WO2025257545A1 - Tumour sensitisation - Google Patents

Tumour sensitisation

Info

Publication number
WO2025257545A1
WO2025257545A1 PCT/GB2025/051280 GB2025051280W WO2025257545A1 WO 2025257545 A1 WO2025257545 A1 WO 2025257545A1 GB 2025051280 W GB2025051280 W GB 2025051280W WO 2025257545 A1 WO2025257545 A1 WO 2025257545A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
inhibitor
composition
component
mutation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
PCT/GB2025/051280
Other languages
French (fr)
Inventor
Payam Gammage
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Cancer Research Technology Ltd
Original Assignee
Cancer Research Technology Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cancer Research Technology Ltd filed Critical Cancer Research Technology Ltd
Publication of WO2025257545A1 publication Critical patent/WO2025257545A1/en
Pending legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/44—Oxidoreductases (1)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5107—Excipients; Inactive ingredients
    • A61K9/5123—Organic compounds, e.g. fats, sugars
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2818—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD28 or CD152
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/34—Macromolecular compounds obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyesters, polyamino acids, polysiloxanes, polyphosphazines, copolymers of polyalkylene glycol or poloxamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0036—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/225—Lactobacillus
    • C12R2001/24—Lactobacillus brevis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y106/00—Oxidoreductases acting on NADH or NADPH (1.6)
    • C12Y106/03—Oxidoreductases acting on NADH or NADPH (1.6) with oxygen as acceptor (1.6.3)
    • C12Y106/03001—NAD(P)H oxidase (1.6.3.1), i.e. NOX1

Definitions

  • Tumour sensitisation The present invention relates to methods of sensitising a subject having a cancer or a pre- cancer to treatment with an immune checkpoint inhibitor, as well as compositions for use in sensitising a subject to such treatment.
  • Background Cancer immunotherapy involves the attack of cancer cells by a patient's immune system. Regulation and activation of T lymphocytes depends on signaling by the T-cell receptor and co-signaling receptors that deliver positive or negative signals for activation. Immune responses by T cells are controlled by a balance of costimulatory and inhibitory signals, called immune checkpoints. Immunotherapy with immune checkpoint inhibitors is revolutionising cancer therapy. However, some patients show little or no improvement with immune checkpoint inhibitor therapies. Accordingly, methods for sensitising patients to such treatments are still needed.
  • the present invention aims to address this need at least in part.
  • mtDNA mitochondrial DNA
  • the inventors have previously shown that cancer cells with heteroplasmic deleterious mutations in mitochondrial DNA (mtDNA) may have an altered tumour microenvironment (see WO2024/089418, hereby incorporated by reference in its entirety).
  • mtDNA mitochondrial DNA
  • the present inventors have shown that cancer cells with a deleterious mtDNA mutation present at a high mutation load are associated with different immune cell populations being present in the tumour microenvironment.
  • tumours comprising such cancer cells are enriched in Natural Killer (NK) cells, monocytes, CD4+ T cells, and interferon-stimulated gene (ISG) expressing immune cells, but have reduced macrophage levels and tumour associated neutrophil levels, as compared to the microenvironments of tumours with cancer cells that have no or low deleterious mtDNA mutation load.
  • NK Natural Killer
  • ISG interferon-stimulated gene
  • the inventors have identified that cancer cells with heteroplasmic mutations in the MT-ND5 gene showed increased levels of reduced nicotinamide adenine dinucleotide (NADH) leading to disrupted NAD+:NADH ratio and altered cellular redox balance. This may result in reverse flux of Malate Dehydrogenase 2 (MDH2) and accumulation of cytosolically derived malate via Malate Dehydrogenase 1 (MDH1). The increased MDH1 activity may drive glycolysis and result in excess glucose consumption and excess lactate release.
  • NADH nicotinamide adenine dinucleotide
  • tumours with > 40% VAF responded well to a PD1 inhibitor, whereas tumours with little or no VAF responded less favourably.
  • an immune checkpoint inhibitor such as a PD-1 inhibitor, PD-L1 inhibitor, or CTLA4 inhibitor.
  • PD-1 inhibitor, a PD-L1 inhibitor and/or a CTLA4 inhibitor is due to the metabolic changes caused by high VAF sensitising the cancer or pre-cancer cells in the tumour to the treatment (and the resultant changes to the immune microenvironment of the cancer or pre-cancer).
  • an immune checkpoint inhibitor such as PD-1 inhibitor, a PD-L1 inhibitor, and/or CTLA4 inhibitor
  • the inventors further showed that upon providing to a cancer cell (e.g.
  • a melanoma cancer cell an agent that alters the redox status, for example NAD+:NADH ratio
  • the cancer cells had an increased response to immune checkpoint inhibitor treatment (such as anti-PD1 treatment).
  • immune checkpoint inhibitor treatment such as anti-PD1 treatment
  • the inventors modified wild-type Hcmel12 cells to constitutively express cytoLBnox, which induces a shift in the NAD+:NADH ratio that is in the opposite direction to a mtDNA mutation.
  • Hcmel12 cytoLBnox tumours demonstrated comparable time to endpoint and tumour weight at endpoint as wild-type or Mt-Nd5 mutant tumours.
  • Hcmel12 cytoLBnox tumours recapitulate the response of Hcmel12 mt-Nd5 m.12,436 80% tumours, confirming that specific changes in redox metabolism within cancer cells, for example changes in the NAD+:NADH ratio, are sufficient to sensitize the tumour to immune checkpoint blockade (for example a PD- 1 inhibitor, a PD-L1 inhibitor, and/or CTLA4 inhibitor).
  • immune checkpoint blockade for example a PD- 1 inhibitor, a PD-L1 inhibitor, and/or CTLA4 inhibitor.
  • treatment responsiveness to an immune checkpoint inhibitor may be further (synergistically) improved in tumours with a high mtDNA mutation load or expressing cytoLbNOX, by co-treatment with compounds that reduce levels of tumour resident neutrophils (such as anti-Ly6G antibodies).
  • agents that alter the redox status for example the NAD+:NADH ratio, in a cancer or a pre-cancer (such as cytoLbNOX or mitoLbNOX) may increase the sensitivity to an immune checkpoint inhibitor in a cancer that has baseline sensitivity to immune checkpoint inhibitors, as shown in the immunogenic 4434 mouse model.
  • WO2024/089418 the inventors found that upon constitutively expressing an NADH oxidase enzyme, e.g. cytoLBnox, in cancer cells (e.g. melanoma cancer cells), the cells had an increased response to immune checkpoint inhibitor treatment (such as anti-PD1 treatment).
  • an NADH oxidase enzyme e.g. cytoLBnox
  • cancer cells e.g. melanoma cancer cells
  • immune checkpoint inhibitor treatment such as anti-PD1 treatment.
  • the inventors have now identified a simplified means for sensitising a cancer or pre-cancer to an immune check point inhibitor using NADH oxidase.
  • lipid nanoparticle having a nucleic acid cargo encoding NADH oxidase to a tumour effectively sensitises cancer or pre-cancer cells in the tumour to an immune checkpoint inhibitor.
  • Transient expression of the NADH oxidase enzyme in cancer and pre-cancer cells is shown to be effective in sensitising the cancer or pre-cancer to an immune checkpoint inhibitor.
  • the administration of a composition comprising a LNP having a nucleic acid cargo encoding NADH oxidase does not adversely impact cells in the tumour microenvironment (TME), e.g. immune cells, such that tumour sensitisation to an immune checkpoint inhibitor does not occur.
  • TEE tumour microenvironment
  • an immune checkpoint inhibitor for use in treating a subject having a cancer or a pre-cancer, wherein the subject has been exposed to a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase.
  • the invention also provides a method of sensitising a subject having a cancer or a pre-cancer to an immune checkpoint inhibitor, comprising exposing the subject to a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase.
  • a method of treating a cancer or a pre-cancer in a subject comprising administering an immune checkpoint inhibitor to the subject, wherein the subject has been exposed to a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase.
  • the invention also provides a method of treating a cancer or a pre-cancer in a subject, comprising: (i) exposing the subject to a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase; and (ii) administering an immune checkpoint inhibitor to the subject.
  • composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase.
  • the NADH oxidase may be from Lactobacillus brevis, further optionally wherein the enzyme may be selected from the group consisting of cytoLbNOX and mitoLbNOX.
  • the immune checkpoint inhibitor may be selected from the group consisting of a PD- 1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, CTLA4 inhibitor, TIGIT inhibitor, LAG-3 inhibitor, TIM-3 inhibitor, BTLA inhibitor and KIR inhibitor.
  • the immune checkpoint inhibitor may be selected from the group consisting of a PD- 1 inhibitor, a PD-L1 inhibitor, and CTLA4 inhibitor.
  • the PD-1 inhibitor may be nivolumab.
  • the LNP may comprise: a) component A wherein component A is a cationic lipid; b) component B wherein component B is a sterol; c) component C wherein component C is a phosphatidylcholine; and d) component D wherein component D is a PEGylated lipid.
  • component A is an ionizable cationic lipid, for example a tertiary amine lipid, preferably 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4- hydroxybutyl)hexan-1-aminium (ALC-0315);
  • component B is an unsaturated sterol, for example wherein the unsaturated sterol is (3 ⁇ )-cholest-5-en-3-ol (cholesterol), cholesta-5,24- dien-3 ⁇ -ol (desmosterol), cholestadienol, 5 ⁇ -cholest-7-en-3 ⁇ -ol (lanthosterol), or cholesta- 5,7-dien-3 ⁇ -ol (7-dehydrocholesterol);
  • component C is a saturated phosphatidylcholine, preferably 1,2-distearoyl-sn-glycero-3-
  • component A is 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4- hydroxybutyl)hexan-1-aminium (ALC-0315);
  • component B is (3 ⁇ )-cholest-5-en-3-ol (cholesterol);
  • component C is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); and component D is 1,2-Dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG- PEG2000).
  • component A is present in 30-70 mol%, preferably 40-60 mol%, more preferably 45- 55 mol%, even more preferably 48-52 mol%;
  • component B is present in 25-45 mol%, preferably 30-42 mol%, more preferably 35-40 mol%;
  • component C is present in 5-15 mol%, preferably 8-12mol%, more preferably 9-11 mol%;
  • component D is present in 0.5-2.5 mol%, preferably 1.2-1.8 mol%, more preferably 1.4-1.6 mol%; wherein mol% refers to the molar percentage of the particular component relative to the total lipid content in the LNP, for example where component A, component B, component C and component D are the only lipids present in the LNP, mol% refers to the molar amount of a particular component as a percentage of the total molar amount of component A, component B, component C and component D.
  • the nucleic acid cargo may be an RNA.
  • the nucleic acid cargo may be an mRNA.
  • the mRNA may comprise a) SEQ ID NO: 1 or b) SEQ ID NO: 2
  • the mRNA may comprise a) SEQ ID NO: 3 or b) SEQ ID NO: 4
  • a sample of the cancer or precancer may have a deleterious mitochondrial DNA (mtDNA) mutation load of less than 50%.
  • the deleterious mitochondrial DNA (mtDNA) mutation load may be less than 40%, less than 30%, or less than 20%.
  • the cancer or pre-cancer may be selected from the group consisting of: a childhood cancer, haematological cancer, and a myeloid cancer.
  • the cancer or pre-cancer may be selected from the group consisting of: leukemia, brain cancer, spinal cord cancer, neuroblastoma, Wilms tumor, lymphoma (such as Hodgkin and non-Hodgkin), rhabdomyosarcoma, retinoblastoma, bone cancer (such as osteosarcoma and Ewing sarcoma), melanoma, pancreatic cancer, prostate cancer, breast cancer and colorectal cancer.
  • the deleterious mtDNA mutation may be selected from the group consisting of: (i) a tRNA mutation having a MitoTIP RAW score of at least 12.6, or at least 16.25; (ii) a rRNA mutation; (iii) a truncation mutation in a mtDNA gene; (iv) a missense mutation in a mtDNA gene, wherein the missense mutation has an Apogee score of more than 0.5, optionally wherein the missense mutation is selected from a frameshift mutation, an insertion mutation or a deletion mutation; and/or (v) a mutation in a mtDNA D-loop region selected from the group consisting of: the H-strand promoter (545-567), MT-HV2 (hypervariable segment 2) m.57-372, and MT-HV1 (hypervariable segment 1) - m.16024-16390.
  • the H-strand promoter 545-567
  • MT-HV2 hypervariable
  • the deleterious mtDNA mutation may be in a gene selected from the group consisting of: MT-ND5, MT-ND1, MT-ND2, MT-ND3, MT-ND4, MT-ND4L, MT-ND6, MT-CO1, MT-CO2, MT-CO3, MT-CYB, MT-ATP6, MT-ATP8, MT-TL1, MT-TA, MT-TC, MT-TD, MT-TE, MT-TF, MT-TG, MT-TH, MT-TI, MT-TK, MT-TL2, MT-TM, MT-TN, MT-TP, MT-TQ, MT-TR, MT-TS1, MT-TS2, MT-TT, MT-TV, MT-TW, MT-TY, MT-RNR1 and MT-RNR2.
  • the MT-ND5 deleterious mtDNA mutation may be a truncating mutation that is in a region selected from: m.12418-12425:A indel or m.12385-12390:C indel.
  • the deleterious mtDNA mutation may be a truncation, missense, insertion, or frameshift mutation.
  • any embodiments that relate to sensitising a subject to an immune checkpoint inhibitor (such as PD-1 inhibitor, PD-L1 inhibitor, and/or CTLA4 inhibitor) (including methods or compositions for use in sensitising) equally apply to the methods of treatment (or compositions for use in treatment) described herein unless the context specifically requires otherwise.
  • an immune checkpoint inhibitor such as PD-1 inhibitor, PD-L1 inhibitor, and/or CTLA4 inhibitor
  • the words “comprise” and “contain” and variations of them mean “including but not limited to”, and they are not intended to (and do not) exclude other moieties, additives, components, integers or steps.
  • the singular encompasses the plural unless the context otherwise requires.
  • tumours were administered 0.25ug vehicle mRNA-LNP or 0.0025, 0.025 or 0.25 ⁇ g-1 of cytoLbNOX mRNA-LNP.
  • C) Tumour weights at day 18 (n 8, 10, 8 and 7 tumours). P values were determined using one-way ANOVA with Fisher’s LSD test. Error bars, s.d. Measure of centrality is mean. Number of replicates are described across conditions from left to right as presented. Figure 2.
  • a refractory tumour model demonstrates non-specific sensitization to immune checkpoint blockade (ICB) that is associated with loss of oxygen consumption in models of either mtDNA mutant or LbNOX expressing melanoma.
  • IRB immune checkpoint blockade
  • Figure 4 CytoLbNOX expression in only 1% of subcutaneously injected Hcme12 melanoma cancer cells is sufficient to induce a potent sensitisation to anti-PD1.
  • Catalytic mutant (D177A) of the enzyme is delivered as the control.
  • a single ITI of 2.5ug mRNA-LNP was administered as indicated once tumours reached 5mmx5mm (day 7), anti-PD1 was administered IP every 3 days from day 8 until humane endpoint (15mmx15mm tumour caliper measurements).
  • B hcmel12 cells were injected subcutaneously.
  • a single ITI of 2.5ug mRNA-LNP was administered as indicated once tumours reached 5mmx5mm (day 7), anti-PD1 and anti-LAG3 were administered IP every 3 days from day 8 until humane endpoint (15mmx15mm tumour caliper measurements).
  • the present disclosure is based on the inventors’ identification of a subpopulation of cancer or pre-cancer patients that respond more favourably to treatment with an immune checkpoint inhibitor (such as a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, CTLA4 inhibitor, TIGIT inhibitor, LAG-3 inhibitor, TIM-3 inhibitor, BTLA inhibitor and/or KIR inhibitor).
  • an immune checkpoint inhibitor such as a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, CTLA4 inhibitor, TIGIT inhibitor, LAG-3 inhibitor, TIM-3 inhibitor, BTLA inhibitor and/or KIR inhibitor.
  • the present invention provides a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase for use in sensitising a subject having cancer or pre-cancer to an immune checkpoint inhibitor.
  • the composition alters the redox status (for example alters the lactate to glucose ratio) of a cancer or a pre-cancer.
  • the composition alters the redox status (for example alters the lactate to glucose ratio) in the interstitial fluid of the cancer or a pre-cancer.
  • the present invention provides a method of sensitising a subject having a cancer or a pre-cancer to an immune checkpoint inhibitor, comprising exposing the subject to a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase.
  • the composition alters the redox status (for example alters the lactate to glucose ratio) of a cancer or a pre-cancer.
  • the composition alters the redox status (for example alters the lactate to glucose ratio) in the interstitial fluid of the cancer or a pre-cancer.
  • the invention provides an immune checkpoint inhibitor for use in treating a subject having a cancer or a pre-cancer, wherein the subject has been exposed to a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase.
  • the composition alters the redox status (for example alters the lactate to glucose ratio) of a cancer or a pre-cancer.
  • the composition alters the redox status (for example alters the lactate to glucose ratio) in the interstitial fluid of the cancer or a pre-cancer.
  • the invention further provides a method of treating a cancer or a pre-cancer in a subject, comprising administering an immune checkpoint inhibitor to the subject, wherein the subject has been exposed to a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase.
  • the composition alters the redox status (for example alters the lactate to glucose ratio) of a cancer or a pre-cancer.
  • the composition alters the redox status (for example alters the lactate to glucose ratio) in the interstitial fluid of the cancer or a pre-cancer.
  • the invention provides a method of treating a cancer or a pre-cancer in a subject, comprising: (i) exposing the subject to a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase; and (ii) administering an immune checkpoint inhibitor to the subject.
  • LNP lipid nanoparticle
  • the composition alters the redox status (for example alters the lactate to glucose ratio) of a cancer or a pre-cancer In one example, the composition alters the redox status (for example alters the lactate to glucose ratio) in the interstitial fluid of the cancer or a pre-cancer.
  • the term “sensitising”, in the context of a treatment with an immune checkpoint inhibitor, refers to increasing the sensitivity or reducing the resistance of a subject’s cancer or pre-cancer to an immune checkpoint inhibitor treatment.
  • Sensitisation may be of a cancer or pre-cancer that was not sensitive to an immune checkpoint inhibitor treatment prior to the subject being exposed to the composition, or increasing the sensitivity of a cancer or pre- cancer that was sensitive (at least partially) to an immune checkpoint inhibitor treatment prior to the subject being exposed to the composition.
  • a subject (or a subject’s cancer or pre- cancer) that has been sensitised is more likely to respond favourably to, or benefit from, such a treatment.
  • the immune checkpoint inhibitor treatment is likely or expected to have a therapeutic effect on the subject’s cancer or pre-cancer, and/or to improve the therapeutic effect on the subject’s cancer or pre-cancer.
  • Such a therapeutic effect may include a clinical improvement of the cancer or pre-cancer in a subject with this disease or condition.
  • a clinical improvement may be demonstrated by an improvement of the pathology and/or symptoms associated with the cancer or pre-cancer.
  • therapeutic effect may be demonstrated by preventing the development of the cancer or pre-cancer in a subject, slowing or halting the progression of the cancer or pre-cancer in the subject, or reversing the cancer or pre-cancer.
  • the cancer or pre-cancer may be reversed partially, or completely.
  • Clinical improvement of the pathology may be demonstrated by one or more of the following: reduced cancer or pre-cancer biomarker levels in the subject, reduced cancer or pre-cancer cell number in the subject, increased time to regrowth of cancer upon stopping of treatment, prevention or delay of pre-cancer development into cancer, prevention of regrowth of cancer upon stopping treatment, decreased tumour invasiveness, reduction or complete elimination of metastasis, increased cancer cell differentiation, or increased survival rate.
  • Other suitable indications of clinical improvement in the pathology will be known to the skilled person. It will be appreciated that indications of clinical improvement of the pathology will vary depending on the type of cancer.
  • Clinical improvement of symptoms associated with cancer may be, but are not limited to, partial or complete alleviation of pain and/or swelling, increased appetite, reduced weight loss, and/or reduced fatigue.
  • sensitised subjects may have about a 1.25-fold, 1.50-fold, 1.75-fold, 2-fold, 2.25-fold, 2.5-fold, 2.75-fold, 3-fold or more, increased likelihood of a PD-1 inhibitor and/or a PD-L1 inhibitor treatment having a therapeutic effect as compared to subjects that have not been sensitised.
  • cancer refers to a large family of diseases which involve abnormal cell growth with the potential to invade or spread to other parts of the body due to the presence of “cancerous cells”.
  • the cancerous cells may form a subset of neoplasms or tumours.
  • a neoplasm or tumour is a group of cells that have undergone unregulated growth, and will often form a mass or lump, but may be distributed diffusely.
  • the tumour or neoplasm may comprise a mixture of cancerous cells (and/or pre-cancerous cells) and healthy (i.e. non-cancerous) cells.
  • the term “tumour” as used herein, encompasses the cancerous and/or pre-cancerous cells, healthy cells (for example stromal cells), as well as the tumour microenvironment which comprises immune cells and the interstitial fluid.
  • the immune cells in the tumour microenvironment may be refers to as the “immune microenvironment” of the tumour.
  • interstitial fluid refers to the fluid that occupies the space between the cells (healthy, cancerous, and/or pre-cancers) of the tumour.
  • the interstitial fluid may comprise, metabolites, ions, signalling molecules, proteins, extracellular vesicles, and/or other components secreted by the cells of the tumour and immune cells present therein.
  • a change in the cells of the tumour may lead to change in the interstitial fluid.
  • a change in the metabolic status of the cells of the tumour may result in an alteration of the metabolites in the interstitial fluid.
  • cancer cells may be defined by one or more of the following characteristics: reduced differentiation, self-sufficiency in growth signalling, insensitivity to anti-growth signals, evasion of apoptosis, enabling of a limitless replicative potential, induction and sustainment of angiogenesis, and/or activation of metastasis and invasion of tissue.
  • a cancer may be a solid cancer or a liquid cancer.
  • a cancer may be selected from the group consisting of: a childhood cancer, haematological cancer, and a myeloid cancer.
  • a childhood cancer may be selected from the group consisting of: leukaemia, brain cancer, spinal cord cancer, neuroblastoma, Wilms tumour, lymphoma (such as Hodgkin and non-Hodgkin), rhabdomyosarcoma, retinoblastoma, and bone cancer (such as osteosarcoma and Ewing sarcoma).
  • the cancer or pre-cancer may be selected from the group consisting of: leukemia, brain cancer, spinal cord cancer, neuroblastoma, Wilms tumor, lymphoma (such as Hodgkin and non-Hodgkin), rhabdomyosarcoma, retinoblastoma, bone cancer (such as osteosarcoma and Ewing sarcoma), melanoma, pancreatic cancer, prostate cancer, breast cancer and colorectal cancer.
  • the cancer may be a skin cancer.
  • the skin cancer may be selected from the group consisting of melanoma, basal cell carcinoma, squamous cell carcinoma, Kaposi's sarcoma, and keratoacanthoma. More suitably, the skin cancer may be melanoma.
  • the present application provides examples relating to melanoma. However, the skilled person would appreciate that the aspects of the present invention may apply to other cancers. Nevertheless, the aspects of the present invention may work particularly well in the context of melanoma.
  • pre-cancer or a “pre-cancerous condition” is an abnormality that has the potential to become cancer (such a cancer mentioned hereinabove), wherein the potential to become cancer is greater than the potential if the abnormality was not present, i.e., was normal.
  • pre-cancer include but are not limited to adenomas, hyperplasias, metaplasias, dysplasias, benign neoplasias (benign tumours), premalignant carcinoma in situ, and polyps.
  • the pre-cancer is a pre-cancer tumour. Such a tumour may comprise pre-cancerous and healthy cells.
  • the “cancer” and/or “pre-cancer” may be referred to as “a tumour”.
  • the cancer or pre-cancer may have a deleterious mitochondrial DNA (mtDNA) mutation load.
  • mtDNA deleterious mitochondrial DNA
  • a subject that is more likely to benefit from sensitisation as described herein will have a cancer or pre-cancer with a low deleterious mitochondrial DNA (mtDNA) mutation load.
  • sensitisation may mimic the metabolic changes seen in subjects with a high deleterious mitochondrial DNA (mtDNA) mutation load.
  • sensitisation as described herein may also be beneficial to subjects with a cancer or pre-cancer having a high deleterious mitochondrial DNA (mtDNA) mutation load (for example to further increase the therapeutic effect of a PD-1 inhibitor and/or PD-L1 inhibitor treatment).
  • the cancer or pre-cancer may have a low deleterious mitochondrial DNA (mtDNA) mutation load.
  • a low deleterious mitochondrial DNA (mtDNA) mutation load may be a mutation load of less than 50% when determined solely or substantially only on cancer or pre-cancer cells.
  • a low deleterious mitochondrial DNA (mtDNA) mutation load may be a mutation load of less than 40%, or less than 30%, when determined solely or substantially only on cancer or pre-cancer cells. More suitably, a low deleterious mitochondrial DNA (mtDNA) mutation load may be a mutation load of less than 20% when determined solely or substantially only on cancer or pre-cancer cells.
  • a low deleterious mitochondrial DNA (mtDNA) mutation load may be a mutation load of less than 30%, less than 20%, less than 10%, when determined on a sample from the subject.
  • a sample will typically comprise a mixture of cancerous cells (and/or pre-cancerous cells) and healthy cells, found within the tumour.
  • the cancer or pre-cancer may have a high deleterious mitochondrial DNA (mtDNA) mutation load.
  • a high deleterious mitochondrial DNA (mtDNA) mutation load may be a mutation load of at least 50% or at least 60%, or more, when determined solely or substantially only on cancer or pre-cancer cells.
  • a high deleterious mitochondrial DNA (mtDNA) mutation load may be a mutation load of at least 70%, at least 80% or more, when determined solely or substantially only on cancer or pre-cancer cells.
  • a high deleterious mitochondrial DNA (mtDNA) mutation load may be a mutation load of at least at least 60% when determined solely or substantially only on cancer or pre-cancer cells.
  • a high deleterious mitochondrial DNA (mtDNA) mutation load may be a mutation load of at least 30%, at least 40%, at least 50% or more, when determined on a sample from the subject. It will be appreciated by a person skilled in the art that a sample will typically comprise a mixture of cancerous cells (and/or pre-cancerous cells) and healthy cells, found within the tumour.
  • the cancer or pre-cancer may have a high nuclear mutation burden.
  • TBM-H tumor mutation burden-high
  • the TBM-H cancer may be a solid cancer.
  • the solid cancer may be selected from the group consisting of skin cancer (such as melanoma), lung cancer, liver cancer, kidney cancer, and head and neck cancer.
  • skin cancer such as melanoma
  • lung cancer liver cancer, kidney cancer, and head and neck cancer.
  • sensitivity to checkpoint inhibitors may be further increased.
  • cancers with an altered redox status for example altered lactate to glucose ratio
  • mtDNA mutations were found to completely regress upon treatment with a checkpoint inhibitor (such as anti-PD1 antibody).
  • the cancer or pre-cancer may have a high nuclear mutation burden and a high mtDNA mutation load.
  • the term “subject” includes humans and mammals (e.g., mice, rats, pigs, cats, dogs, and horses).
  • subjects are mammals, particularly primates, especially humans.
  • subjects are livestock such as cattle, sheep, goats, cows, swine, and the like; poultry such as chickens, ducks, geese, turkeys, and the like; and domesticated animals particularly pets such as dogs and cats.
  • subject mammals will be, for example, rodents (e.g., mice, rats, hamsters), rabbits, primates, or swine such as inbred pigs and the like.
  • rodents e.g., mice, rats, hamsters
  • rabbits primates
  • swine such as inbred pigs and the like.
  • patients and “subjects” may be used interchangeably.
  • Immune checkpoint inhibitors are agents that inhibit proteins or peptides (e.g. immune checkpoint proteins) which are blocking the immune system, e.g., from attacking cancer cells.
  • the immune checkpoint protein blocking the immune system prevents the production and/or activation of T cells.
  • An immune checkpoint inhibitor can be an antibody or antigen-binding fragment thereof, a protein, a peptide, a small molecule, or combination thereof.
  • the inhibitor interacts directly to a target immune checkpoint protein (or its ligand, where appropriate) and thereby disrupts its function/biological activity.
  • it may bind directly to a target immune checkpoint protein (or its ligand, where appropriate).
  • direct binding to a target immune checkpoint protein (or its ligand, where appropriate) inhibits, prevents or reduces the formation of protein complexes which are needed for immune checkpoint protein function/biological activity.
  • PD-1 inhibitors, PD-L1, and PD-L2 inhibitors are a group of checkpoint inhibitors that block or reduce the activity of PD-1, PD-L1 and PD-L2 immune checkpoint proteins.
  • a review describing immune checkpoint pathways and the blockade of such pathways with immune checkpoint inhibitor compounds is provided by Pardoll in Nature Reviews Cancer (April, 2012).
  • Immune check point inhibitor compounds display anti-tumour activity by blocking one or more of the endogenous immune checkpoint pathways that downregulate an anti-tumour immune response.
  • the inhibition or blockade of an immune checkpoint pathway typically involves inhibiting a checkpoint receptor and ligand interaction with an immune checkpoint inhibitor compound to reduce or eliminate the signal and resulting diminishment of the anti-tumour response.
  • the immune checkpoint inhibitor compound may inhibit the signalling interaction between an immune checkpoint receptor and the corresponding ligand of the immune checkpoint receptor.
  • the immune checkpoint inhibitor compound can act by blocking activation of the immune checkpoint pathway by inhibition (antagonism) of an immune checkpoint receptor (some examples of receptors include CTLA-4, PD-1, and NKG2A) or by inhibition of a ligand of an immune checkpoint receptor (some examples of ligands include PD-L1 and PD-L2).
  • the effect of the immune checkpoint inhibitor compound is to reduce or eliminate down regulation of certain aspects of the immune system anti-tumour response in the tumour microenvironment.
  • the immune checkpoint receptor programmed death 1 (PD-1) is expressed by activated T- cells upon extended exposure to antigen.
  • PD-L1 and PD-L2 engage primarily within the tumour microenvironment and results in downregulation of anti-tumour specific T-cell responses. Both PD-L1 and PD-L2 are known to be expressed on tumour cells. The expression of PD-L1 and PD-L2 on tumours has been correlated with decreased survival outcomes. Many PD-1 inhibitors and/or PD-L1 inhibitors are known in the art. In some examples, the PD- 1 inhibitor and/or PD-L1 inhibitor is a small organic molecule (molecular weight less than 1000 daltons), a peptide, a polypeptide, a protein, an antibody, an antibody fragment, or an antibody derivative.
  • the inhibitor compound is an antibody.
  • the antibody is a monoclonal antibody, specifically a human or a humanized monoclonal antibody.
  • the PD-1 inhibitor is an anti-PD-1 antibody or derivative or antigen-binding fragment thereof.
  • the anti-PD-1 antibody selectively binds a PD-1 protein or fragment thereof.
  • the anti-PD1 antibody is nivolumab, pembrolizumab, or pidilizumab.
  • the anti-PD1 antibody is nivolumab.
  • the PD-L1 inhibitor is an anti-PDL-1 antibody or derivative or antigen- binding fragment thereof.
  • the anti-PD-L1 antibody or derivative or antigen- binding fragment thereof selectively binds a PD-L1 protein or fragment thereof.
  • anti-PD-L1 antibodies and derivatives and fragments thereof are described in, e.g., WO 01/14556, WO 2007/005874, WO 2009/089149, WO 2011/066389, WO 2012/145493; US 8,217,149, US 8,779,108; US 2012/0039906, US 2013/0034559, US 2014/0044738, and US 2014/0356353.
  • the anti-PD-L1 antibody is MEDI4736 (durvalumab), MDPL3280A, 2.7A4, AMP-814, MDX-1105, atezolizumab (MPDL3280A), or BMS-936559.
  • the anti-PD-L1 antibody is MEDI4736, also known as durvalumab.
  • MEDI4736 is an anti-PD-L1 antibody that is selective for a PD-L1 polypeptide and blocks the binding of PD-L1 to the PD-1 and CD80 receptors.
  • MEDI4736 can relieve PD-L1 -mediated suppression of human T-cell activation in vitro and can further inhibit tumour growth in a xenograft model via a T-cell dependent mechanism.
  • MEDI4736 is further described in, e.g., US 8,779,108.
  • the fragment crystallizable (Fc) domain of MEDI4736 contains a triple mutation in the constant domain of the lgG1 heavy chain that reduces binding to the complement component C1q and the Fey receptors responsible for mediating antibody-dependent cell- mediated cytotoxicity (ADCC).
  • CTLA4 inhibitors are inhibitors that block or reduce the activity of CTLA4.
  • CTLA4 The immune checkpoint receptor cytotoxic T-lymphocyte associated antigen 4 (CTLA4 or CTLA-4) is expressed on T-cells and is involved in signaling pathways that reduce the level of T-cell activation. It is believed that CTLA4 can downregulate T-cell activation through competitive binding and sequestration of CD80 and CD86. In addition, CTLA4 has been shown to be involved in enhancing the immunosuppressive activity of T Reg cells.
  • a CTLA4 inhibitor may prevent or reduce binding to CD80 and/or CD86.
  • a CTLA-4 inhibitor comprises an antibody binding compound, such as an antibody or an antigen-binding fragment thereof.
  • CTLA-4 antibodies specific for human CTLA-4, including antibodies specific for the extracellular domain of CTLA-4 and which are capable of blocking its binding to CD80 or CD86; methods of making such antibodies, and methods of using such antibodies as anti-cancer agents.
  • the anti-CTLA-4 antibody is Tremelimumab, Ipilimumab, or Pembrolizumab.
  • TIGIT T-cell immunoreceptor containing Ig and ITIM domains belongs to the immunoglobulin superfamily, also known as Wucam, Vstm3 or Vsig9.
  • TIGIT has an extracellular immunoglobulin domain, type I transmembrane domain and two Immune receptor tyrosine inhibition motif (ITIM).
  • TIGIT is mainly distributed in regulatory T cells (Tregs), activated T cells and natural killer cells (NK), etc. It is a co-suppressive receptor protein, which can be combined with the positive proteins CD226 (Dnam-1) and APC on T cells
  • CD226 Dnam-1
  • APC The expressed ligands CD155 (Pvr or Necl-5) and CD112 (Pvrl-2 or Nectin2) constitute a costimulatory network.
  • TIGIT competes with CD226 to bind CD155 and CD112, and TIGIT binds its ligand with a higher affinity than CD226.
  • TIGIT inhibitors can inhibit, reduce, or neutralize one or more activities of TIGIT, for example, result in the blocking or reduction of immune checkpoints on T cells or NK cells, or The immune response is reactivated by adjusting antigen presenting cells.
  • anti-TIGIT antibodies include Vibostolimab, Etigilimab, Tiragolumab, and Domvanalimab.
  • LAG-3 refers to Lymphocyte Activation Gene-3.
  • LAG-3's main ligand is MHC class II, to which it binds with higher affinity than CD4.
  • the protein negatively regulates cellular proliferation, activation, and homeostasis of T cells, in a similar fashion to CTLA-4 and PD-1and has been reported to play a role in Treg suppressive function.
  • LAG3 is known to be involved in the maturation and activation of dendritic cells.
  • a LAG-3 inhibitor can reduce or block the binding of LAG-3 to the MHC class II molecule, and thereby reduce or block its activity.
  • the LAG-3 inhibitor may be an anti-LAG-3 antibody, for example Favezelimab or Relatlimab.
  • TIM-3 is an immune checkpoint receptor that suppresses antitumor responses by negatively regulating the activity of CD8 T cells and antigen-presenting cells.
  • a TIM-3 inhibitor may reduce or block the activity of TIM-3.
  • the TIM-3 inhibitor may be an anti-TIM-3 antibody, for example, Cobolimab.
  • B and T lymphocyte attenuator (BTLA) is an important co-signaling molecule. It belongs to the CD28 superfamily and is similar to programmed cell death-1 (PD-1) and cytotoxic T lymphocyte associated antigen-4 (CTLA-4) in terms of its structure and function.
  • BTLA can be detected in most lymphocytes and induces immunosuppression by inhibiting B and T cell activation and proliferation.
  • BTLA is found to be expressed in tumor-infiltrating lymphocytes (TILs) and is often associated with impaired anti-tumor immune response.
  • a BTLA inhibitor may reduce or block the activity of BTLA. Such a reduction or blockage may increase B and T cell activation and proliferation.
  • the BTLA inhibitor may be an anti-BTLA antibody, for example, Tifcemalimab.
  • Killer immunoglobulin-like receptors are a family of cell surface proteins found on natural killer (NK) cells. They inhibit the killing function of these cells by interacting with MHC class I molecules.
  • KIR inhibitors may reduce or block the activity of KIR. Such a reduction or blockage may increase the killing ability of NK cells.
  • a KIR inhibitor may be an anti- KIR antibody, for example, Lirilumab.
  • the immune checkpoint inhibitor may be selected from the group consisting of a PD- 1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, CTLA4 inhibitor, TIGIT inhibitor, LAG-3 inhibitor, TIM-3 inhibitor, BTLA inhibitor and KIR inhibitor.
  • the immune checkpoint inhibitor may be selected from the group consisting of a PD-1 inhibitor, a PD-L1 inhibitor, and CTLA4 inhibitor
  • the immune checkpoint inhibitor may be an antibody.
  • the immune checkpoint inhibitor may be an anti-PD-1 antibody, an anti-PD-L1 antibody, an anti-PD-L2 antibody, an anti-CTLA4 antibody, an anti-TIGIT antibody, an anti-LAG-3 antibody, an anti- TIM-3 antibody, an anti-BTLA antibody, and/or anti-KIR antibody.
  • Monoclonal antibodies, antibody fragments, and antibody derivatives for blocking immune checkpoint pathways can be prepared by any of several methods known to those of ordinary skill in the art, including but not limited to, somatic cell hybridization techniques and hybridoma, methods. Hybridoma generation is described in Antibodies, A Laboratory Manual, Harlow and Lane, 1988, Cold Spring Harbor Publications, New York.
  • Human monoclonal antibodies can be identified and isolated by screening phage display libraries of human immunoglobulin genes by methods described for example in U.S. Patent Nos.5223409, 5403484, 5571698, 6582915, and 6593081.
  • Monoclonal antibodies can be prepared using the general methods described in U.S. Patent No.6331415 (Cabilly).
  • human monoclonal antibodies can be prepared using a XenoMouseTM (Abgenix, Freemont, CA) or hybridomas of B cells from a XenoMouse.
  • a XenoMouse is a murine host having functional human immunoglobulin genes as described in U.S. Patent No.6162963 (Kucherlapati).
  • the immune checkpoint therapy is pembrolizumab (also known as KEYTRUDA).
  • the immune checkpoint inhibitor can be administered in an amount and for a time (e.g., for a particular therapeutic regimen over time) to provide an improvement of the pathology and/or symptoms associated with the cancer or pre-cancer as described herein above.
  • the immune checkpoint inhibitor may be formulated, dosed, and administered in a fashion consistent with good medical practice. Factors for consideration in this context include, the particular subject being treated, the clinical condition of the individual patient, the cause of the disorder, the site of delivery of the agent, the method of administration, the scheduling of administration, and other factors known to medical practitioners.
  • a "therapeutically effective amount" of an immune checkpoint inhibitor to be administered will be governed by such considerations, and is the minimum amount necessary to prevent, ameliorate, or treat, or stabilize, a benign, precancerous, or early stage cancer; or to treat or prevent the occurrence or recurrence of a tumour, a dormant tumour, or a micrometastases, for example, when used as a neoadjuvant.
  • the immune checkpoint inhibitor need not be, but is optionally, formulated with one or more agents currently used to prevent or treat cancer.
  • Suitable routes of administration of an immune checkpoint inhibitor include, without limitation, oral, parenteral, subcutaneous, rectal, transmucosal, intestinal administration, intramuscular, intramedullary, intrathecal, direct intraventricular, intravenous, intravitreal, intraperitoneal, intranasal, or intraocular injections.
  • an immune checkpoint inhibitor in a local rather than systemic manner, for example, via injection of an immune checkpoint inhibitor directly into a solid tumour, or by topical application (for example to a skin cancer).
  • An immune checkpoint inhibitor may be formulated according to known methods to prepare pharmaceutically useful compositions, whereby the inhibitor is combined in a mixture with a pharmaceutically suitable excipient or carrier.
  • Sterile phosphate-buffered saline is one example of a pharmaceutically suitable excipient.
  • suitable excipients are well-known to those in the art. See, for example, Ansel et al, PHARMACEUTICAL DOSAGE FORMS AND DRUG DELIVERY SYSTEMS, 5th Edition (Lea & Febiger 1990), and Gennaro (ed.), REMINGTON'S PHARMACEUTICAL SCIENCES, 18th Edition (Mack Publishing Company 1990), and revised editions thereof.
  • the dosage of an administered immune checkpoint inhibitor for humans will vary depending upon such factors as the patient's age, weight, height, sex, general medical condition and previous medical history.
  • a dosage of 1-20 mg/kg for a 70 kg patient for example, is 70-1,400 mg, or 41-824 mg/m2 for a 1.7-m patient.
  • the dosage may be repeated as needed, for example, once per week for 4- 10 weeks, once per week for 8 weeks, or once per week for 4 weeks. It may also be given less frequently, such as every other week for several months, or monthly or quarterly for many months, as needed.
  • the dosage of an administered mRNA-LNPs composition for humans will vary depending upon such factors as the patient's age, weight, height, sex, general medical condition and previous medical history. It may be desirable to provide the subject with a dosage that is at a concentration of 0.0025, 0.025, 0.25 or 2.5 ⁇ g per tumour, as intratumoral injections. It may be desirable to provide a subject with 10, 20, 30, 40, 50, 100, 150 or 200 ⁇ g of the claimed composition via intramuscular administration. Preferably, it may be desirable to provide a subject and/or a tumour with 100 ⁇ g of the claimed composition via intramuscular administration.
  • a dosage of 1-20 mg/kg for a 70 kg patient for example, is 70-1,400 mg, or 41-824 mg/m2 for a 1.7-m patient.
  • the dosage may be repeated as needed, for example, once per week for 4-10 weeks, once per week for 8 weeks, or once per week for 4 weeks. It may also be given less frequently, such as every other week for several months, or monthly or quarterly for many months, as needed.
  • the nucleic acid cargo may be present in the pharmaceutical composition in an amount from 1 mg to 10 g, preferably 50 mg to 2 g, in particular 100 mg to 1 g.
  • Usual dosages can also be determined on the basis of kg body weight of the patient, for example preferred dosages are in the range of 0.1 mg to 100 mg/kg body weight, especially 1 to 10 mg/kg body weight (per administration session). The administration may occur e.g. once daily, once every other day, once per week or once every two weeks.
  • the immune checkpoint inhibitor may be employed in the use or method as described herein as a sole treatment for cancer or pre-cancer, or in conjunction with a second treatment for cancer or pre-cancer, such as a surgery, radiation, chemotherapy, hormone therapy, or any combination thereof.
  • the immune checkpoint inhibitor may be employed as first, second, third, or further, line treatment for cancer or pre-precancer.
  • the invention relates to a composition
  • a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase and its uses in sensitising a subject (their cancer or pre-cancer) to an immune checkpoint inhibitor (for example PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, CTLA4 inhibitor, TIGIT inhibitor, LAG-3 inhibitor, TIM-3 inhibitor, BTLA inhibitor and/or KIR inhibitor).
  • the composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase may alter the redox status (for example alters the NAD+:NADH ratio) in a cancer or a pre-cancer.
  • the composition may alter the lactate to glucose ratio in the interstitial fluid of the cancer or pre-cancer.
  • the cells of the cancer or pre-cancer must be exposed to the composition.
  • the term “expose” refers to an active step of contacting the cancer or pre-cancer cells with the composition so as to alter the redox status (for example lactate to glucose ratio) and/or providing to a cancer or pre-cancer cell the composition that alters redox status (for example the lactate to glucose ratio). Exposure may be in vitro, in vivo or ex vivo. Upon exposure in vitro or ex vivo, the cells may be introduced (e.g.
  • re-introduced into the subject with cancer or pre-cancer.
  • the term “redox status” or “metabolic status” as used herein refers to the cytosolic and/or mitochondrial ratio of NAD+:NADH in the cancer or pre-cancer microenvironment, such as the tumour as a whole and/or interstitial fluid of the cancer or pre-cancer (also referred to herein as the interstitial fluid of the tumour).
  • the inventors have found that both decreasing the NAD+:NADH ratio (mtDNA mutation) and/or increasing the NAD+:NADH ratio away from homeostatic levels within cancer and/or pre-cancer cells exerts an immunomodulatory effect on tumours, rendering these more sensitive to immune checkpoint inhibitors.
  • Homeostatic levels in this context may refer to the levels in wild-type (for example non-cancerous cells, and/or cancer cells that do not bear mtDNA mutations).
  • NAD+:NADH ratio is tightly regulated in cells – as the directionality and activity of a huge number of reactions (glycolysis, gluconeogenesis, fatty acid synthesis, DNA repair (PARP is NAD+ dependent) histone acetylation etc) are dependent on it.
  • the composition is provided by exposing the subject to the composition with a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase, for example by transducing or transfecting the cells of the cancer or pre-cancer with a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase.
  • LNP lipid nanoparticle
  • NADH oxidase is an agent that may alter the redox status (for example alters the lactate to glucose ratio) of the cells.
  • the encoded NADH oxidase is an enzyme.
  • the enzyme may be an enzyme that increases glucose uptake and/or lactate release.
  • the NADH oxidase may be from Lactobacillus brevis.
  • Such an enzyme may be referred to herein as “LbNOX”.
  • the enzyme may suitably be expressed in the cytosol of the cancer or pre-cancer cells.
  • LbNOX expressed in the cytosol may be referred to herein as cytoLbNOX.
  • the enzyme may suitably be expressed in the mitochondria of the cancer or pre- cancer cells.
  • LbNOX expressed in the mitochondria may be referred to herein as mitoLbNOX.
  • Killing of the neutrophils may be by antibody-dependent cell-mediated cytotoxicity (ADCC).
  • Compounds that may reduce tumour resident neutrophils include for example anti- Ly6G antibody, anti-GR1 antibody, and/or other antibodies that are specific to certain neutrophil antigens (such as antibodies that are specific to the human neutrophil antigens (HNAs), selected from the group consisting of HNA-1a, HNA-1b, and HNA-1c). These antibodies can be used to identify and deplete neutrophils that express these antigens.
  • HNAs human neutrophil antigens
  • the term “altered” as used herein refers to a change, which may be an increase or a decrease, relative to a reference value.
  • the term "increased” or “increase” as used herein generally means a difference between the relevant level (metabolite, mutation load etc) and a suitable corresponding reference value, that is at least about 10% greater than the reference value, for example at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% greater than the reference value.
  • the term “decrease” or “decreased” as used herein generally means a difference between the relevant level (metabolite, mutation load etc) and a suitable corresponding reference value that is at a reduction of least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% etc than the reference value.
  • the “reference value” may be the corresponding parameter (such as an NAD+:NADH ratio, or an lactate to glucose ratio) of a cancer or a pre-cancer prior to the cancer or pre-cancer being exposed to the composition.
  • the composition may be provided prior to, or simultaneously with, the immune checkpoint inhibitor (such as PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, CTLA4 inhibitor, TIGIT inhibitor, LAG-3 inhibitor, TIM-3 inhibitor, BTLA inhibitor and/or KIR inhibitor).
  • the composition may be formulated as appropriate.
  • the composition may be an infusion.
  • “infusion” refers to a solution, emulsion or suspension.
  • the composition may be injected into the cancer or pre-cancer.
  • the composition is composition is a cell permeable compound or a pre-cursor thereof.
  • the composition may be in the form of a pharmaceutical composition.
  • the pharmaceutical composition may further comprise a pharmaceutically acceptable diluent, carrier or excipient.
  • Such compositions may further routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, supplementary immune potentiating agents such as adjuvants and cytokines and optionally other therapeutic agents.
  • the compositions may also include antioxidants and/or preservatives. As antioxidants may be mentioned thiol derivatives (e.g.
  • thioglycerol cysteine, acetylcysteine, cystine, dithioerythreitol, dithiothreitol, glutathione), tocopherols, butylated hydroxyanisole, butylated hydroxytoluene, sulfurous acid salts (e.g. sodium sulfate, sodium bisulfite, acetone sodium bisulfite, sodium metabisulfite, sodium sulfite, sodium formaldehyde sulfoxylate, sodium thiosulfate) and nordihydroguaiareticacid.
  • sulfurous acid salts e.g. sodium sulfate, sodium bisulfite, acetone sodium bisulfite, sodium metabisulfite, sodium sulfite, sodium formaldehyde sulfoxylate, sodium thiosulfate
  • nordihydroguaiareticacid e.g. sodium sulfate, sodium bisulfite,
  • Suitable preservatives may for instance be phenol, chlorobutanol, benzylalcohol, methyl paraben, propyl paraben, benzalkonium chloride and cetylpyridinium chloride.
  • pharmaceutically acceptable is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings or animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio. It will be appreciated that the pharmaceutical compositions described above may be suitable for use in treating cancer or precancer, and particularly those various forms of cancer described herein.
  • the nucleic acid cargo comprises at least one (therapeutic) RNA.
  • the nucleic acid cargo may be a ribonucleic acid (RNA).
  • the RNA may have a CMV promoter.
  • the RNA may have a 110-120 polyA tail.
  • the RNA may be pseudoU modified.
  • the nucleic acid cargo may be a messenger ribonucleic acid (mRNA).
  • the mRNA may be a therapeutic mRNA.
  • the mRNA may be codon-optimized.
  • the nucleic acid cargo encodes NADH oxidase.
  • NADH oxidase is an enzyme.
  • the NADH oxidase is from Lactobacillus brevis, Lactococcus lactis, Streptococcus pneumoniae, Streptococcus mutans or Serpulina hyodysenteriae.
  • lactobacillus brevis Such an enzyme from Lactobacillus brevis may be referred to herein as “LbNOX”.
  • Lactococcus lactis Such an enzyme from Lactococcus lactis may be referred to herein as “LlNOX”.
  • Such an enzyme from Streptococcus pneumoniae may be referred to herein as “SpNOX”.
  • Such an enzyme from Streptococcus mutans may be referred to herein as “SmNOX”.
  • Such an enzyme from Serpulina hyodysenteriae may be referred to herein as “ShNOX”.
  • suitable NADH oxidase enzymes are discussed in Titov, Denis V et al. “Complementation of mitochondrial electron transport chain by manipulation of the NAD+/NADH ratio.” Science (New York, N.Y.) vol. 352,6282 (2016): 231-5. (doi:10.1126/science.aad4017) (which is hereby incorporated by reference in its entirety).
  • the supplementary material of this paper e.g. Figure S1 provides evidence of the activity and the sequences for NADH oxidases from several bacterial species.
  • the NADH oxidase is from Lactobacillus brevis.
  • the mRNA may comprise the nucleic acid sequence of SEQ ID NO: 1.
  • SEQ ID NO: 1 encodes the cytoLbNOX enzyme.
  • AUGAAGGUCACCGUGGUCGGAUGCACCCAUGCCGGCACCUUCGCCAUCAAGCAAAU CCUCGCUGAGCACCCUGACGCCGAGGUCACCGUCUACGAGAGGAACGAUGUGAUCU CCUUCCUGUCCUGUGGCAUCGCCCUCUACCUGGGCGGAAAAGUGGCCGAUCCCCAA GGCCUCUUCUACAGCUCCCCUGAAGAACUGCAGAAGCUGGGCGCUAAUGUGCAGAU GAACCACAACGUGCUGGCCAUCGACCCUGACCAAAAGACCGUCACAGUCGAGGACCU CACCAAUCACGCCCAGACCACCGAGUCCUACGACAAACUGGUGAUGACCUCCGGAAG CUGGCCUAUCGUGCCCAAAAUCCCCGGCAUCGACAGCGAUAGGGUGAAGCUCUGCA AGAAUUGGGCCCACGCCCAGGCUCUGAUUGAG
  • the mRNA may comprise the nucleic acid sequence of SEQ ID NO: 3.
  • SEQ ID NO: 3 encodes the full cytoLbNOX enzyme with tags.
  • the mRNA may comprise the nucleic acid sequence of SEQ ID NO: 4.
  • SEQ ID NO: 4 encodes the full mitoLbNOX enzyme with tags.
  • the LNP may comprise: a) component A wherein component A is a cationic lipid; b) component B wherein component B is a sterol; c) component C wherein component C is a phosphatidylcholine; and d) component D wherein component D is a PEGylated lipid.
  • the LNP may consist of: a) component A wherein component A is a cationic lipid; b) component B wherein component B is a sterol; c) component C wherein component C is a phosphatidylcholine; and d) component D wherein component D is a PEGylated lipid.
  • the phosphatidylcholine may be selected from the group consisting of 1,2- dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1-oleoyl-2-palmitoyl-sn-glycero-3- phosphocholine (OPPC), 1,2-didecanoyl-sn-glycero-3-phosphocholine (DDPC), 1,2- dierucoyl-sn-glycero-3-phosphocholine (DEPC), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLOPC), 1,2-dilauroyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-3- phosphocholine (DMPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1-myristoyl-2- palmitoyl-sn-glycero-3-phosphocholine (DPPC
  • the phosphatidylcholine may be 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).
  • the cationic lipid may be 6-((2-hexyldecanoyl)oxy)-N-(6-((2- hexyldecanoyl)oxy)hexyl)-N-(4-hydroxybutyl)hexan-1-aminium (ALC-0315), 1,2-dioleoyl-3- trimethylammonium propane (DOTAP), N-[1-(2,3-dioleyloxy)propyl]-N,N,N- trimethylammonium chloride (DOTMA), 1,2-dioleyloxy-3-dimethylaminopropane (DODMA), 1,2-dioleoyl-3-dimethylaminopropane (DODAP), 1,2-dilinoleyloxy-3-(N,N- dimethyl)aminopropane (DL
  • the cationic lipid may be [(4-hydroxybutyl)azanediyl]di(hexane-6,1-diyl) bis(2-hexyldecanoate) (ALC-0315), heptadecan-9-yl 8- ⁇ (2-hydroxyethyl)[6-oxo-6- (undecyloxy)hexyl]amino ⁇ octanoate (SM-102),3-(didodecylamino)-N1,N1,4-tridodecyl-1- piperazineethanamine (KL10), N1-[2-(didodecylamino)ethyl] N1,N4,N4-tridodecyl-1,4- piperazinediethanamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-octatriacontane (KL25), 1,2-dil
  • the cationic lipid may be (20Z,23Z)-N,N-dimethylnonacosa-20,23-dien-10-amine, (17Z,20Z)- N,N-dimemylhexacosa-17,20-dien-9-amine, (1Z,19Z)-N5N-dimethylpentacosa-16, 19-dien-8- amine, (13Z,16Z)-N,N-dimethyldocosa-13,16-dien-5-amine, (12Z,15Z)-N,N dimethylhenicosa-12,15-dien-4-amine, (14Z,17Z)-N,N-dimethyltricosa-14,17-dien-6-amine, (15Z,18Z)-N,N-dimethyltetracosa-15,18-dien-7-amine, (18Z,21Z)-N,N-dimethylheptacosa- 18,21-dien-10-amine, (15Z,18Z)-N,N
  • the sterol may be (3 ⁇ )-cholest-5-en-3-ol (cholesterol), cholesta-5,24-dien-3 ⁇ -ol (desmosterol), cholestadienol, 5 ⁇ -cholest-7-en-3 ⁇ -ol (lanthosterol), stigmast-5-en-3 ⁇ -ol (beta- sitosterol), cholesta-5,7-dien-3 ⁇ -ol (7-dehydrocholesterol), 9,19-cyclo-9 ⁇ -lanost-24-en-3 ⁇ -ol (cycloartol), ergosta-5,22-dien-3 ⁇ -ol (brassicasterol), 5 ⁇ -campestan-3 ⁇ -ol (campestanol), campest-5-en-3 ⁇ -ol (campesterol), 5 ⁇ -stigmastan-3 ⁇ -ol (stigmastanol), stigmasta-5,22-dien- 3 ⁇ -ol (stigmasterol), (22E)-ergosta-5,7, chol
  • the sterol may be (3 ⁇ )- cholest-5-en-3-ol (cholesterol).
  • the PEGylated lipid may be a PEGylated diglyceride, a PEGylated ceramide or any combination thereof.
  • Suitable PEGylated lipid may be for instance 2-[(polyethylene glycol)- 2000]-N,N-ditetradecylacetamide (ALC-0159), pegylated diacylglycerol lipid (PEG-DAG), a pegylated ceramide lipid (PEG-Cer), a pegylated phosphatidylethanoloamine lipid (PEG-PE), a pegylated succinate diacylglycerol lipid (PEG-S-DAG), a pegylated dialkoxypropylcarbamate lipid, 1 ,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol ("PEG-DMG” or "DMG-PEG”), in particular PEG2000-DMG, 1,2-dicapryl-rac-glycero-3- methylpolyoxyethylene glycol (Ci0 -diacylglycerol PEG), N-octanoyl-
  • the PEGylated lipid may be 1,2-Dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG2000).
  • lipid components may be present as a pharmaceutically acceptable salt, or a combination of pharmaceutically acceptable salts.
  • any, some or all of component A, component B, component C and component D may be/comprise pharmaceutically acceptable salts.
  • component A may be an ionizable cationic lipid, for example a tertiary amine lipid, preferably 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4- hydroxybutyl)hexan-1-aminium (ALC-0315).
  • a tertiary amine lipid preferably 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4- hydroxybutyl)hexan-1-aminium (ALC-0315).
  • component B may be an unsaturated sterol, for example wherein the unsaturated sterol may be (3 ⁇ )-cholest-5-en-3-ol (cholesterol), cholesta-5,24-dien-3 ⁇ -ol (desmosterol), cholestadienol, 5 ⁇ -cholest-7-en-3 ⁇ -ol (lanthosterol), or cholesta-5,7-dien-3 ⁇ -ol (7-dehydrocholesterol).
  • component C may be a saturated phosphatidylcholine, preferably 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).
  • component D may be a PEGylated diglyceride, preferably PEGylated myristoyl diglyceride.
  • component A may be an ionizable cationic lipid, for example a tertiary amine lipid, preferably 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4- hydroxybutyl)hexan-1-aminium (ALC-0315);
  • component B may be an unsaturated sterol, for example wherein the unsaturated sterol may be (3 ⁇ )-cholest-5-en-3-ol (cholesterol), cholesta- 5,24-dien-3 ⁇ -ol (desmosterol), cholestadienol, 5 ⁇ -cholest-7-en-3 ⁇ -ol (lanthosterol), or cholesta-5,7-dien-3 ⁇ -ol (7-dehydrocholesterol
  • component A may be 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N- (4-hydroxybutyl)hexan-1-aminium (ALC-0315);
  • component B may be (3 ⁇ )-cholest-5-en-3-ol (cholesterol);
  • component C may be 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); and component D may be 1,2-Dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG- PEG2000).
  • the LNP described herein may further comprise a coat, such as a steric shield coating, or an inert polymer coating.
  • An LNP may be coated in order to reduce non-specific cellular interactions.
  • Suitably coating involves derivatisation of the liposome with polyethylene glycol (PEG) as a steric shield, for example by preparing the LNP using a mixture of lipids wherein one or more of the lipids in the mixture of lipids comprises a lipid containing a PEG group.
  • PEGylated means a compound which contains a PEG group (i.e. a polyethylene glycol moiety).
  • PEGylation may be achieved by chemical reaction which covalently joins a polyethylene glycol precursor to a lipid, for example reaction of a diglyceride with an activated PEG ether to form a PEGylated diglyceride.
  • Suitable molecular weights for PEG groups may range from 100 to 5000 PEG units, preferably 2000 PEG units.
  • the nucleic acid cargo (for example RNA) may be associated with the membrane of the LNP, preferably by non-covalent interaction.
  • nucleic acid cargo may be associated with the cationic lipid of the LNP, for example through a Coulombic interaction.
  • the nucleic acid cargo may associate with the hydrophobic region of the LNP, for example through hydrophobic interactions between some or all of the nucleic acid cargo and the lipids of the LNP.
  • the nucleic acid cargo may be present within a bilayer of the LNP.
  • a hydrophobic portion of the nucleic acid cargo may be present within a bilayer of the LNP.
  • the nucleic acid cargo may be present in an aqueous lumen of the LNP, (for example, the interior of a liposome).
  • the nucleic acid cargo may be present in an aqueous lumen of the LNP by physical entrapment, for example whereby the nucleic acid cargo is sufficiently hydrophilic that it cannot pass from the aqueous lumen to the exterior of the LNP.
  • the nucleic acid cargo may be present in an aqueous lumen of the LNP and associated with the cationic lipid of the LNP (e.g. through a Coulombic interaction).
  • the LNP may comprise a nucleic acid cargo and a drug compound, for example a nucleic acid cargo within an aqueous lumen of the LNP and a drug compound within an aqueous lumen of the LNP, or a nucleic acid cargo within an aqueous lumen of the LNP and a drug compound within a hydrophobic bilayer of the LNP.
  • the nucleic acid cargo may be modified, preferably by covalent modification, more preferably by covalent attachment of lipid moieties, which may improve hydrophobic interactions e.g. with a hydrophobic bilayer of the LNP.
  • the lipids of the LNP are in the liquid phase at ambient temperature.
  • the lipids of the LNP are in the liquid phase at body temperature.
  • the lipids of the LNP are in the gel phase at ambient temperature.
  • the lipids of the LNP are in the liquid phase at body temperature.
  • the size of LNP of the disclosure may be measured by dynamic light scattering (DLS) for example to obtain an average diameter measurement by the method of Koppel, D., J. Chem. Phys.57, 1972, pp 4814- 4820, ISO 13321.
  • LNPs may have an average diameter of 10 nm to 10000 nm, optionally 20 nm to 5000 nm, for example 50 to 1000 nm or 50 to 500 nm.
  • component A may be present in 30-70 mol%, preferably 40-60 mol%, more preferably 45-55 mol%, even more preferably 48-52 mol%; component B may be present in 25-45 mol%, preferably 30-42 mol%, more preferably 35-40 mol%; component C may be present in 5-15 mol%, preferably 8-12 mol%, more preferably 9-11 mol%; and component D may be present in 0.5-2.5 mol%, preferably 1.2-1.8 mol%, more preferably 1.4-1.6 mol%.
  • component A may be present in 50 mol%; component B may be present in 38.5 mol%; component C may be present in 10 mol%; and component D may be present in 1.5 mol%.
  • component A may be present in 50 mol%.
  • component B may be present in 38.5 mol%.
  • component C may be present in 10 mol%.
  • component D may be present in 1.5 mol%.
  • mol% refers to the molar percentage of the particular component relative to the total lipid content of the LNP, for example where component A, component B, component C and component D are the only lipids present in the LNP, mol% refers to the molar amount of a particular component as a percentage of the total molar amount of component A, component B, component C and component D.
  • the nucleic acid may be incorporated into a distinct nucleic acid sequence, such as a vector.
  • the vector is a plasmid, a viral vector, or a cosmid, optionally wherein the vector is selected from the group consisting of a lentivirus, retrovirus, adeno-associated virus, adenovirus, vaccinia virus, canary poxvirus, herpes virus, minicircle vector and synthetic DNA or RNA.
  • the term “vector” refers to a nucleic acid sequence capable of transporting another nucleic acid sequence to which it has been operably linked.
  • the vector can be capable of autonomous replication or it can integrate into a host DNA.
  • the vector may include restriction enzyme sites for insertion of recombinant DNA and may include one or more selectable markers or suicide genes.
  • the vector can be a nucleic acid sequence in the form of a plasmid, a bacteriophage or a cosmid.
  • the vector is suitable for expression in a cell (i.e. the vector is an “expression vector”).
  • the vector is suitable for expression in a human T cell such as a CD8 + T cell or CD4 + T cell, or stem cell, iPS cell, or NK cell.
  • the vector is a viral vector, such as a retroviral vector, a lentiviral vector or an adeno-associated vector.
  • the vector is selected from the group consisting of an adenovirus, vaccinia virus, canary poxvirus, herpes virus, minicircle vector and synthetic DNA or synthetic RNA.
  • the (expression) vector is capable of propagation in a host cell and is stably transmitted to future generations.
  • the vector may comprise regulatory sequences. "Regulatory sequences" as used herein, refers to, DNA or RNA elements that are capable of controlling gene expression. Examples of expression control sequences include promoters, enhancers, silencers, TATA- boxes, internal ribosomal entry sites (IRES), attachment sites for transcription factors, transcriptional terminators, polyadenylation sites etc.
  • the vector includes one or more regulatory sequences operatively linked to the nucleic acid sequence to be expressed. Regulatory sequences include those which direct constitutive expression, as well as tissue-specific regulatory and/or inducible sequences.
  • the vector comprises the nucleic acid sequence of interest operably linked to a promoter.
  • Promoter refers to the nucleotide sequences in DNA to which RNA polymerase binds to start transcription.
  • the promoter may be inducible or constitutively expressed. Alternatively, the promoter is under the control of a repressor or stimulatory protein.
  • the promoter may be one that is not naturally found in the host cell (e.g. it may be an exogenous promoter).
  • operably linked refers to a single or a combination of the below-described control elements together with a coding sequence in a functional relationship with one another, for example, in a linked relationship so as to direct expression of the coding sequence.
  • the vector may comprise a transcriptional terminator.
  • Transcriptional terminator refers to a DNA element, which terminates the function of RNA polymerases responsible for transcribing DNA into RNA. Preferred transcriptional terminators are characterized by a run of T residues preceded by a GC rich dyad symmetrical region.
  • the vector may comprise a translational control element.
  • Translational control element refers to DNA or RNA elements that control the translation of mRNA.
  • Preferred translational control elements are ribosome binding sites.
  • the translational control element is from a homologous system as the promoter, for example a promoter and its associated ribozyme binding site. Preferred ribosome binding sites are known, and will depend on the chosen host cell.
  • the vector may comprise restriction enzyme recognition sites. "Restriction enzyme recognition site” as used herein, refers to a motif on the DNA recognized by a restriction enzyme.
  • the vector may comprise a selectable marker.
  • Selectable marker refers to proteins that, when expressed in a host cell, confer a phenotype onto the cell which allows selection of the cell expressing said selectable marker gene. Generally this may be a protein that confers a new beneficial property onto the host cell (e.g. antibiotic resistance) or a protein that is expressed on the cell surface and thus accessible for antibody binding. Appropriate selectable markers are well known in the art.
  • the vector may also comprise a suicide gene. “Suicide gene” as used herein, encodes a protein that induce death of the modified cell upon treatment with specific drugs.
  • suicide can be induced in cells modified by the herpes simplex virus thymidine kinase gene upon treatment with specific nucleoside analogs including ganciclovir, cells modified by human CD20 upon treatment with anti-CD20 monoclonal antibody and cells modified with inducible Caspase9 (iCasp9) upon treatment with AP1903 (reviewed by BS Jones, LS Lamb, F Goldman, A Di Stasi; Improving the safety of cell therapy products by suicide gene transfer. Front Pharmacol. (2014) 5:254).
  • Appropriate suicide genes are well known in the art.
  • the vector comprises those genetic elements which are necessary for expression of the binding proteins described herein by a host cell.
  • the elements required for transcription and translation in the host cell include a promoter, a coding region for the protein(s) of interest, and a transcriptional terminator.
  • a person of skill in the art will be well aware of the molecular techniques available for the preparation of (expression) vectors and how the (expression) vectors may be transduced or transfected into an appropriate host cell (thereby generating a modified cell described further below).
  • the (expression) vector system described herein can be introduced into cells by conventional techniques such as transformation, transfection or transduction.
  • Transformation refer generally to techniques for introducing foreign (exogenous) nucleic acid sequences into a host cell, and therefore encompass methods such as electroporation, microinjection, gene gun delivery, transduction with retroviral, lentiviral or adeno-associated vectors, lipofection, superfection etc.
  • the specific method used typically depends on both the type of vector and the cell.
  • deleterious mtDNA mutation refers to a mutation that adversely affects the structure and/or function of the mtDNA element it encodes, in contrast to a neutral mutation (such as a silent point mutation), which has neither a positive or negative mutation on the corresponding encoded element.
  • a deleterious mtDNA mutation may be selected from the group consisting of: (i) a tRNA mutation having a MitoTIP RAW score of at least 12.6, or at least 16.25; (ii) a rRNA mutation; (iii) a truncation mutation in a mtDNA gene; (iv) a missense mutation in a mtDNA gene, wherein the missense mutation has an Apogee score of more than 0.5, optionally wherein the missense mutation is selected from a frameshift mutation, an insertion mutation or a deletion mutation; and/or (v) a mutation in a mtDNA D-loop region selected from the group consisting of: the H-strand promoter (m.
  • the tRNA mutation may be in a gene selected from the group consisting of MT-TL1, MT-TA, MT-TC, MT-TD, MT-TE, MT-TF, MT-TG, MT-TH, MT-TI, MT-TK, MT-TL2, MT-TM, MT-TN, MT-TP, MT-TQ, MT-TR, MT-TS1, MT-TS2, MT-TT, MT-TV, MT-TW, and MT-TY.
  • the rRNA mutation may be in a gene selected from the group of MT-RNR1 and MT-RNR2.
  • the truncation or missense mutation may be in a tRNA, rRNA or protein coding gene.
  • the protein coding gene may be selected from the group of MT-ND5, MT-ND1, MT-ND2, MT- ND3, MT-ND4, MT-ND4L, MT-ND6, MT-CO1, MT-CO2, MT-CO3, MT-CYB, MT-ATP6, and MT-ATP8.
  • the mutation may be in a mtDNA gene that encodes a subunit of a mitochondrial respiratory chain complex selected from the group consisting of complex I, complex III, complex IV and complex V.
  • the deleterious mtDNA mutation is a truncation, missense, insertion, or frameshift mutation.
  • the deleterious mutation may be in the gene MT-ND5.
  • the deleterious mutation may be a truncating mutation that is in a region selected from: m.12418-12425:A indel or m.12385-12390:C indel.
  • the deleterious mutation may be a missense mutation in the MT-CO1, MT-ND5, MT- ND4, MT-CYB or MT-TY gene.
  • the missense mutation may be selected from the group consisting of m.6318C>T, m.12730G>A, m.11736T>C, m.15140G>A, m.5843A>G, and m.6214G>A.
  • the insertion mutation may be selected from the group consisting of m.16183:CC indel, and m.16192:T indel.
  • mtDNA mutation load refers to mtDNA mutations that arise and co-exist with the wild-type allele in the same cell, or group of cells.
  • the term “determine” or “determining” refers to measuring the level of mtDNA molecules comprising a deleterious mutation in a cell or group of cells and comparing that level to the level of mtDNA molecules that do not comprise such deleterious mutations (or to the total number of mtDNA molecules that are present in the cell or group of cells). It will be appreciated that mtDNA molecules that do not comprise deleterious mutations may comprise other mutations, however these mutations would not be deleterious within the meaning of the present disclosure. MtDNA mutation load may be typically represented as a percentage.
  • a mutation load of 30% means that 30% of mtDNA molecules in a cell or group of cells (such as a sample) carry a deleterious mtDNA mutation.
  • the deleterious mutation may be the same or different in all mutated mtDNA molecules. More suitably, the deleterious mutation may be the same in all mutated mtDNA molecules for the purpose of measuring mutation load.
  • the mtDNA molecules with the deleterious mutation used for determining mutation load may have further (additional) deleterious mutations.
  • Methods of determining mtDNA mutation loads are well known in the art and include mtDNA sequencing, such as single cell mtDNA sequencing.
  • the deleterious mtDNA mutation load is determined in a cancer or pre-cancer sample from the subject.
  • the term “sample” refers to any group of cells comprising cancer cells and/or pre-cancer cells derived from the subject.
  • the sample may typically comprise a mixture of healthy (i.e. non- cancerous and non-precancerous cells) and cancer cells (and/or pre-cancerous cells).
  • the sample may comprise components of a tumour e.g. cells (cancer, pre-cancer, and healthy cells), as well as interstitial fluid.
  • the sample will comprise at least 5%, at least 10%, at least 15%, at least 20%, or more of cancer and/or pre-cancer cells.
  • the sample may comprise at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% or more of cancer and/or pre-cancer cells.
  • the presence of healthy cells which may be substantially free of a deleterious mtDNA mutation load, may lower the determined (overall) deleterious mtDNA mutation load in a sample as compared to if the deleterious mtDNA mutation load was determined solely or substantially only on cancer or pre-cancer cells.
  • the term “substantially only” means that the cancer cells account for at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or more of the cells in the sample.
  • the deleterious mtDNA mutation load of the cancer or precancer cells present in the sample specifically may be more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, more than 80%, or more than 90%.
  • the sample may be a biopsy, a smear sample, or a interstitial fluid sample.
  • the sample may be a blood sample (for example, a whole blood sample, a blood plasma sample, or a serum sample), or a urine sample.
  • a blood sample for example, a whole blood sample, a blood plasma sample, or a serum sample
  • the amount of mtDNA molecules having the deleterious mutation is used to determine the level of the mutation load in a cell or a group of cells.
  • the proportion of mtDNA molecules having the deleterious mutation is referred to as “the deleterious mtDNA mutation load”.
  • the deleterious mtDNA mutation load The skilled person would appreciate that a low proportion of mtDNA molecules having the deleterious mutation will correspond to a low deleterious mtDNA mutation load, which may be asymptomatic (i.e.
  • tumour microenvironment such as the tumour as a whole and/or interstitial fluid of the cancer or pre-cancer (also referred to herein as the interstitial fluid of the tumour).
  • the altered tumour microenvironment may be more or less favourable for specific immune cell populations, as explained in more detail hereinbelow.
  • An altered redox status may be indicated by an increase in one or more cellular metabolite selected from the group consisting of: fumarate, lactate, malate, acetyl CoA, aspartate, glucose, glucose 6-phosphate, glutamine, glucose 3-phosphate, glycolytic intermediates, fumarate adducts (such as succinicGSH and/or succinylCysteine), and arginosuccinate.
  • altered redox status may be indicated by increase in the fumarate adducts succinicGSH and/or succinylCysteine (also referred to as succ.cys and succ.gsh respectively herein).
  • altered redox status may include a decrease in one or more cellular metabolite selected from the group consisting of: alpha-ketoglutarate, pyruvate, phosphoenolpyruvate and succinate.
  • a deleterious mtDNA mutation load may alter the NAD+:NADH ratio in the mitochondria and/or the cytosol.
  • the deleterious mtDNA mutation load may increase the NAD+:NADH ratio in the mitochondria and/or the cytosol.
  • Disturbed NAD+:NADH ratio may result in partial reverse flux of MDH2 within mitochondria (which can be determined from the ratio of pyruvate carboxylase-derived (m+3) malate, citrate, and aconitate, and pyruvate).
  • altered redox status may include changes in TCA cycle and/or urea cycle metabolites.
  • these metabolites may be related to the malate-aspartate shuttle (MAS) and fumarate within mitochondria and/or within the cytosol.
  • MAS malate-aspartate shuttle
  • the inventors used 1- 13 C-glutamine tracing, which revealed that NAD+:NADH ratio changes are associated with increases in malate m+1 abundance, and argininosuccinate m+1 abundance, but not a-KG m+1, aconitate m+1 or aspartate m+1 – implicating increased MDH1 flux.
  • altered mitochondrial metabolic state may include increased MDH1 flux.
  • altered redox status may include an imbalance between lactate and glucose in the tumour (e.g. in the interstitial fluid of the tumour).
  • an altered lactate to glucose ratio in a cancer or pre-cancer can sensitise the cancer or pre-cancer to a PD-1 inhibitor and/or PD-L1 inhibitor.
  • an altered lactate to glucose ratio may be an increased lactate to glucose ratio.
  • altered redox status may include an imbalance between pyruvate and lactate in the tumour (e.g. in the interstitial fluid of the tumour).
  • a deleterious mtDNA mutation load may alter the redox status (for example alter the pyruvate to lactate ratio) in the tumour (e.g. in the interstitial fluid of the tumour).
  • the inventors believe that an altered redox status (for example altered lactate to glucose ratio) in the cancer or pre-cancer is the reason why such cancers or pre-cancers have a notably different proportion of immune cells in the tumour microenvironment.
  • the composition may increase the levels of immune cells selected from the group consisting of: NK cells; monocytes; CD4+ T cells; and ISG-expressing immune cells, and/or decreased the levels of macrophages (for example tumour associated macrophages) and/or neutrophils.
  • the composition may decreases the levels of neutrophils, for example tumour infiltrating neutrophils.
  • an immune checkpoint inhibitor may be for use in treating a subject having a cancer or a pre-cancer, wherein the subject has been exposed to a composition that reduces neutrophils (for example tumour infiltrating neutrophils).
  • a method of sensitising a subject having a cancer or a pre-cancer to an immune checkpoint inhibitor may comprise exposing the subject to a composition that reduces neutrophils (for example tumour infiltrating neutrophils).
  • a method of treating a cancer or a pre-cancer in a subject may comprise administering an immune checkpoint inhibitor to the subject, wherein the subject has been exposed to a composition that reduces neutrophils (for example tumour infiltrating neutrophils).
  • a method of treating a cancer or a pre-cancer in a subject may comprise: (i) exposing the subject to a composition that reduces neutrophils (for example tumour infiltrating neutrophils); and (ii) administering an immune checkpoint inhibitor to the subject.
  • NK cells or “Natural Killer cells” as used herein refers to a subset of peripheral blood lymphocytes defined by the expression of CD56 or CD16 and the absence of the T cell receptor (CD3).
  • monocytes refers to a subset of immune cells that are produced in the bone marrow and migrate through the blood to tissues in the body, where they become a macrophage.
  • the monocytes are immature, intermediate or classical monocytes. Immature monocytes are Lys6C and F480 positive. Intermediate monocytes are CD14+ and CD16+.
  • Classical monocytes are CD14+ and CD16-.
  • CD4 NK-like T cells refers to a subset of immune cells that are cytotoxic T-cells that co-express NK receptors such as CD56, CD16, and/or CD57.
  • CD4+ T cells refers to T helper cells.
  • ISG-expressing immune cells refers to a subset of cells that express interferon- stimulated genes.
  • macrophages refers to a subgroup of phagocytic cells produced by monocyte differentiation.
  • TAMs tumor associated macrophages
  • neutrophils generally refers to macrophages that exist in the microenvironment of a cancer, for example, a tumour.
  • neutrophils may be present within the tumour. Such neutrophils may be referred to as tumour infiltrating neutrophil (TANs).
  • TANs may be associated with poor prognosis.
  • NK cell levels may be increased by at least 100%, at least 150%, at least 200% etc.
  • the levels of tumour associated macrophages may be decreased by at least 25%, at least 50%, at least 75% etc.
  • the levels of immature monocytes may be increased by at least 100%, at least 150%, at least 200% etc.
  • CD4+ T cell levels may be increased by at least 20%, at least 50%, at least 100%, at least 200%, etc.
  • neutrophil levels may be decreased by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or more.
  • the inventors encapsulated mRNA encoding either cytoLbNOX or mitoLbNOX, a mitochondrially targeted form of the oxidase, their respective catalytic mutants and a reporter-only construct within a LNP composition from a commercial provider (See materials and methods section).
  • a key difference between this approach and proof-of-principle using genetically modified cells is that the LNP is not specifically targeted to cancer cells, all cells within the tumour microenvironment will be transduced to a greater or lesser extent, as is also true of other organs within the animal, potentially limiting the efficacy of the approach due to: a) off target transduction of cells within the tumour (e.g.
  • the inventors delivered the LNPs by a single intratumoural injection into subcutaneous B78-D14 murine melanoma tumours in immunocompetent animals at day 7, one day prior to the start of a bi-weekly single agent checkpoint blockade regimen. In an initial dose escalation study, they observed cytoLbNOX LNP dose-dependent effects on sensitivity to anti-PD1 checkpoint blockade ( Figure 1) without any instances of observable toxicity requiring animal subjects to be euthanised.
  • Lipid nanoparticles were externally produced by PackGene.
  • composition of LNPs is as follows: 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4- hydroxybutyl)hexan-1-aminium (ALC-0315), (3 ⁇ )-cholest-5-en-3-ol (cholesterol), 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC) and 1,2-Dimyristoyl-rac-glycero-3- methoxypolyethylene glycol-2000 (DMG-PEG2000).
  • mRNA-LNP complexes are re- suspended in a buffer composed of: >79% water, 20% sucrose and ⁇ 1% of potassium dihydrogen phosphate, disodium hydrogenphosphate, sodium chloride and potassium chloride. Encapsulation efficiencies of LNPs ranged from 88.0 – 89.0%. Experiments comply with all relevant ethical regulations. Animal experiments were carried out in accordance with the UK Animals (Scientific Procedures) Act 1986 (P72BA642F) and by adhering to the ARRIVE guidelines with approval from the local Animal Welfare and Ethical Review Board of the University of Glasgow.
  • mRNA design mRNA sequences were designed as follows: (MTS)-LbNOX-4xHA-T2A-mScarlet3-v5 Cell Culture B78 melanoma cells (RRID: CVCL_8341) were maintained in DMEM containing GLUTAMAX, 0.11 g/L sodium pyruvate and 4.5 g/L D-glucose (Life Technologies), supplemented with 1% penicillin–streptomycin (Life Technologies) and 10% FBS (Life Technologies). Cells were grown in incubators at 37 °C and 5% CO2.
  • mice were housed in conventional cages in an animal room at a controlled temperature (19– 23 °C) and humidity (55 ⁇ 10%) under a 12 h light:12 h dark cycle.
  • Experiments used male C57BL/6 at ⁇ 8 weeks of age that were injected subcutaneously with 2.5 ⁇ 105 B78-D14 murine melanoma cells prepared in 1:1 RPMI (Life Technologies) and Matrigel (Merck).
  • Intratumoral injections of mRNA-LNPs were administered 7 days post-transplant (tumours approx.5mm diameter) at a concentration of 0.0025, 0.025, 0.25 or 2.5 ⁇ g per tumour.
  • mice receiving immunotherapy were put on a dosing regimen of 200 ⁇ g of anti-PD1 given intraperitoneally at set intervals. The first dose was given 8 days post-transplant and all mice were culled at day 18.
  • EXAMPLE 2 Results The data in Figure 3 shows that the expression of bacterial NADH oxidase, cytoLbNOX, results in loss of O2 consumption and sensitisation of refractory murine melanoma tumours to immune checkpoint inhibition in vivo. The data shows this is non-specific sensitization to immune checkpoint blockade (ICB) that is associated with loss of oxygen consumption in models of either mtDNA mutant or LbNOX expressing melanoma.
  • IRB immune checkpoint blockade
  • the data further shows that when anti-PD1 treatment was administered, an enhanced, mtDNA mutation-dependent response was observed in Hcmel12 80% mutant tumors and that when challenged with anti-PD1 treatment, Hcmel12 cytoLbNOX tumors recapitulate the response of Hcmel12 Mt-Nd5 m.12,436 80% tumors, whereas catalytic mutant tumors were unresponsive.
  • LNPs Lipid nanoparticles
  • the composition of LNPs is as follows: 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4- hydroxybutyl)hexan-1-aminium (ALC-0315), (3 ⁇ )-cholest-5-en-3-ol (cholesterol), 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC) and 1,2-Dimyristoyl-rac-glycero-3- methoxypolyethylene glycol-2000 (DMG-PEG2000).
  • mRNA-LNP complexes are re- suspended in a buffer composed of: >79% water, 20% sucrose and ⁇ 1% of potassium dihydrogen phosphate, disodium hydrogenphosphate, sodium chloride and potassium chloride. Encapsulation efficiencies of LNPs ranged from 88.0 – 89.0%. Experiments comply with all relevant ethical regulations. Animal experiments were carried out in accordance with the UK Animals (Scientific Procedures) Act 1986 (P72BA642F) and by adhering to the ARRIVE guidelines with approval from the local Animal Welfare and Ethical Review Board of the University of Glasgow.
  • mRNA design mRNA sequences were designed as follows: (MTS)-LbNOX-4xHA-T2A-mScarlet3-v5 Cell Culture Hcmel12 cells were maintained in DMEM containing GLUTAMAX, 0.11 g/L sodium pyruvate and 4.5 g/L D-glucose (Life Technologies), supplemented with 1% penicillin–streptomycin (Life Technologies) and 10% FBS (Life Technologies). Cells were grown in incubators at 37 °C and 5% CO2. Cells were transfected using Lipofectamine 3000 (Life Technologies) using a ratio of 5 ⁇ g DNA:7.5 ⁇ l Lipofectamine 3000.
  • mice were housed in conventional cages in an animal room at a controlled temperature (19– 23 °C) and humidity (55 ⁇ 10%) under a 12 h light:12 h dark cycle.
  • Experiments used male C57BL/6 or NOD scid gamma mice at ⁇ 8 weeks of age that were injected subcutaneously with 1 ⁇ 10 4 HcMel12 cells, prepared in 1:1 RPMI (Life Technologies) and Matrigel (Merck). Untreated mice were killed at an endpoint of 15 mm tumour measurement, which was not exceeded for any experiment.
  • Mice receiving immunotherapy were killed at a fixed timepoint of day 13 for tumors derived from Hcmel12 cells.
  • mice were put on a dosing regimen of 200 ⁇ g of anti-PD1, anti-PDL1 and anti-CTLA4 treatment given intraperitoneally at set intervals. The first dose was given 7 days post injection and all mice were killed at 13 days post injection for HcMel12 cells.
  • EXAMPLE 3 Results Figure 4 shows that sensitivity to checkpoint blockade is observed in an otherwise totally refractory model, even when only 1% of cells in a chimeric tumor bears a mtDNA mutation or expresses LbNOX. The same trend is observed with chimeric mtDNA mutant melanomas.
  • Figure 4A shows that cells of the indicated genotypes were administered subcutaneously in the indicated ratios.
  • the data in Figure 4 shows that CytoLbNOX expression in only 1% of subcutaneously injected Hcme12 melanoma cancer cells is sufficient to induce a potent sensitisation to anti-PD1.
  • the data in Figure 5 studies Hcme12 melanoma cells expressing cytoLbNOX in a dox- inducible manner. The data shows that cytoLbNOX in melanoma cells which have undergone 5 days cytoLbNOX induction (day 0-5) followed by anti-PD1 treatment (day 7-13) has the same level of anti-tumour efficacy as cytoLbNOX in melanoma cells which have undergone 13-days cytoLbNOX expression together with anti-PD1 treatment at day 7.
  • Figure 5A shows tumour weight of dox-inducible cytolbnox Hcmel12 tumours at humane endpoint (15mmx15mm).
  • Figure 5B shows the survival of animals as studied in Figure 5A.
  • Figure 5C shows experimental design. Dox-inducible cytolbnox Hcmel12 cells were injected and animals then received either regular chow or doxycycline supplemented food for 5 or 13 days. IP administration of anti-PD1 then occurred every 3 days from day 7.
  • Figure 5D shows representative tumours taken at endpoint for indicated conditions.
  • Figure 5E shows the tumour weights in indicated conditions.
  • composition of LNPs is as follows: 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4- hydroxybutyl)hexan-1-aminium (ALC-0315), (3 ⁇ )-cholest-5-en-3-ol (cholesterol), 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC) and 1,2-Dimyristoyl-rac-glycero-3- methoxypolyethylene glycol-2000 (DMG-PEG2000).
  • mRNA-LNP complexes are re- suspended in a buffer composed of: >79% water, 20% sucrose and ⁇ 1% of potassium dihydrogen phosphate, disodium hydrogenphosphate, sodium chloride and potassium chloride. Encapsulation efficiencies of LNPs ranged from 88.0 – 89.0%. Experiments comply with all relevant ethical regulations. Animal experiments were carried out in accordance with the UK Animals (Scientific Procedures) Act 1986 (P72BA642F) and by adhering to the ARRIVE guidelines with approval from the local Animal Welfare and Ethical Review Board of the University of Glasgow.
  • mRNA design mRNA sequences were designed as follows: (MTS)-LbNOX-4xHA-T2A-mScarlet3-v5 Cell Culture Hcmel12 cells were maintained in DMEM containing GLUTAMAX, 0.11 g/L sodium pyruvate and 4.5 g/L D-glucose (Life Technologies), supplemented with 1% penicillin–streptomycin (Life Technologies) and 10% FBS (Life Technologies). Cells were grown in incubators at 37 °C and 5% CO2. Cells were transfected using Lipofectamine 3000 (Life Technologies) using a ratio of 5 ⁇ g DNA:7.5 ⁇ l Lipofectamine 3000.
  • mice were housed in conventional cages in an animal room at a controlled temperature (19– 23 °C) and humidity (55 ⁇ 10%) under a 12 h light:12 h dark cycle.
  • Experiments used male C57BL/6 or NOD scid gamma mice at ⁇ 8 weeks of age that were injected subcutaneously with 1 ⁇ 10 4 HcMel12 cells, prepared in 1:1 RPMI (Life Technologies) and Matrigel (Merck). Untreated mice were killed at an endpoint of 15 mm tumour measurement, which was not exceeded for any experiment.
  • Mice receiving immunotherapy were killed at a fixed timepoint of day 13 (Fig.5) or day 15 (Fig.4) for tumors derived from Hcmel12 cells.
  • mice were put on a dosing regimen of 200 ⁇ g of anti-PD1 treatment given intraperitoneally at set intervals. The first dose was given 7 days post injection and all mice were killed at 13 days (Fig.5) or 15 days (Fig.4) post injection for HcMel12 cells.
  • EXAMPLE 4 Results LNP cytoLbNOX proof-of-concept experiment B78-D14 amelanotic melanoma cells are implanted. Once the tumour reaches 5mmx5mm (day 7), a single intratumoural injection (ITI) of a range of cytoLbNOX mRNA-LNP doses from 0.0025 ug to 0.25 ug is administered.
  • ITI intratumoural injection
  • Anti-PD1 is administered every 3 days IP from day 8 until timed endpoint.
  • Figure 6B shows representative images of tumours at timed endpoint across indicated conditions. In this Figure, the sloped triangle indicates quantity of mRNA administered via ITI.
  • Figure 6C shows the tumour weights of indicated conditions at timed endpoints. All animals received anti-PD1.
  • the data shows that conservative dose-escalation of cytoLbNOX delivery via intratumoural injection of LNPs induces sensitisation in an aggressive mouse model of ICI-refractory melanoma (B78-D14).
  • the maximum dose administered is equivalent to ⁇ 10ug mRNA into a tumour ⁇ 75% the size of a golf ball.
  • B78-D14 amelanotic melanoma cells are implanted, once the tumour reaches 5mmx5mm (day 7). Then, a single intratumoural injection (ITI) of 2.5ug cytoLbNOX mRNA-LNP is administered as indicated.
  • ITI intratumoural injection
  • Anti-PD1 is administered every 3 days IP from day 8 until timed endpoint.
  • Figure 7B shows representative images of tumours at timed endpoints across indicated conditions, including transgene-free LNP and LNP delivering mRNA encoding catalytic mutants of both cytosolically targeted and mitochondrially targeted LbNOX.
  • Figure 7C shows the tumour weights of indicated conditions at timed endpoints. All animals received anti-PD1.
  • mitoLbNOX a mitochondrially targeted form of the enzyme, appears to work more robustly, likely because the enzyme is able to consume more NADH in mitochondria due to the higher concentration inside mitochondria than in the cytosol. This is expected, and further strengthens the inventor’s mechanistic understanding of the sensitizing effect.
  • the data shows the investigation of higher doses of cytoLbNOX and mitoLbNOX delivery via intratumoural injection. The data shows that catalytic mutants of either enzyme are ineffective. The data suggests that mitochondria-targeted LbNOX is the superior sensitising agent.
  • the dose shown in this data is equivalent to ⁇ 100ug mRNA into a tumour ⁇ 75% the size of a golf ball.
  • hcmel12 cells were injected subcutaneously.
  • a single ITI of 2.5ug mRNA-LNP was administered by intratumoral injection once tumours reached 5mmx5mm (day 7).
  • Anti- PD1 was administered IP every 3 days from day 8 until humane endpoint (15mmx15mm tumour caliper measurements).
  • Figure 8B hcmel12 cells were injected subcutaneously.
  • a single ITI of 2.5ug mRNA-LNP was administered by intratumoral injection once tumours reached 5mmx5mm (day 7).
  • Anti- PD1 and anti-LAG3 were administered IP every 3 days from day 8 until humane endpoint (15mmx15mm tumour caliper measurements).
  • the KPC cytolbnox cells initially appeared to form tumours, and then spontaneously receded in both the isotype and anti-PD1 conditions, indicating a possible highly potent impact of lbnox expression in PDAC.
  • the inventors also engineered cells of the widely used breast cancer model YeJ2.1g (also known as PyMT or polyoma middle T), which is loosely termed as a luminal B subtype model.
  • YeJ2.1g also known as PyMT or polyoma middle T
  • the inventors observed a substantial increase in survival of tumours expressing cytoLbNOX.
  • KPC cyto cells (+isotype). Both YEJ and KPC cells were generated by lentiviral transduction and selection with puromycin, to produce cells that constitutively express LbNOX. KPC and YEJ2.1g (PyMT) cells were treated with lentiviruses to enable stable-expression of cytoLbNOX or a control vector, and subjected to antibiotic selection. Representative clones were characterized and used in onward studies. For Figure 9A, KPC cells of indicated genotypes were injected orthotopically into the mouse pancreas, and tumour formation monitored by ultrasound.
  • mice were housed in conventional cages in an animal room at a controlled temperature (19– 23 °C) and humidity (55 ⁇ 10%) under a 12 h light:12 h dark cycle.
  • mice were housed in conventional cages in an animal room at a controlled temperature (19– 23 °C) and humidity (55 ⁇ 10%) under a 12 h light:12 h dark cycle.
  • Experiments used male C57BL/6 or NOD scid gamma mice at ⁇ 8 weeks of age that were injected subcutaneously with either 2.5 ⁇ 10 5 B78 cells or 1 ⁇ 10 4 HcMel12 cells, both prepared in 1:1 RPMI (Life Technologies) and Matrigel (Merck).
  • mice Untreated mice were killed at an endpoint of 15 mm tumor measurement, which was not exceeded for any experiment. Mice receiving immunotherapy were killed at a fixed timepoint of day 21 or day 13 for tumors derived from B78-D14 or Hcmel12, respectively.
  • Intratumoral injections of mRNA-LNPs were administered 7 days post-transplant (tumours approx.5mm diameter, as measured by calipers) at a set concentration of mRNA per tumour.
  • mice were put on a dosing regimen of 200 ⁇ g of anti-PD1 given intraperitoneally at set intervals. The first dose was given 8 days post injection and all mice were killed at 21 or 13 days post injection for B78 or HcMel12 cells, respectively.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Nanotechnology (AREA)
  • Dermatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Optics & Photonics (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to methods of sensitising a subject having a cancer or a pre-cancer to treatment with an immune checkpoint inhibitor, as well as compositions for use in sensitising a subject to such treatment.

Description

Tumour sensitisation The present invention relates to methods of sensitising a subject having a cancer or a pre- cancer to treatment with an immune checkpoint inhibitor, as well as compositions for use in sensitising a subject to such treatment. Background Cancer immunotherapy involves the attack of cancer cells by a patient's immune system. Regulation and activation of T lymphocytes depends on signaling by the T-cell receptor and co-signaling receptors that deliver positive or negative signals for activation. Immune responses by T cells are controlled by a balance of costimulatory and inhibitory signals, called immune checkpoints. Immunotherapy with immune checkpoint inhibitors is revolutionising cancer therapy. However, some patients show little or no improvement with immune checkpoint inhibitor therapies. Accordingly, methods for sensitising patients to such treatments are still needed. The present invention aims to address this need at least in part. Brief summary of the disclosure The inventors have previously shown that cancer cells with heteroplasmic deleterious mutations in mitochondrial DNA (mtDNA) may have an altered tumour microenvironment (see WO2024/089418, hereby incorporated by reference in its entirety). Specifically, the present inventors have shown that cancer cells with a deleterious mtDNA mutation present at a high mutation load are associated with different immune cell populations being present in the tumour microenvironment. The inventors have found that microenvironments of tumours comprising such cancer cells are enriched in Natural Killer (NK) cells, monocytes, CD4+ T cells, and interferon-stimulated gene (ISG) expressing immune cells, but have reduced macrophage levels and tumour associated neutrophil levels, as compared to the microenvironments of tumours with cancer cells that have no or low deleterious mtDNA mutation load. The inventors believe that the presence of a deleterious mtDNA mutation load alters the cancer cell metabolism in a way that alters the tumour microenvironment making it conducive to infiltration by certain populations of immune cells. The inventors have identified that cancer cells with heteroplasmic mutations in the MT-ND5 gene showed increased levels of reduced nicotinamide adenine dinucleotide (NADH) leading to disrupted NAD+:NADH ratio and altered cellular redox balance. This may result in reverse flux of Malate Dehydrogenase 2 (MDH2) and accumulation of cytosolically derived malate via Malate Dehydrogenase 1 (MDH1). The increased MDH1 activity may drive glycolysis and result in excess glucose consumption and excess lactate release. Indeed, the inventors have shown that these mutations promoted utilization of pyruvate as a terminal electron acceptor and increased glycolytic flux driven by an over-reduced NAD pool and NADH shuttling between GAPDH and MDH1, mediating a Warburg-like metabolic shift. The inventors found that, despite these changes, oxygen consumption and ATP synthesis remained unaffected at a 60% mutation load (also referred to herein as “variant allele frequency” or “VAF”), although the inventors believe that these parameters would be impacted by a higher mutation load. The inventors then embarked on a study to determine whether these findings might be associated with clinical outcome. Using a mouse model, the inventors showed that tumours with > 40% VAF responded well to a PD1 inhibitor, whereas tumours with little or no VAF responded less favourably. The inventors found that this difference in treatment responsiveness was valid in the context of treatment with an immune checkpoint inhibitor (such as a PD-1 inhibitor, PD-L1 inhibitor, or CTLA4 inhibitor). These findings were also supported by a retrospective study on a clinical cohort of human patients with >50% VAF due to mutations in a variety of different mtDNA genes (such as MT-COI, MT-ND4, MT-CYB, MT-TY, and/or the mtDNA control region). The inventors believe that this difference in responsiveness to treatment with an immune checkpoint inhibitor (e.g. PD-1 inhibitor, a PD-L1 inhibitor and/or a CTLA4 inhibitor) is due to the metabolic changes caused by high VAF sensitising the cancer or pre-cancer cells in the tumour to the treatment (and the resultant changes to the immune microenvironment of the cancer or pre-cancer). Based on these data, the inventors conclude that a cancer or pre- cancer can be sensitised to treatment with an immune checkpoint inhibitor (such as PD-1 inhibitor, a PD-L1 inhibitor, and/or CTLA4 inhibitor) by mimicking this metabolic change (i.e. by altering the redox status in the cancer or a pre-cancer. The inventors further showed that upon providing to a cancer cell (e.g. a melanoma cancer cell) an agent that alters the redox status, for example NAD+:NADH ratio, the cancer cells had an increased response to immune checkpoint inhibitor treatment (such as anti-PD1 treatment). Specifically, the inventors modified wild-type Hcmel12 cells to constitutively express cytoLBnox, which induces a shift in the NAD+:NADH ratio that is in the opposite direction to a mtDNA mutation. When grafted into mice, Hcmel12 cytoLBnox tumours demonstrated comparable time to endpoint and tumour weight at endpoint as wild-type or Mt-Nd5 mutant tumours. However, when challenged with anti-PD1 treatment, Hcmel12 cytoLBnox tumours recapitulate the response of Hcmel12 mt-Nd5 m.12,43680% tumours, confirming that specific changes in redox metabolism within cancer cells, for example changes in the NAD+:NADH ratio, are sufficient to sensitize the tumour to immune checkpoint blockade (for example a PD- 1 inhibitor, a PD-L1 inhibitor, and/or CTLA4 inhibitor). Moreover, the inventors have found that treatment responsiveness to an immune checkpoint inhibitor may be further (synergistically) improved in tumours with a high mtDNA mutation load or expressing cytoLbNOX, by co-treatment with compounds that reduce levels of tumour resident neutrophils (such as anti-Ly6G antibodies). The present inventors have also shown that agents that alter the redox status, for example the NAD+:NADH ratio, in a cancer or a pre-cancer (such as cytoLbNOX or mitoLbNOX) may increase the sensitivity to an immune checkpoint inhibitor in a cancer that has baseline sensitivity to immune checkpoint inhibitors, as shown in the immunogenic 4434 mouse model. In WO2024/089418 the inventors found that upon constitutively expressing an NADH oxidase enzyme, e.g. cytoLBnox, in cancer cells (e.g. melanoma cancer cells), the cells had an increased response to immune checkpoint inhibitor treatment (such as anti-PD1 treatment). This demonstrated that NADH oxidase enzymes are therapeutically effective at sensitising cancer or pre-cancer to immune checkpoint inhibitors (particularly when the NADH oxidase is expressed by the cancer or pre-cancer cells per se). The inventors have now identified a simplified means for sensitising a cancer or pre-cancer to an immune check point inhibitor using NADH oxidase. They have surprisingly found that the administration of a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase to a tumour effectively sensitises cancer or pre-cancer cells in the tumour to an immune checkpoint inhibitor. Transient expression of the NADH oxidase enzyme in cancer and pre-cancer cells, is shown to be effective in sensitising the cancer or pre-cancer to an immune checkpoint inhibitor. Surprisingly, the administration of a composition comprising a LNP having a nucleic acid cargo encoding NADH oxidase does not adversely impact cells in the tumour microenvironment (TME), e.g. immune cells, such that tumour sensitisation to an immune checkpoint inhibitor does not occur. The inventors have therefore surprisingly found that administration to the whole tumour (e.g. by intratumoural administration) of the LNP/nucleic acid compositions described herein leads to sufficient expression of the nucleic acid in cancer or pre-cancer cells to acheive a therapeutic effect (i.e. sensitisation to an immune checkpoint inhibitor) in the tumour as a whole. The present invention is therefore based on a refined methodology that relates to the invention as described in WO/2024/089418. The invention therefore provides a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase for use in sensitising a subject having cancer or pre-cancer to an immune checkpoint inhibitor. Also provided is an immune checkpoint inhibitor for use in treating a subject having a cancer or a pre-cancer, wherein the subject has been exposed to a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase. The invention also provides a method of sensitising a subject having a cancer or a pre-cancer to an immune checkpoint inhibitor, comprising exposing the subject to a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase. Further provided is a method of treating a cancer or a pre-cancer in a subject, comprising administering an immune checkpoint inhibitor to the subject, wherein the subject has been exposed to a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase. The invention also provides a method of treating a cancer or a pre-cancer in a subject, comprising: (i) exposing the subject to a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase; and (ii) administering an immune checkpoint inhibitor to the subject. Also provided is a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase. Suitably, the NADH oxidase may be from Lactobacillus brevis, further optionally wherein the enzyme may be selected from the group consisting of cytoLbNOX and mitoLbNOX. Suitably, the immune checkpoint inhibitor may be selected from the group consisting of a PD- 1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, CTLA4 inhibitor, TIGIT inhibitor, LAG-3 inhibitor, TIM-3 inhibitor, BTLA inhibitor and KIR inhibitor. Suitably, the immune checkpoint inhibitor may be selected from the group consisting of a PD- 1 inhibitor, a PD-L1 inhibitor, and CTLA4 inhibitor. Suitably, the PD-1 inhibitor may be nivolumab. Suitably, the LNP may comprise: a) component A wherein component A is a cationic lipid; b) component B wherein component B is a sterol; c) component C wherein component C is a phosphatidylcholine; and d) component D wherein component D is a PEGylated lipid. Suitably, component A is an ionizable cationic lipid, for example a tertiary amine lipid, preferably 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4- hydroxybutyl)hexan-1-aminium (ALC-0315); component B is an unsaturated sterol, for example wherein the unsaturated sterol is (3β)-cholest-5-en-3-ol (cholesterol), cholesta-5,24- dien-3β-ol (desmosterol), cholestadienol, 5α-cholest-7-en-3β-ol (lanthosterol), or cholesta- 5,7-dien-3β-ol (7-dehydrocholesterol); component C is a saturated phosphatidylcholine, preferably 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); and/or component D is a PEGylated diglyceride, preferably PEGylated myristoyl diglyceride. Suitably, component A is 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4- hydroxybutyl)hexan-1-aminium (ALC-0315); component B is (3β)-cholest-5-en-3-ol (cholesterol); component C is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); and component D is 1,2-Dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG- PEG2000). Suitably, component A is present in 30-70 mol%, preferably 40-60 mol%, more preferably 45- 55 mol%, even more preferably 48-52 mol%; component B is present in 25-45 mol%, preferably 30-42 mol%, more preferably 35-40 mol%; component C is present in 5-15 mol%, preferably 8-12mol%, more preferably 9-11 mol%; and component D is present in 0.5-2.5 mol%, preferably 1.2-1.8 mol%, more preferably 1.4-1.6 mol%; wherein mol% refers to the molar percentage of the particular component relative to the total lipid content in the LNP, for example where component A, component B, component C and component D are the only lipids present in the LNP, mol% refers to the molar amount of a particular component as a percentage of the total molar amount of component A, component B, component C and component D. Suitably, the nucleic acid cargo may be an RNA. Suitably, the nucleic acid cargo may be an mRNA. Suitably, the mRNA may comprise a) SEQ ID NO: 1 or b) SEQ ID NO: 2 Suitably, the mRNA may comprise a) SEQ ID NO: 3 or b) SEQ ID NO: 4 Suitably, a sample of the cancer or precancer may have a deleterious mitochondrial DNA (mtDNA) mutation load of less than 50%. Suitably, the deleterious mitochondrial DNA (mtDNA) mutation load may be less than 40%, less than 30%, or less than 20%. Suitably, the cancer or pre-cancer may be selected from the group consisting of: a childhood cancer, haematological cancer, and a myeloid cancer. Suitably, the cancer or pre-cancer may be selected from the group consisting of: leukemia, brain cancer, spinal cord cancer, neuroblastoma, Wilms tumor, lymphoma (such as Hodgkin and non-Hodgkin), rhabdomyosarcoma, retinoblastoma, bone cancer (such as osteosarcoma and Ewing sarcoma), melanoma, pancreatic cancer, prostate cancer, breast cancer and colorectal cancer. Suitably, the deleterious mtDNA mutation may be selected from the group consisting of: (i) a tRNA mutation having a MitoTIP RAW score of at least 12.6, or at least 16.25; (ii) a rRNA mutation; (iii) a truncation mutation in a mtDNA gene; (iv) a missense mutation in a mtDNA gene, wherein the missense mutation has an Apogee score of more than 0.5, optionally wherein the missense mutation is selected from a frameshift mutation, an insertion mutation or a deletion mutation; and/or (v) a mutation in a mtDNA D-loop region selected from the group consisting of: the H-strand promoter (545-567), MT-HV2 (hypervariable segment 2) m.57-372, and MT-HV1 (hypervariable segment 1) - m.16024-16390. Suitably, the deleterious mtDNA mutation may be in a gene selected from the group consisting of: MT-ND5, MT-ND1, MT-ND2, MT-ND3, MT-ND4, MT-ND4L, MT-ND6, MT-CO1, MT-CO2, MT-CO3, MT-CYB, MT-ATP6, MT-ATP8, MT-TL1, MT-TA, MT-TC, MT-TD, MT-TE, MT-TF, MT-TG, MT-TH, MT-TI, MT-TK, MT-TL2, MT-TM, MT-TN, MT-TP, MT-TQ, MT-TR, MT-TS1, MT-TS2, MT-TT, MT-TV, MT-TW, MT-TY, MT-RNR1 and MT-RNR2. Suitably, the MT-ND5 deleterious mtDNA mutation may be a truncating mutation that is in a region selected from: m.12418-12425:A indel or m.12385-12390:C indel. Suitably, the deleterious mtDNA mutation may be a truncation, missense, insertion, or frameshift mutation. As would be clear to a person of skill in the art, any embodiments that relate to sensitising a subject to an immune checkpoint inhibitor (such as PD-1 inhibitor, PD-L1 inhibitor, and/or CTLA4 inhibitor) (including methods or compositions for use in sensitising) equally apply to the methods of treatment (or compositions for use in treatment) described herein unless the context specifically requires otherwise. Throughout the description and claims of this specification, the words “comprise” and “contain” and variations of them mean “including but not limited to”, and they are not intended to (and do not) exclude other moieties, additives, components, integers or steps. Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise. Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith. Various aspects of the invention are described in further detail below. Brief description of the Figures Embodiments of the invention are further described hereinafter with reference to the accompanying drawings, in which: Figure 1. cytoLbNOX mRNA-LNPs sensitise B78-D14 tumours to checkpoint blockade with LNP dose-dependent kinetics. A) Schematic of the experimental plan and dosing regimen for B78-D14 tumours with mRNA LNPs and anti-PD1 monoclonal antibody (mAb). By intratumoural injection, tumours were administered 0.25ug vehicle mRNA-LNP or 0.0025, 0.025 or 0.25µg-1 of cytoLbNOX mRNA-LNP. B) Representative images of harvested tumours at day 18. C) Tumour weights at day 18 (n = 8, 10, 8 and 7 tumours). P values were determined using one-way ANOVA with Fisher’s LSD test. Error bars, s.d. Measure of centrality is mean. Number of replicates are described across conditions from left to right as presented. Figure 2. The activity of cyto- and mitoLbNOX sensitises B78-D14 tumours to checkpoint blockade. A) Schematic of the experimental plan and dosing regimen for B78-D14 tumours with mRNA LNPs and anti-PD1 monoclonal antibody (mAb). By intratumoural injection, tumours were administered 2.5µg of the respective mRNA-LNPs or vehicle. B) Representative images of harvested tumours at day 18. C) Tumour weights at day 18 (n = 9, 7, 8, 7 and 9 tumours). P values were determined using one-way ANOVA with Fisher’s LSD test. Error bars, s.d. Measure of centrality is mean. Number of replicates are described across conditions from left to right as presented. Figure 3. A refractory tumour model demonstrates non-specific sensitization to immune checkpoint blockade (ICB) that is associated with loss of oxygen consumption in models of either mtDNA mutant or LbNOX expressing melanoma. Tumor weights shown at day 13 (n = 11, 11, 12 and 10 anti-PD1; n = 12 anti-PD-L1; and n = 12 anti-CTLA4 individual tumors) for each drug regimen. Figure 4. CytoLbNOX expression in only 1% of subcutaneously injected Hcme12 melanoma cancer cells is sufficient to induce a potent sensitisation to anti-PD1. (A) Cells of the indicated genotypes were administered subcutaneously in the indicated ratios. Once tumours reached 5mmx5mm, at day 7, IP administration of anti-PD1 checkpoint inhibitor started (every 3 days until timed endpoint at day 15). (B) Tumour weights at endpoint of indicated tumour genotypes and admixed ratios. All animals in this graph were administered anti-PD1. Figure 5. Hcme12 melanoma cells expressing cytoLbNOX in a dox-inducible manner show that 5 days cytoLbNOX induction day 0-5 followed by anti-PD1 treatment day 7-13 results in the same level of anti-tumour efficacy as 13-day cytoLbNOX expression together with anti- PD1 treatment at day 7. (A) Tumour weight of dox-inducible cytolbnox Hcmel12 tumours at humane endpoint (15mmx15mm). (B) Survival of animals in (A). The right-hand line shows the survival (%) over time (days) of mice that received doxycycline supplemented food and the left-hand line shows this data for mice that received regular chow food. (C) Experimental design. Dox-inducible cytolbnox Hcmel12 cells were injected. Animals receive either regular chow or doxycycline supplemented food for 5 or 13 days. IP administration of anti-PD1 every 3 days from day 7. (D) Representative tumours taken at endpoint for indicated conditions. (E) Tumour weights in indicated conditions. All animals received anti-PD1. Figure 6. Conservative dose-escalation of cytoLbNOX delivery via intratumoural injection of LNPs induces sensitisation in an aggressive mouse model of ICI-refractory melanoma (B78- D14). (A) Experimental design. B78-D14 amelanotic melanoma cells are implanted, once the tumour reaches 5mmx5mm (day 7), then a single intratumoural injection (ITI) of a range of cytoLbNOX mRNA-LNP dose is administered as indicated. Anti-PD1 is administered every 3 days IP from day 8 until timed endpoint. (B) Representative images of tumours at timed endpoint across indicated conditions. Sloped triangle indicates quantity of mRNA administered via ITI. (C) Tumour weights of indicated conditions at timed endpoint. All animals received anti-PD1. Figure 7. Investigation of higher dose of cytoLbNOX and mitoLbNOX delivery via intratumoural injection. Catalytic mutants of either enzyme are ineffective. Suggestion that mitochondria- targeted LbNOX is superior sensitising agent. Experimental design. B78-D14 amelanotic melanoma cells are implanted, once the tumour reaches 5mmx5mm (day 7), then a single intratumoural injection (ITI) of 2.5ug cytoLbNOX mRNA-LNP is administered as indicated. Anti-PD1 is administered every 3 days IP from day 8 until timed endpoint. (A) Representative images of tumours at timed endpoint across indicated conditions, including transgene-free LNP and LNP delivering mRNA encoding catalytic mutants of both cytosolically targeted and mitochondrially targeted LbNOX. (C) Tumour weights of indicated conditions at timed endpoint. All animals received anti-PD1. Figure 8. The sensitizing effects of LbNOX are observed regardless of the checkpoint inhibitor given. Catalytic mutant (D177A) of the enzyme is delivered as the control. (A) hcmel12 cells were injected subcutaneously. A single ITI of 2.5ug mRNA-LNP was administered as indicated once tumours reached 5mmx5mm (day 7), anti-PD1 was administered IP every 3 days from day 8 until humane endpoint (15mmx15mm tumour caliper measurements). (B) hcmel12 cells were injected subcutaneously. A single ITI of 2.5ug mRNA-LNP was administered as indicated once tumours reached 5mmx5mm (day 7), anti-PD1 and anti-LAG3 were administered IP every 3 days from day 8 until humane endpoint (15mmx15mm tumour caliper measurements). For both (A) and (B), the right-hand line shows survival (%) over time (days) for mice administered mitoLbNOX and the left-hand line shows this data for mice administered mitoLbNOX D177A. Figure 9. Stable genetic models of cytoLbNOX demonstrate increased latency without checkpoint inhibition in orthotopic transplant models of pancreatic and breast cancer. (A) KPC cells of indicated genotypes were injected orthotopically into the mouse pancreas, and tumour formation monitored by ultrasound. Once a 3mm mass could be detected anti-PD1/isotype treatment (twice weekly) was initiated. Both isotype and anti-PD1-treated KPC cyto tumours regressed and were undetectable at endpoint, suggesting that cytoLbNOX has monotherapy efficacy in this model. (B) YEJ2.1g cells of indicated genotypes were injected orthotopically into the mammary fat pad. Animals were culled once humane endpoint (15mmx15mm) was reached. Tumours expressing cytoLbNOX demonstrate increased latency, despite the lack of checkpoint inhibitor administration. These data suggest the potential for monotherapy efficacy in the model. Various aspects of the invention are described in further detail below. Detailed Description The present disclosure is based on the inventors’ identification of a subpopulation of cancer or pre-cancer patients that respond more favourably to treatment with an immune checkpoint inhibitor (such as a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, CTLA4 inhibitor, TIGIT inhibitor, LAG-3 inhibitor, TIM-3 inhibitor, BTLA inhibitor and/or KIR inhibitor). The inventors conclude that these patients have an altered cancer or pre-cancer NAD+:NADH ratio, and therefore an altered cancer or pre-cancer redox status (indicative of Warburg-like metabolic shift). This altered redox status results in a change to the overall tumour microenvironment such that different ratios of immune cells are present within the cancer or pre-cancer. Specifically, the inventors observed that cancers or pre-cancers with an altered redox status, for example altered lactate to glucose ratio have increased numbers of Natural Killer (NK) cells, monocytes, CD4+ NK-like T cells, and interferon-stimulated gene (ISG) expressing immune cells, and decreased numbers of macrophages. Accordingly, in one aspect, the present invention provides a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase for use in sensitising a subject having cancer or pre-cancer to an immune checkpoint inhibitor. In one embodiment, the composition alters the redox status (for example alters the lactate to glucose ratio) of a cancer or a pre-cancer. In one example, the composition alters the redox status (for example alters the lactate to glucose ratio) in the interstitial fluid of the cancer or a pre-cancer. In a related aspect, the present invention provides a method of sensitising a subject having a cancer or a pre-cancer to an immune checkpoint inhibitor, comprising exposing the subject to a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase. In one embodiment, the composition alters the redox status (for example alters the lactate to glucose ratio) of a cancer or a pre-cancer. In one example, the composition alters the redox status (for example alters the lactate to glucose ratio) in the interstitial fluid of the cancer or a pre-cancer. In a further aspect, the invention provides an immune checkpoint inhibitor for use in treating a subject having a cancer or a pre-cancer, wherein the subject has been exposed to a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase. In one embodiment, the composition alters the redox status (for example alters the lactate to glucose ratio) of a cancer or a pre-cancer. In one example, the composition alters the redox status (for example alters the lactate to glucose ratio) in the interstitial fluid of the cancer or a pre-cancer. The invention further provides a method of treating a cancer or a pre-cancer in a subject, comprising administering an immune checkpoint inhibitor to the subject, wherein the subject has been exposed to a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase. In one embodiment, the composition alters the redox status (for example alters the lactate to glucose ratio) of a cancer or a pre-cancer. In one example, the composition alters the redox status (for example alters the lactate to glucose ratio) in the interstitial fluid of the cancer or a pre-cancer. In a further aspect, the invention provides a method of treating a cancer or a pre-cancer in a subject, comprising: (i) exposing the subject to a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase; and (ii) administering an immune checkpoint inhibitor to the subject. In one embodiment, the composition alters the redox status (for example alters the lactate to glucose ratio) of a cancer or a pre-cancer In one example, the composition alters the redox status (for example alters the lactate to glucose ratio) in the interstitial fluid of the cancer or a pre-cancer. As used herein, the term “sensitising”, in the context of a treatment with an immune checkpoint inhibitor, refers to increasing the sensitivity or reducing the resistance of a subject’s cancer or pre-cancer to an immune checkpoint inhibitor treatment. Sensitisation may be of a cancer or pre-cancer that was not sensitive to an immune checkpoint inhibitor treatment prior to the subject being exposed to the composition, or increasing the sensitivity of a cancer or pre- cancer that was sensitive (at least partially) to an immune checkpoint inhibitor treatment prior to the subject being exposed to the composition. A subject (or a subject’s cancer or pre- cancer) that has been sensitised is more likely to respond favourably to, or benefit from, such a treatment. In other words the immune checkpoint inhibitor treatment is likely or expected to have a therapeutic effect on the subject’s cancer or pre-cancer, and/or to improve the therapeutic effect on the subject’s cancer or pre-cancer. Such a therapeutic effect may include a clinical improvement of the cancer or pre-cancer in a subject with this disease or condition. A clinical improvement may be demonstrated by an improvement of the pathology and/or symptoms associated with the cancer or pre-cancer. Suitably, therapeutic effect may be demonstrated by preventing the development of the cancer or pre-cancer in a subject, slowing or halting the progression of the cancer or pre-cancer in the subject, or reversing the cancer or pre-cancer. Suitably, the cancer or pre-cancer may be reversed partially, or completely. Clinical improvement of the pathology may be demonstrated by one or more of the following: reduced cancer or pre-cancer biomarker levels in the subject, reduced cancer or pre-cancer cell number in the subject, increased time to regrowth of cancer upon stopping of treatment, prevention or delay of pre-cancer development into cancer, prevention of regrowth of cancer upon stopping treatment, decreased tumour invasiveness, reduction or complete elimination of metastasis, increased cancer cell differentiation, or increased survival rate. Other suitable indications of clinical improvement in the pathology will be known to the skilled person. It will be appreciated that indications of clinical improvement of the pathology will vary depending on the type of cancer. Clinical improvement of symptoms associated with cancer may be, but are not limited to, partial or complete alleviation of pain and/or swelling, increased appetite, reduced weight loss, and/or reduced fatigue. Suitably, sensitised subjects may have about a 1.25-fold, 1.50-fold, 1.75-fold, 2-fold, 2.25-fold, 2.5-fold, 2.75-fold, 3-fold or more, increased likelihood of a PD-1 inhibitor and/or a PD-L1 inhibitor treatment having a therapeutic effect as compared to subjects that have not been sensitised. As used herein, the term “cancer” refers to a large family of diseases which involve abnormal cell growth with the potential to invade or spread to other parts of the body due to the presence of “cancerous cells”. The cancerous cells may form a subset of neoplasms or tumours. A neoplasm or tumour is a group of cells that have undergone unregulated growth, and will often form a mass or lump, but may be distributed diffusely. The tumour or neoplasm may comprise a mixture of cancerous cells (and/or pre-cancerous cells) and healthy (i.e. non-cancerous) cells. The term “tumour” as used herein, encompasses the cancerous and/or pre-cancerous cells, healthy cells (for example stromal cells), as well as the tumour microenvironment which comprises immune cells and the interstitial fluid. The immune cells in the tumour microenvironment may be refers to as the “immune microenvironment” of the tumour. The term “interstitial fluid” refers to the fluid that occupies the space between the cells (healthy, cancerous, and/or pre-cancers) of the tumour. The interstitial fluid may comprise, metabolites, ions, signalling molecules, proteins, extracellular vesicles, and/or other components secreted by the cells of the tumour and immune cells present therein. As it will be appreciated by the person skilled in the art, a change in the cells of the tumour may lead to change in the interstitial fluid. Merely by way of example, a change in the metabolic status of the cells of the tumour may result in an alteration of the metabolites in the interstitial fluid. As shown by the present inventors, such a change in the metabolic status of the cells of the tumour may alter the tumour microenvironment, for example by altering the immune cell populations within the tumour. “Cancer cells” may be defined by one or more of the following characteristics: reduced differentiation, self-sufficiency in growth signalling, insensitivity to anti-growth signals, evasion of apoptosis, enabling of a limitless replicative potential, induction and sustainment of angiogenesis, and/or activation of metastasis and invasion of tissue. A cancer may be a solid cancer or a liquid cancer. Suitably, a cancer may be selected from the group consisting of: a childhood cancer, haematological cancer, and a myeloid cancer. Suitably, a childhood cancer may be selected from the group consisting of: leukaemia, brain cancer, spinal cord cancer, neuroblastoma, Wilms tumour, lymphoma (such as Hodgkin and non-Hodgkin), rhabdomyosarcoma, retinoblastoma, and bone cancer (such as osteosarcoma and Ewing sarcoma). Suitably, the cancer or pre-cancer may be selected from the group consisting of: leukemia, brain cancer, spinal cord cancer, neuroblastoma, Wilms tumor, lymphoma (such as Hodgkin and non-Hodgkin), rhabdomyosarcoma, retinoblastoma, bone cancer (such as osteosarcoma and Ewing sarcoma), melanoma, pancreatic cancer, prostate cancer, breast cancer and colorectal cancer. Suitably, the cancer may be a skin cancer. Suitably, the skin cancer may be selected from the group consisting of melanoma, basal cell carcinoma, squamous cell carcinoma, Kaposi's sarcoma, and keratoacanthoma. More suitably, the skin cancer may be melanoma. The present application provides examples relating to melanoma. However, the skilled person would appreciate that the aspects of the present invention may apply to other cancers. Nevertheless, the aspects of the present invention may work particularly well in the context of melanoma. As used herein, “pre-cancer” or a “pre-cancerous condition” is an abnormality that has the potential to become cancer (such a cancer mentioned hereinabove), wherein the potential to become cancer is greater than the potential if the abnormality was not present, i.e., was normal. Examples of pre-cancer include but are not limited to adenomas, hyperplasias, metaplasias, dysplasias, benign neoplasias (benign tumours), premalignant carcinoma in situ, and polyps. In one example, the pre-cancer is a pre-cancer tumour. Such a tumour may comprise pre-cancerous and healthy cells. As will be clear to a person skilled in the art, the “cancer” and/or “pre-cancer” may be referred to as “a tumour”. Suitably, in the context of the present disclosure, the cancer or pre-cancer may have a deleterious mitochondrial DNA (mtDNA) mutation load. Typically, in the context of the disclosure, a subject that is more likely to benefit from sensitisation as described herein will have a cancer or pre-cancer with a low deleterious mitochondrial DNA (mtDNA) mutation load. In this context, sensitisation may mimic the metabolic changes seen in subjects with a high deleterious mitochondrial DNA (mtDNA) mutation load. Notwithstanding this, sensitisation as described herein may also be beneficial to subjects with a cancer or pre-cancer having a high deleterious mitochondrial DNA (mtDNA) mutation load (for example to further increase the therapeutic effect of a PD-1 inhibitor and/or PD-L1 inhibitor treatment). Suitably, the cancer or pre-cancer may have a low deleterious mitochondrial DNA (mtDNA) mutation load. In the context of the present disclosure, a low deleterious mitochondrial DNA (mtDNA) mutation load may be a mutation load of less than 50% when determined solely or substantially only on cancer or pre-cancer cells. For example, a low deleterious mitochondrial DNA (mtDNA) mutation load may be a mutation load of less than 40%, or less than 30%, when determined solely or substantially only on cancer or pre-cancer cells. More suitably, a low deleterious mitochondrial DNA (mtDNA) mutation load may be a mutation load of less than 20% when determined solely or substantially only on cancer or pre-cancer cells. Suitably, in the context of the present disclosure, a low deleterious mitochondrial DNA (mtDNA) mutation load may be a mutation load of less than 30%, less than 20%, less than 10%, when determined on a sample from the subject. It will be appreciated by a person skilled in the art that a sample will typically comprise a mixture of cancerous cells (and/or pre-cancerous cells) and healthy cells, found within the tumour. Suitably, the cancer or pre-cancer may have a high deleterious mitochondrial DNA (mtDNA) mutation load. In the context of the present disclosure, a high deleterious mitochondrial DNA (mtDNA) mutation load may be a mutation load of at least 50% or at least 60%, or more, when determined solely or substantially only on cancer or pre-cancer cells. For example, a high deleterious mitochondrial DNA (mtDNA) mutation load may be a mutation load of at least 70%, at least 80% or more, when determined solely or substantially only on cancer or pre-cancer cells. More suitably, a high deleterious mitochondrial DNA (mtDNA) mutation load may be a mutation load of at least at least 60% when determined solely or substantially only on cancer or pre-cancer cells. Suitably, in the context of the present disclosure, a high deleterious mitochondrial DNA (mtDNA) mutation load may be a mutation load of at least 30%, at least 40%, at least 50% or more, when determined on a sample from the subject. It will be appreciated by a person skilled in the art that a sample will typically comprise a mixture of cancerous cells (and/or pre-cancerous cells) and healthy cells, found within the tumour. Suitably, the cancer or pre-cancer may have a high nuclear mutation burden. Such a cancer may be referred to as TMB-H (tumour mutation burden-high) cancer. Suitably, the TBM-H cancer may be a solid cancer. Suitably, the solid cancer may be selected from the group consisting of skin cancer (such as melanoma), lung cancer, liver cancer, kidney cancer, and head and neck cancer. Such cancers are generally found to have better sensitivity to immune checkpoint inhibitors, and the present inventors believe that by treating these cancers with the composition of the invention, the sensitivity to checkpoint inhibitors may be further increased. In fact, cancers with an altered redox status (for example altered lactate to glucose ratio) due to mtDNA mutations were found to completely regress upon treatment with a checkpoint inhibitor (such as anti-PD1 antibody). Suitably, the cancer or pre-cancer may have a high nuclear mutation burden and a high mtDNA mutation load. In the context of the present disclosure, the term “subject” includes humans and mammals (e.g., mice, rats, pigs, cats, dogs, and horses). In suitable embodiments, subjects are mammals, particularly primates, especially humans. In suitable embodiments, subjects are livestock such as cattle, sheep, goats, cows, swine, and the like; poultry such as chickens, ducks, geese, turkeys, and the like; and domesticated animals particularly pets such as dogs and cats. In certain embodiments (e.g., particularly in research contexts) subject mammals will be, for example, rodents (e.g., mice, rats, hamsters), rabbits, primates, or swine such as inbred pigs and the like. Herein, the terms, “patients” and “subjects” may be used interchangeably. Immune checkpoint inhibitors are agents that inhibit proteins or peptides (e.g. immune checkpoint proteins) which are blocking the immune system, e.g., from attacking cancer cells. In some examples, the immune checkpoint protein blocking the immune system prevents the production and/or activation of T cells. An immune checkpoint inhibitor can be an antibody or antigen-binding fragment thereof, a protein, a peptide, a small molecule, or combination thereof. Typically, the inhibitor interacts directly to a target immune checkpoint protein (or its ligand, where appropriate) and thereby disrupts its function/biological activity. For example, it may bind directly to a target immune checkpoint protein (or its ligand, where appropriate). In one example, direct binding to a target immune checkpoint protein (or its ligand, where appropriate) inhibits, prevents or reduces the formation of protein complexes which are needed for immune checkpoint protein function/biological activity. PD-1 inhibitors, PD-L1, and PD-L2 inhibitors are a group of checkpoint inhibitors that block or reduce the activity of PD-1, PD-L1 and PD-L2 immune checkpoint proteins. A review describing immune checkpoint pathways and the blockade of such pathways with immune checkpoint inhibitor compounds is provided by Pardoll in Nature Reviews Cancer (April, 2012). Immune check point inhibitor compounds display anti-tumour activity by blocking one or more of the endogenous immune checkpoint pathways that downregulate an anti-tumour immune response. The inhibition or blockade of an immune checkpoint pathway typically involves inhibiting a checkpoint receptor and ligand interaction with an immune checkpoint inhibitor compound to reduce or eliminate the signal and resulting diminishment of the anti-tumour response. The immune checkpoint inhibitor compound may inhibit the signalling interaction between an immune checkpoint receptor and the corresponding ligand of the immune checkpoint receptor. The immune checkpoint inhibitor compound can act by blocking activation of the immune checkpoint pathway by inhibition (antagonism) of an immune checkpoint receptor (some examples of receptors include CTLA-4, PD-1, and NKG2A) or by inhibition of a ligand of an immune checkpoint receptor (some examples of ligands include PD-L1 and PD-L2). In such examples, the effect of the immune checkpoint inhibitor compound is to reduce or eliminate down regulation of certain aspects of the immune system anti-tumour response in the tumour microenvironment. The immune checkpoint receptor programmed death 1 (PD-1) is expressed by activated T- cells upon extended exposure to antigen. Engagement of PD-1 with its known binding ligands, PD-L1 and PD-L2, occurs primarily within the tumour microenvironment and results in downregulation of anti-tumour specific T-cell responses. Both PD-L1 and PD-L2 are known to be expressed on tumour cells. The expression of PD-L1 and PD-L2 on tumours has been correlated with decreased survival outcomes. Many PD-1 inhibitors and/or PD-L1 inhibitors are known in the art. In some examples, the PD- 1 inhibitor and/or PD-L1 inhibitor is a small organic molecule (molecular weight less than 1000 daltons), a peptide, a polypeptide, a protein, an antibody, an antibody fragment, or an antibody derivative. In some embodiments, the inhibitor compound is an antibody. In some embodiments, the antibody is a monoclonal antibody, specifically a human or a humanized monoclonal antibody. In some examples, the PD-1 inhibitor is an anti-PD-1 antibody or derivative or antigen-binding fragment thereof. In some embodiments, the anti-PD-1 antibody selectively binds a PD-1 protein or fragment thereof. In some embodiments, the anti-PD1 antibody is nivolumab, pembrolizumab, or pidilizumab. In some embodiments, the anti-PD1 antibody is nivolumab. In some examples, the PD-L1 inhibitor is an anti-PDL-1 antibody or derivative or antigen- binding fragment thereof. In some examples, the anti-PD-L1 antibody or derivative or antigen- binding fragment thereof selectively binds a PD-L1 protein or fragment thereof. Examples of anti-PD-L1 antibodies and derivatives and fragments thereof are described in, e.g., WO 01/14556, WO 2007/005874, WO 2009/089149, WO 2011/066389, WO 2012/145493; US 8,217,149, US 8,779,108; US 2012/0039906, US 2013/0034559, US 2014/0044738, and US 2014/0356353. In some embodiments, the anti-PD-L1 antibody is MEDI4736 (durvalumab), MDPL3280A, 2.7A4, AMP-814, MDX-1105, atezolizumab (MPDL3280A), or BMS-936559. In some examples, the anti-PD-L1 antibody is MEDI4736, also known as durvalumab. MEDI4736 is an anti-PD-L1 antibody that is selective for a PD-L1 polypeptide and blocks the binding of PD-L1 to the PD-1 and CD80 receptors. MEDI4736 can relieve PD-L1 -mediated suppression of human T-cell activation in vitro and can further inhibit tumour growth in a xenograft model via a T-cell dependent mechanism. MEDI4736 is further described in, e.g., US 8,779,108. The fragment crystallizable (Fc) domain of MEDI4736 contains a triple mutation in the constant domain of the lgG1 heavy chain that reduces binding to the complement component C1q and the Fey receptors responsible for mediating antibody-dependent cell- mediated cytotoxicity (ADCC). CTLA4 inhibitors are inhibitors that block or reduce the activity of CTLA4. The immune checkpoint receptor cytotoxic T-lymphocyte associated antigen 4 (CTLA4 or CTLA-4) is expressed on T-cells and is involved in signaling pathways that reduce the level of T-cell activation. It is believed that CTLA4 can downregulate T-cell activation through competitive binding and sequestration of CD80 and CD86. In addition, CTLA4 has been shown to be involved in enhancing the immunosuppressive activity of TReg cells. A CTLA4 inhibitor may prevent or reduce binding to CD80 and/or CD86. In some embodiments, a CTLA-4 inhibitor comprises an antibody binding compound, such as an antibody or an antigen-binding fragment thereof. U.S. Pat. Nos. 5,855,887; 5,811,097; 6,682,736; 7,452,535 disclose antibodies specific for human CTLA-4, including antibodies specific for the extracellular domain of CTLA-4 and which are capable of blocking its binding to CD80 or CD86; methods of making such antibodies, and methods of using such antibodies as anti-cancer agents. In some examples, the anti-CTLA-4 antibody is Tremelimumab, Ipilimumab, or Pembrolizumab. TIGIT (T-cell immunoreceptor containing Ig and ITIM domains) belongs to the immunoglobulin superfamily, also known as Wucam, Vstm3 or Vsig9. TIGIT has an extracellular immunoglobulin domain, type I transmembrane domain and two Immune receptor tyrosine inhibition motif (ITIM). TIGIT is mainly distributed in regulatory T cells (Tregs), activated T cells and natural killer cells (NK), etc. It is a co-suppressive receptor protein, which can be combined with the positive proteins CD226 (Dnam-1) and APC on T cells The expressed ligands CD155 (Pvr or Necl-5) and CD112 (Pvrl-2 or Nectin2) constitute a costimulatory network. Among them, TIGIT competes with CD226 to bind CD155 and CD112, and TIGIT binds its ligand with a higher affinity than CD226. The connection between TIGIT and CD155 or CD112 is mediated by its cytoplasmic ITIM or ITT-like motif, recruiting phosphatase SHIP-1 to the tail of TIGIT to trigger inhibitory signaling. In addition, the ITIM domain is also responsible for the inhibitory ability of mouse TIGIT. Suitably, TIGIT inhibitors (such as anti-TIGIT antibodies) can inhibit, reduce, or neutralize one or more activities of TIGIT, for example, result in the blocking or reduction of immune checkpoints on T cells or NK cells, or The immune response is reactivated by adjusting antigen presenting cells. Examples of anti-TIGIT antibodies include Vibostolimab, Etigilimab, Tiragolumab, and Domvanalimab. The term “LAG-3”, “LAG3”, or “Lymphocyte Activation Gene-3” refers to Lymphocyte Activation Gene-3. LAG-3's main ligand is MHC class II, to which it binds with higher affinity than CD4. The protein negatively regulates cellular proliferation, activation, and homeostasis of T cells, in a similar fashion to CTLA-4 and PD-1and has been reported to play a role in Treg suppressive function. LAG3 is known to be involved in the maturation and activation of dendritic cells. A LAG-3 inhibitor can reduce or block the binding of LAG-3 to the MHC class II molecule, and thereby reduce or block its activity. Suitably, the LAG-3 inhibitor may be an anti-LAG-3 antibody, for example Favezelimab or Relatlimab. TIM-3 is an immune checkpoint receptor that suppresses antitumor responses by negatively regulating the activity of CD8 T cells and antigen-presenting cells. A TIM-3 inhibitor may reduce or block the activity of TIM-3. Suitably, the TIM-3 inhibitor may be an anti-TIM-3 antibody, for example, Cobolimab. B and T lymphocyte attenuator (BTLA) is an important co-signaling molecule. It belongs to the CD28 superfamily and is similar to programmed cell death-1 (PD-1) and cytotoxic T lymphocyte associated antigen-4 (CTLA-4) in terms of its structure and function. BTLA can be detected in most lymphocytes and induces immunosuppression by inhibiting B and T cell activation and proliferation. BTLA is found to be expressed in tumor-infiltrating lymphocytes (TILs) and is often associated with impaired anti-tumor immune response. A BTLA inhibitor may reduce or block the activity of BTLA. Such a reduction or blockage may increase B and T cell activation and proliferation. Suitably, the BTLA inhibitor may be an anti-BTLA antibody, for example, Tifcemalimab. Killer immunoglobulin-like receptors (KIRs), are a family of cell surface proteins found on natural killer (NK) cells. They inhibit the killing function of these cells by interacting with MHC class I molecules. KIR inhibitors may reduce or block the activity of KIR. Such a reduction or blockage may increase the killing ability of NK cells. Suitably, a KIR inhibitor may be an anti- KIR antibody, for example, Lirilumab. Suitably, the immune checkpoint inhibitor may be selected from the group consisting of a PD- 1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, CTLA4 inhibitor, TIGIT inhibitor, LAG-3 inhibitor, TIM-3 inhibitor, BTLA inhibitor and KIR inhibitor. Suitably, the immune checkpoint inhibitor may be selected from the group consisting of a PD-1 inhibitor, a PD-L1 inhibitor, and CTLA4 inhibitor Suitably, the immune checkpoint inhibitor may be an antibody. For example, the immune checkpoint inhibitor may be an anti-PD-1 antibody, an anti-PD-L1 antibody, an anti-PD-L2 antibody, an anti-CTLA4 antibody, an anti-TIGIT antibody, an anti-LAG-3 antibody, an anti- TIM-3 antibody, an anti-BTLA antibody, and/or anti-KIR antibody. Monoclonal antibodies, antibody fragments, and antibody derivatives for blocking immune checkpoint pathways can be prepared by any of several methods known to those of ordinary skill in the art, including but not limited to, somatic cell hybridization techniques and hybridoma, methods. Hybridoma generation is described in Antibodies, A Laboratory Manual, Harlow and Lane, 1988, Cold Spring Harbor Publications, New York. Human monoclonal antibodies can be identified and isolated by screening phage display libraries of human immunoglobulin genes by methods described for example in U.S. Patent Nos.5223409, 5403484, 5571698, 6582915, and 6593081. Monoclonal antibodies can be prepared using the general methods described in U.S. Patent No.6331415 (Cabilly). As an example, human monoclonal antibodies can be prepared using a XenoMouse™ (Abgenix, Freemont, CA) or hybridomas of B cells from a XenoMouse. A XenoMouse is a murine host having functional human immunoglobulin genes as described in U.S. Patent No.6162963 (Kucherlapati). Methods for the preparation and use of immune checkpoint antibodies are well known in the art, and merely by way of example, some are described in the following illustrative publications. The preparation and therapeutic uses of anti-CTLA-4 antibodies are described in U.S. Patent Nos. 7229628 (Allison), 7311910 (Linsley), and 8017144 (Korman). The preparation and therapeutic uses of anti-PD-1 antibodies are described in U.S. Patent No. 8008449 (Korman) and U.S. Patent Application No. 2011/0271358 (Freeman). The preparation and therapeutic uses of anti-PD-L1 antibodies are described in U.S. Patent No. 7943743 (Korman). The preparation and therapeutic uses of anti-TIM-3 antibodies are described in U.S. Patent Nos. 8101176 (Kuchroo) and 8552156 (Tagayanagi). The preparation and therapeutic uses of anti-LAG-3 antibodies are described in U.S. Patent Application No. 2011/0150892 (Thudium) and International Publication Number W02014/008218 (Lonberg). The preparation and therapeutic uses of anti-KIR antibodies are described in U.S. Patent No. 8119775 (Moretta). The preparation of antibodies that block BTLA regulated inhibitory pathways (anti-BTLA antibodies) are described in U.S. Patent No. 8563694 (Mataraza).In particular examples, the inhibitor of PD1 and/or PD-L1 may be as described in US8354509B2 and US8900587B2 which are incorporated herein by reference. For example, the immune checkpoint therapy is pembrolizumab (also known as KEYTRUDA). The immune checkpoint inhibitor can be administered in an amount and for a time (e.g., for a particular therapeutic regimen over time) to provide an improvement of the pathology and/or symptoms associated with the cancer or pre-cancer as described herein above. The immune checkpoint inhibitor may be formulated, dosed, and administered in a fashion consistent with good medical practice. Factors for consideration in this context include, the particular subject being treated, the clinical condition of the individual patient, the cause of the disorder, the site of delivery of the agent, the method of administration, the scheduling of administration, and other factors known to medical practitioners. A "therapeutically effective amount" of an immune checkpoint inhibitor to be administered will be governed by such considerations, and is the minimum amount necessary to prevent, ameliorate, or treat, or stabilize, a benign, precancerous, or early stage cancer; or to treat or prevent the occurrence or recurrence of a tumour, a dormant tumour, or a micrometastases, for example, when used as a neoadjuvant. The immune checkpoint inhibitor need not be, but is optionally, formulated with one or more agents currently used to prevent or treat cancer. Suitable routes of administration of an immune checkpoint inhibitor include, without limitation, oral, parenteral, subcutaneous, rectal, transmucosal, intestinal administration, intramuscular, intramedullary, intrathecal, direct intraventricular, intravenous, intravitreal, intraperitoneal, intranasal, or intraocular injections. Alternatively, one may administer an immune checkpoint inhibitor in a local rather than systemic manner, for example, via injection of an immune checkpoint inhibitor directly into a solid tumour, or by topical application (for example to a skin cancer). An immune checkpoint inhibitor may be formulated according to known methods to prepare pharmaceutically useful compositions, whereby the inhibitor is combined in a mixture with a pharmaceutically suitable excipient or carrier. Sterile phosphate-buffered saline is one example of a pharmaceutically suitable excipient. Other suitable excipients are well-known to those in the art. See, for example, Ansel et al, PHARMACEUTICAL DOSAGE FORMS AND DRUG DELIVERY SYSTEMS, 5th Edition (Lea & Febiger 1990), and Gennaro (ed.), REMINGTON'S PHARMACEUTICAL SCIENCES, 18th Edition (Mack Publishing Company 1990), and revised editions thereof. Generally, the dosage of an administered immune checkpoint inhibitor for humans will vary depending upon such factors as the patient's age, weight, height, sex, general medical condition and previous medical history. It may be desirable to provide the subject with a dosage that is in the range of from about 1 mg/kg to 24 mg/kg as a single intravenous infusion, although a lower or higher dosage also may be administered as circumstances dictate. A dosage of 1-20 mg/kg for a 70 kg patient, for example, is 70-1,400 mg, or 41-824 mg/m2 for a 1.7-m patient. The dosage may be repeated as needed, for example, once per week for 4- 10 weeks, once per week for 8 weeks, or once per week for 4 weeks. It may also be given less frequently, such as every other week for several months, or monthly or quarterly for many months, as needed. Generally, the dosage of an administered mRNA-LNPs composition for humans will vary depending upon such factors as the patient's age, weight, height, sex, general medical condition and previous medical history. It may be desirable to provide the subject with a dosage that is at a concentration of 0.0025, 0.025, 0.25 or 2.5µg per tumour, as intratumoral injections. It may be desirable to provide a subject with 10, 20, 30, 40, 50, 100, 150 or 200 µg of the claimed composition via intramuscular administration. Preferably, it may be desirable to provide a subject and/or a tumour with 100 µg of the claimed composition via intramuscular administration. It may be desirable to provide the subject with a dosage that is in the range of from about 1 mg/kg to 24 mg/kg as a single intravenous infusion, although a lower or higher dosage also may be administered as circumstances dictate. A dosage of 1-20 mg/kg for a 70 kg patient, for example, is 70-1,400 mg, or 41-824 mg/m2 for a 1.7-m patient. The dosage may be repeated as needed, for example, once per week for 4-10 weeks, once per week for 8 weeks, or once per week for 4 weeks. It may also be given less frequently, such as every other week for several months, or monthly or quarterly for many months, as needed. For example, the nucleic acid cargo may be present in the pharmaceutical composition in an amount from 1 mg to 10 g, preferably 50 mg to 2 g, in particular 100 mg to 1 g. Usual dosages can also be determined on the basis of kg body weight of the patient, for example preferred dosages are in the range of 0.1 mg to 100 mg/kg body weight, especially 1 to 10 mg/kg body weight (per administration session). The administration may occur e.g. once daily, once every other day, once per week or once every two weeks. Suitably, the immune checkpoint inhibitor may be employed in the use or method as described herein as a sole treatment for cancer or pre-cancer, or in conjunction with a second treatment for cancer or pre-cancer, such as a surgery, radiation, chemotherapy, hormone therapy, or any combination thereof. Suitably, the immune checkpoint inhibitor may be employed as first, second, third, or further, line treatment for cancer or pre-precancer. In some aspects, the invention relates to a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase and its uses in sensitising a subject (their cancer or pre-cancer) to an immune checkpoint inhibitor (for example PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, CTLA4 inhibitor, TIGIT inhibitor, LAG-3 inhibitor, TIM-3 inhibitor, BTLA inhibitor and/or KIR inhibitor). The composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase may alter the redox status (for example alters the NAD+:NADH ratio) in a cancer or a pre-cancer. For example, the composition may alter the lactate to glucose ratio in the interstitial fluid of the cancer or pre-cancer. In order for the composition to alter the redox status (for example alters the lactate to glucose ratio), the cells of the cancer or pre-cancer must be exposed to the composition. In this context, the term “expose” refers to an active step of contacting the cancer or pre-cancer cells with the composition so as to alter the redox status (for example lactate to glucose ratio) and/or providing to a cancer or pre-cancer cell the composition that alters redox status (for example the lactate to glucose ratio). Exposure may be in vitro, in vivo or ex vivo. Upon exposure in vitro or ex vivo, the cells may be introduced (e.g. re-introduced) into the subject with cancer or pre-cancer. The term “redox status” or “metabolic status” as used herein refers to the cytosolic and/or mitochondrial ratio of NAD+:NADH in the cancer or pre-cancer microenvironment, such as the tumour as a whole and/or interstitial fluid of the cancer or pre-cancer (also referred to herein as the interstitial fluid of the tumour). The inventors have found that both decreasing the NAD+:NADH ratio (mtDNA mutation) and/or increasing the NAD+:NADH ratio away from homeostatic levels within cancer and/or pre-cancer cells exerts an immunomodulatory effect on tumours, rendering these more sensitive to immune checkpoint inhibitors. Homeostatic levels in this context may refer to the levels in wild-type (for example non-cancerous cells, and/or cancer cells that do not bear mtDNA mutations). NAD+:NADH ratio is tightly regulated in cells – as the directionality and activity of a huge number of reactions (glycolysis, gluconeogenesis, fatty acid synthesis, DNA repair (PARP is NAD+ dependent) histone acetylation etc) are dependent on it. In the present invention, the composition is provided by exposing the subject to the composition with a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase, for example by transducing or transfecting the cells of the cancer or pre-cancer with a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase. NADH oxidase is an agent that may alter the redox status (for example alters the lactate to glucose ratio) of the cells. The encoded NADH oxidase is an enzyme. Suitably, the enzyme may be an enzyme that increases glucose uptake and/or lactate release. By way of example, the NADH oxidase may be from Lactobacillus brevis. Such an enzyme may be referred to herein as “LbNOX”. The enzyme may suitably be expressed in the cytosol of the cancer or pre-cancer cells. LbNOX expressed in the cytosol may be referred to herein as cytoLbNOX. Alternatively, or additionally, the enzyme may suitably be expressed in the mitochondria of the cancer or pre- cancer cells. LbNOX expressed in the mitochondria may be referred to herein as mitoLbNOX. By comparing bulk tumour metabolite changes of B78-D14 m.12,43680%, Hcmel12 m.12,43680%, and Hcmel12 cytoLbNOX tumours, which did not show any changes in common metabolites, the inventors believe that, surprisingly, an altered redox status (for example altered cellular redox state of the cancer and/or pre-cancer) irrespective of direction, and not gross metabolite abundance change is sufficient to alter the tumour immune microenvironment and sensitise the cancer or pre-cancer to a treatment with an immune checkpoint inhibitor. In this context, “irrespective of direction” may refer to the changes in direction of the NAD+:NADH ratios. Suitably, the composition (comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase, for example cytoLbNOX and/or mitoLbNOX) may be for use in combination with a tumour-associated neutrophil reducing compound. A tumour-associated neutrophil reducing compound is a compound that decreases the number of tumour resident neutrophils within a tumour. Herein tumour resident neutrophils may also be referred to as tumour-associated neutrophils. The reduction may be, for example, by blocking tumour resident neutrophil infiltration into the tumour, by reducing the number of neutrophils in the subject (for example by killing and/or blocking the production/maturation of neutrophils), or both. Killing of the neutrophils may be by antibody-dependent cell-mediated cytotoxicity (ADCC). Compounds that may reduce tumour resident neutrophils include for example anti- Ly6G antibody, anti-GR1 antibody, and/or other antibodies that are specific to certain neutrophil antigens (such as antibodies that are specific to the human neutrophil antigens (HNAs), selected from the group consisting of HNA-1a, HNA-1b, and HNA-1c). These antibodies can be used to identify and deplete neutrophils that express these antigens. The term “altered” as used herein refers to a change, which may be an increase or a decrease, relative to a reference value. Suitably, the composition described herein may alter the NAD+:NADH ratio in a cancer or a pre-cancer. As mentioned elsewhere herein, the alteration may be an increase or a decrease in the NAD+:NADH ratio. Suitably, the composition described herein may increase the lactate to glucose ratio in a cancer or a pre-cancer. Suitably, the composition may increase the lactate to glucose ratio in the tumour to above 2.5:1, 3:1, 3.5:1, 4:1 or more. Suitably, the composition described herein may increase the lactate to glucose ratio in the interstitial fluid of a cancer or a pre-cancer. Suitably, the composition may increase the lactate to glucose ratio in the interstitial fluid of the tumour to above 2.5:1, 3:1, 3.5:1, 4:1 or more. The term "increased" or "increase" as used herein generally means a difference between the relevant level (metabolite, mutation load etc) and a suitable corresponding reference value, that is at least about 10% greater than the reference value, for example at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% greater than the reference value. The term “decrease” or “decreased” as used herein, generally means a difference between the relevant level (metabolite, mutation load etc) and a suitable corresponding reference value that is at a reduction of least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% etc than the reference value. In the context of a composition that alters the lactate to glucose ratio, as used herein, the “reference value” may be the corresponding parameter (such as an NAD+:NADH ratio, or an lactate to glucose ratio) of a cancer or a pre-cancer prior to the cancer or pre-cancer being exposed to the composition. Many compositions that alter redox status (for example alter the lactate to glucose ratio) of a cancer or a pre-cancer are known in the art. Additionally, methods of determining the level of lactate and glucose are known in the art and may be used as a matter of routine (see for example Cengiz et al.2009 doi: 10.1089/dia.2009.0002; and Spahar- Deleze et al.2021 doi: 10.3390/chemosensors9080195). Assays for measuring NAD+:NADH ratio are also widely known in the art. The composition may be used as a pre-treatment. In this context, the composition may be considered as a neoadjuvant. The composition may be provided prior to, or simultaneously with, the immune checkpoint inhibitor (such as PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, CTLA4 inhibitor, TIGIT inhibitor, LAG-3 inhibitor, TIM-3 inhibitor, BTLA inhibitor and/or KIR inhibitor). The composition may be formulated as appropriate. For example, the composition may be an infusion. As used herein, “infusion” refers to a solution, emulsion or suspension. In one example, the composition may be injected into the cancer or pre-cancer. Typically, the composition is composition is a cell permeable compound or a pre-cursor thereof. The composition may be in the form of a pharmaceutical composition. The pharmaceutical composition may further comprise a pharmaceutically acceptable diluent, carrier or excipient. Such compositions may further routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, supplementary immune potentiating agents such as adjuvants and cytokines and optionally other therapeutic agents. The compositions may also include antioxidants and/or preservatives. As antioxidants may be mentioned thiol derivatives (e.g. thioglycerol, cysteine, acetylcysteine, cystine, dithioerythreitol, dithiothreitol, glutathione), tocopherols, butylated hydroxyanisole, butylated hydroxytoluene, sulfurous acid salts (e.g. sodium sulfate, sodium bisulfite, acetone sodium bisulfite, sodium metabisulfite, sodium sulfite, sodium formaldehyde sulfoxylate, sodium thiosulfate) and nordihydroguaiareticacid. Suitable preservatives may for instance be phenol, chlorobutanol, benzylalcohol, methyl paraben, propyl paraben, benzalkonium chloride and cetylpyridinium chloride. The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings or animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio. It will be appreciated that the pharmaceutical compositions described above may be suitable for use in treating cancer or precancer, and particularly those various forms of cancer described herein. The composition may be for administration to the subject by any suitable route by which a therapeutically effective amount of the composition may be provided. The term “nucleic acid cargo” herein means a nucleic acid molecule associated with the lipid nanoparticle (LNP). The nucleic acid cargo may be carried in or upon the LNP, for example carried internally or externally of the LNP. In some embodiments, the composition comprises a lipid nanoparticle (LNP) encapsulating a nucleic acid cargo encoding NADH oxidase. The nucleic acid molecule (nucleic acid cargo) may be DNA, RNA or any other form of nucleic acid. The inventive LNPs are particularly suitable for RNA cargo. Accordingly, in one embodiment, the nucleic acid cargo comprises at least one (therapeutic) RNA. Suitably, the nucleic acid cargo may be a ribonucleic acid (RNA). The RNA may have a CMV promoter. The RNA may have a 110-120 polyA tail. The RNA may be pseudoU modified. Suitably, the nucleic acid cargo may be a messenger ribonucleic acid (mRNA). The mRNA may be a therapeutic mRNA. The mRNA may be codon-optimized. The nucleic acid cargo encodes NADH oxidase. NADH oxidase is an enzyme. Suitably, the NADH oxidase is from Lactobacillus brevis, Lactococcus lactis, Streptococcus pneumoniae, Streptococcus mutans or Serpulina hyodysenteriae. Such an enzyme from Lactobacillus brevis may be referred to herein as “LbNOX”. Such an enzyme from Lactococcus lactis may be referred to herein as “LlNOX”. Such an enzyme from Streptococcus pneumoniae may be referred to herein as “SpNOX”. Such an enzyme from Streptococcus mutans may be referred to herein as “SmNOX”. Such an enzyme from Serpulina hyodysenteriae may be referred to herein as “ShNOX”. Examples of suitable NADH oxidase enzymes are discussed in Titov, Denis V et al. “Complementation of mitochondrial electron transport chain by manipulation of the NAD+/NADH ratio.” Science (New York, N.Y.) vol. 352,6282 (2016): 231-5. (doi:10.1126/science.aad4017) (which is hereby incorporated by reference in its entirety). The supplementary material of this paper (e.g. Figure S1) provides evidence of the activity and the sequences for NADH oxidases from several bacterial species. Preferably, the NADH oxidase is from Lactobacillus brevis. The enzyme may suitably be expressed in the cytosol of the cancer or pre-cancer cells. LbNOX expressed in the cytosol may be referred to herein as cytoLbNOX. Alternatively, or additionally, the enzyme may suitably be expressed in the mitochondria of the cancer or pre-cancer cells. LbNOX expressed in the mitochondria may be referred to herein as mitoLbNOX. In some embodiments, the enzyme may be selected from the group consisting of cytoLbNOX and mitoLbNOX. Suitably, the mRNA may comprise a) SEQ ID NO: 1 or b) SEQ ID NO: 2. Suitably, the mRNA may comprise a) SEQ ID NO: 3 or b) SEQ ID NO: 4. Suitably, the mRNA may comprise the nucleic acid sequence of SEQ ID NO: 1. SEQ ID NO: 1 encodes the cytoLbNOX enzyme. AUGAAGGUCACCGUGGUCGGAUGCACCCAUGCCGGCACCUUCGCCAUCAAGCAAAU CCUCGCUGAGCACCCUGACGCCGAGGUCACCGUCUACGAGAGGAACGAUGUGAUCU CCUUCCUGUCCUGUGGCAUCGCCCUCUACCUGGGCGGAAAAGUGGCCGAUCCCCAA GGCCUCUUCUACAGCUCCCCUGAAGAACUGCAGAAGCUGGGCGCUAAUGUGCAGAU GAACCACAACGUGCUGGCCAUCGACCCUGACCAAAAGACCGUCACAGUCGAGGACCU CACCAAUCACGCCCAGACCACCGAGUCCUACGACAAACUGGUGAUGACCUCCGGAAG CUGGCCUAUCGUGCCCAAAAUCCCCGGCAUCGACAGCGAUAGGGUGAAGCUCUGCA AGAAUUGGGCCCACGCCCAGGCUCUGAUUGAGGACGCCAAGGAGGCCAAGAGGAUC ACCGUCAUCGGCGCCGGAUACAUCGGAGCCGAACUGGCCGAGGCCUACUCCACAAC AGGCCACGACGUCACCCUGAUUGACGCCAUGGCUAGGGUCAUGCCCAAGUACUUCG AUGCCGACUUCACCGACGUCAUCGAACAGGACUACAGGGACCAUGGCGUGCAACUC GCUCUGGGCGAGACAGUGGAGAGCUUCACCGACAGCGCCACCGGCCUCACAAUCAA GACAGACAAGAACUCCUAUGAGACCGACCUGGCCAUCCUCUGCAUUGGCUUUAGGC CCAACACAGACCUGCUGAAAGGCAAAGUGGACAUGGCCCCUAACGGCGCCAUCAUUA CCGACGACUACAUGAGGUCCAGCAACCCUGAUAUUUUCGCUGCUGGCGACUCCGCC GCCGUCCAUUACAACCCCACACACCAAAACGCCUACAUUCCCCUCGCUACCAACGCC GUCAGGCAGGGAAUCCUCGUCGGAAAGAACCUCGUCAAGCCCACAGUGAAGUACAU GGGAACCCAGUCCAGCUCCGGACUGGCCCUCUAUGACAGGACAAUUGUCUCCACAG GCCUCACACUGGCCGCCGCCAAGCAACAAGGCCUCAAUGCCGAGCAGGUCAUCGUG GAGGACAACUAUAGGCCCGAGUUCAUGCCUUCCACCGAGCCCGUCCUCAUGAGCCU GGUCUUCGACCCCGAUACACACAGAAUCCUGGGAGGCGCCCUGAUGUCCAAAUACG ACGUGUCCCAGAGCGCUAAUACCCUGUCCGUCUGCAUCCAGAACGAGAACACCAUCG AUGACCUGGCCAUGGUGGACAUGCUGUUCCAGCCCAAUUUCGACAGGCCCUUCAAC UACCUGAACAUUCUCGCCCAGGCUGCCCAAGCUAAAGUGGCCCAAUCCGUCAACGCU GGUGGAUCUGGUGGAUCUGGUGGAUCUAUG (SEQ ID NO: 1). Suitably, the mRNA may comprise the nucleic acid sequence of SEQ ID NO: 2. SEQ ID NO: 2 encodes the mitoLbNOX enzyme. AUGCUCGCUACAAGGGUCUUUAGCCUCGUCGGAAAGAGAGCUAUCAGCACCUCCGU CUGCGUGAGAGCUCAUAAGGUCACCGUGGUCGGAUGCACCCAUGCCGGCACCUUCG CCAUCAAGCAAAUCCUCGCUGAGCACCCUGACGCCGAGGUCACCGUCUACGAGAGG AACGAUGUGAUCUCCUUCCUGUCCUGUGGCAUCGCCCUCUACCUGGGCGGAAAAGU GGCCGAUCCCCAAGGCCUCUUCUACAGCUCCCCUGAAGAACUGCAGAAGCUGGGCG CUAAUGUGCAGAUGAACCACAACGUGCUGGCCAUCGACCCUGACCAAAAGACCGUCA CAGUCGAGGACCUCACCAAUCACGCCCAGACCACCGAGUCCUACGACAAACUGGUGA UGACCUCCGGAAGCUGGCCUAUCGUGCCCAAAAUCCCCGGCAUCGACAGCGAUAGG GUGAAGCUCUGCAAGAAUUGGGCCCACGCCCAGGCUCUGAUUGAGGACGCCAAGGA GGCCAAGAGGAUCACCGUCAUCGGCGCCGGAUACAUCGGAGCCGAACUGGCCGAGG CCUACUCCACAACAGGCCACGACGUCACCCUGAUUGACGCCAUGGCUAGGGUCAUG CCCAAGUACUUCGAUGCCGACUUCACCGACGUCAUCGAACAGGACUACAGGGACCAU GGCGUGCAACUCGCUCUGGGCGAGACAGUGGAGAGCUUCACCGACAGCGCCACCGG CCUCACAAUCAAGACAGACAAGAACUCCUAUGAGACCGACCUGGCCAUCCUCUGCAU UGGCUUUAGGCCCAACACAGACCUGCUGAAAGGCAAAGUGGACAUGGCCCCUAACG GCGCCAUCAUUACCGACGACUACAUGAGGUCCAGCAACCCUGAUAUUUUCGCUGCU GGCGACUCCGCCGCCGUCCAUUACAACCCCACACACCAAAACGCCUACAUUCCCCUC GCUACCAACGCCGUCAGGCAGGGAAUCCUCGUCGGAAAGAACCUCGUCAAGCCCAC AGUGAAGUACAUGGGAACCCAGUCCAGCUCCGGACUGGCCCUCUAUGACAGGACAA UUGUCUCCACAGGCCUCACACUGGCCGCCGCCAAGCAACAAGGCCUCAAUGCCGAG CAGGUCAUCGUGGAGGACAACUAUAGGCCCGAGUUCAUGCCUUCCACCGAGCCCGU CCUCAUGAGCCUGGUCUUCGACCCCGAUACACACAGAAUCCUGGGAGGCGCCCUGA UGUCCAAAUACGACGUGUCCCAGAGCGCUAAUACCCUGUCCGUCUGCAUCCAGAAC GAGAACACCAUCGAUGACCUGGCCAUGGUGGACAUGCUGUUCCAGCCCAAUUUCGA CAGGCCCUUCAACUACCUGAACAUUCUCGCCCAGGCUGCCCAAGCUAAAGUGGCCCA AUCCGUCAACGCUGGUGGAUCUGGUGGAUCUGGUGGAUCUAUG (SEQ ID NO: 2). Suitably, the mRNA may comprise the nucleic acid sequence of SEQ ID NO: 3. SEQ ID NO: 3 encodes the full cytoLbNOX enzyme with tags. AUGAAGGUCACCGUGGUCGGAUGCACCCAUGCCGGCACCUUCGCCAUCAAGCAAAU CCUCGCUGAGCACCCUGACGCCGAGGUCACCGUCUACGAGAGGAACGAUGUGAUCU CCUUCCUGUCCUGUGGCAUCGCCCUCUACCUGGGCGGAAAAGUGGCCGAUCCCCAA GGCCUCUUCUACAGCUCCCCUGAAGAACUGCAGAAGCUGGGCGCUAAUGUGCAGAU GAACCACAACGUGCUGGCCAUCGACCCUGACCAAAAGACCGUCACAGUCGAGGACCU CACCAAUCACGCCCAGACCACCGAGUCCUACGACAAACUGGUGAUGACCUCCGGAAG CUGGCCUAUCGUGCCCAAAAUCCCCGGCAUCGACAGCGAUAGGGUGAAGCUCUGCA AGAAUUGGGCCCACGCCCAGGCUCUGAUUGAGGACGCCAAGGAGGCCAAGAGGAUC ACCGUCAUCGGCGCCGGAUACAUCGGAGCCGAACUGGCCGAGGCCUACUCCACAAC AGGCCACGACGUCACCCUGAUUGACGCCAUGGCUAGGGUCAUGCCCAAGUACUUCG AUGCCGACUUCACCGACGUCAUCGAACAGGACUACAGGGACCAUGGCGUGCAACUC GCUCUGGGCGAGACAGUGGAGAGCUUCACCGACAGCGCCACCGGCCUCACAAUCAA GACAGACAAGAACUCCUAUGAGACCGACCUGGCCAUCCUCUGCAUUGGCUUUAGGC CCAACACAGACCUGCUGAAAGGCAAAGUGGACAUGGCCCCUAACGGCGCCAUCAUUA CCGACGACUACAUGAGGUCCAGCAACCCUGAUAUUUUCGCUGCUGGCGACUCCGCC GCCGUCCAUUACAACCCCACACACCAAAACGCCUACAUUCCCCUCGCUACCAACGCC GUCAGGCAGGGAAUCCUCGUCGGAAAGAACCUCGUCAAGCCCACAGUGAAGUACAU GGGAACCCAGUCCAGCUCCGGACUGGCCCUCUAUGACAGGACAAUUGUCUCCACAG GCCUCACACUGGCCGCCGCCAAGCAACAAGGCCUCAAUGCCGAGCAGGUCAUCGUG GAGGACAACUAUAGGCCCGAGUUCAUGCCUUCCACCGAGCCCGUCCUCAUGAGCCU GGUCUUCGACCCCGAUACACACAGAAUCCUGGGAGGCGCCCUGAUGUCCAAAUACG ACGUGUCCCAGAGCGCUAAUACCCUGUCCGUCUGCAUCCAGAACGAGAACACCAUCG AUGACCUGGCCAUGGUGGACAUGCUGUUCCAGCCCAAUUUCGACAGGCCCUUCAAC UACCUGAACAUUCUCGCCCAGGCUGCCCAAGCUAAAGUGGCCCAAUCCGUCAACGCU GGUGGAUCUGGUGGAUCUGGUGGAUCUAUGUACCCUUACGACGUGCCAGACUACGC UGGCAGCGGCGAGGGCAGGGGCAGCCUGCUGACCUGCGGCGACGUGGAGGAGAAC CCCGGCCCCAUGGAUAGCACCGAGGCAGUGAUCAAGGAGUUCAUGCGGUUCAAGGU GCACAUGGAGGGCUCCAUGAACGGCCACGAGUUCGAGAUCGAGGGCGAGGGCGAG GGCCGCCCCUACGAGGGCACCCAGACCGCCAAGCUGAGGGUGACCAAGGGUGGCCC CCUGCCCUUCUCCUGGGACAUCCUGUCCCCUCAGUUCAUGUACGGCUCCAGGGCCU UCACGAAGCACCCCGCCGACAUCCCCGACUACUGGAAGCAGUCCUUCCCCGAGGGC UUCAAGUGGGAGCGCGUGAUGAACUUCGAGGACGGCGGCGCCGUGUCCGUGGCCC AGGACACCUCCCUGGAGGACGGCACCCUGAUCUACAAGGUGAAGCUCCGCGGCACC AACUUCCCUCCUGACGGCCCCGUAAUGCAGAAGAAGACAAUGGGCUGGGAAGCAUC CACCGAGCGGUUGUACCCCGAGGACGUCGUGCUGAAGGGCGACAUUAAGAUGGCCC UGCGCCUGAAGGACGGCGGCCGCUACCUGGCGGACUUCAAGACCACCUACAGGGCC AAGAAGCCCGUGCAGAUGCCCGGCGCCUUCAACAUCGACCGCAAGUUGGACAUCAC AUCCCACAACGAGGACUACACCGUGGUGGAACAGUACGAACGCUCCGUGGCCCGCC ACUCCACCGGCGGCUCCGGUGGCUCCGGCAAACCGAUUCCGAACCCGCUGCUGGGC CUGGAUAGCACCUAA (SEQ ID NO: 3). Suitably, the mRNA may comprise the nucleic acid sequence of SEQ ID NO: 4. SEQ ID NO: 4 encodes the full mitoLbNOX enzyme with tags. AUGCUCGCUACAAGGGUCUUUAGCCUCGUCGGAAAGAGAGCUAUCAGCACCUCCGU CUGCGUGAGAGCUCAUAAGGUCACCGUGGUCGGAUGCACCCAUGCCGGCACCUUCG CCAUCAAGCAAAUCCUCGCUGAGCACCCUGACGCCGAGGUCACCGUCUACGAGAGG AACGAUGUGAUCUCCUUCCUGUCCUGUGGCAUCGCCCUCUACCUGGGCGGAAAAGU GGCCGAUCCCCAAGGCCUCUUCUACAGCUCCCCUGAAGAACUGCAGAAGCUGGGCG CUAAUGUGCAGAUGAACCACAACGUGCUGGCCAUCGACCCUGACCAAAAGACCGUCA CAGUCGAGGACCUCACCAAUCACGCCCAGACCACCGAGUCCUACGACAAACUGGUGA UGACCUCCGGAAGCUGGCCUAUCGUGCCCAAAAUCCCCGGCAUCGACAGCGAUAGG GUGAAGCUCUGCAAGAAUUGGGCCCACGCCCAGGCUCUGAUUGAGGACGCCAAGGA GGCCAAGAGGAUCACCGUCAUCGGCGCCGGAUACAUCGGAGCCGAACUGGCCGAGG CCUACUCCACAACAGGCCACGACGUCACCCUGAUUGACGCCAUGGCUAGGGUCAUG CCCAAGUACUUCGAUGCCGACUUCACCGACGUCAUCGAACAGGACUACAGGGACCAU GGCGUGCAACUCGCUCUGGGCGAGACAGUGGAGAGCUUCACCGACAGCGCCACCGG CCUCACAAUCAAGACAGACAAGAACUCCUAUGAGACCGACCUGGCCAUCCUCUGCAU UGGCUUUAGGCCCAACACAGACCUGCUGAAAGGCAAAGUGGACAUGGCCCCUAACG GCGCCAUCAUUACCGACGACUACAUGAGGUCCAGCAACCCUGAUAUUUUCGCUGCU GGCGACUCCGCCGCCGUCCAUUACAACCCCACACACCAAAACGCCUACAUUCCCCUC GCUACCAACGCCGUCAGGCAGGGAAUCCUCGUCGGAAAGAACCUCGUCAAGCCCAC AGUGAAGUACAUGGGAACCCAGUCCAGCUCCGGACUGGCCCUCUAUGACAGGACAA UUGUCUCCACAGGCCUCACACUGGCCGCCGCCAAGCAACAAGGCCUCAAUGCCGAG CAGGUCAUCGUGGAGGACAACUAUAGGCCCGAGUUCAUGCCUUCCACCGAGCCCGU CCUCAUGAGCCUGGUCUUCGACCCCGAUACACACAGAAUCCUGGGAGGCGCCCUGA UGUCCAAAUACGACGUGUCCCAGAGCGCUAAUACCCUGUCCGUCUGCAUCCAGAAC GAGAACACCAUCGAUGACCUGGCCAUGGUGGACAUGCUGUUCCAGCCCAAUUUCGA CAGGCCCUUCAACUACCUGAACAUUCUCGCCCAGGCUGCCCAAGCUAAAGUGGCCCA AUCCGUCAACGCUGGUGGAUCUGGUGGAUCUGGUGGAUCUAUGUACCCUUACGACG UGCCAGACUACGCUGGCAGCGGCGAGGGCAGGGGCAGCCUGCUGACCUGCGGCGA CGUGGAGGAGAACCCCGGCCCCAUGGAUAGCACCGAGGCAGUGAUCAAGGAGUUCA UGCGGUUCAAGGUGCACAUGGAGGGCUCCAUGAACGGCCACGAGUUCGAGAUCGAG GGCGAGGGCGAGGGCCGCCCCUACGAGGGCACCCAGACCGCCAAGCUGAGGGUGA CCAAGGGUGGCCCCCUGCCCUUCUCCUGGGACAUCCUGUCCCCUCAGUUCAUGUAC GGCUCCAGGGCCUUCACGAAGCACCCCGCCGACAUCCCCGACUACUGGAAGCAGUC CUUCCCCGAGGGCUUCAAGUGGGAGCGCGUGAUGAACUUCGAGGACGGCGGCGCC GUGUCCGUGGCCCAGGACACCUCCCUGGAGGACGGCACCCUGAUCUACAAGGUGAA GCUCCGCGGCACCAACUUCCCUCCUGACGGCCCCGUAAUGCAGAAGAAGACAAUGG GCUGGGAAGCAUCCACCGAGCGGUUGUACCCCGAGGACGUCGUGCUGAAGGGCGAC AUUAAGAUGGCCCUGCGCCUGAAGGACGGCGGCCGCUACCUGGCGGACUUCAAGAC CACCUACAGGGCCAAGAAGCCCGUGCAGAUGCCCGGCGCCUUCAACAUCGACCGCA AGUUGGACAUCACAUCCCACAACGAGGACUACACCGUGGUGGAACAGUACGAACGCU CCGUGGCCCGCCACUCCACCGGCGGCUCCGGUGGCUCCGGCAAACCGAUUCCGAAC CCGCUGCUGGGCCUGGAUAGCACCUAA (SEQ ID NO: 4). Suitably the LNP may comprise: a) component A wherein component A is a cationic lipid; b) component B wherein component B is a sterol; c) component C wherein component C is a phosphatidylcholine; and d) component D wherein component D is a PEGylated lipid. Suitably the LNP may consist of: a) component A wherein component A is a cationic lipid; b) component B wherein component B is a sterol; c) component C wherein component C is a phosphatidylcholine; and d) component D wherein component D is a PEGylated lipid. Suitably, the phosphatidylcholine may be selected from the group consisting of 1,2- dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1-oleoyl-2-palmitoyl-sn-glycero-3- phosphocholine (OPPC), 1,2-didecanoyl-sn-glycero-3-phosphocholine (DDPC), 1,2- dierucoyl-sn-glycero-3-phosphocholine (DEPC), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLOPC), 1,2-dilauroyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-3- phosphocholine (DMPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1-myristoyl-2- palmitoyl-sn-glycero-3-phosphocholine (MPPC), 1-myristoyl-2-stearoyl-sn-glycero-3- phosphocholine (MSPC), 1-palmitoyl-2-myristoyl-sn-3-phosphocholine (PMPC), 1-palmitoyl- 2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1-palmitoyl-2-stearoyl-sn-glycero-3- phosphocholine (PSPC), 1-stearoyl-2-myristoyl- sn-glycero-3-phosphocholine (SMPC), 1- stearoyl-2-oleoyl-sn-glycero-3-phosphocholine (SOPC), 1-stearoyl-2-palmitoyl-sn-glycero-3- phosphocholine (SPPC), egg phosphatidylcho-line (EPC), soy PC, hydro soy PC (HSPC), brain PC, heart PC, liver PC, or any combination thereof. Suitably, the phosphatidylcholine may be 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). Suitably the cationic lipid may be 6-((2-hexyldecanoyl)oxy)-N-(6-((2- hexyldecanoyl)oxy)hexyl)-N-(4-hydroxybutyl)hexan-1-aminium (ALC-0315), 1,2-dioleoyl-3- trimethylammonium propane (DOTAP), N-[1-(2,3-dioleyloxy)propyl]-N,N,N- trimethylammonium chloride (DOTMA), 1,2-dioleyloxy-3-dimethylaminopropane (DODMA), 1,2-dioleoyl-3-dimethylaminopropane (DODAP), 1,2-dilinoleyloxy-3-(N,N- dimethyl)aminopropane (DLinDMA), heptadecan-9-yl 8-(2-hydroxyethyl)[6-oxo-6- (undecyloxy)hexyl]amino octanoate (SM-102) or any combination thereof. Alternatively or in addition, suitably the cationic lipid may be [(4-hydroxybutyl)azanediyl]di(hexane-6,1-diyl) bis(2-hexyldecanoate) (ALC-0315), heptadecan-9-yl 8-{(2-hydroxyethyl)[6-oxo-6- (undecyloxy)hexyl]amino}octanoate (SM-102),3-(didodecylamino)-N1,N1,4-tridodecyl-1- piperazineethanamine (KL10), N1-[2-(didodecylamino)ethyl] N1,N4,N4-tridodecyl-1,4- piperazinediethanamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-octatriacontane (KL25), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4- dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl- 4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2 dimethylaminoethyl)-[1,3]- dioxolane (DLin-KC2-DMA), 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), 2-({8 [(3β)- cholest-5-en-3-yloxy]octyl}oxy) N,N dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan- 1-amine (Octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3- [(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (Octyl-CLinDMA (2R)), (2S) 2-({8- [(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1- yloxy]propan-1-amine (Octyl-CLinDMA (2S)) or mixtures thereof. Alternatively, or in addition the cationic lipid may be (20Z,23Z)-N,N-dimethylnonacosa-20,23-dien-10-amine, (17Z,20Z)- N,N-dimemylhexacosa-17,20-dien-9-amine, (1Z,19Z)-N5N-dimethylpentacosa-16, 19-dien-8- amine, (13Z,16Z)-N,N-dimethyldocosa-13,16-dien-5-amine, (12Z,15Z)-N,N dimethylhenicosa-12,15-dien-4-amine, (14Z,17Z)-N,N-dimethyltricosa-14,17-dien-6-amine, (15Z,18Z)-N,N-dimethyltetracosa-15,18-dien-7-amine, (18Z,21Z)-N,N-dimethylheptacosa- 18,21-dien-10-amine, (15Z,18Z)-N,N-dimethyltetracosa-15,18-dien-5-amine, (14Z,17Z)-N,N- dimethyltricosa-14,17-dien-4-amine, (19Z,22Z)-N,N-dimeihyloctacosa-19,22-dien-9-amine, (18Z,21Z)-N,N-dimethylheptacosa-18,21-dien-8-amine, (17Z,20Z)-N,N-dimethylhexacosa- 17,20-dien-7-amine, (16Z,19Z)-N,N-dimethylpentacosa-16,19-dien-6-amine, (22Z,25Z)-N,N- dimethylhentriaconta-22,25-dien-10-amine, (21Z,24Z)-N,N-dimethyltriaconta-21,24-dien-9- amine, (18Z)-N,N-dimetylheptacos-18-en-10-amine, (17Z)-N,N-dimethylhexacos-17-en-9- amine, (19Z,22Z)-N,N-dimethyloctacosa-19,22-dien-7-amine, N,N-dimethylheptacosan-10- amine, (20Z,23Z)-N-ethyl-N-methylnonacosa-20,23-dien-10-amine, 1-[(11Z,14Z)-1- nonylicosa-11,14-dien-1-yl]pyrrolidine, (20Z)-N,N-dimethylheptacos-20-en-10-amine, (15Z)- N,N-dimethyl eptacos-15-en-10-amine, (14Z)-N,N-dimethylnonacos-14-en-10-amine, (17Z)- N,N-dimethylnonacos-17-en-10-amine, (24Z)-N,N-dimethyltritriacont-24-en-10-amine, (20Z)- N,N-dimethylnonacos-20-en-10-amine, (22Z)-N,N-dimethylhentriacont-22-en-10-amine, (16Z)-N,N-dimethylpentacos-16-en-8-amine, (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa- 12,15-dien-1-amine, (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16-dien-1-amine, N,N- dimethyl-1-[(1S,2R)-2-octylcyclopropyl] eptadecan-8-amine, 1-[(1S,2R)-2-hexylcyclopropyl]- N,N-dimethylnonadecan-10-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]nonadecan- 10-amine, N,N-dimethyl-21-[(1S,2R)-2-octylcyclopropyl]henicosan-10-amine,N,N-dimethyl-1- [(1S,2S)-2-1[(1R,2R)-2-pentylcyciopropyl]methyl}cyclopropyl]nonadecan-10-amine,N,N- dimethyl-1-[(1S,2R)-2-octylcyclopropyl]hexadecan-8-amine, N,N-dimethyl-[(1R,2S)- 2undecyIcyclopropyl]tetradecan-5-amine, N,N-dimethyl-3-{7-[(1S,2R)-2- octylcyclopropyl]heptyl} dodecan-1-amine, 1-[(1R,2S)-2-heptylcyclopropyl]-N,N- dimethyloctadecan-9-amine, 1-[(1S,2R)-2-decylcyclopropyl]-N,N-dimethylpentadecan-6- amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]pentadecan-8-amine, R-N,N-dimethyl-1- [(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-(octyloxy)propan-2-amine, S-N,N-dimethyl-1- [(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-(octyloxy)propan-2-amine, 1-{2-[(9Z,12Z)-octadeca- 9,12-dien-1-yloxy]-1-[(octyloxy)methyl]ethyl}pyrrolidine, (2 S)-N,N-dimethyl-1-[(9Z,12Z)- octadeca-9,12-dien-1-yloxy]-3-[(5Z)-oct-5-en-1-yloxy]propan-2-amine, 1-{2-[(9Z,12Z)- octadeca-9,12-dien-1-yloxy]-1-[(octyloxy)methyl]ethyl}azetidine, (2S)-1-(hexyloxy)-N,N- dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, (2S)-1-(heptyloxy)-N,N- dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, N,N-dimethyl-1- (nonyloxy)-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, N,N-dimethyl-1-[(9Z)- octadec-9-en-1-yloxy]-3-(octyloxy)propan-2-amine; (2S)-N,N-dimethyl-1-[(6Z,9Z,12Z)- octadeca-6,9,12-trien-1-yloxy]-3-(octyloxy)propan-2-amine, (2S)-1-[(11Z,14Z)-icosa-11,14- dien-1-yloxy]-N,N-dimethyl-3-(pentyloxy)propan-2-amine, (2S)-1-(hexyloxy)-3-[(11Z,14Z)- icosa-11,14-dien-1-yloxy]-N,N-dimethylpropan-2-amine, 1-[(11Z,14Z)-icosa-11,14-dien-1- yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, 1-[(13Z,16Z)-docosa-13,16-dien-1-yloxy]- N,N-dimethyl-3-(octyloxy)propan-2-amine, (2S)-1-[(13Z,16Z)-docosa-13,16-dien-1-yloxy]-3- (hexyloxy)-N,N-dimethylpropan-2-amine, (2S)-1-[(13Z)-docos-13-en-1-yloxy]-3-(hexyloxy)- N,N-dimethylpropan-2-amine, 1-[(13Z)-docos-13-en-1-yloxy]-N,N-dimethyl-3- (octyloxy)propan-2-amine, 1-[(9Z)-hexadec-9-en-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2- amine, (2R)-N,N-dimethyl-H(1-metoyloctyl)oxy]-3-[(9Z,12Z)-octadeca-9,12-dien-1- yloxy]propan-2-amine, (2R)-1-[(3,7-dimethyloctyl)oxy]-N,N-dimethyl-3-[(9Z,12Z)-octadeca- 9,12-dien-1-yloxy]propan-2-amine, N,N-dimethyl-1-(octyloxy)-3-({8-[(1S,2S)-2-[(1R,2R)-2- pentylcyclopropyl]methyl}cyclopropyl]octyl}oxy)propan-2-amine, Suitably the cationic lipid may be N,N-dimethyl-1-{[8-(2-oclylcyclopropyl)octyl]oxy}-3-(octyloxy)propan-2-amine, (11E,20Z,23Z)- N,N-dimethylnonacosa-11,20,2-trien-10-amine, and stereoisomers thereof, or mixtures thereof. 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4- hydroxybutyl)hexan-1-aminium (ALC-0315). Suitably the sterol may be (3β)-cholest-5-en-3-ol (cholesterol), cholesta-5,24-dien-3β-ol (desmosterol), cholestadienol, 5α-cholest-7-en-3β-ol (lanthosterol), stigmast-5-en-3β-ol (beta- sitosterol), cholesta-5,7-dien-3β-ol (7-dehydrocholesterol), 9,19-cyclo-9β-lanost-24-en-3β-ol (cycloartenol), ergosta-5,22-dien-3β-ol (brassicasterol), 5α-campestan-3β-ol (campestanol), campest-5-en-3β-ol (campesterol), 5α-stigmastan-3β-ol (stigmastanol), stigmasta-5,22-dien- 3β-ol (stigmasterol), (22E)-ergosta-5,7,22-trien-3β-ol (ergosterol), fecosterol, phytosterol, 5α- ergost-7-en-3β-ol (fungisterol) or any combination thereof. Suitably the sterol may be (3β)- cholest-5-en-3-ol (cholesterol). Suitably the PEGylated lipid may be a PEGylated diglyceride, a PEGylated ceramide or any combination thereof. Suitable PEGylated lipid may be for instance 2-[(polyethylene glycol)- 2000]-N,N-ditetradecylacetamide (ALC-0159), pegylated diacylglycerol lipid (PEG-DAG), a pegylated ceramide lipid (PEG-Cer), a pegylated phosphatidylethanoloamine lipid (PEG-PE), a pegylated succinate diacylglycerol lipid (PEG-S-DAG), a pegylated dialkoxypropylcarbamate lipid, 1 ,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol ("PEG-DMG" or "DMG-PEG"), in particular PEG2000-DMG, 1,2-dicapryl-rac-glycero-3- methylpolyoxyethylene glycol (Ci0 -diacylglycerol PEG), N-octanoyl-sphingosine-1- {succinyl[methoxy(polyethylene glycol)2000]} (comprising N-octanoyl-D-erythro-sphingosine (d18:1/8:0), also named PEG-Ceramide8), a PEG lipid as disclosed in WO 2018/126084 A1 , WO 2020/093061 A1 , or WO 2020/219941 A1 (all three references are incorporated by reference in their entirety); or any combination thereof. Suitably the PEGylated lipid may be 1,2-Dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG2000). Suitably lipid components may be present as a pharmaceutically acceptable salt, or a combination of pharmaceutically acceptable salts. For example, any, some or all of component A, component B, component C and component D may be/comprise pharmaceutically acceptable salts. Suitably component A may be an ionizable cationic lipid, for example a tertiary amine lipid, preferably 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4- hydroxybutyl)hexan-1-aminium (ALC-0315). Suitably component B may be an unsaturated sterol, for example wherein the unsaturated sterol may be (3β)-cholest-5-en-3-ol (cholesterol), cholesta-5,24-dien-3β-ol (desmosterol), cholestadienol, 5α-cholest-7-en-3β-ol (lanthosterol), or cholesta-5,7-dien-3β-ol (7-dehydrocholesterol). Suitably component C may be a saturated phosphatidylcholine, preferably 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). Suitably component D may be a PEGylated diglyceride, preferably PEGylated myristoyl diglyceride. Suitably component A may be an ionizable cationic lipid, for example a tertiary amine lipid, preferably 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4- hydroxybutyl)hexan-1-aminium (ALC-0315); component B may be an unsaturated sterol, for example wherein the unsaturated sterol may be (3β)-cholest-5-en-3-ol (cholesterol), cholesta- 5,24-dien-3β-ol (desmosterol), cholestadienol, 5α-cholest-7-en-3β-ol (lanthosterol), or cholesta-5,7-dien-3β-ol (7-dehydrocholesterol); component C may be a saturated phosphatidylcholine, preferably 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); and component D may be a PEGylated diglyceride, preferably PEGylated myristoyl diglyceride. Suitably component A may be 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N- (4-hydroxybutyl)hexan-1-aminium (ALC-0315); component B may be (3β)-cholest-5-en-3-ol (cholesterol); component C may be 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); and component D may be 1,2-Dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG- PEG2000). The LNP described herein may further comprise a coat, such as a steric shield coating, or an inert polymer coating. An LNP may be coated in order to reduce non-specific cellular interactions. Suitably coating involves derivatisation of the liposome with polyethylene glycol (PEG) as a steric shield, for example by preparing the LNP using a mixture of lipids wherein one or more of the lipids in the mixture of lipids comprises a lipid containing a PEG group. Used herein PEGylated means a compound which contains a PEG group (i.e. a polyethylene glycol moiety). PEGylation may be achieved by chemical reaction which covalently joins a polyethylene glycol precursor to a lipid, for example reaction of a diglyceride with an activated PEG ether to form a PEGylated diglyceride. Suitable molecular weights for PEG groups may range from 100 to 5000 PEG units, preferably 2000 PEG units. Suitably the nucleic acid cargo (for example RNA) may be associated with the membrane of the LNP, preferably by non-covalent interaction. Suitably the nucleic acid cargo may be associated with the cationic lipid of the LNP, for example through a Coulombic interaction. Suitably the nucleic acid cargo may associate with the hydrophobic region of the LNP, for example through hydrophobic interactions between some or all of the nucleic acid cargo and the lipids of the LNP. Suitably the nucleic acid cargo may be present within a bilayer of the LNP. Suitably a hydrophobic portion of the nucleic acid cargo may be present within a bilayer of the LNP. Suitably the nucleic acid cargo may be present in an aqueous lumen of the LNP, (for example, the interior of a liposome). Suitably the nucleic acid cargo may be present in an aqueous lumen of the LNP by physical entrapment, for example whereby the nucleic acid cargo is sufficiently hydrophilic that it cannot pass from the aqueous lumen to the exterior of the LNP. Suitably the nucleic acid cargo may be present in an aqueous lumen of the LNP and associated with the cationic lipid of the LNP (e.g. through a Coulombic interaction). Suitably the LNP may comprise a nucleic acid cargo and a drug compound, for example a nucleic acid cargo within an aqueous lumen of the LNP and a drug compound within an aqueous lumen of the LNP, or a nucleic acid cargo within an aqueous lumen of the LNP and a drug compound within a hydrophobic bilayer of the LNP. Suitably the nucleic acid cargo may be modified, preferably by covalent modification, more preferably by covalent attachment of lipid moieties, which may improve hydrophobic interactions e.g. with a hydrophobic bilayer of the LNP. Suitably the lipids of the LNP are in the liquid phase at ambient temperature. Suitably the lipids of the LNP are in the liquid phase at body temperature. Preferably the lipids of the LNP are in the gel phase at ambient temperature. Preferably the lipids of the LNP are in the liquid phase at body temperature. The size of LNP of the disclosure may be measured by dynamic light scattering (DLS) for example to obtain an average diameter measurement by the method of Koppel, D., J. Chem. Phys.57, 1972, pp 4814- 4820, ISO 13321. Suitably LNPs may have an average diameter of 10 nm to 10000 nm, optionally 20 nm to 5000 nm, for example 50 to 1000 nm or 50 to 500 nm. Suitably component A may be present in 30-70 mol%, preferably 40-60 mol%, more preferably 45-55 mol%, even more preferably 48-52 mol%; component B may be present in 25-45 mol%, preferably 30-42 mol%, more preferably 35-40 mol%; component C may be present in 5-15 mol%, preferably 8-12 mol%, more preferably 9-11 mol%; and component D may be present in 0.5-2.5 mol%, preferably 1.2-1.8 mol%, more preferably 1.4-1.6 mol%. Suitably component A may be present in 50 mol%; component B may be present in 38.5 mol%; component C may be present in 10 mol%; and component D may be present in 1.5 mol%. Suitably component A may be present in 50 mol%. Suitably component B may be present in 38.5 mol%. Suitably component C may be present in 10 mol%. Suitably component D may be present in 1.5 mol%. ‘mol%’ refers to the molar percentage of the particular component relative to the total lipid content of the LNP, for example where component A, component B, component C and component D are the only lipids present in the LNP, mol% refers to the molar amount of a particular component as a percentage of the total molar amount of component A, component B, component C and component D. The nucleic acid may be incorporated into a distinct nucleic acid sequence, such as a vector. In one example, the vector is a plasmid, a viral vector, or a cosmid, optionally wherein the vector is selected from the group consisting of a lentivirus, retrovirus, adeno-associated virus, adenovirus, vaccinia virus, canary poxvirus, herpes virus, minicircle vector and synthetic DNA or RNA. As used herein, the term “vector” refers to a nucleic acid sequence capable of transporting another nucleic acid sequence to which it has been operably linked. The vector can be capable of autonomous replication or it can integrate into a host DNA. The vector may include restriction enzyme sites for insertion of recombinant DNA and may include one or more selectable markers or suicide genes. The vector can be a nucleic acid sequence in the form of a plasmid, a bacteriophage or a cosmid. Preferably the vector is suitable for expression in a cell (i.e. the vector is an “expression vector”). Preferably, the vector is suitable for expression in a human T cell such as a CD8+ T cell or CD4+ T cell, or stem cell, iPS cell, or NK cell. In certain aspects, the vector is a viral vector, such as a retroviral vector, a lentiviral vector or an adeno-associated vector. Optionally, the vector is selected from the group consisting of an adenovirus, vaccinia virus, canary poxvirus, herpes virus, minicircle vector and synthetic DNA or synthetic RNA. Preferably the (expression) vector is capable of propagation in a host cell and is stably transmitted to future generations. The vector may comprise regulatory sequences. "Regulatory sequences" as used herein, refers to, DNA or RNA elements that are capable of controlling gene expression. Examples of expression control sequences include promoters, enhancers, silencers, TATA- boxes, internal ribosomal entry sites (IRES), attachment sites for transcription factors, transcriptional terminators, polyadenylation sites etc. Optionally, the vector includes one or more regulatory sequences operatively linked to the nucleic acid sequence to be expressed. Regulatory sequences include those which direct constitutive expression, as well as tissue-specific regulatory and/or inducible sequences. Optionally, the vector comprises the nucleic acid sequence of interest operably linked to a promoter. "Promoter", as used herein, refers to the nucleotide sequences in DNA to which RNA polymerase binds to start transcription. The promoter may be inducible or constitutively expressed. Alternatively, the promoter is under the control of a repressor or stimulatory protein. The promoter may be one that is not naturally found in the host cell (e.g. it may be an exogenous promoter). The skilled person in the art is well aware of appropriate promoters for use in the expression of target proteins, wherein the selected promoter will depend on the host cell. "Operably linked" refers to a single or a combination of the below-described control elements together with a coding sequence in a functional relationship with one another, for example, in a linked relationship so as to direct expression of the coding sequence. The vector may comprise a transcriptional terminator. “Transcriptional terminator” as used herein, refers to a DNA element, which terminates the function of RNA polymerases responsible for transcribing DNA into RNA. Preferred transcriptional terminators are characterized by a run of T residues preceded by a GC rich dyad symmetrical region. The vector may comprise a translational control element. “Translational control element”, as used herein, refers to DNA or RNA elements that control the translation of mRNA. Preferred translational control elements are ribosome binding sites. Preferably, the translational control element is from a homologous system as the promoter, for example a promoter and its associated ribozyme binding site. Preferred ribosome binding sites are known, and will depend on the chosen host cell. The vector may comprise restriction enzyme recognition sites. "Restriction enzyme recognition site" as used herein, refers to a motif on the DNA recognized by a restriction enzyme. The vector may comprise a selectable marker. "Selectable marker" as used herein, refers to proteins that, when expressed in a host cell, confer a phenotype onto the cell which allows selection of the cell expressing said selectable marker gene. Generally this may be a protein that confers a new beneficial property onto the host cell (e.g. antibiotic resistance) or a protein that is expressed on the cell surface and thus accessible for antibody binding. Appropriate selectable markers are well known in the art. Optionally, the vector may also comprise a suicide gene. “Suicide gene” as used herein, encodes a protein that induce death of the modified cell upon treatment with specific drugs. By way of example, suicide can be induced in cells modified by the herpes simplex virus thymidine kinase gene upon treatment with specific nucleoside analogs including ganciclovir, cells modified by human CD20 upon treatment with anti-CD20 monoclonal antibody and cells modified with inducible Caspase9 (iCasp9) upon treatment with AP1903 (reviewed by BS Jones, LS Lamb, F Goldman, A Di Stasi; Improving the safety of cell therapy products by suicide gene transfer. Front Pharmacol. (2014) 5:254). Appropriate suicide genes are well known in the art. Preferably the vector comprises those genetic elements which are necessary for expression of the binding proteins described herein by a host cell. The elements required for transcription and translation in the host cell include a promoter, a coding region for the protein(s) of interest, and a transcriptional terminator. A person of skill in the art will be well aware of the molecular techniques available for the preparation of (expression) vectors and how the (expression) vectors may be transduced or transfected into an appropriate host cell (thereby generating a modified cell described further below). The (expression) vector system described herein can be introduced into cells by conventional techniques such as transformation, transfection or transduction. “Transformation”, “transfection” and “transduction” refer generally to techniques for introducing foreign (exogenous) nucleic acid sequences into a host cell, and therefore encompass methods such as electroporation, microinjection, gene gun delivery, transduction with retroviral, lentiviral or adeno-associated vectors, lipofection, superfection etc. The specific method used typically depends on both the type of vector and the cell. Appropriate methods for introducing nucleic acid sequences and vectors into host cells such as human cells are well known in the art; see for example Sambrook et al (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y; Ausubel et al (1987) Current Protocols in Molecular Biology, John Wiley and Sons, Inc., NY; Cohen et al (1972) Proc. Natl. Acad. Sci. USA 69, 2110; Luchansky et al (1988) Mol. Microbiol.2, 637-646. The inventors established a link between an altered immune cell population within the tumour microenvironment, an altered metabolic status in the cancer or pre-cancer, and a high deleterious mtDNA mutation load. On the basis of this, the inventors believe that increasing the deleterious mtDNA mutation load in a cancer or pre-cancer will sensitise the cancer or pre- cancer to a treatment with an immune checkpoint inhibitor. The term “deleterious mtDNA mutation” as used herein refers to a mutation that adversely affects the structure and/or function of the mtDNA element it encodes, in contrast to a neutral mutation (such as a silent point mutation), which has neither a positive or negative mutation on the corresponding encoded element. Methods of identifying deleterious mtDNA mutations will be known in the art. Merely by way of example, a deleterious mtDNA mutation may be selected from the group consisting of: (i) a tRNA mutation having a MitoTIP RAW score of at least 12.6, or at least 16.25; (ii) a rRNA mutation; (iii) a truncation mutation in a mtDNA gene; (iv) a missense mutation in a mtDNA gene, wherein the missense mutation has an Apogee score of more than 0.5, optionally wherein the missense mutation is selected from a frameshift mutation, an insertion mutation or a deletion mutation; and/or (v) a mutation in a mtDNA D-loop region selected from the group consisting of: the H-strand promoter (m. 545-567), hypervariable segment 2 (MT-HV2; m.57-372), and hypervariable segment 1 (MT-HV1; m.16024-16390). The tRNA mutation may be in a gene selected from the group consisting of MT-TL1, MT-TA, MT-TC, MT-TD, MT-TE, MT-TF, MT-TG, MT-TH, MT-TI, MT-TK, MT-TL2, MT-TM, MT-TN, MT-TP, MT-TQ, MT-TR, MT-TS1, MT-TS2, MT-TT, MT-TV, MT-TW, and MT-TY. The rRNA mutation may be in a gene selected from the group of MT-RNR1 and MT-RNR2. The truncation or missense mutation may be in a tRNA, rRNA or protein coding gene. The protein coding gene may be selected from the group of MT-ND5, MT-ND1, MT-ND2, MT- ND3, MT-ND4, MT-ND4L, MT-ND6, MT-CO1, MT-CO2, MT-CO3, MT-CYB, MT-ATP6, and MT-ATP8. These genes encode proteins that are subunits of the mitochondrial respiratory chain complexes, specifically NADH: ubiquinone oxidoreductase (complex I), ubiquinol:cytochrome c oxidoreductase (complex III), cytochrome c oxidase (complex IV), or ATP synthase (complex V). Accordingly, the mutation may be in a mtDNA gene that encodes a subunit of a mitochondrial respiratory chain complex selected from the group consisting of complex I, complex III, complex IV and complex V. Suitably, the deleterious mtDNA mutation is a truncation, missense, insertion, or frameshift mutation. Suitably the deleterious mutation may be in the gene MT-ND5. Suitably, the deleterious mutation may be a truncating mutation that is in a region selected from: m.12418-12425:A indel or m.12385-12390:C indel. Suitably, the deleterious mutation may be a missense mutation in the MT-CO1, MT-ND5, MT- ND4, MT-CYB or MT-TY gene. Suitably, the missense mutation may be selected from the group consisting of m.6318C>T, m.12730G>A, m.11736T>C, m.15140G>A, m.5843A>G, and m.6214G>A. Suitably, the insertion mutation may be selected from the group consisting of m.16183:CC indel, and m.16192:T indel. The terms “mtDNA mutation load”, “mtDNA heteroplasmy”, “variant allele frequency”, or “VAF” refer to mtDNA mutations that arise and co-exist with the wild-type allele in the same cell, or group of cells. In the context of the present disclosure, the term “determine” or “determining” refers to measuring the level of mtDNA molecules comprising a deleterious mutation in a cell or group of cells and comparing that level to the level of mtDNA molecules that do not comprise such deleterious mutations (or to the total number of mtDNA molecules that are present in the cell or group of cells). It will be appreciated that mtDNA molecules that do not comprise deleterious mutations may comprise other mutations, however these mutations would not be deleterious within the meaning of the present disclosure. MtDNA mutation load may be typically represented as a percentage. For example a mutation load of 30% means that 30% of mtDNA molecules in a cell or group of cells (such as a sample) carry a deleterious mtDNA mutation. The deleterious mutation may be the same or different in all mutated mtDNA molecules. More suitably, the deleterious mutation may be the same in all mutated mtDNA molecules for the purpose of measuring mutation load. However, it will be appreciated that the mtDNA molecules with the deleterious mutation used for determining mutation load may have further (additional) deleterious mutations. Methods of determining mtDNA mutation loads are well known in the art and include mtDNA sequencing, such as single cell mtDNA sequencing. Methods of determining mtDNA mutation loads are described in, for example, Sobenin et al, 2014 (doi: 10.1155/2014/292017). In the context of some of the methods disclosed herein, the deleterious mtDNA mutation load is determined in a cancer or pre-cancer sample from the subject. The term “sample” refers to any group of cells comprising cancer cells and/or pre-cancer cells derived from the subject. The sample may typically comprise a mixture of healthy (i.e. non- cancerous and non-precancerous cells) and cancer cells (and/or pre-cancerous cells). The sample may comprise components of a tumour e.g. cells (cancer, pre-cancer, and healthy cells), as well as interstitial fluid. Suitably, the sample will comprise at least 5%, at least 10%, at least 15%, at least 20%, or more of cancer and/or pre-cancer cells. For example the sample may comprise at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% or more of cancer and/or pre-cancer cells. The presence of healthy cells, which may be substantially free of a deleterious mtDNA mutation load, may lower the determined (overall) deleterious mtDNA mutation load in a sample as compared to if the deleterious mtDNA mutation load was determined solely or substantially only on cancer or pre-cancer cells. In this context the term “substantially only” means that the cancer cells account for at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or more of the cells in the sample. Thus, merely by way of example, when a deleterious mtDNA mutation load in a cancer or pre- cancer sample obtained from a subject is determined to be about 30%, the deleterious mtDNA mutation load of the cancer or precancer cells present in the sample specifically may be more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, more than 80%, or more than 90%. Suitably, with reference to a solid cancer, the sample may be a biopsy, a smear sample, or a interstitial fluid sample. Suitably, with reference to a liquid cancer, the sample may be a blood sample (for example, a whole blood sample, a blood plasma sample, or a serum sample), or a urine sample. As will be clear to the person skilled in the art, the amount of mtDNA molecules having the deleterious mutation is used to determine the level of the mutation load in a cell or a group of cells. Herein, the proportion of mtDNA molecules having the deleterious mutation is referred to as “the deleterious mtDNA mutation load”. The skilled person would appreciate that a low proportion of mtDNA molecules having the deleterious mutation will correspond to a low deleterious mtDNA mutation load, which may be asymptomatic (i.e. have little or no impact on overall mitochondrial function of the cell). Conversely, a high proportion of mtDNA molecules having the deleterious mutation will correspond to a high deleterious mtDNA mutation load, which in the context of the present disclosure may be symptomatic, i.e. have an adverse effect on overall mitochondrial function of the cell. An adverse effect on overall mitochondrial function of the cell may be determined by an altered redox status (for example mitochondrial and/or cytosolic metabolic state), which may be due to: altered mitochondrial redox homeostasis, reduced oxidative phosphorylation, increased oxidative stress, or any combination thereof. These changes may further lead to alterations in the cancer or pre-cancer microenvironment, such as the tumour as a whole and/or interstitial fluid of the cancer or pre-cancer (also referred to herein as the interstitial fluid of the tumour). The altered tumour microenvironment may be more or less favourable for specific immune cell populations, as explained in more detail hereinbelow. An altered redox status may be indicated by an increase in one or more cellular metabolite selected from the group consisting of: fumarate, lactate, malate, acetyl CoA, aspartate, glucose, glucose 6-phosphate, glutamine, glucose 3-phosphate, glycolytic intermediates, fumarate adducts (such as succinicGSH and/or succinylCysteine), and arginosuccinate. In particular, altered redox status may be indicated by increase in the fumarate adducts succinicGSH and/or succinylCysteine (also referred to as succ.cys and succ.gsh respectively herein). Additionally, or alternatively, altered redox status may include a decrease in one or more cellular metabolite selected from the group consisting of: alpha-ketoglutarate, pyruvate, phosphoenolpyruvate and succinate. A deleterious mtDNA mutation load may alter the NAD+:NADH ratio in the mitochondria and/or the cytosol. Suitably, the deleterious mtDNA mutation load may increase the NAD+:NADH ratio in the mitochondria and/or the cytosol. Disturbed NAD+:NADH ratio may result in partial reverse flux of MDH2 within mitochondria (which can be determined from the ratio of pyruvate carboxylase-derived (m+3) malate, citrate, and aconitate, and pyruvate). Merely by way of example, altered redox status may include changes in TCA cycle and/or urea cycle metabolites. Suitably, these metabolites may be related to the malate-aspartate shuttle (MAS) and fumarate within mitochondria and/or within the cytosol. The inventors used 1-13C-glutamine tracing, which revealed that NAD+:NADH ratio changes are associated with increases in malate m+1 abundance, and argininosuccinate m+1 abundance, but not a-KG m+1, aconitate m+1 or aspartate m+1 – implicating increased MDH1 flux. Accordingly, altered mitochondrial metabolic state may include increased MDH1 flux. Merely by way of example, altered redox status may include an imbalance between lactate and glucose in the tumour (e.g. in the interstitial fluid of the tumour). As described elsewhere herein an altered lactate to glucose ratio in a cancer or pre-cancer can sensitise the cancer or pre-cancer to a PD-1 inhibitor and/or PD-L1 inhibitor. In this context, an altered lactate to glucose ratio may be an increased lactate to glucose ratio. Merely by way of example, altered redox status may include an imbalance between pyruvate and lactate in the tumour (e.g. in the interstitial fluid of the tumour). Accordingly, a deleterious mtDNA mutation load may alter the redox status (for example alter the pyruvate to lactate ratio) in the tumour (e.g. in the interstitial fluid of the tumour). The inventors believe that an altered redox status (for example altered lactate to glucose ratio) in the cancer or pre-cancer is the reason why such cancers or pre-cancers have a notably different proportion of immune cells in the tumour microenvironment. The inventors believe that an altered lactate to glucose ratio in the cancer or pre-cancer is associated with increased levels of immune cells selected from the group consisting of: NK cells; monocytes; CD4+ T cells; and ISG-expressing immune cells, and/or decreased levels of macrophages (for example tumour associated macrophages) and/or neutrophils. Suitably, in the context of the present disclosure, the composition may increase the levels of immune cells selected from the group consisting of: NK cells; monocytes; CD4+ T cells; and ISG-expressing immune cells, and/or decreased the levels of macrophages (for example tumour associated macrophages) and/or neutrophils. Suitably the composition may decreases the levels of neutrophils, for example tumour infiltrating neutrophils. It will be appreciated that such a composition may decrease the levels of neutrophils (for example tumour infiltrating neutrophils) by altering the redox status in a cancer or a pre-cancer. Suitably, an immune checkpoint inhibitor may be for use in treating a subject having a cancer or a pre-cancer, wherein the subject has been exposed to a composition that reduces neutrophils (for example tumour infiltrating neutrophils). Suitably, a method of sensitising a subject having a cancer or a pre-cancer to an immune checkpoint inhibitor, may comprise exposing the subject to a composition that reduces neutrophils (for example tumour infiltrating neutrophils). Suitably, a method of treating a cancer or a pre-cancer in a subject, may comprise administering an immune checkpoint inhibitor to the subject, wherein the subject has been exposed to a composition that reduces neutrophils (for example tumour infiltrating neutrophils). Suitably, a method of treating a cancer or a pre-cancer in a subject, may comprise: (i) exposing the subject to a composition that reduces neutrophils (for example tumour infiltrating neutrophils); and (ii) administering an immune checkpoint inhibitor to the subject. The term “NK cells” or “Natural Killer cells” as used herein refers to a subset of peripheral blood lymphocytes defined by the expression of CD56 or CD16 and the absence of the T cell receptor (CD3). The term “monocytes” as used herein refers to a subset of immune cells that are produced in the bone marrow and migrate through the blood to tissues in the body, where they become a macrophage. Suitably the monocytes are immature, intermediate or classical monocytes. Immature monocytes are Lys6C and F480 positive. Intermediate monocytes are CD14+ and CD16+. Classical monocytes are CD14+ and CD16-. The term “CD4 NK-like T cells” as used herein refers to a subset of immune cells that are cytotoxic T-cells that co-express NK receptors such as CD56, CD16, and/or CD57. The term “CD4+ T cells” refers to T helper cells. The term “ISG-expressing immune cells” refers to a subset of cells that express interferon- stimulated genes. The term “macrophages” refers to a subgroup of phagocytic cells produced by monocyte differentiation. The term “tumour associated macrophages” (TAMs) generally refers to macrophages that exist in the microenvironment of a cancer, for example, a tumour. The term "neutrophil" refers to a type of granulocytes of white blood cells which are first- responders of inflammatory cells. In come cancers and/or precancers, neutrophils may be present within the tumour. Such neutrophils may be referred to as tumour infiltrating neutrophil (TANs). The presence of TANs may be associated with poor prognosis. Suitably, NK cell levels may be increased by at least 100%, at least 150%, at least 200% etc. Suitably, the levels of tumour associated macrophages may be decreased by at least 25%, at least 50%, at least 75% etc. Suitably, the levels of immature monocytes may be increased by at least 100%, at least 150%, at least 200% etc. Suitably, CD4+ T cell levels may be increased by at least 20%, at least 50%, at least 100%, at least 200%, etc. Suitably, neutrophil levels may be decreased by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or more. Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. For example, Singleton and Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d Ed., John Wiley and Sons, NY (1994); and Hale and Marham, The Harper Collins Dictionary of Biology, Harper Perennial, NY (1991) provide those of skill in the art with a general dictionary of many of the terms used in the invention. Although any methods and materials similar or equivalent to those described herein find use in the practice of the present invention, the preferred methods and materials are described herein. Accordingly, the terms defined immediately below are more fully described by reference to the Specification as a whole. Also, as used herein, the singular terms "a", "an," and "the" include the plural reference unless the context clearly indicates otherwise. Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively. It is to be understood that this invention is not limited to the particular methodology, protocols, and reagents described, as these may vary, depending upon the context they are used by those of skill in the art. Aspects of the invention are demonstrated by the following non-limiting examples. Examples EXAMPLE 1 Results The inventors demonstrated (Mahmood et al, Nature Cancer, 2024 and WO2024/089418) that genetic modification of hcmel12 melanoma cancer cells to express the cytosolically localised NADH oxidase, cytoLbNOX, induces sensitivity to checkpoint blockade. They then determined that this is through a cancer cell-autonomous mechanism. In order to translate this finding to a clinically relevant setting, the inventors encapsulated mRNA encoding either cytoLbNOX or mitoLbNOX, a mitochondrially targeted form of the oxidase, their respective catalytic mutants and a reporter-only construct within a LNP composition from a commercial provider (See materials and methods section). A key difference between this approach and proof-of-principle using genetically modified cells is that the LNP is not specifically targeted to cancer cells, all cells within the tumour microenvironment will be transduced to a greater or lesser extent, as is also true of other organs within the animal, potentially limiting the efficacy of the approach due to: a) off target transduction of cells within the tumour (e.g. immune cells) resulting in an attenuated immune response and; b) off target transduction of cells within organs of the animal, resulting in toxicity. To determine whether delivery of mRNA-LNP via intratumoural injection is an efficacious means of delivery, the inventors delivered the LNPs by a single intratumoural injection into subcutaneous B78-D14 murine melanoma tumours in immunocompetent animals at day 7, one day prior to the start of a bi-weekly single agent checkpoint blockade regimen. In an initial dose escalation study, they observed cytoLbNOX LNP dose-dependent effects on sensitivity to anti-PD1 checkpoint blockade (Figure 1) without any instances of observable toxicity requiring animal subjects to be euthanised. They then performed a further study using a single intratumoural injection into the same animal model at 10x higher dose, observing substantial sensitisation to the active enzyme formulations that is not observed in vehicle or catalytic mutant formulations (Figure 2). Materials and Methods Lipid nanoparticles (LNPs) were externally produced by PackGene. The composition of LNPs is as follows: 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4- hydroxybutyl)hexan-1-aminium (ALC-0315), (3β)-cholest-5-en-3-ol (cholesterol), 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC) and 1,2-Dimyristoyl-rac-glycero-3- methoxypolyethylene glycol-2000 (DMG-PEG2000). mRNA-LNP complexes are re- suspended in a buffer composed of: >79% water, 20% sucrose and <1% of potassium dihydrogen phosphate, disodium hydrogenphosphate, sodium chloride and potassium chloride. Encapsulation efficiencies of LNPs ranged from 88.0 – 89.0%. Experiments comply with all relevant ethical regulations. Animal experiments were carried out in accordance with the UK Animals (Scientific Procedures) Act 1986 (P72BA642F) and by adhering to the ARRIVE guidelines with approval from the local Animal Welfare and Ethical Review Board of the University of Glasgow. mRNA design mRNA sequences were designed as follows: (MTS)-LbNOX-4xHA-T2A-mScarlet3-v5 Cell Culture B78 melanoma cells (RRID: CVCL_8341) were maintained in DMEM containing GLUTAMAX, 0.11 g/L sodium pyruvate and 4.5 g/L D-glucose (Life Technologies), supplemented with 1% penicillin–streptomycin (Life Technologies) and 10% FBS (Life Technologies). Cells were grown in incubators at 37 °C and 5% CO2. Animal Husbandry and Experimental Procedures Mice were housed in conventional cages in an animal room at a controlled temperature (19– 23 °C) and humidity (55 ± 10%) under a 12 h light:12 h dark cycle. Experiments used male C57BL/6 at ~8 weeks of age that were injected subcutaneously with 2.5 × 105 B78-D14 murine melanoma cells prepared in 1:1 RPMI (Life Technologies) and Matrigel (Merck). Intratumoral injections of mRNA-LNPs were administered 7 days post-transplant (tumours approx.5mm diameter) at a concentration of 0.0025, 0.025, 0.25 or 2.5µg per tumour. Mice receiving immunotherapy were put on a dosing regimen of 200 µg of anti-PD1 given intraperitoneally at set intervals. The first dose was given 8 days post-transplant and all mice were culled at day 18. EXAMPLE 2 Results The data in Figure 3 shows that the expression of bacterial NADH oxidase, cytoLbNOX, results in loss of O2 consumption and sensitisation of refractory murine melanoma tumours to immune checkpoint inhibition in vivo. The data shows this is non-specific sensitization to immune checkpoint blockade (ICB) that is associated with loss of oxygen consumption in models of either mtDNA mutant or LbNOX expressing melanoma. The Hcme12 cells expressing truncated mt-ND5 (83% VAF) exhibit significant sensitisation to anti-PD1, anti-PDL1 and anti- CTLA4 treatment. CytoLbNOX expressing cells show a further significant sensitisation to anti- PD1 and anti-PDL1 treatment. The data further shows that when anti-PD1 treatment was administered, an enhanced, mtDNA mutation-dependent response was observed in Hcmel1280% mutant tumors and that when challenged with anti-PD1 treatment, Hcmel12 cytoLbNOX tumors recapitulate the response of Hcmel12 Mt-Nd5 m.12,43680% tumors, whereas catalytic mutant tumors were unresponsive. Materials and methods Lipid nanoparticles (LNPs) were externally produced by PackGene. The composition of LNPs is as follows: 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4- hydroxybutyl)hexan-1-aminium (ALC-0315), (3β)-cholest-5-en-3-ol (cholesterol), 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC) and 1,2-Dimyristoyl-rac-glycero-3- methoxypolyethylene glycol-2000 (DMG-PEG2000). mRNA-LNP complexes are re- suspended in a buffer composed of: >79% water, 20% sucrose and <1% of potassium dihydrogen phosphate, disodium hydrogenphosphate, sodium chloride and potassium chloride. Encapsulation efficiencies of LNPs ranged from 88.0 – 89.0%. Experiments comply with all relevant ethical regulations. Animal experiments were carried out in accordance with the UK Animals (Scientific Procedures) Act 1986 (P72BA642F) and by adhering to the ARRIVE guidelines with approval from the local Animal Welfare and Ethical Review Board of the University of Glasgow. mRNA design mRNA sequences were designed as follows: (MTS)-LbNOX-4xHA-T2A-mScarlet3-v5 Cell Culture Hcmel12 cells were maintained in DMEM containing GLUTAMAX, 0.11 g/L sodium pyruvate and 4.5 g/L D-glucose (Life Technologies), supplemented with 1% penicillin–streptomycin (Life Technologies) and 10% FBS (Life Technologies). Cells were grown in incubators at 37 °C and 5% CO2. Cells were transfected using Lipofectamine 3000 (Life Technologies) using a ratio of 5 µg DNA:7.5 µl Lipofectamine 3000. Animal Husbandry and Experimental Procedures Mice were housed in conventional cages in an animal room at a controlled temperature (19– 23 °C) and humidity (55 ± 10%) under a 12 h light:12 h dark cycle. Experiments used male C57BL/6 or NOD scid gamma mice at ~8 weeks of age that were injected subcutaneously with 1 × 104 HcMel12 cells, prepared in 1:1 RPMI (Life Technologies) and Matrigel (Merck). Untreated mice were killed at an endpoint of 15 mm tumour measurement, which was not exceeded for any experiment. Mice receiving immunotherapy were killed at a fixed timepoint of day 13 for tumors derived from Hcmel12 cells. For immunotherapy experiments, mice were put on a dosing regimen of 200 µg of anti-PD1, anti-PDL1 and anti-CTLA4 treatment given intraperitoneally at set intervals. The first dose was given 7 days post injection and all mice were killed at 13 days post injection for HcMel12 cells. EXAMPLE 3 Results Figure 4 shows that sensitivity to checkpoint blockade is observed in an otherwise totally refractory model, even when only 1% of cells in a chimeric tumor bears a mtDNA mutation or expresses LbNOX. The same trend is observed with chimeric mtDNA mutant melanomas. Figure 4A shows that cells of the indicated genotypes were administered subcutaneously in the indicated ratios. Once tumours reached 5mmx5mm, at day 7, IP administration of anti- PD1 checkpoint inhibitor started (every 3 days until timed endpoint at day 15). Figure 4B shows the tumour weights at the endpoint of indicated tumour genotypes and admixed ratios. All animals in this graph were administered anti-PD1. This data demonstrates that the effect of these manipulations in terms of response to therapy are unlikely to be driven by gross metabolite abundance changes in tumours, as the sensitization effect is not diluted in proportion to the dilution of the sensitized cell type in the chimera (i.e. the sensitization isn’t only 1% as potent as it would normally be in a non-chimeric setting). The data in Figure 4 shows that CytoLbNOX expression in only 1% of subcutaneously injected Hcme12 melanoma cancer cells is sufficient to induce a potent sensitisation to anti-PD1. The data in Figure 5 studies Hcme12 melanoma cells expressing cytoLbNOX in a dox- inducible manner. The data shows that cytoLbNOX in melanoma cells which have undergone 5 days cytoLbNOX induction (day 0-5) followed by anti-PD1 treatment (day 7-13) has the same level of anti-tumour efficacy as cytoLbNOX in melanoma cells which have undergone 13-days cytoLbNOX expression together with anti-PD1 treatment at day 7. Figure 5A shows tumour weight of dox-inducible cytolbnox Hcmel12 tumours at humane endpoint (15mmx15mm). Figure 5B shows the survival of animals as studied in Figure 5A. Figure 5C shows experimental design. Dox-inducible cytolbnox Hcmel12 cells were injected and animals then received either regular chow or doxycycline supplemented food for 5 or 13 days. IP administration of anti-PD1 then occurred every 3 days from day 7. Figure 5D shows representative tumours taken at endpoint for indicated conditions. Figure 5E shows the tumour weights in indicated conditions. All animals received anti-PD1 The data shows that using the doxycycline inducible cytolbnox model the inventors first showed that inducing lbnox alone, in the absence of a checkpoint inhibitor does not impact tumour growth in this model, as shown by Figures 5A and 5B. By providing doxycycline in the diet, either up to day 5, or up until day 13 (timed endpoint) the inventors induced an antitumour effect of similar magnitude in the presence of a checkpoint inhibitor. When LbNOX is not expressed (0 days) tumours do not respond to the checkpoint inhibitor. This suggests that the impact of LbNOX is mediated by a robust T cell response, that is fully unleashed using a checkpoint inhibitor, and can be primed by a brief burst of LbNOX expression. Importantly, the enzyme does not need to be expressed continuously for the sensitization to be effective. In combination with the previous data showing that only 1% of cells need to express the enzyme for an effect to be seen, this positions the approach advantageously, as any delivery method used can be relatively ineffective (either hitting only a minority of cancer cells, and only being expressed for a comparatively short period of time) and still result in enhanced anti- tumour responses. Materials and methods Lipid nanoparticles (LNPs) were externally produced by PackGene. The composition of LNPs is as follows: 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4- hydroxybutyl)hexan-1-aminium (ALC-0315), (3β)-cholest-5-en-3-ol (cholesterol), 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC) and 1,2-Dimyristoyl-rac-glycero-3- methoxypolyethylene glycol-2000 (DMG-PEG2000). mRNA-LNP complexes are re- suspended in a buffer composed of: >79% water, 20% sucrose and <1% of potassium dihydrogen phosphate, disodium hydrogenphosphate, sodium chloride and potassium chloride. Encapsulation efficiencies of LNPs ranged from 88.0 – 89.0%. Experiments comply with all relevant ethical regulations. Animal experiments were carried out in accordance with the UK Animals (Scientific Procedures) Act 1986 (P72BA642F) and by adhering to the ARRIVE guidelines with approval from the local Animal Welfare and Ethical Review Board of the University of Glasgow. mRNA design mRNA sequences were designed as follows: (MTS)-LbNOX-4xHA-T2A-mScarlet3-v5 Cell Culture Hcmel12 cells were maintained in DMEM containing GLUTAMAX, 0.11 g/L sodium pyruvate and 4.5 g/L D-glucose (Life Technologies), supplemented with 1% penicillin–streptomycin (Life Technologies) and 10% FBS (Life Technologies). Cells were grown in incubators at 37 °C and 5% CO2. Cells were transfected using Lipofectamine 3000 (Life Technologies) using a ratio of 5 µg DNA:7.5 µl Lipofectamine 3000. Animal Husbandry and Experimental Procedures Mice were housed in conventional cages in an animal room at a controlled temperature (19– 23 °C) and humidity (55 ± 10%) under a 12 h light:12 h dark cycle. Experiments used male C57BL/6 or NOD scid gamma mice at ~8 weeks of age that were injected subcutaneously with 1 × 104 HcMel12 cells, prepared in 1:1 RPMI (Life Technologies) and Matrigel (Merck). Untreated mice were killed at an endpoint of 15 mm tumour measurement, which was not exceeded for any experiment. Mice receiving immunotherapy were killed at a fixed timepoint of day 13 (Fig.5) or day 15 (Fig.4) for tumors derived from Hcmel12 cells. For immunotherapy experiments, mice were put on a dosing regimen of 200 µg of anti-PD1 treatment given intraperitoneally at set intervals. The first dose was given 7 days post injection and all mice were killed at 13 days (Fig.5) or 15 days (Fig.4) post injection for HcMel12 cells. EXAMPLE 4 Results LNP cytoLbNOX proof-of-concept experiment B78-D14 amelanotic melanoma cells are implanted. Once the tumour reaches 5mmx5mm (day 7), a single intratumoural injection (ITI) of a range of cytoLbNOX mRNA-LNP doses from 0.0025 ug to 0.25 ug is administered. Anti-PD1 is administered every 3 days IP from day 8 until timed endpoint. Figure 6B shows representative images of tumours at timed endpoint across indicated conditions. In this Figure, the sloped triangle indicates quantity of mRNA administered via ITI. Figure 6C shows the tumour weights of indicated conditions at timed endpoints. All animals received anti-PD1. The data shows that conservative dose-escalation of cytoLbNOX delivery via intratumoural injection of LNPs induces sensitisation in an aggressive mouse model of ICI-refractory melanoma (B78-D14). The maximum dose administered is equivalent to ~10ug mRNA into a tumour ~75% the size of a golf ball. The quantities of intratumourally injected mRNA are very low, and these are challenging experiments to perform, as the tumours being injecting are very small (~5mm x ~5mm) necessarily because the model is so aggressive and grows so quickly. LNP cyto and mitoLbNOX proof-of-concept experiment The same experiment was repeated using 10x more mRNA (which still represents a fairly low dose, i.e. in the mid-range of what is given as a single shot of mRNA vaccine). Catalytic mutants of the enzyme are included as controls, showing that the lbnox protein itself has no immunological impact, and only the active enzyme exerts the antitumour effect. B78-D14 amelanotic melanoma cells are implanted, once the tumour reaches 5mmx5mm (day 7). Then, a single intratumoural injection (ITI) of 2.5ug cytoLbNOX mRNA-LNP is administered as indicated. Anti-PD1 is administered every 3 days IP from day 8 until timed endpoint. Figure 7B shows representative images of tumours at timed endpoints across indicated conditions, including transgene-free LNP and LNP delivering mRNA encoding catalytic mutants of both cytosolically targeted and mitochondrially targeted LbNOX. Figure 7C shows the tumour weights of indicated conditions at timed endpoints. All animals received anti-PD1. mitoLbNOX, a mitochondrially targeted form of the enzyme, appears to work more robustly, likely because the enzyme is able to consume more NADH in mitochondria due to the higher concentration inside mitochondria than in the cytosol. This is expected, and further strengthens the inventor’s mechanistic understanding of the sensitizing effect. The data shows the investigation of higher doses of cytoLbNOX and mitoLbNOX delivery via intratumoural injection. The data shows that catalytic mutants of either enzyme are ineffective. The data suggests that mitochondria-targeted LbNOX is the superior sensitising agent. The dose shown in this data is equivalent to ~100ug mRNA into a tumour ~75% the size of a golf ball. mitoLbNOX clinical endpoint proof-of-concept experiment Using a clinical endpoint, the inventor’s show that the sensitizing effects of LbNOX are observed regardless of the checkpoint inhibitor given. A catalytic mutant (D177A) of the enzyme is delivered as the control. Hcmel12 cells is used as an ICB refractory model of melanoma. Importantly, this model captures the patient population that fail on multiple lines of therapy including best in class combination checkpoint inhibitors (as Figure 8B shows that the addition of LAG3 only results in a 7 day survival increase). The inventors are able to evoke durable responses in a treatment agnostic manner in this population, which could be extrapolated to a substantial improvement in survival for those patients who run out of therapeutic options. For Figure 8A, hcmel12 cells were injected subcutaneously. A single ITI of 2.5ug mRNA-LNP was administered by intratumoral injection once tumours reached 5mmx5mm (day 7). Anti- PD1 was administered IP every 3 days from day 8 until humane endpoint (15mmx15mm tumour caliper measurements). For Figure 8B, hcmel12 cells were injected subcutaneously. A single ITI of 2.5ug mRNA-LNP was administered by intratumoral injection once tumours reached 5mmx5mm (day 7). Anti- PD1 and anti-LAG3 were administered IP every 3 days from day 8 until humane endpoint (15mmx15mm tumour caliper measurements). Indications beyond melanoma The inventors engineered cells of the widely used KPC model of PDAC to express LbNOX. They intended to see whether this would enhance response to checkpoint blockade. KPC, as with most PDAC, is known to be unresponsive to checkpoint blockade. Cells were implanted orthotopically into the pancreas, tumours were allowed to form (as seen by ultrasound). When tumours reached 4mm x 4mm, treatment started. For the KPC wt cells, neither isotype or anti-pd1 antibodies prevented disease progression, as expected. Unexpectedly, the KPC cytolbnox cells initially appeared to form tumours, and then spontaneously receded in both the isotype and anti-PD1 conditions, indicating a possible highly potent impact of lbnox expression in PDAC. This fits with what is known of PDAC tumours, as they are known to be extremely hypoxic/anoxic. The inventors also engineered cells of the widely used breast cancer model YeJ2.1g (also known as PyMT or polyoma middle T), which is loosely termed as a luminal B subtype model. Here, when cells were engrafted orthotopically into the mammary fat pad (breast tissue equivalent) the inventors observed a substantial increase in survival of tumours expressing cytoLbNOX. These animals were not given a checkpoint inhibitor, and therefore the data appears to support what has been observed in the KPC cyto cells (+isotype). Both YEJ and KPC cells were generated by lentiviral transduction and selection with puromycin, to produce cells that constitutively express LbNOX. KPC and YEJ2.1g (PyMT) cells were treated with lentiviruses to enable stable-expression of cytoLbNOX or a control vector, and subjected to antibiotic selection. Representative clones were characterized and used in onward studies. For Figure 9A, KPC cells of indicated genotypes were injected orthotopically into the mouse pancreas, and tumour formation monitored by ultrasound. Once a 3mm mass could be detected anti-PD1/isotype treatment (twice weekly) was initiated. Both isotype and anti-PD1- treated KPC cyto tumours regressed and were undetectable at endpoint, suggesting that cytoLbNOX has monotherapy efficacy in this model. For Figure 9B, YEJ2.1g cells of indicated genotypes were injected orthotopically into the mammary fat pad. Animals were culled once humane endpoint (15mmx15mm) was reached. Tumours expressing cytoLbNOX demonstrate increased latency, despite the lack of checkpoint inhibitor administration. These data suggest the potential for monotherapy efficacy in the model. The data shows that stable genetic models of cytoLbNOX demonstrate increased latency without checkpoint inhibition in orthotopic transplant models of pancreatic and breast cancer. Materials and methods Lipid nanoparticles (LNPs) were externally produced by PackGene. The composition of LNPs is as follows: 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4- hydroxybutyl)hexan-1-aminium (ALC-0315), (3β)-cholest-5-en-3-ol (cholesterol), 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC) and 1,2-Dimyristoyl-rac-glycero-3- methoxypolyethylene glycol-2000 (DMG-PEG2000). mRNA-LNP complexes are re- suspended in a buffer composed of: >79% water, 20% sucrose and <1% of potassium dihydrogen phosphate, disodium hydrogenphosphate, sodium chloride and potassium chloride. Encapsulation efficiencies of LNPs ranged from 88.0 – 89.0%. Experiments comply with all relevant ethical regulations. Animal experiments were carried out in accordance with the UK Animals (Scientific Procedures) Act 1986 (P72BA642F) and by adhering to the ARRIVE guidelines with approval from the local Animal Welfare and Ethical Review Board of the University of Glasgow. mRNA design mRNA sequences were designed as follows: (MTS)-LbNOX-4xHA-T2A-mScarlet3-v5 Animal Husbandry and Experimental Procedures Mice were housed in conventional cages in an animal room at a controlled temperature (19– 23 °C) and humidity (55 ± 10%) under a 12 h light:12 h dark cycle. Experiments used male C57BL/6 or NOD scid gamma mice at ~8 weeks of age that were injected subcutaneously with either 2.5 × 105 B78 cells or 1 × 104 HcMel12 cells, both prepared in 1:1 RPMI (Life Technologies) and Matrigel (Merck). Untreated mice were killed at an endpoint of 15 mm tumor measurement, which was not exceeded for any experiment. Mice receiving immunotherapy were killed at a fixed timepoint of day 21 or day 13 for tumors derived from B78-D14 or Hcmel12, respectively. Intratumoral injections of mRNA-LNPs were administered 7 days post-transplant (tumours approx.5mm diameter, as measured by calipers) at a set concentration of mRNA per tumour. For immunotherapy experiments, mice were put on a dosing regimen of 200 µg of anti-PD1 given intraperitoneally at set intervals. The first dose was given 8 days post injection and all mice were killed at 21 or 13 days post injection for B78 or HcMel12 cells, respectively.

Claims

Claims 1. A composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase for use in sensitising a subject having cancer or pre-cancer to an immune checkpoint inhibitor. 2. An immune checkpoint inhibitor for use in treating a subject having a cancer or a pre- cancer, wherein the subject has been exposed to a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase. 3. A method of sensitising a subject having a cancer or a pre-cancer to an immune checkpoint inhibitor, comprising exposing the subject to a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase. 4. A method of treating a cancer or a pre-cancer in a subject, comprising administering an immune checkpoint inhibitor to the subject, wherein the subject has been exposed to a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase. 5. A method of treating a cancer or a pre-cancer in a subject, comprising: (i) exposing the subject to a composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase; and (ii) administering an immune checkpoint inhibitor to the subject. 6. A composition comprising a lipid nanoparticle (LNP) having a nucleic acid cargo encoding NADH oxidase. 7. The composition for use, inhibitor for use, method, or composition of any preceding claim, wherein the NADH oxidase is from Lactobacillus brevis, further optionally wherein the enzyme is selected from the group consisting of cytoLbNOX and mitoLbNOX. 8. The composition for use, inhibitor for use, or method, of any preceding claim, wherein the immune checkpoint inhibitor is selected from the group consisting of a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, CTLA4 inhibitor, TIGIT inhibitor, LAG-3 inhibitor, TIM-3 inhibitor, BTLA inhibitor and KIR inhibitor. 9. The composition for use, inhibitor for use, or method, of claim 8, wherein the immune checkpoint inhibitor is selected from the group consisting of a PD-1 inhibitor, a PD-L1 inhibitor, and CTLA4 inhibitor. 10. The composition for use, inhibitor for use, or method, of claim 9, wherein the PD-1 inhibitor is nivolumab. 11. The composition for use, inhibitor for use, method, or composition of any preceding claim, wherein the LNP comprises: a) component A wherein component A is a cationic lipid; b) component B wherein component B is a sterol; c) component C wherein component C is a phosphatidylcholine; and d) component D wherein component D is a PEGylated lipid. 12. The composition for use, inhibitor for use, method, or composition of claim 11, wherein one or more, or preferably all of: a) component A is an ionizable cationic lipid, for example a tertiary amine lipid, preferably 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4-hydroxybutyl)hexan-1- aminium (ALC-0315); b) component B is an unsaturated sterol, for example wherein the unsaturated sterol is (3β)-cholest-5-en-3-ol (cholesterol), cholesta-5,24-dien-3β-ol (desmosterol), cholestadienol, 5α-cholest-7-en-3β-ol (lanthosterol), stigmast-5-en-3β-ol (beta-sitosterol) or cholesta-5,7- dien-3β-ol (7-dehydrocholesterol); c) component C is a saturated phosphatidylcholine, preferably 1,2-distearoyl-sn-glycero- 3-phosphocholine (DSPC); and/or d) component D is a PEGylated diglyceride, preferably PEGylated myristoyl diglyceride. 13. The composition for use, inhibitor for use, method, or composition of claim 11 or claim 12, wherein: a) component A is 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4- hydroxybutyl)hexan-1-aminium (ALC-0315); b) component B is (3β)-cholest-5-en-3-ol (cholesterol); c) component C is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); and d) component D is 1,2-Dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG2000). 14. The composition for use, inhibitor for use, method, or composition according to any one of claims 11-13, wherein: (i) Component A is present in 30-70 mol%, preferably 40-60 mol%, more preferably 45- 55 mol%, even more preferably 48-52 mol%; (ii) Component B is present in 25-45 mol%, preferably 30-42 mol%, more preferably 35- 40 mol%; (iii) Component C is present in 5-15 mol%, preferably 8-12 mol%, more preferably 9-11 mol%; and (iv) Component D is present in 0.5-2.5 mol%, preferably 1.2-1.8 mol%, more preferably 1.4-1.6 mol%; wherein mol% refers to the molar percentage of the particular component relative to the total lipid content of the LNP, for example where component A, component B, component C and component D are the only lipids present in the LNP, mol% refers to the molar amount of a particular component as a percentage of the total molar amount of component A, component B, component C and component D. 15. The composition for use, inhibitor for use, method, or composition of any preceding claim, wherein the nucleic acid cargo is an RNA. 16. The composition for use, inhibitor for use, method, or composition of any preceding claim, wherein the nucleic acid cargo is an mRNA. 17. The composition for use, inhibitor for use, method, or composition of any preceding claim, wherein the mRNA comprises a) SEQ ID NO: 1 or b) SEQ ID NO: 2. 18. The composition for use, inhibitor for use, method, or composition of any preceding claim, wherein the mRNA comprises a) SEQ ID NO: 3 or b) SEQ ID NO: 4. 19. The composition for use, inhibitor for use, or method, of any preceding claim, wherein a sample of the cancer or precancer has a deleterious mitochondrial DNA (mtDNA) mutation load of less than 50%. 20. The composition for use, inhibitor for use, or method, of claim 19, wherein the deleterious mitochondrial DNA (mtDNA) mutation load is less than 40%, less than 30%, or less than 20%. 21. The composition for use, inhibitor for use, or method, of any preceding claim, wherein the cancer or pre-cancer is selected from the group consisting of: a childhood cancer, haematological cancer, and a myeloid cancer. 22. The composition for use, inhibitor for use, or method, of any preceding claim, wherein the cancer or pre-cancer is selected from the group consisting of: leukemia, brain cancer, spinal cord cancer, neuroblastoma, Wilms tumor, lymphoma (such as Hodgkin and non- Hodgkin), rhabdomyosarcoma, retinoblastoma, bone cancer (such as osteosarcoma and Ewing sarcoma), melanoma, pancreatic cancer, prostate cancer, breast cancer and colorectal cancer. 23. The composition for use, inhibitor for use, or method, of any one of claims 19 to 22, wherein the deleterious mtDNA mutation is selected from the group consisting of: (i) a tRNA mutation having a MitoTIP RAW score of at least 12.6, or at least 16.25; (ii) a rRNA mutation; (iii) a truncation mutation in a mtDNA gene; (iv) a missense mutation in a mtDNA gene, wherein the missense mutation has an Apogee score of more than 0.5, optionally wherein the missense mutation is selected from a frameshift mutation, an insertion mutation or a deletion mutation; and/or (v) a mutation in a mtDNA D-loop region selected from the group consisting of: the H-strand promoter (545-567), MT-HV2 (hypervariable segment 2) m.57-372, and MT-HV1 (hypervariable segment 1) - m.16024-16390. 24. The composition for use, inhibitor for use, or method, of any one of claims 19 to 23, wherein the deleterious mtDNA mutation is in a gene selected from the group consisting of: MT-ND5, MT-ND1, MT-ND2, MT-ND3, MT-ND4, MT-ND4L, MT-ND6, MT-CO1, MT-CO2, MT- CO3, MT-CYB, MT-ATP6, MT-ATP8, MT-TL1, MT-TA, MT-TC, MT-TD, MT-TE, MT-TF, MT- TG, MT-TH, MT-TI, MT-TK, MT-TL2, MT-TM, MT-TN, MT-TP, MT-TQ, MT-TR, MT-TS1, MT- TS2, MT-TT, MT-TV, MT-TW, MT-TY, MT-RNR1 and MT-RNR2. 25. The composition for use, inhibitor for use, or method, of any one of claims 19 to 24, wherein the MT-ND5 deleterious mtDNA mutation is a truncating mutation that is in a region selected from: m.12418-12425:A indel or m.12385-12390:C indel. 26. The composition for use, inhibitor for use, or method, of any one of claims 19 to 25, wherein the deleterious mtDNA mutation is a truncation, missense, insertion, or frameshift mutation.
PCT/GB2025/051280 2024-06-11 2025-06-11 Tumour sensitisation Pending WO2025257545A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB2408360.2A GB202408360D0 (en) 2024-06-11 2024-06-11 Tumour sensitisation
GB2408360.2 2024-06-11

Publications (1)

Publication Number Publication Date
WO2025257545A1 true WO2025257545A1 (en) 2025-12-18

Family

ID=91948660

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2025/051280 Pending WO2025257545A1 (en) 2024-06-11 2025-06-11 Tumour sensitisation

Country Status (2)

Country Link
GB (1) GB202408360D0 (en)
WO (1) WO2025257545A1 (en)

Citations (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
US5811097A (en) 1995-07-25 1998-09-22 The Regents Of The University Of California Blockade of T lymphocyte down-regulation associated with CTLA-4 signaling
US5855887A (en) 1995-07-25 1999-01-05 The Regents Of The University Of California Blockade of lymphocyte down-regulation associated with CTLA-4 signaling
US6162963A (en) 1990-01-12 2000-12-19 Abgenix, Inc. Generation of Xenogenetic antibodies
WO2001014556A1 (en) 1999-08-23 2001-03-01 Dana-Farber Cancer Institute, Inc. Novel b7-4 molecules and uses therefor
US6331415B1 (en) 1983-04-08 2001-12-18 Genentech, Inc. Methods of producing immunoglobulins, vectors and transformed host cells for use therein
US6582915B1 (en) 1991-12-02 2003-06-24 Medical Research Council Production of anti-self bodies from antibody segment repertories and displayed on phage
US6682736B1 (en) 1998-12-23 2004-01-27 Abgenix, Inc. Human monoclonal antibodies to CTLA-4
WO2007005874A2 (en) 2005-07-01 2007-01-11 Medarex, Inc. Human monoclonal antibodies to programmed death ligand 1 (pd-l1)
US7229628B1 (en) 1995-07-25 2007-06-12 The Regents Of The University Of California, Office Of Technology Transfer Blockade of T lymphocyte down-regulation associated with CTLA-4 signaling
US7311910B2 (en) 1991-06-27 2007-12-25 Bristol-Myers Squibb Company Methods for treating cancer and infectious disease by blocking CTLA4-B7 interactions
US7452535B2 (en) 2002-04-12 2008-11-18 Medarex, Inc. Methods of treatment using CTLA-4 antibodies
WO2009089149A1 (en) 2008-01-03 2009-07-16 The Johns Hopkins University B7-h1 (cd274) antagonists induce apoptosis of tumor cells
WO2011066389A1 (en) 2009-11-24 2011-06-03 Medimmmune, Limited Targeted binding agents against b7-h1
US20110150892A1 (en) 2008-08-11 2011-06-23 Medarex, Inc. Human antibodies that bind lymphocyte activation gene-3 (lag-3) and uses thereof
US8008449B2 (en) 2005-05-09 2011-08-30 Medarex, Inc. Human monoclonal antibodies to programmed death 1 (PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics
US8017144B2 (en) 2001-11-30 2011-09-13 Pfizer Inc. Controlled release polymeric compositions of bone growth promoting compounds
US20110271358A1 (en) 2008-09-26 2011-11-03 Dana-Farber Cancer Institute, Inc. Human anti-pd-1, pd-l1, and pd-l2 antibodies and uses therefor
US8101176B2 (en) 2002-01-30 2012-01-24 The Brigham And Women's Hospital, Inc. Compositions and methods related to TIM-3, a TH1-specific cell surface molecule
US20120039906A1 (en) 2009-02-09 2012-02-16 INSER (Institut National de la Recherche Medicale) PD-1 Antibodies and PD-L1 Antibodies and Uses Thereof
US8119775B2 (en) 2004-07-01 2012-02-21 University Of Genoa Human anti-KIR antibodies
US8217149B2 (en) 2008-12-09 2012-07-10 Genentech, Inc. Anti-PD-L1 antibodies, compositions and articles of manufacture
WO2012145493A1 (en) 2011-04-20 2012-10-26 Amplimmune, Inc. Antibodies and other molecules that bind b7-h1 and pd-1
US8354509B2 (en) 2007-06-18 2013-01-15 Msd Oss B.V. Antibodies to human programmed death receptor PD-1
US8552156B2 (en) 2010-06-11 2013-10-08 Kyowa Hakko Kirin Co., Ltd Anti-TIM-3 antibody
US8563694B2 (en) 2009-07-31 2013-10-22 Medarex, Inc. Fully human antibodies to BTLA
WO2014008218A1 (en) 2012-07-02 2014-01-09 Bristol-Myers Squibb Company Optimization of antibodies that bind lymphocyte activation gene-3 (lag-3), and uses thereof
WO2018126084A1 (en) 2016-12-30 2018-07-05 Phaserx, Inc. Branched peg molecules and related compositions and methods
WO2020093061A1 (en) 2018-11-02 2020-05-07 Genevant Sciences Gmbh Therapeutic methods
WO2020219941A1 (en) 2019-04-26 2020-10-29 Genevant Sciences Gmbh Lipid nanoparticles
WO2024089418A1 (en) 2022-10-24 2024-05-02 Cancer Research Technology Limited Tumour sensitisation to checkpoint inhibitors with redox status modifier

Patent Citations (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6331415B1 (en) 1983-04-08 2001-12-18 Genentech, Inc. Methods of producing immunoglobulins, vectors and transformed host cells for use therein
US5403484A (en) 1988-09-02 1995-04-04 Protein Engineering Corporation Viruses expressing chimeric binding proteins
US5571698A (en) 1988-09-02 1996-11-05 Protein Engineering Corporation Directed evolution of novel binding proteins
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
US6162963A (en) 1990-01-12 2000-12-19 Abgenix, Inc. Generation of Xenogenetic antibodies
US7311910B2 (en) 1991-06-27 2007-12-25 Bristol-Myers Squibb Company Methods for treating cancer and infectious disease by blocking CTLA4-B7 interactions
US6582915B1 (en) 1991-12-02 2003-06-24 Medical Research Council Production of anti-self bodies from antibody segment repertories and displayed on phage
US6593081B1 (en) 1991-12-02 2003-07-15 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
US5811097A (en) 1995-07-25 1998-09-22 The Regents Of The University Of California Blockade of T lymphocyte down-regulation associated with CTLA-4 signaling
US5855887A (en) 1995-07-25 1999-01-05 The Regents Of The University Of California Blockade of lymphocyte down-regulation associated with CTLA-4 signaling
US7229628B1 (en) 1995-07-25 2007-06-12 The Regents Of The University Of California, Office Of Technology Transfer Blockade of T lymphocyte down-regulation associated with CTLA-4 signaling
US6682736B1 (en) 1998-12-23 2004-01-27 Abgenix, Inc. Human monoclonal antibodies to CTLA-4
WO2001014556A1 (en) 1999-08-23 2001-03-01 Dana-Farber Cancer Institute, Inc. Novel b7-4 molecules and uses therefor
US8017144B2 (en) 2001-11-30 2011-09-13 Pfizer Inc. Controlled release polymeric compositions of bone growth promoting compounds
US8101176B2 (en) 2002-01-30 2012-01-24 The Brigham And Women's Hospital, Inc. Compositions and methods related to TIM-3, a TH1-specific cell surface molecule
US7452535B2 (en) 2002-04-12 2008-11-18 Medarex, Inc. Methods of treatment using CTLA-4 antibodies
US8119775B2 (en) 2004-07-01 2012-02-21 University Of Genoa Human anti-KIR antibodies
US8008449B2 (en) 2005-05-09 2011-08-30 Medarex, Inc. Human monoclonal antibodies to programmed death 1 (PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics
WO2007005874A2 (en) 2005-07-01 2007-01-11 Medarex, Inc. Human monoclonal antibodies to programmed death ligand 1 (pd-l1)
US7943743B2 (en) 2005-07-01 2011-05-17 Medarex, Inc. Human monoclonal antibodies to programmed death ligand 1 (PD-L1)
US8900587B2 (en) 2007-06-18 2014-12-02 Merck Sharp & Dohme Corp. Antibodies to human programmed death receptor PD-1
US8354509B2 (en) 2007-06-18 2013-01-15 Msd Oss B.V. Antibodies to human programmed death receptor PD-1
WO2009089149A1 (en) 2008-01-03 2009-07-16 The Johns Hopkins University B7-h1 (cd274) antagonists induce apoptosis of tumor cells
US20110150892A1 (en) 2008-08-11 2011-06-23 Medarex, Inc. Human antibodies that bind lymphocyte activation gene-3 (lag-3) and uses thereof
US20110271358A1 (en) 2008-09-26 2011-11-03 Dana-Farber Cancer Institute, Inc. Human anti-pd-1, pd-l1, and pd-l2 antibodies and uses therefor
US8217149B2 (en) 2008-12-09 2012-07-10 Genentech, Inc. Anti-PD-L1 antibodies, compositions and articles of manufacture
US20120039906A1 (en) 2009-02-09 2012-02-16 INSER (Institut National de la Recherche Medicale) PD-1 Antibodies and PD-L1 Antibodies and Uses Thereof
US8563694B2 (en) 2009-07-31 2013-10-22 Medarex, Inc. Fully human antibodies to BTLA
US8779108B2 (en) 2009-11-24 2014-07-15 Medimmune, Limited Targeted binding agents against B7-H1
US20130034559A1 (en) 2009-11-24 2013-02-07 Medlmmune Limited Targeted Binding Agents Against B7-H1
US20140356353A1 (en) 2009-11-24 2014-12-04 Medimmune Limited Targeted binding agents against b7-h1
WO2011066389A1 (en) 2009-11-24 2011-06-03 Medimmmune, Limited Targeted binding agents against b7-h1
US8552156B2 (en) 2010-06-11 2013-10-08 Kyowa Hakko Kirin Co., Ltd Anti-TIM-3 antibody
WO2012145493A1 (en) 2011-04-20 2012-10-26 Amplimmune, Inc. Antibodies and other molecules that bind b7-h1 and pd-1
US20140044738A1 (en) 2011-04-20 2014-02-13 Amplimmune, Inc. Antibodies And Other Molecules That Bind B7-H1 And PD-1
WO2014008218A1 (en) 2012-07-02 2014-01-09 Bristol-Myers Squibb Company Optimization of antibodies that bind lymphocyte activation gene-3 (lag-3), and uses thereof
WO2018126084A1 (en) 2016-12-30 2018-07-05 Phaserx, Inc. Branched peg molecules and related compositions and methods
WO2020093061A1 (en) 2018-11-02 2020-05-07 Genevant Sciences Gmbh Therapeutic methods
WO2020219941A1 (en) 2019-04-26 2020-10-29 Genevant Sciences Gmbh Lipid nanoparticles
WO2024089418A1 (en) 2022-10-24 2024-05-02 Cancer Research Technology Limited Tumour sensitisation to checkpoint inhibitors with redox status modifier

Non-Patent Citations (14)

* Cited by examiner, † Cited by third party
Title
"REMINGTON'S PHARMACEUTICAL SCIENCES", 1990, MACK PUBLISHING COMPANY
ANSEL ET AL., PHARMACEUTICAL DOSAGE FORMS AND DRUG DELIVERY SYSTEMS, 1990
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1987, JOHN WILEY AND SONS
COHEN ET AL.: "Proc. Natl. Acad. Sci. USA", vol. 69, 1972, pages: 2110
DENIS V ET AL.: "Complementation of mitochondrial electron transport chain by manipulation of the NAD+/NADH ratio", SCIENCE, vol. 352, no. 6282, 2016, pages 231 - 5, XP055830434, DOI: 10.1126/science.aad4017
GAMBARO ROCIO: "Optimizing mRNA-Loaded Lipid Nanoparticles as a Potential Tool for Protein-Replacement Therapy", PHARMACEUTICS, vol. 16, no. 6, 6 June 2024 (2024-06-06), Switzerland, pages 771, XP093311341, ISSN: 1999-4923, Retrieved from the Internet <URL:https://doi.org/10.3390/pharmaceutics16060771> *
HALEMARHAM: "The Harper Collins Dictionary of Biology", 1991, HARPER PERENNIAL
KOPPEL, D., J. CHEM. PHYS., vol. 57, 1972, pages 4814 - 4820
LUCHANSKY ET AL., MOL. MICROBIOL., vol. 2, 1988, pages 637 - 646
MAHMOOD ET AL., NATURE CANCER, 2024
MAHMOOD MAHNOOR ET AL: "Mitochondrial DNA mutations drive aerobic glycolysis to enhance checkpoint blockade response in melanoma", NATURE CANCER, vol. 5, no. 4, 29 January 2024 (2024-01-29), pages 659 - 672, XP093311190, ISSN: 2662-1347, Retrieved from the Internet <URL:https://www.nature.com/articles/s43018-023-00721-w> DOI: 10.1038/s43018-023-00721-w *
PARDOLL IN NATURE REVIEWS CANCER, April 2012 (2012-04-01)
SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY
SINGLETONSAINSBURY: "Dictionary of Microbiology and Molecular Biology", 1994, JOHN WILEY AND SONS

Also Published As

Publication number Publication date
GB202408360D0 (en) 2024-07-24

Similar Documents

Publication Publication Date Title
US20230416408A1 (en) Compositions and Methods for Targeting Stromal Cells for the Treatment of Cancer
US20230203538A1 (en) In vivo targeting of Fibrosis by anti-CD5-targeted FAP-CAR T mRNA-LNP
JP7109789B2 (en) Compositions and methods for TCR reprogramming using fusion proteins
Evans et al. Antibody blockade of semaphorin 4D promotes immune infiltration into tumor and enhances response to other immunomodulatory therapies
US11890301B2 (en) Methods and compositions for cells expressing a chimeric intracellular signaling molecule
KR102810368B1 (en) Compositions and methods for treating autoimmune diseases and cancer
CN110678197A (en) method
US11993659B2 (en) BCMA targetting antibodies, chimeric antigen receptors, and uses thereof
KR20180127966A (en) Cardiacin-17-specific antibodies and cytotoxic cells for cancer treatment
KR20140126357A (en) C1orf32 antibodies, and uses thereof for treatment of cancer
EP3485017A1 (en) Car immune cells directed to carcinoembryonic antigen related cell adhesion molecule 6 to treat cancer
JP2016523929A (en) Soluble MIC neutralizing monoclonal antibody for treating cancer
CN121358500A (en) Lipid-based nanoparticles targeting activated immune cells to express immune cell inhibitory molecules and their applications
WO1998025946A1 (en) Monoclonal antibodies specific to endothelial cell cadherins and uses thereof
WO2020198033A1 (en) Compositions and methods for tcr reprogramming using fusion proteins
EP3340998B1 (en) Methods and compositions for cells expressing a chimeric intracellular signaling molecule
JP2026048806A (en) Compositions and methods for treating cytotoxic T-cell resistant tumors
WO2023019398A1 (en) Bcma targetting antibodies, chimeric antigen receptors, and uses thereof
US20230372395A1 (en) Car cells targeting an inserted ligand
CA2546406C (en) Angiogenesis inhibiting molecules and their use in the treatment and diagnosis of cancer
WO2023200873A2 (en) Chimeric antigen receptor compositions and methods of using the same
US12605446B2 (en) PSMA-targeted immunotherapies for cancers
US11897966B2 (en) Mesothelin-targetting antibodies, chimeric antigen receptors, and uses thereof
WO2023019396A1 (en) Mesothelin-targetting antibodies, chimeric antigen receptors, and uses thereof
US12042527B2 (en) Use of mRNAs encoding OX40L, IL-23 and IL-36gamma in combination with immune checkpoint blockade for treating particular cancers

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 25733459

Country of ref document: EP

Kind code of ref document: A1