제2 목적 유전자의 5' 말단을 작동 가능하게 연결한다. 본 발명에서 상기 인공 핵산은 제1 목적 유전자의 3' 말단 종결 코돈 및 제2 목적 유전자의 5' 말단 개시코돈을 제거하고 각 목적 유전자를 연결할 수 있다.
본 명세서에서, 목적 유전자의 발현을 조절하기 위한 상기 인공 핵산은 '유전자 부품' 또는 'SMART 부품' 으로 명명될 수 있다.
본 발명의 인공 핵산은 개시 코돈과 종결 코돈이 중첩된 ATGA, GTGA 또는 TTGA를 포함하고, 상기 중첩서열 상류에 샤인-달가노 서열을 포함한다. 본 발명의 인공 핵산은 상기 중첩서열을 기준으로 상류에 90 내지 110 bp(바람직하게는 99bp)의 서열, 하류에 10 내지 40bp(바람직하게는 30bp)의 서열을 갖는다. 따라서, 본 발명의 인공 핵산은 약 100 내지 150 bp의 길이를 갖고, 바람직하게는 120 내지 130bp, 가장 바람직하게는 125bp 길이로 이루어진다.
본 발명의 바람직한 일 실시예에서, 상기 인공 핵산은 서열번호 1 내지 10중 어느 하나의 서열 또는 이와 90% 이상의 상동성을 갖는 서열로 이루어진다.
본 발명은 또한, 상기 인공 핵산을 이용한 유전자 발현 조절 시스템을 제공한다. 본 발명의 유전자 발현 조절 시스템은 제1 목적 유전자 및 제2 목적 유전자 사이에 삽입되어 제1 목적 유전자 및 제2 목적 유전자를 연결하는 인공 핵산을 포함한다. 본 발명의 상기 인공 핵산은 링커를 통해 각 목적 유전자와 작동 가능하게 연결된다.
본 발명에서 상기 인공 핵산은 상류의 목적 유전자와 링커를 통해 연결될 수 있다. 이 경우, 링커 유전자는 서열번호 18의 서열을 코딩하는 유전자 서열로 이루어진다.
본 발명에서 상기 인공 핵산은 하류의 목적 유전자와 링커를 통해 연결될 수 있으며, 하류 목적 유전자와 연결되는 링커 유전자는 '아미노산 AG' 을 코딩하는 유전자 서열로 이루어진다.
본 발명은 또한, 상기 유전자 발현 조절 시스템을 이용하여, 목적 유전자의 발현량을 조절하는 방법을 제공한다.
본 발명의 인공 핵산 및 시스템은 번역 동조 기작을 활용하여 상류 유전자가 번역될 경우에만 하류 유전자가 번역되도록 하고, 상류 유전자의 번역에 관여한 리보솜이 하류 유전자 번역에 사용되도록 하여 오페론 구성 유전자 간의 발현 비율을 예측한 대로 정확하게 조절할 수 있다.
본 발명의 인공 핵산은 대장균 MG1655의 유전체에서 추출한 서로 다른 서열로 구성되어 있어서, 각 유전자 부품을 함께 사용하여 인공 오페론을 구축하더라도 호스트 균주 내에서 발생할 수 있는 상동재조합 현상을 최소화할 수 있다.
본 발명의 인공 핵산은 각 번역 동조 서열에 존재하는 샤인-달가노 서열의 변화를 통해, 번역 동조 서열이 보이는 고유의 유전자 발현 비율을 조절할 수 있다.
도 1은 본 발명의 유전자 발현 조절 시스템을 설명하는 개략도이다. 도 1에서는 상류 목적 유전자로 mcherry를, 하류 목적 유전자로 sgfp를 이용하였으며, 각 목적 유전자 사이에 발현 조절 핵산(도 1에서 SMART Biopart)을 삽입하여, 목적 유전자의 발현량을 조절한다.
도 2는 본 발명의 유전자 발현 조절 시스템의 구조와 작용 메커니즘을 나타내는 이미지이다.
도 3은 본 발명의 유전자 발현 조절 핵산을 결정하기 위하여 수행된 스크리닝 과정을 나타내는 흐름도이다.
도 4는 본 발명의 일 실시예에 따라 E.coli K-12MG1655 게놈에서 선택된 유전자 발현 조절 핵산(SMART) 17개의 후보군의 위치를 나타내는 이미지이다.
도 5는 후보군 핵산의 5' 말단에 TAA를 연결(TAA+ SMART cassette 제작)하여, 발현된 mcherry 및 sgfp 단백질의 비율을 나타낸 그래프이다. mcherry 및 sgfp 단백질의 발현량은 모두 각 후보군의 mcherry 단백질 양으로 표준화하였다.
도 6은 본 발명에 따라 합성된 핵산(SMART cassette)을 삽입하여, 생산된 목적 단백질 양을 비교한 결과이다. 도 6에서 SMART 활성화 비율은 인접한 두 유전자 mcherry와 sgfp 사이의 발현 비율을 의미한다. 또한, 도 5 및 도 6에서 y축은 각 단백질의 상대적인 양을 나타내며, 각 데이터는 생물학적으로 독립적인 3개의 샘플 측정값의 평균 ± 표준편차(SD)로 표시되며 흰색 점은 실제 데이터 포인트를 나타낸다.
도 7은 본 발명에 따라 선별된 핵산의 TAA 결합(TAA+ cassette)에 따른 목적 유전자의 전사 비율과 SMART 활성화 비율을 비교한 결과이다. SMART 및 TAA+ 카세트에서 파생된 전사물을 비교할 때 TC와 전사율 사이에는 유의한 관계가 나타나지 않았다.
도 8은 본 발명의 핵산(SMART 부품)이 도입된 오페론에서 프로모터로 T7, Tac를 각각 이용하였을 때, SMART 활성화 비율을 비교한 결과이다. 도 8을 참조하면, 프로모터 종류에 따라 SMART 활성화 비율이 오차범위 내에서 유지되는 것을 확인할 수 있다.
도 9는 본 발명의 핵산(SMART 부품)이 도입된 오페론에서 상류 유전자의 발현량 변화가 하류 유전자의 발현량 변화에 미치는 영향을 확인한 결과이다. 본 실시예에서는 mCherry의 5' 비번역 부위 (5’ UTR) 서열을 변화시켜 mCherry 유전자의 번역 개시 속도를 조절하였다. 도 9에서 x축 및 y 축은 각각 세포 바이오매스(OD600)로 정규화된 mCherry 및 sGFP의 양을 나타낸다.
도 10의 좌측은 SMART 활성화 비율에 대한 목적 유전자의 코딩 순서에 따른 영향을 확인한 결과이다. 다양한 리포터 조합을 갖춘 다양한 합성 카세트가 본 실시예에 사용되었으며, 대표적으로 mcherry, sgfp 및 luc 유전자가 리포터로 사용되었다. 도 10의 우측은 링커 서열에 따른 영향을 확인한 결과이다. 본 발명의 핵산 상류에 3개 링커 서열을 도입하고 그 결과를 검증했다. 도 10의 결과는 링커 간의 차이가 무시할 수 있음을 나타낸다. 데이터는 생물학적으로 독립적인 3개의 샘플(n = 3) 측정값의 평균 ± 표준 편차(sd)로 표시되며 각 점은 실제 데이터 포인트를 나타낸다.
도 11은 호스트 균주의 변경에 따른 SMART 활성화 비율(activation ratio)의 변화 여부를 확인한 결과이다. 도 11의 각 경우에서 SMART 카세트는 Tac 프로모터에 의해 전사되었다. 도 11에서, ECD는 BL21(DE3)를; ECB는 BL21를; ECN는 Nissle 1917를; ECM는 K-12 MG1655를; ECW는 W 균주를 의미한다. 각 데이터는 생물학적으로 독립적인 3개의 샘플(n = 3) 측정값의 평균 ± 표준 편차(sd)로 표현되었다.
도 12는 본 발명의 핵산(SMART 부품) 내에 존재하는 샤인-달가노 서열 (SD 서열)을 변경하여, 각 핵산에 의한 SMART 활성화 비율(activation ratio)을 변화할 수 있는지 확인한 결과이다.
도 13은 3-HP, P(3HB) 및 리코펜 생산으로 이어지는 단순화된 생합성 경로를 나타낸 이미지이다. 도 13에서, dhaB123는 글리세롤 탈수효소(GDHt)의 세 가지 단백질 하위 단위를 암호화하는 유전자; kgsadh는 향상된 ALDH 효소 돌연변이를 코딩하는 유전자; gdrAB는 GDHt revertase를 코딩하는 유전자; phaA는 3-케토티올라제(3-ketothiolase)를 코딩하는 유전자; phaB는 아세토아세틸 조효소 A 환원효소(acetoacetyl coenzyme A reductase)를 코딩하는 유전자; phaC는 폴리하이드록시알카노에이트(PHA) 생성효소(synthase); crtE는 geranylgeranyl pyrophosphate synthase를 코딩하는 유전자; crtB는 phytoene synthase 를 코딩하는 유전자; crtI는 phytoene desaturase를 코딩하는 유전자이다.
도 14는 본 발명의 일 실시예에 따라 kgsadh, dhaB1 및 8개의 서로 다른 핵산 서열로 구성된 합성 오페론을 사용한 3-HP 생산량을 확인한 결과이다.
도 15는 phaABC 및 세 가지 서로 다른 핵산(SMART 부품)의 조합으로 구성된 합성 오페론을 사용한 P(3HB) 생산 모식도와 그에 따른 결과를 나타낸다.
도 16은 crtEBI와 다섯 가지 SMART 시퀀스의 다양한 조합으로 구성된 합성 오페론을 사용한 리코펜 생산 결과이다. 도 14, 15 및 16에서 각 오페론에 사용되는 SMART 활성화 비율은 막대 그래프 아래에 음영 처리된 원 또는 반원으로 표시되었다. 각 데이터는 생물학적으로 독립적인 3개의 샘플(n = 3) 측정값의 평균 ± 표준 편차(sd)로 표현시되며, 각 점은 실제 데이터 포인트를 나타낸다.
이하, 발명의 이해를 돕기 위해 다양한 실시예를 제시한다. 하기 실시예는 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐 발명의 보호범위가 하기 실시예에 한정되는 것은 아니다.
본 명세서에서 사용되는 A, T, C, G 및 U 기호는 당업계 통상의 기술자가 이해하는 의미로 해석된다. 문맥 및 기술에 따라 DNA 또는 RNA 상에서 염기, 뉴클레오사이드 또는 뉴클레오타이드로 적절히 해석될 수 있다. 예를 들어, 염기를 의미하는 경우는 각각 아데닌(A), 티민(T), 시토신(C), 구아닌(G) 또는 우라실(U) 자체로 해석될 수 있고, 뉴클레오사이드를 의미하는 경우는 각각 아데노신(A), 티미딘(T), 시티딘(C), 구아노신(G) 또는 유리딘(U)으로 해석될 수 있으며, 서열에서 뉴클레오타이드를 의미하는 경우는 상기 각각의 뉴클레오사이드를 포함 하는 뉴클레오타이드를 의미하는 것으로 해석되어야 한다.
본 명세서에서 사용되는 "작동 가능하게 연결된(operably linked)"이라는 용어는 유전자 발현 기술에 있어서, 특정 구성이 다른 구성과 연결되어, 상기 특정 구성이 의도된 방식대로 기능할 수 있도록 연결되어 있는 것을 의미한다. 예를 들 어, 프로모터 서열이 암호화 서열과 작동적으로 연결되었다고 할 때, 상기 프로모터가 상기 암호화 서열의 세포 내에서의 전사 및/또는 발현에 영향을 미칠 수 있도록 연결된 것을 의미한다. 또한, 상기 용어는 당업계 통상의 기술자가 인식할 수 있는 의미를 모두 포함하며, 문맥에 따라 적절히 해석될 수 있다.
본 명세서에서 사용되는 "목적 유전자" 또는 "목적 핵산"은 기본적으로, 유전자 발현 조절의 대상이 되는 세포 내 유전자, 또는 핵산을 의미한다. 상기 목적 유전자 또는 목적 핵산은 혼용될 수 있으며, 서로 동일한 대상을 지칭할 수 있다. 상기 목적 유전자 또는 목적 핵산은 달리 기재되지 않은 한, 대상 세포가 가진 고유한 유전자 또는 핵산, 혹은 외부 유래의 유전자 또는 핵산 모두를 의미할 수 있으며, 유전자 발현 조절의 대상이 될 수 있다면 특별히 제한되지 않는다. 상기 표적 유전자 또는 표적 핵산은 단일가닥 DNA, 이중가닥 DNA, 및/또는 RNA일 수 있다. 또한, 상기 용어는 당업계 통상의 기술자가 인식할 수 있는 의미를 모두 포함하며, 문맥에 따라 적절히 해석될 수 있다.
본 발명의 목적 유전자는 "인공 핵산(본 발명의 유전자 부품 또는 SMART 부품)"을 기준으로 상류 및 하류에 각각 위치할 수 있다. 예컨대, 제1 목적 유전자는 인공 핵산을 기준으로 상류에, 제2 목적유전자는 인공 핵산을 기준으로 하류에 위치할 수 있으며, 제1 목적 유전자와 제2 목적 유전자는 서로 다른 서열로 이루어질 수 있다. 본 발명의 목적 유전자는 그 종류를 제한하지 않으며, 오페론의 번역 기작을 통해 발현 가능한 유전자 서열이면 모두 포함될 수 있다.
본 발명의 "인공 핵산"은 서로 다른 목적 유전자(예컨대, 제1 목적 유전자 및 제2 목적 유전자)사이에 삽입되어, 각 목적 유전자의 발현 비율을 조절할 수 있다. 본 발명의 "인공 핵산"은 번역 동조 서열 내 샤인-달가노 서열을 포함하며, 상기 샤인-달가노 서열의 변화를 통해 목적 유전자의 발현량을 조절할 수 있다. 상기 샤인-달가노 서열을 변경하여 mRNA와 rRNA의 결합에너지를 강화시키는 경우, 하류(제2) 목적 유전자의 발현 비율을 증가시킬 수 있다.
예를들어, 본 발명의 인공 핵산인, 서열번호 1(cpxRA), 서열번호 2(pcnB/folK), 서열번호 3(fecCD), 서열번호 4(pqiBC), 서열번호 5(nanEK), 서열번호 6(ybgPO), 서열번호 7(hyfHI), 서열번호 8(hisDC), 서열번호 9(astDB), 서열번호 10(fumE/yggC) 순으로 하류 유전자의 발현 비율을 증가시킬 수 있다. 즉, 서열번호 1의 인공 핵산을 이용하는 경우, 서열번호 10의 인공 핵산보다 상류 유전자의 발현 비율을 높일 수 있다.
하기 표 1을 참조하면, 본 발명의 인공 핵산을 이용하였을 때, 나타나는 상류 유전자(예컨대, 제1 목적 유전자) 및 하류 유전자(예컨대, 제2 목적 유전자)의 발현 비율을 알 수 있다. 표 1에서, SMART activation ratio 는 상류 유전자 대비 하류 유전자의 발현 비율 (하류 유전자 발현량/상류 유전자 발현량)을 나타낸다. 인공 핵산으로 cpxRA을 이용하는 경우 100:8~10 (상류유전자 발현량:하류유전자 발현량, 이하 동일), pcnB/folK을 이용하는 경우 100:12~14, fecCD을 이용하는 경우 100:16~20, pqiBC을 이용하는 경우 100:26~29, nanEK을 이용하는 경우 100:32~37, ybgPO을 이용하는 경우 100:40~49, hyfH을 이용하는 경우 100:45~51, hisDC를 이용하는 경우 100:66~70, astDB를 이용하는 경우 100:81~89, fumE/yggC을 이용하는 경우 100:84~99의 비율로 발현량을 조절할 수 있다.
서열 명칭 SMART activation ratio ratio 범위
최소 최대
cpxRA 0.09 0.08 0.1
pcnB/folK 0.12 0.12 0.14
fecCD 0.18 0.16 0.2
pqiBC 0.27 0.26 0.29
nanEK 0.34 0.32 0.37
ybgPO 0.44 0.40 0.49
hyfHI 0.47 0.45 0.51
hisDC 0.68 0.66 0.7
astDB 0.84 0.81 0.89
fumE/yggC 0.92 0.84 0.99
yidKJ 3.17 3.00 3.40
livHM 12.18 11.60 12.60
이하의 실시예는 발명의 이해를 돕기 위해 제시한 것으로 하기 내용이 발명의 보호범위를 한정하는 것은 아니다.
[실시예 1]
형광단백질을 이용한 번역 동조 서열 기반 오페론 발현 제어 모듈 스크리닝
번역 동조에 의한 오페론 유전자 발현 조절 여부를 검증할 수 있도록 리포터 단백질을 이용해 인공 번역 카세트를 제작했다. 인공 번역 카세트는 형광단백질 mCherry, sGFP를 코딩하고 있는 두 유전자가 순서대로 존재하며, T7 RNA 중합효소에 의해 전사가 진행될 수 있도록 T7 프로모터와 T7 터미네이터를 도입하였다. mCherry 코딩 서열의 3‘ 말단은 종결 코돈을 제거하고 10개의 아미노산 (DSAGSAGSAG)을 코딩하고 있는 링커 서열을 삽입하여 번역 동조 서열이 상류 유전자의 접힘 (folding)에 영향을 미치지 않도록 하였다. sGFP 코딩 서열의 5’ 말단은 개시 코돈을 제거하고 2개의 아미노산 (AG)을 코딩하고 있는 링커 서열을 삽입하였다. mCherry와 sGFP 코딩 서열 사이에는 번역 동조 서열 기반의 오페론 발현 제어 모듈 (Synthetic Module for Accurate expression Ratio by Translational coupling; 이하 SMART 부품)을 도입함으로써, 상류 유전자 (upstream gene)를 번역하던 리보솜에 의해 하류 유전자 (downstream gene) 번역이 개시될 수 있도록 하였다 (도 2).
먼저 번역 동조를 유발하는 서열을 확보하기 위해 대장균 K-12 MG1655의 유전체에서 동일 방향으로 중첩된 유전자 쌍을 탐색하고, 일련의 과정에 따라 특정 서열만을 추출하였다 (도 3). 우선 대장균에 존재하는 전체 중첩 유전자 쌍 660개 중에서 가장 빈도가 높은 4 bp 중첩 유전자 쌍 261개를 추출하였다. 4 bp 중첩 유전자 쌍은 상류 유전자의 종결 코돈과 하류 유전자의 개시 코돈이 중첩된 형태로, 본 발명에서는 ATGA, GTGA, TTGA가 이에 해당한다. 4 bp 중첩 유전자 쌍 목록에서, 대장균 유전체 상에 다양한 위치에 분포하고 있는 17개의 유전자 쌍을 무작위로 선별하였다 (도 4). 이후 상류 유전자의 3’ 말단 99 bp와 하류 유전자의 5’ 말단 30 bp 서열만을 추출해 번역 동조 서열 후보군을 확보했다. 이 경우, 상류 유전자와 하류 유전자의 4 bp 중첩 서열로 인해 추출한 번역 동조 서열의 길이는 125 bp가 되었다 (표 1 참조).
선별된 17개의 후보군 서열
명칭 서열 (5’->3’) 서열번호
cpxRA ATTTCCAACCTGCGTCGTAAACTGCCGGATCGTAAAGATGGTCACCCGTGGTTTAAAACCTTGCGTGGTCGCGGCTATCTGATGGTTTCTGCTTCATGATAGGCAGCTTAACCGCGCGCATCTTC 1
pcnB/folK CAAAAAGGGATGCTCAACGAGCTGGATGAAGAACCGTCACCGCGTCGTCGTACTCGTCGTCCACGCAAACGCGCACCACGTCGTGAGGGTACCGCATGACAGTGGCGTATATTGCCATAGGCAGC 2
fecCD GCACGCGCGCTGGCCTTCCCCGGAGATCTGCCCGCAGGCGCAGTGCTGGCGCTGATTGGCAGCCCTTGCTTTGTCTGGCTTGTGAGGAGGCGAGGATGAAAATTGCGCTGGTTATTTTCATCACC 3
pqiBC CTGCAACCGGTGCTGAAAACGCTCAATGAGAAGAGTAACGCGCTGGTATTTGAAGCGAAGGACAAAAAAGATCCAGAGCCGAAGAGGGCGAAACAATGAAAAAGTGGCTAGTGACGATTGCAGCA 4
nanEK CGCCACGGCGCGTGGGCGGTGACGGTCGGTTCTGCAATCACGCGTCTTGAGCACATTTGTCAGTGGTACAACACAGCGATGAAAAAGGCGGTGCTATGACCACACTGGCGATTGATATCGGCGGT 5
ybgPO CAGTTTTATCTCGGTTACATGGATGATTACGGCGCATTACGCATGACGACGCTCAACTGCAGCGGACAATGCCGTTTACAAGCAGTGGAGGCGAAATGAGTGCTGGCAAGGGATTGTTGCTCGTC 6
hyfHI TTGTGGGCGCAAGCGAGCGTCTGCCCGGAATGCAAACAACGCGCGACGCTGATCAACGACGATACAGATGTACTGCTGGTGGCTAAGGAGCAGCTATGAGTCCAGTGCTTACACAACATGTCAGC 7
hisDC CTGGCTTCAACCATAGAAACACTGGCCGCCGCCGAGCGCCTGACCGCCCACAAAAATGCCGTTACTTTGCGTGTTAACGCCCTTAAGGAGCAAGCATGAGCACCGTGACTATTACCGATTTAGCG 8
astDB TACTGCGCATGGCCGATGGCGAGCCTGGAGTCGGACTCGTTAACATTGCCCGCCACGCTTAACCCCGGGCTGGATTTTTCCGATGAGGTGGTGCGATGAACGCCTGGGAAGTCAATTTCGACGGG 9
fumE/yggC GCTGATTTCTCCGTCTGGTCAGAGGCGCGTTTTAGCGGAATGGTCAAAACGGCGCTGACGCTGGCAGTAACGACCACCTTAAAGGAATTAACGCCGTGAAAATTGAATTAACGGTGAATGGGCTG 10
yidKJ ATTGCCGCCGTAGTGATTGTCTACCTGATTTTTGACAGCTGGCGGCATCGTCACGACCCAGCCGTAACCTTTACTCCCGACGGGAAGGATAGCCTATGAAACGCCCCAATTTTCTGTTCGTCATG 11
livHM ACGGAATATAAAGATGTGGTCTCATTCGCCCTGCTGATTCTGGTGCTGCTGGTGATGCCGACCGGTATTCTGGGTCGCCCGGAGGTAGAGAAAGTATGAAACCGATGCATATTGCAATGGCGCTG 12
lpxB/rnhB AGCCACGCGATGCACGATACCTTCCGTGAACTGCATCAGCAGATCCGCTGCAATGCCGATGAGCAGGCGGCACAAGCCGTTCTGGAGTTAGCACAATGATCGAATTTGTTTATCCGCACACGCAG 13
ydbH/ynbE TTACGCTTTGGCGATAATCTCCAGGCATGGCTGGAGCAGAACGCACGTCTGCCGGGAAATGACTGTCCGCAAGGAAAAGAGTGTGAGGAAAAACAATGAAAATTTTACTGGCTGCGTTGACGTCA 14
sgcXB GATTGCATCCGCCTATTGACCGCTCTGGCAGGTATGTCAGCAGCACATTTCCCCGTTGAGCCTGATTCAGGCACTACACAAGAGGCACATCCATTATGAAAAAGATCCTTGTGGCATGCGGTACC 15
napHB ACCAGCCGCGATTGCATGACGTGCGGTCGCTGCGTGGATGTCTGTTCTGAGGATGTATTTACAATAACTACACGATGGAGTTCGGGAGCGAAATCATGAAAAGCCATGACCTGAAGAAAGCGCTG 16
lldRD ACCACCATGAAACGATTCGATGAAGATCAGGCTCGCCACGCACGGATTACCCGCCTGCCCGGTGAGCATAATGAGCATTCGAGGGAGAAAAACGCATGATTATTTCCGCAGCCAGCGATTATCGC 17
상기 표 2에서, 볼드체는 개시코돈과 종결 코돈의 중첩 유전자(ATGA, GTGA)를, 밑줄 표시된 서열은 샤인-달가노 예상 서열이다.
선별된 유전자 쌍에서 번역 동조 기작이 발생하지 않을 때 하류 유전자의 번역이 개시되는 유전자 쌍을 제외함으로써, 오페론 번역이 온전히 번역 동조 기작에 의해서만 발생하도록 만들고자 하였다. 이를 위해 번역 동조 서열의 5’ 말단에 인공 종결 코돈 TAA를 추가하여, 상류 유전자를 번역하던 리보솜이 4 bp 중첩 서열까지 도달하지 못하게 되어 번역 동조가 발생하지 않도록 하였다. 인공 종결 코돈이 연결된 번역 동조 서열 후보군을 상기에 제작한 인공 번역 카세트의 mCherry, sGFP 코딩 서열 사이에 삽입하였다(TAA+ SMART 카세트). 형광 측정 결과로부터 계산한 sGFP 단백질 양이 mCherry 단백질 양의 2%를 초과하는 번역 동조 서열의 경우, 하류 유전자의 번역 개시가 독립적으로 발생한다고 판단하였다(표 3 참조, sGFP/mCherry ratio > 0.02인 서열은 탈락). 독립적인 번역 개시를 일으키는 서열을 제외하여 12개의 번역 동조 서열만을 선별하였다 (도 5).
번역 동조를 발생시키는 핵산의 선별(TAA+ SMART 카세트 이용)
mCherry (pmol/OD600) sGFP (pmol/OD600)
명칭 triplicate 1 triplicate 2 triplicate 3 triplicate 1 triplicate 2 triplicate 3 sGFP/mCherry ratio
cpxRA 91.2 84.7 83.8 0.0 0.0 0.0 0.00
pcnB/folK 79.1 73.9 74.5 0.0 0.0 0.0 0.00
fecCD 80.3 77.4 75.3 0.0 0.0 0.0 0.00
pqiBC 82.0 83.0 79.2 1.8 1.9 1.9 0.02
nanEK 88.6 83.5 81.4 0.0 0.0 0.0 0.00
ybgPO 81.2 79.3 80.5 0.0 0.0 0.0 0.00
hyfHI 83.3 79.5 79.6 0.6 0.6 0.5 0.01
hisDC 64.7 72.5 69.9 0.4 0.5 0.5 0.01
astDB 101.9 100.3 96.9 0.6 0.5 0.5 0.01
fumE/yggC 80.8 79.1 74.9 1.1 1.1 0.9 0.01
yidKJ 67.9 61.3 62.3 1.0 0.9 0.9 0.01
livHM 77.3 78.8 81.5 1.0 1.2 1.3 0.01
lpxB/rnhB 70.2 73.2 71.0 2.7 2.9 2.7 0.04
ydbH/ynbE 78.5 74.6 76.5 8.9 8.2 8.8 0.11
sgcXB 57.8 56.1 58.0 8.3 8.3 8.6 0.15
napHB 60.1 63.8 57.9 14.4 14.7 13.3 0.23
lldRD 69.8 71.4 66.4 37.5 36.5 34.9 0.52
상기 표 3에서, sGFP/mCherry ratio > 0.02인, lpxB/rnhB, ydbH/ynbE, sgcXB, napHB, lldRD 는 후보군에서 탈락시켰다.
선별된 번역 동조 서열을 인공 종결 코돈 없이 번역 카세트에 삽입하여 형광 측정을 시행하였고, 상류 유전자 대비 하류 유전자의 발현 비율 (sGFP 단백질/mCherry 단백질, 이하 SMART activation ratio)이 1을 초과하지 않는 SMART 부품 10종을 선별하였다 (도 6). 이러한 선별 기준은, 하류 유전자의 독립적인 번역 개시 없이 상류 유전자의 번역에 사용된 리보솜에 의해서만 하류 유전자의 번역이 개시될 경우, 하류 유전자의 번역에 사용되는 리보솜은 상류 유전자의 번역에 사용된 리보솜의 수를 초과하지 못한다는 가정에 의해 설정되었다. 최종 선별된 10종의 SMART 부품은 서로 다른 SMART activation ratio를 보였다.
상류 목적 유전자/ 하류 목적 유전자의 발현량을 이용한 핵산의 선별
mCherry (pmol/OD600) sGFP (pmol/OD600)
명칭 triplicate 1 triplicate 2 triplicate 3 triplicate 1 triplicate 2 triplicate 3 SMART activation ratio (sGFP/mCherry)
cpxRA 37.6 36.5 33.6 3.4 3.2 3.1 0.09
pcnB/folK 52.5 51.3 50.6 6.4 6.7 6.1 0.12
fecCD 16.1 15.7 18.7 2.8 3.1 3.2 0.18
pqiBC 54.2 48.5 47.7 14.4 13.7 13.2 0.27
nanEK 24.9 24.0 21.5 8.0 7.8 7.9 0.34
ybgPO 22.3 23.6 25.3 10.8 10.3 10.2 0.44
hyfHI 43.0 43.5 42.1 19.6 20.0 21.2 0.47
hisDC 30.0 27.3 27.6 20.9 18.2 18.9 0.68
astDB 38.8 39.9 40.4 34.2 33.3 32.9 0.84
fumE/yggC 15.0 14.5 13.1 12.7 13.5 12.9 0.92
yidKJ 8.3 8.5 8.9 27.8 26.3 27.3 3.17
livHM 3.2 3.2 3.4 39.6 39.8 39.9 12.18
선별한 서열들의 번역 동조 기작 여부를 확인하기 위한 형광 측정 실험은 다음과 같이 진행하였다. 인공 번역 카세트를 대장균 BL21(DE3) 균주에 도입 후, 인공 번역 카세트를 보유한 플라스미드가 유지되도록 34 μg/mL의 Chloramphenicol이 첨가된 LB 배지에서 균주를 밤새 배양하였다. 이후 균주를 1/100로 희석해서 새 배지 5 mL에 접종하여 37 ℃, 250 rpm의 진탕배양기에서 배양했다. 흡광도 (OD600) 0.8-1.0 부근에서 0.2 mM IPTG를 첨가하여 인공 번역 카세트의 발현을 유도하였다. IPTG 첨가 후 6시간을 추가 배양하고 최종 흡광도를 측정한 후, Hidex Sense Microplate Reader를 활용하여 각 형광단백질 (mCherry, sGFP)에 의한 형광과 nanoluciferase에 의한 발광을 측정하였다. 본 발명에서 형광 측정에 사용한 파장 필터는 다음과 같다. mCherry, 575-nm excitation filter, 616-nm emission filter; sGFP, 485-nm excitation filter, 535-nm emission filter. nanoluciferase에 의한 발광은 Promega 사의 Nano-Glo® Luciferase Assay System을 사용하여 사용자 매뉴얼에 따라 Hidex Sense Microplate Reader를 활용하여 측정했다. 각 형광으로부터 형광단백질 양을 추산하여 SMART 부품에 의한 유전자 발현 비율을 계산하고자 하였다. 이를 위해 형광단백질의 3’ 말단에 6X His-tag을 연결하여 Ni-NTA 방법으로 각 단백질을 정제하였고, 정제된 단백질의 양을 Bradford assay로 측정했다. 정량한 형광단백질을 서로 다른 양으로 희석하면서 형광 측정하여, 형광값과 단백질 양의 관계식을 구하였고, 여기에 각 형광단백질의 분자량을 고려해서 형광값으로부터 몰 수를 계산하였다. 이와 유사한 방법으로 nanoluciferase 또한 발광값으로부터 단백질의 몰 수를 계산하였다. 이후 진행되는 형광 측정 실험은 모두 본 방법을 따라 진행하였다.
[실시예 2]
SMART 부품 특성 분석
SMART 부품이 오페론 구성 유전자의 전사량에 미치는 영향을 파악하기 위해 droplet digital PCR을 진행하였다. SMART 부품의 5' 말단에 인공 종결 코돈이 추가된 경우 (TAA+ SMART)와 그렇지 않은 경우 (SMART)의 전사량이 특별한 경향성이 확인되지 않았으며, SMART activation ratio와 전사량 사이에도 경향성이 나타나지 않았다(도 7). 따라서 본 발명에 따라 선별된 핵산(SMART 부품)은 오페론 구성 유전자의 전사량에 영향을 미치지 않음을 확인하였다.
반대로 전사량의 변화가 SMART activation ratio에 영향을 미치는지 확인하기 위해 기존의 인공 번역 카세트에서 T7 프로모터를 Tac 프로모터로 교체하고 형광 측정을 진행했다. 서로 다른 프로모터를 사용한 경우에도 SMART activation ratio는 대체로 잘 유지되었다 (도 8).
SMART 부품이 도입된 오페론에서 상류 유전자의 발현량 변화가 하류 유전자의 발현량 변화에 미치는 영향을 파악하였다. 이를 위해 mCherry의 5’ 비번역 부위 (5’ UTR) 서열을 변화시켜 mCherry 유전자의 번역 개시 속도를 조절하였다. SMART 부품 pcnB/folK, hyfHI, hisDC, astDB에 대하여 형광 측정을 시행 결과에서, mCherry 단백질 양 변화에 비례하여 sGFP 단백질 양 또한 변화하여 SMART activation ratio가 유지됨을 확인하였다 (도 9).
본 발명에서는 또한, 인공 오페론을 구성하는 유전자 서열과 링커의 변경이 SMART activation ratio에 미치는 영향을 확인하였다. 리포터로는 mCherry, sGFP를 코딩하고 있는 유전자 외에 nanoluciferase를 추가로 활용하였다. 링커의 변경은 기존 인공 번역 카세트에서 mCherry 코딩 서열의 3' 말단에 존재하는 10개의 아미노산 서열은 유지하면서 뉴클레오타이드 서열만 변경하였다 (표 5의 링커 서열 이용). 유전자 서열과 링커의 변경 시에도 각 SMART 부품이 보유한 SMART activation ratio는 잘 유지됨을 확인하였다 (도 10).
링커 서열
명칭 서열 (5' -> 3') 서열번호
Linker (amino acid) DSAGSAGSAG 18
Linker GAT AGT GCT GGT AGT GCT GGT AGT GCT GGT 19
Linker_S GAT TCG GCC GGA AGC GCT G6G TCC GCA GGC 20
Linker_SS GAT AGC GCT GGG TCC GCA GGA AGT GCT GGC 21
본 발명에서는 또한, 호스트 균주의 변경 시 SMART activation ratio의 변화 여부를 확인하였다. 10종의 SMART 부품을 도입한 Tac 프로모터 기반의 인공 번역 카세트를 대장균 BL21(DE3) 외에 다른 4종의 대장균 (대장균 K-12 MG1655, W, BL21, Nissle 1917)에 도입하였다. 각 균주에서의 측정한 형광 단백질 양으로부터 계산한 SMART activation ratio를 비교해본 결과, 대장균 BL21 종이 기존 호스트 균주와 가장 높은 상관성 (R2 = 0.94)을 보였으며, 나머지 세 종에서도 높은 상관성 (R2 ≥ 0.85)을 보여, 다른 균주에서 SMART 부품의 적용 가능성을 확인하였다 (도 11).
[실시예 3]
SMART 부품 내 샤인-달가노 서열 변경을 통한 부품 종류의 확장
SMART 부품 내에 존재하는 샤인-달가노 서열 (SD 서열)을 변경함으로써, 각 SMART 부품에 의한 SMART activation ratio를 변화할 수 있는지 확인하였다. pcnB/folK, hyfHI, hisDC, astDB에서 추출한 SMART 부품의 SD 서열 중 mRNA 2차 구조를 크게 변경하지 않는 염기를 선정하여 무작위로 변경하였고, 이로 인해 변경된 SD 서열에서의 mRNA와 rRNA의 결합에너지 (ΔGmRNA_rRNA)를 계산하였다. SMART 부품 부분의 mRNA 2차 구조 예측에는 RNAfold web server (http:/rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi)를 사용하였고, 결합에너지 계산은 RBS calculator (https:/salislab.net/software/design_rbs_calculator)를 사용하였다. 변경된 SD 서열을 보유한 SMART 부품 사용 시, mRNA와 rRNA의 결합에너지가 강화될수록 하류 유전자와 상류 유전자의 발현 비율 (sGFP/mCherry 단백질 비율)이 증가함을 확인하였다 (도 12).
[실시예 4]
대사산물 생산 경로에 SMART 부품 적용 시 생산성 변화 분석
본 발명에 따라 선별된 핵산(SMART 부품)을 대사 경로에 도입함으로써 생화학물질 생산에 관여하는 대사흐름을 조절할 수 있는지를 파악하였다. 이를 통해 구축된 인공 오페론의 순서와 추가적인 균주 엔지니어링 없이도 대사산물 생산을 최적화할 수 있는지 가능성을 확인하고자 하였다. 고부가 대사산물인 3-하이드록시프로피온산 (3-hydroxypropionic acid, 3-HP), 폴리하이드록시 부티레이트의 일종인 P(3HB) (poly(3-hydroxybutyrate)), 리코펜 (lycopene)을 목적 대사산물로 선정하고 대장균 MG1655 또는 대장균 W 균주 내에 이들의 대사 경로를 구축하였다 (도 13).
3-HP 대사 경로는 글리세롤로부터 3-하이드록시프로피온알데히드 (3-hydroxypropionaldehyde, 3-HPA)를 생산하는 글리세롤 디하이드라타제 (glycerol dehydratase, GDHt)와, 3-HPA로부터 3-HP를 생산하는 알데히드 디하이드로게나제 (aldehyde dehydrogenase, KGSADH)로 이루어져 있으며, GDHt를 재활성화하는 글리세롤 디하이드라타제 재활성화인자 (GDHt reactivase)로 구성된다. GDHt는 3개의 단백질 단위체 (DhaB1, DhaB2, DhaB3)에 의해 구성되는 복합체이며, 이 중 DhaB1 단백질이 효소 반응을 일으키는 주요 단위체로 알려져 있다. 본 발명에서는 KGSADH와 DhaB1을 코딩하고 있는 유전자 사이에 서로 다른 8종의 SMART 부품을 삽입하여 제작한 인공 오페론에서 생산되는 3-HP 양을 비교하였으며, SMART 부품은 대장균 유래 서열 5종 (pcnB/folK, pqiBC, hyfHI, hisDC, astDB)과 SD 서열을 변경하여 제작한 SMART 부품 3종 (hisSD1, astSD3, hyfSD14)을 사용하였다. 3-HP 생산을 위한 대사 경로는 두 선행 연구에서 사용된 3-HP 생산 플라스미드 1, 2를 변형하여 구축하였다. 3-HP 생산 플라스미드 1에서는 DhaB1을 독립적인 유전자 카세트로 발현하고, DhaB2, DhaB3, 글리세롤 디하이드라타제 재활성화인자를 오페론으로 발현한다 (Lim et al., ACS Synth. Biol., 2016). 3-HP 생산 플라스미드 2에서는 KGSADH를 발현한다 (Seok et al., Metab. Eng., 2018). 본 발명에서는 3-HP 생산 플라스미드 1에 존재하는 DhaB1 유전자 카세트를 제거하고, 3-HP 생산 플라스미드 2의 KGSADH 유전자의 하류에 10개 아미노산 링커-SMART 부품-2개 아미노산 링커-DhaB1 유전자를 배치하였다. 새롭게 재구성된 3-HP 생산 플라스미드 1, 2를 대장균 W 균주에 도입한 후 3-HP 생산 실험을 진행한 결과, 최대 7.7배의 3-HP 농도 차이가 발생했으며, 상류 유전자 대비 하류 유전자의 발현량이 증가할수록 3-HP 생산량이 감소함을 확인하였다 (도 14).
3-HP 생산을 위한 배양에는 100 mM 글리세롤이 탄소원으로 사용된 최소 배지[0.5 g/L MgSO4·7H2O, 2 g/L NH4Cl, 2 g/L NaCl, 1 g/L yeast extract, 100 mM potassium phosphate buffer (pH 7.0)]를 사용했다. 플라스미드를 유지하기 위해서는 34 μg/mL chloramphenicol, 80 μg/mL ampicillin을 첨가했다. 밤새 배양한 세포를 초기 흡광도가 0.05가 되도록 하여 5 mL 배지에 계대배양 하였고, 37℃, 250 rpm의 진탕배양기에서 배양했다. 흡광도 0.9-1.0에 도달했을 때 0.1 mM IPTG와 0.2 μM의 B12를 첨가해 주었다. 배양 8시간, 16시간 째에 pH 측정을 진행하고 pH 7.0 이하인 경우 10 M NaOH를 첨가하여 pH를 7.0으로 보정하였다. 배양 24시간 째에 배양액을 HPLC (high-performance liquid chromatography)를 이용해 분석했다. 분석 장비는 Shimadzu LC-40 HPLC system을 사용했고, 분석 조건은 Aminex HPX-87H 칼럼과 0.6 mL/min으로 흐르는 5 mM H2SO4를 이동상으로 사용했다.
P(3HB)는 대장균의 acetyl-CoA로부터 생산할 수 있으며, P(3HB)를 생산하기 위해 추가적으로 필요한 대사경로는 3개의 효소 (PhaA, PhaB, PhaC)로 구성된다. PhaABC 유전자로 인공 오페론을 제작하고, 각 유전자 사이에 3종의 SMART 부품 (pcnB/folK, hyfHI, astDB)을 조합하여 삽입함으로써, 총 9개의 인공 오페론을 제작하였다. 이 때 인공 오페론은 Tac 프로모터에 의해 발현되도록 하였다. 인공 오페론을 대장균 MG1655 균주에 도입 후, 인공 오페론을 보유한 플라스미드가 유지되도록 34 μg/mL의 Chloramphenicol이 첨가된 LB 배지에서 균주를 밤새 배양하였다. 이후 균주를 초기 흡광도 0.02가 되도록 새 배지 100 mL에 접종하여 30℃, 200 rpm의 진탕배양기에서 배양했다. 흡광도 (OD600) 1.0-1.2일 때 0.2 mM IPTG를 첨가하여 인공 오페론의 발현을 유도하였다. P(3HB)를 추출 및 정량하여 생산 수율 (세포 건조 중량 당 생성된 P(3HB) 무게)을 계산하였다. SMART 부품의 변화로 인해 PhaC의 발현이 증가할수록 P(3HB)의 수율 또한 증가함을 확인하였다 (도 15).
P(3HB) 추출을 위해서는 균주를 72시간 배양 후 원심 분리를 통해 세포만 수확하여 1X PBS 용액으로 1회 세척하였다. 세포를 48시간 동결건조한 후 50 mg 안팎의 동결건조 세포를 사용하여 P(3HB) 추출을 위한 methonolysis를 진행하였다. methanolysis는 Chloroform 2 mL, 15% 황산 함유 메탄올 1.9 mL, 50 mg/L 농도의 벤조산 함유 메탄올 0.1 mL를 동결건조 세포와 혼합한 후 65 ℃에서 48시간 이상 반응했다. 이후 증류수 2 mL를 첨가하고 vortexing했고, 층분리가 일어날 때까지 대기하다가 아래 층 용액만을 추출하여 GC 분석에 사용했다. Agilent 7890B 장비를 사용했으며, FID를 이용해 P(3HB)와 벤조산을 검출하였다. P(3HB) 정량은 벤조산 대비 P(3HB)의 신호 면적을 계산하여, 미리 정량해둔 P(3HB) standard와의 신호 면적을 비교함으로써 측정하였다.
리코펜 대사 경로는 대장균 내에 존재하는 DXP 대사 경로에 3개의 외래 효소 (CrtE, CrtB, CrtI)가 추가되어 구성된다. CrtEBI 유전자로 인공 오페론을 구성한 후, 각 유전자 사이에 대장균 유래 SMART 부품 5종 (pcnB/folK, pqiBC, hyfHI, hisDC, astDB)을 무작위로 삽입함으로써, 총 25개의 SMART 부품 조합을 제작하였다. 이 때 인공 오페론은 Tac 프로모터에 의해 발현되도록 하였다. 인공 오페론을 대장균 MG1655 균주에 도입 후, 인공 오페론을 보유한 플라스미드가 유지되도록 34 μg/mL의 Chloramphenicol이 첨가된 LB 배지에서 균주를 밤새 배양하였다. 이후 균주를 초기 흡광도 0.05가 되도록 새 배지 3 mL에 접종하여 37℃, 250 rpm의 진탕배양기에서 배양했다. 흡광도 (OD600) 1.0-1.2일 때 0.2 mM IPTG를 첨가하여 인공 오페론의 발현을 유도하였다. 24시간 배양 후 배양액의 최종 흡광도를 측정하였고, 배양액으로부터 리코펜을 추출 및 정량하여 생산 수율 (세포 건조 중량 당 생성된 리코펜 무게)을 계산하였다. 서로 다른 SMART 부품의 조합을 통해 오페론의 발현 비율을 변화함으로써 최대 2.2배 차이가 나는 목적 산물의 생산 수율 조절을 달성하였다 (도 16).
리코펜 추출을 위해 1 mL 배양액을 1X PBS 용액으로 1회 세척 후 200 μL 아세톤을 첨가하여 55℃에서 15분 간 반응하였다. 원심 분리를 통해 세포 찌꺼기를 가라앉힌 후 상층액을 동일 부피의 DMSO와 혼합하였고, 이후 475 nm 파장의 흡광도 값으로부터 리코펜 함유량을 측정했다. 흡광도 측정에는 NanoDrop spectrophotometer (ThermoFisher) 장비를 사용했다. 흡광도 값으로부터 리코펜 양을 변환하기 위해, 정량된 리코펜을 여러 농도로 희석하면서 흡광도를 측정하였고, 이로부터 흡광도와 리코펜 양의 비례 관계를 파악하였다. 도 16을 참조하면, 리코펜을 생산하는 경로 유전자에 본 기술을 적용하여 대사산물의 생산성을 조절할 수 있음을 알 수 있다. 따라서, 본 발명을 이용하는 경우, 다수의 유전자를 호스트 균주에 신속하게 도입하면서도 각 유전자의 발현을 정확하고 예측 가능하게 조절할 수 있다.
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.
서열번호 1
cpxRA
ATTTCCAACCTGCGTCGTAAACTGCCGGATCGTAAAGATGGTCACCCGTGGTTTAAAACCTTGCGTGGTCGCGGCTATCTGATGGTTTCTGCTTCATGATAGGCAGCTTAACCGCGCGCATCTTC
서열번호 2
pcnB/folK
CAAAAAGGGATGCTCAACGAGCTGGATGAAGAACCGTCACCGCGTCGTCGTACTCGTCGTCCACGCAAACGCGCACCACGTCGTGAGGGTACCGCATGACAGTGGCGTATATTGCCATAGGCAGC
서열번호 3
fecCD
GCACGCGCGCTGGCCTTCCCCGGAGATCTGCCCGCAGGCGCAGTGCTGGCGCTGATTGGCAGCCCTTGCTTTGTCTGGCTTGTGAGGAGGCGAGGATGAAAATTGCGCTGGTTATTTTCATCACC
서열번호 4
pqiBC
CTGCAACCGGTGCTGAAAACGCTCAATGAGAAGAGTAACGCGCTGGTATTTGAAGCGAAGGACAAAAAAGATCCAGAGCCGAAGAGGGCGAAACAATGAAAAAGTGGCTAGTGACGATTGCAGCA
서열번호 5
nanEK
CGCCACGGCGCGTGGGCGGTGACGGTCGGTTCTGCAATCACGCGTCTTGAGCACATTTGTCAGTGGTACAACACAGCGATGAAAAAGGCGGTGCTATGACCACACTGGCGATTGATATCGGCGGT
서열번호 6
ybgPO
CAGTTTTATCTCGGTTACATGGATGATTACGGCGCATTACGCATGACGACGCTCAACTGCAGCGGACAATGCCGTTTACAAGCAGTGGAGGCGAAATGAGTGCTGGCAAGGGATTGTTGCTCGTC
서열번호 7
hyfHI
TTGTGGGCGCAAGCGAGCGTCTGCCCGGAATGCAAACAACGCGCGACGCTGATCAACGACGATACAGATGTACTGCTGGTGGCTAAGGAGCAGCTATGAGTCCAGTGCTTACACAACATGTCAGC
서열번호 8
hisDC
CTGGCTTCAACCATAGAAACACTGGCCGCCGCCGAGCGCCTGACCGCCCACAAAAATGCCGTTACTTTGCGTGTTAACGCCCTTAAGGAGCAAGCATGAGCACCGTGACTATTACCGATTTAGCG
서열번호 9
astDB
TACTGCGCATGGCCGATGGCGAGCCTGGAGTCGGACTCGTTAACATTGCCCGCCACGCTTAACCCCGGGCTGGATTTTTCCGATGAGGTGGTGCGATGAACGCCTGGGAAGTCAATTTCGACGGG
서열번호 10
fumE/yggC
GCTGATTTCTCCGTCTGGTCAGAGGCGCGTTTTAGCGGAATGGTCAAAACGGCGCTGACGCTGGCAGTAACGACCACCTTAAAGGAATTAACGCCGTGAAAATTGAATTAACGGTGAATGGGCTG
서열번호 11
yidKJ
ATTGCCGCCGTAGTGATTGTCTACCTGATTTTTGACAGCTGGCGGCATCGTCACGACCCAGCCGTAACCTTTACTCCCGACGGGAAGGATAGCCTATGAAACGCCCCAATTTTCTGTTCGTCATG
서열번호 12
livHM
ACGGAATATAAAGATGTGGTCTCATTCGCCCTGCTGATTCTGGTGCTGCTGGTGATGCCGACCGGTATTCTGGGTCGCCCGGAGGTAGAGAAAGTATGAAACCGATGCATATTGCAATGGCGCTG
서열번호 13
lpxB/rnhB
AGCCACGCGATGCACGATACCTTCCGTGAACTGCATCAGCAGATCCGCTGCAATGCCGATGAGCAGGCGGCACAAGCCGTTCTGGAGTTAGCACAATGATCGAATTTGTTTATCCGCACACGCAG
서열번호 14
ydbH/ynbE
TTACGCTTTGGCGATAATCTCCAGGCATGGCTGGAGCAGAACGCACGTCTGCCGGGAAATGACTGTCCGCAAGGAAAAGAGTGTGAGGAAAAACAATGAAAATTTTACTGGCTGCGTTGACGTCA
서열번호 15
sgcXB
GATTGCATCCGCCTATTGACCGCTCTGGCAGGTATGTCAGCAGCACATTTCCCCGTTGAGCCTGATTCAGGCACTACACAAGAGGCACATCCATTATGAAAAAGATCCTTGTGGCATGCGGTACC
서열번호 16
napHB
ACCAGCCGCGATTGCATGACGTGCGGTCGCTGCGTGGATGTCTGTTCTGAGGATGTATTTACAATAACTACACGATGGAGTTCGGGAGCGAAATCATGAAAAGCCATGACCTGAAGAAAGCGCTG
서열번호 17
lldRD
ACCACCATGAAACGATTCGATGAAGATCAGGCTCGCCACGCACGGATTACCCGCCTGCCCGGTGAGCATAATGAGCATTCGAGGGAGAAAAACGCATGATTATTTCCGCAGCCAGCGATTATCGC
서열번호 18
Linker
DSAGSAGSAG
서열번호 19
Linker
GAT AGT GCT GGT AGT GCT GGT AGT GCT GGT
서열번호 20
Linker_S
GAT TCG GCC GGA AGC GCT G6G TCC GCA GGC
서열번호 21
Linker_SS
GAT AGC GCT GGG TCC GCA GGA AGT GCT GGC

Claims (14)

  1. 서열번호 1 내지 10 중 어느 하나의 서열 또는 이와 90% 이상의 상동성을 갖는 서열을 포함하며, 제1 목적 유전자 및 제2 목적 유전자 사이에 삽입되어 유전자의 발현을 조절하는, 인공 핵산.
  2. 제1 항에 있어서,
    상기 인공 핵산은 제1 목적 유전자의 3' 말단 및 제2 목적 유전자의 5' 말단을 연결하는, 인공 핵산.
  3. 제1 항에 있어서,
    상기 제1 목적 유전자는 3' 말단의 종결 코돈이 제거되고, 상기 제2 목적 유전자는 5' 말단의 개시코돈이 제거된 것인, 인공 핵산.
  4. 제1 항에 있어서,
    상기 인공 핵산은 100 내지 150 bp의 길이를 갖는, 인공 핵산.
  5. 제1 항에 있어서,
    상기 핵산은 서열번호 1 내지 10중 어느 하나의 서열로 이루어진 것인, 인공 핵산.
  6. 유전자 발현 조절 시스템으로서,
    서열번호 1 내지 10중 어느 하나의 서열 또는 이와 90% 이상의 상동성을 갖는 서열을 포함하며, 제1 목적 유전자 및 제2 목적 유전자 사이에 삽입되어 제1 목적 유전자 및 제2 목적 유전자를 연결하는, 인공 핵산 서열을 포함하고,
    상기 인공 핵산은 링커를 통해 각 목적 유전자와 작동 가능하게 연결되는 것인, 시스템.
  7. 제6 항에 있어서,
    상기 인공 핵산 서열은 서열번호 18의 서열을 코딩하는 유전자 서열로 이루어진 링커로 상류의 목적 유전자와 연결되는, 시스템.
  8. 제6 항에 있어서,
    상기 인공 핵산 서열은 아미노산 AG를 코딩하는 유전자 서열로 이루어진 링커로 하류의 목적 유전자와 연결되는, 시스템.
  9. 제6 항에 있어서,
    상기 인공 핵산 서열은 샤인-달가노 서열을 포함하고, 샤인-달가노 서열의 서열을 변경하여 상류 목적 유전자와 하류 목적 유전자의 발현량을 조절하는, 시스템.
  10. 제6 항에 있어서,
    상기 제1 목적 유전자는 3' 말단의 종결 코돈이 제거되고, 상기 제2 목적 유전자는 5' 말단의 개시코돈이 제거된 것인, 시스템.
  11. 제6 항에 있어서,
    상기 인공 핵산 서열은 100 내지 150 bp의 길이를 갖는, 시스템.
  12. 제6 항에 있어서,
    상기 인공 핵산 서열은 서열번호 1 내지 10 중 어느 하나의 서열로 이루어진 것인, 시스템.
  13. 제12항에 있어서,
    상류 목적 유전자 및 하류 목적 유전자의 발현 비율은,
    상기 인공 핵산 서열이 서열번호 1로 이루어진 경우 100:8~10,
    서열번호 2로 이루어진 경우 100:12~14,
    서열번호 3로 이루어진 경우 100:16~20,
    서열번호 4로 이루어진 경우 100:26~29,
    서열번호 5로 이루어진 경우 100:32~37,
    서열번호 6로 이루어진 경우 100:40~49,
    서열번호 7로 이루어진 경우 100:45~51,
    서열번호 8로 이루어진 경우 100:66~70,
    서열번호 9로 이루어진 경우 100:81~89,
    서열번호 10로 이루어진 경우 100:84~99인, 시스템.
  14. 제6 항 내지 제13 항 중 어느 한 항의 유전자 발현 조절 시스템을 이용하여, 목적 유전자의 발현량을 조절하는 방법.
PCT/KR2025/008926 2024-06-25 2025-06-25 목적 유전자의 발현 조절을 위한 인공 핵산 및 이를 이용한 다수 유전자의 발현 조절 시스템 Pending WO2026005490A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2024-0083179 2024-06-25
KR20240083179 2024-06-25

Publications (1)

Publication Number Publication Date
WO2026005490A1 true WO2026005490A1 (ko) 2026-01-02

Family

ID=98222409

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2025/008926 Pending WO2026005490A1 (ko) 2024-06-25 2025-06-25 목적 유전자의 발현 조절을 위한 인공 핵산 및 이를 이용한 다수 유전자의 발현 조절 시스템

Country Status (2)

Country Link
KR (1) KR20260001118A (ko)
WO (1) WO2026005490A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013000278A1 (en) * 2011-06-30 2013-01-03 The University Of Hong Kong Two-way, portable riboswitch mediated gene expression control device
KR101485853B1 (ko) * 2006-07-26 2015-01-23 베링거 잉겔하임 파르마 게엠베하 운트 코 카게 조절 핵산 요소

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101485853B1 (ko) * 2006-07-26 2015-01-23 베링거 잉겔하임 파르마 게엠베하 운트 코 카게 조절 핵산 요소
WO2013000278A1 (en) * 2011-06-30 2013-01-03 The University Of Hong Kong Two-way, portable riboswitch mediated gene expression control device

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
"D. Eng. thesis, The Graduate School Seoul National University", 1 February 2024, article HAN YONG HEE: "Development of multiscale synthetic gene expression systems for optimizing metabolite production in bacteria", XP093382809 *
DATABASE NUCLEOTIDE 21 March 2023 (2023-03-21), XP093382851, Database accession no. AP027461.1 *
HAN YONG HEE, KIM HYEON JIN, KIM KEONWOO, YANG JINA, SEO SANG WOO: "Synthetic translational coupling system for accurate and predictable polycistronic gene expression control in bacteria", METABOLIC ENGINEERING, ACADEMIC PRESS, AMSTERDAM, NL, vol. 88, 1 March 2025 (2025-03-01), AMSTERDAM, NL, pages 148 - 159, XP093382855, ISSN: 1096-7176, DOI: 10.1016/j.ymben.2024.12.011 *
HUBER MADELEINE, FAURE GUILHEM, LAASS SEBASTIAN, KOLBE ESTHER, SEITZ KRISTINA, WEHRHEIM CHRISTINA, WOLF YURI I., KOONIN EUGENE V.,: "Translational coupling via termination-reinitiation in archaea and bacteria", NATURE COMMUNICATIONS, NATURE PUBLISHING GROUP, UK, vol. 10, no. 1, UK, XP093382854, ISSN: 2041-1723, DOI: 10.1038/s41467-019-11999-9 *
MULTAMÄKI ELINA, NANEKAR RAHUL, MOROZOV DMITRY, LIEVONEN TOPIAS, GOLONKA DAVID, WAHLGREN WEIXIAO YUAN, STUCKI-BUCHLI BRIGITTE, ROS: "Comparative analysis of two paradigm bacteriophytochromes reveals opposite functionalities in two-component signaling", NATURE COMMUNICATIONS, NATURE PUBLISHING GROUP, UK, vol. 12, no. 1, UK, XP093355145, ISSN: 2041-1723, DOI: 10.1038/s41467-021-24676-7 *

Also Published As

Publication number Publication date
KR20260001118A (ko) 2026-01-05

Similar Documents

Publication Publication Date Title
Wu et al. Metabolic engineering of Escherichia coli for high-yield uridine production
Shoji et al. Metabolic design for selective production of nicotinamide mononucleotide from glucose and nicotinamide
US12385035B2 (en) Synthetic genome
Shao et al. Refactoring the silent spectinabilin gene cluster using a plug-and-play scaffold
Gil et al. Determination of the core of a minimal bacterial gene set
WO2018186704A1 (ko) 무항생제 플라스미드 유지 시스템에서 플라스미드 카피 수의 정량적 조절 방법
Liu et al. Engineering Bacillus subtilis for high-value bioproduction: recent advances and applications
Shao et al. Manipulating natural product biosynthetic pathways via DNA assembler
Costello et al. Efficient genetic code expansion without host genome modifications
JP2018503385A (ja) Ｌ−セリンに対して改善された耐性を有する遺伝子組換え微生物
Mohanty et al. Inactivation of RNase P in Escherichia coli significantly changes post‐transcriptional RNA metabolism
Bu et al. A novel AdpA homologue negatively regulates morphological differentiation in Streptomyces xiamenensis 318
Pandi et al. Microaerobic fermentation alters lactose metabolism in Escherichia coli
Druzhinin et al. A conserved pattern of primer-dependent transcription initiation in Escherichia coli and Vibrio cholerae revealed by 5′ RNA-seq
Zhang et al. Mechanism of salinomycin overproduction in Streptomyces albus as revealed by comparative functional genomics
Hirooka et al. Bacillus subtilis highly efficient protein expression systems that are chromosomally integrated and controllable by glucose and rhamnose
KR20260001118A (ko) 목적 유전자의 발현 조절을 위한 인공 핵산 및 이를 이용한 다수 유전자의 발현 조절 시스템
WO2019231149A1 (ko) Crispri 시스템을 이용하여 목적 유전자로 형질전환된 숙주세포를 선별하기 위한 키트 및 이의 용도
WO2021125867A1 (ko) 화합물을 생산하는 미생물 및 이를 이용한 화합물의 생산 방법
WO2020180132A1 (ko) D-글루타메이트 영양요구성 대장균 및 이를 이용한 목적 물질 생산 방법
WO2025143878A1 (ko) 아세트산 적응 진화를 통한 이타콘산 고효율 생산 균주 및 이의 용도
WO2017164615A1 (en) Method for preparing 3'-amino-2',3'-dideoxyadenosine by using nucleoside phosphorylase derived from bacillus
WO2025101028A1 (ko) TdT(Terminal deoxynucleotidyl transferase) 및 dNTP를 이용한 비번역영 역 (untranslated region) 라이브러리 합성 방법
Nissilä Transcrip* onal regula* on in Spirochaeta africana Supervisor: Georgi Belogurov and Vilma Trapp Number of pages: 74 Date: 18 August, 2023 The genome sets the limits of how far the cells can differen* ate or adapt; the extent to which
WO2013095009A1 (ko) 3-히드록시프로피온산을 생산하는 재조합 미생물 및 이를 이용한 3-히드록시프로피온산의 생산방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 25827060

Country of ref document: EP

Kind code of ref document: A1