WO2025159698A1

WO2025159698A1 - Vector comprising one or more exogenous 3' splice sites

Info

Publication number: WO2025159698A1
Application number: PCT/SG2025/050056
Authority: WO
Inventors: Zhiwei Song; Huashan Wang
Original assignee: Agency for Science Technology and Research Singapore
Current assignee: Agency for Science Technology and Research Singapore
Priority date: 2024-01-24
Filing date: 2025-01-24
Publication date: 2025-07-31
Anticipated expiration: 2026-07-24

Abstract

A vector comprising an intron having endogenous 5' and 3' splice sites, and one or more exogenous 3' splice sites downstream of and/or within the intron. Also provided are polynucleotides encoding the construct, host cells comprising the construct, kits thereof, a method of producing/increasing production of a protein of interest, and a method of preventing abnormal/incorrect splicing.

Description

VECTOR COMPRISING ONE OR MORE EXOGENOUS 3’ SPLICE SITES

TECHNICAL FIELD

The present disclosure relates to a vector comprising an intron having endogenous 5’ and 3’ splice sites, and one or more exogenous 3’ splice sites downstream of and/or within the intron. Also provided are polynucleotides encoding the construct, host cells comprising the construct, kits thereof, a method of producing/increasing production of a protein of interest, and a method of preventing abnormal/incorrect splicing.

BACKGROUND

In eukaryotic genes, exons (protein coding regions) are often separated by introns (non-coding regions). These introns are removed from pre-mRNAs, and exons are then joined together to form mature mRNA. The nucleotide sequences at the exonintron boundaries are highly conserved. In introns, the donor site or 5’ splice site consistently begins with a GU, while the acceptor site or 3’ splice site always ends with an AG. The branchpoint sequence or branch site, normally located 20-40 nucleotides upstream of the 3’ splice site, is relatively less conserved, but it always contains an adenine nucleotide (A) to facilitate splicing reaction. In some cases, the branchpoint sequence or branch site adenine nucleotide (A) can be several hundred nucleotides upstream of the 3’ splice site.

Introns play important roles in gene expression regulation. For example, the major immediate-early protein (IE) gene of human cytomegalovirus (hCMV) is transcribed by one of the strongest promoter/enhancer complexes known. This complex has been widely used in expression vectors to drive the production of recombinant proteins, including antibodies, in mammalian cells. The presence of intron A, located in the 5’ untranslated region (5’ UTR) of the IE gene, significantly enhances the transcriptional efficiency of the CMV promoter.

Like the Intron A of hCMV, many mammalian genes have an intron located within 100 base pairs downstream of the transcription start site in the 5’ UTR. Many introns can enhance gene expression and increase transcript levels by affecting almost every step of gene expression, from transcription initiation to translation (Shaul, 2017; Rose 2019). However, the detailed molecular mechanisms for IME remain to be elucidated.

Commercial expression vectors often include an intron inserted in the 5’ UTR. These introns can enhance expression level of reporter genes such as luciferase or GFP. They also increase the productivity of secreted glycoproteins (Chapman et al., 1991; Xu et al., 2001 ; Xia et al., 2006). This concept holds true unless the gene of interest contains 3' splicing sites within the ORF. in such case, the intron’s 5’ splice site in the vector might bypass its usual 3' site and link with the ORF's 3^: site, resulting in a truncated mRNA. The present inventors observed frequent occurrence of this abnormal splicing when expressing antibody heavy chains in such vectors. This abnormal splicing always leads to a significant reduction in antibody production.

Hence, there is a need for an expression vector/method that effectively prevents, deduces such abnormal splicing, leading to a substantial enhancement in antibody production in host cells, such as CHO ceils.

SUMMARY

In one aspect, there is provided a vector comprising an intron having endogenous 5’ and 3’ splice sites, and one or more exogenous 3’ splice sites downstream of and/or within the intron.

In one embodiment, the exogenous 3’ splice site is downstream of the intron, for example immediately downstream of the intron.

In one embodiment, the exogenous 3’ splice site is placed between an intron and an exon, or the open reading frame of a gene of interest, such as wherein the exogenous 3’ splice site is placed downstream of the 3’ end of an intron and immediately before an exon.

In one embodiment, the exogenous 3’ splice site is within the intron, for example wherein the exogenous 3’ splice site is placed downstream of the branch point of the intron.

In one embodiment, the 3’ exogenous splice site is placed between the branch point and the 3’ splice site of the intron.

In one embodiment, the 3’ exogenous splice site is placed between the branch point and the 5’ splice site of the intron.

In one embodiment, the exogenous 3’ splice site is a 3’ splice site derived/obtained from another intron.

In one embodiment, the exogenous 3’ splice site is derived/obtained from a first intron of a gene.

In one embodiment, the exogenous 3’ splice site comprises a sequence extending from the branch point to the splice site (AG site) at the 3’ end of an intron.

In one embodiment, the exogenous 3’ splice site comprises a sequence extending from the branch point to the splice site (AG site) at the 3’ end of an intron, and excludes the 5’ splice site (GT site) of the intron.

In one embodiment, the exogenous 3’ splice site further comprises a sequence upstream of the branch point, for example 1-25 or more nucleobases, such as 1-50, 1- 100, 1-150, or 1 - 200 nucleobases upstream of the branch point.

In one embodiment, the exogenous 3’ splice site comprises a sequence extending from upstream of the branch point to the splice site (AG) at the 3’ end of an intron, excluding the intron's 5’ splice site (GT).

In one embodiment, the exogenous 3’ splice site comprises an adenine nucleotide at its branch point.

In one embodiment, the exogenous 3’ splice site comprises GCCACTGACTCT, GCCACTAACTCT, or CTAACCAT, where underlined is the A branchpoint.

In one embodiment, the exogenous 3’ splice site comprises AGGTT, for example wherein the exogenous 3’ splice site terminates at the 3’ end with AGGTT.

In one embodiment, the exogenous 3’ splice site lacks a translation start codon, such as ATG, for example wherein the exogenous 3’ splice site is modified to remove any ATG motifs.

In one embodiment, the exogenous 3’ splice site is one or more selected from the group comprising: the 3’ splice site from SP6 intron, the 3’ splice site based on the consensus sequence of all human introns, the 3’ splice site of human beta-globulin intron, and the like.

In one embodiment, the exogenous 3’ splice site is one or more selected from the group consisting of: a. SP6 branch point and 3’ splicing site consensus sequences (3’ SS A): GCCACTGACTCTttcctttqtcctqttcccatttccAGGTT (SEQ ID NO: 1), b. Branch point and 3’ splicing site based on consensus sequences of all human genes (3’ SS B):

AATACTCTGAGTCCAAACCGGGCCCCGCCACTAACTCTttcctttttctttttttttttcttttC

AGGTT (SEQ ID NO: 2), and c. b-globin intron (3’ SSC):

AATACTCTGAGTCCAAACCGGGCCCCTCTGCTAACCATGTTCATGCCTTCT

TCTTTTTCCTACAGGTT (SEQ ID NO: 3), where the underlined sequence is the conserved sequence surrounding the A (bold), and d. a variant thereof at least 80% identical to any of the above.

In one embodiment, the exogenous 3’ splice site is one or more selected from the group consisting of: a. SP6 branch point and 3’ splicing site consensus sequences (3’ SS A):

GCCACTGACTCTttcctttqtcctqttcccatttccAGGTT (SEQ ID NO: 1), b. Branch point and 3’ splicing site based on consensus sequences of all human genes (3’ SS B):

AATACTCTGAGTCCAAACCGGGCCCCGCCACTAACTCTttcctttttctttttttttttcttttC

AGGTT (SEQ ID NO: 2), and c. b-globin intron (3’ SS C):

AATACTCTGAGTCCAAACCGGGCCCCTCTGCTAACCATGTTCATGCCTTCT

TCTTTTTCCTACAGGTT (SEQ ID NO: 3), where the underlined sequence is the conserved sequence surrounding the A (bold).

In one embodiment, the vector comprises two or more, such as two, three, four or five exogenous 3’ splice sites, in particular three exogenous 3’ splice sites.

In one embodiment, the vector comprises: a. the 3’ splice site from SP6 intron and the 3’ splice site based on the consensus sequence of all human introns; b. the 3’ splice site from SP6 intron and the 3’ splice site of human betaglobulin intron; c. the 3’ splice site based on the consensus sequence of all human introns and the 3’ splice site of human beta-globulin intron; d. the 3’ splice site from SP6 intron, the 3’ splice site based on the consensus sequence of all human introns, and the 3’ splice site of human beta-globulin intron; or e. a fusion of the 3’ splice site from SP6 intron, the 3’ splice site based on the consensus sequence of all human introns, and the 3’ splice site of human beta-globulin intron.

In one embodiment, the vector comprises: a. SEQ ID NO: 1 and SEQ ID NO: 2; b. SEQ ID NO: 1 and SEQ ID NO: 3; c. SEQ ID NO: 2 and SEQ ID NO: 3; d. SEQ ID NO: 1 , SEQ ID NO: 2 and SEQ ID NO: 3; e. a fusion of SEQ ID NO: 1 , SEQ ID NO: 2 and SEQ ID NO: 3

GCCACTGACTCTTTCCTTTGTCCTGTTCCCATTTCCAGGTTAATACT CTGAGTCCAAACCGGGCCCCGCCACTAACTCTTTCCTTTTTCTTTTT TTTTTTCTTTTCAGGTTAATACTCTGAGTCCAAACCGGGCCCCTCTG CTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGGTT (SEQ ID NO: 4); or f. a variant thereof at least 80% identical to any of the above.

In one embodiment, the intron is selected from the group comprising: a naturally existing intron without alteration, such as Intron A from the CMV genome, or a recombinant/engineered intron, such as a truncated version of a naturally existing intron.

In one embodiment, the intron is Intron A from CMV genome or a truncated version of Intron A from the CMV genome.

In one embodiment, the intron comprises its own 5’ splice site, a branch point, and its own (endogenous) 3’ splice site.

In one embodiment, the vector comprises:

In one embodiment, the intron is the first intron immediately downstream of the promoter (for example Intron 1 or Intron A).

In one embodiment, the vector further comprises one or more of a promoter, for example selected from the group consisting of rEF1a promoter, hEEF2 promoter, CMV promoter, EF-1a promoter, EF2 promoter, and SV40 promoter.

In one embodiment, the vector comprises a polynucleotide encoding a gene of interest, for example an antibody, such as an antibody heavy and/or light chain.

In one embodiment, the vector comprises:

In one embodiment, the vector comprises a polynucleotide encoding an antibody heavy chain and/or light chain with a signal peptide.

In one embodiment, the vector comprises one or more polynucleotides encoding one or more of the following signal peptides of the antibody heavy chain or light chain:

H1 MELGLSWIFLLAILKGVQC (SEQ ID NO: 5),

H2 MELGLRWVFLVAILEGVQC (SEQ ID NO: 6),

H3 MKHLWFFLLLVAAPRWVLS (SEQ ID NO: 7),

H4 MDWTWRILFLVAAATGAHS (SEQ ID NO: 8),

H5 MDWTWRFLFVVAAATGVQS (SEQ ID NO: 9),

H6 MEFGLSWLFLVAILKGVQC (SEQ ID NO: 10),

H7 MEFGLSWVFLVALFRGVQC (SEQ ID NO: 11),

H8 MDLLHKNMKHLWFFLLLVAAPRWVLS (SEQ ID NO: 12),

L1 MDMRVPAQLLGLLLLWLSGARC (SEQ ID NO: 13), and a variant of any of the above having a sequence identity of at least 80%.

In one embodiment, the vector comprises a polynucleotide having a sequence that is at least 75% identical to a sequence selected from the group consisting of:

H1

ATGGAGTTGGGACTGAGCTGGATTTTCCTTTTGGCTATTTTAAAAGGTGTC

CAGTGT (SEQ ID NO: 14)

H2

ATGGAACTGGGGCTCCGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTC

CAGTGT (SEQ ID NO: 15)

H3

ATGAAACACCTGTGGTTCTTCCTCCTGCTGGTGGCAGCTCCCAGATGGGT

CCTGTCC (SEQ ID NO: 16)

H4

ATGGACTGGACCTGGAGGATCCTCTTCTTGGTGGCAGCAGCAACAGGTGC

CCACTCG (SEQ ID NO: 17)

H5

ATGGACTGGACCTGGAGGTTCCTCTTTGTGGTGGCAGCAGCTACAGGTGT

CCAGTCC (SEQ ID NO: 18)

H6

ATGGAGTTTGGGCTGAGCTGGCTTTTTCTTGTGGCGATTCTAAAAGGTGTC

CAGTGT (SEQ ID NO: 19)

H7

ATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTTAGAGGTGTC

CAGTGT (SEQ ID NO: 20)

H8

ATGGACCTCCTGCACAAGAACATGAAACACCTGTGGTTCTTCCTCCTCCTG

GTGGCAGCTCCCAGATGGGTGCTGTCC (SEQ ID NO: 21), and

L1

ATGGACATGAGGGTCCCTGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCT CTCAGGTGCCAGATGT (SEQ ID NO: 22).

In one embodiment, the vector comprises a polynucleotide encoding for an open reading frame (ORF) of a heavy chain(s) selected from the group consisting of Trastuzumab, Rituximab, a member of IGHV1 family such as IGHV1-46, and a member of IGHV3 family such as IGHV3-23.

In one embodiment, the vector further comprises a poly-A-tail signal.

In one embodiment, the vector comprises a nucleic acid sequence as set forth in SEQ ID NO: 24.

In one embodiment, the vector is selected from the group comprising: pBEE (rat EF1-alpha promoter with intron), pCHOl .O (human EF-2 promoter with intron), pcDNA3.1 (CMV promoter without intron), pCMV-lntron A (CMV promoter with Intron A), and the like.

In one aspect, there is provided a polynucleotide encoding the vector as described above.

In one aspect, there is provided a host cell comprising the vector and/or polynucleotide as described above.

In one aspect, there is provided a kit or system containing a vector or a cell according to any one of the preceding claims.

In one aspect, there is provided a method of producing (or increasing the production of) a protein of interest, comprising: providing the vector as described above in an expression system.

In one embodiment, the method increases the production of a protein of interest in the presence of abnormal (or incorrect) splicing when the open reading frame (ORF) is placed downstream of an intron, such as Intron A.

In one embodiment, the method increases the production of a protein of interest even in the absence of abnormal (or incorrect) splicing.

In one aspect, there is provided a method of preventing abnormal (or incorrect) splicing, comprising: providing the vector as described above in an expression system.

In one aspect, there is provided a method of producing (or increasing the production of) a protein of interest, comprising: providing and/or introducing an exogenous 3’ splice site downstream of and/or within an intron downstream of a promoter region.

In one aspect, there is provided a method of preventing abnormal (or incorrect) splicing in the expression of a gene of interest comprising: providing and/or introducing an exogenous 3’ splice site downstream of and/or within an intron downstream of a promoter region.

In one embodiment, the method provides and/or introduces an exogenous 3’ splice site downstream of an intron 3’ splice site of a promoter region, for example wherein the exogenous 3’ splice site is immediately downstream of an intron.

In one embodiment, the method provides and/or introduces an exogenous 3’ splice site within an intron 3’ splice site of a promoter region, for example between the branch point and the 5’ splice site of the intron.

In one embodiment, the vector comprising the gene of interest comprises an intron that comprises 5’ and 3’ endogenous splice sites.

In one embodiment, the exogenous 3’ splice site is about 0 to 50 nucleobases from the intron.

In one embodiment, the exogenous 3’ splice site is placed between an intron and an exon, for example at the 3’ end of an intron and immediately before an exon.

In one embodiment, the exogenous 3’ splice site is selected from the group comprising the 3’ splice site of SP6 intron, the 3’ splice site based on the consensus sequence of all human introns, the 3’ splice site of human beta-globulin intron, and the like.

In one embodiment, wherein the intron is the first intron immediately downstream of the promoter (i.e. Intron A or Intron 1).

In one embodiment, the promoter is selected from the group consisting of rEF1a promoter, hEEF2 promoter, CMV promoter, EF-1a promoter and EF2 promoters from other mammals, and SV40 promoter.

In one embodiment, the exogenous 3’ splice site is introduced in a promoter/intron pair selected from the group consisting of CMV/lntron A and rEF1a/lntron1.

DEFINITIONS

As used herein, an “expression construct” is generally depicted from the 5’ end to the 3’ end, recognizing that the construct may be a circular DNA molecule.

As used herein, the term “exogenous 3’ splice site” refers to a 3’ splice site (also called a 3’ SS) that is not intrinsically available in the intron already present in the construct but is externally introduced into the construct/vector. That is, the construct/vector in its original state would not comprise the exogenous splice site. The present invention introduces one or more exogenous 3’ splice sites into the construct/vector.

Unless specified, the “exogenous 3’ splice site” is not confined solely to the AG site located at the 3’ end of an intron. It may for example comprise the DNA sequence from the branch point to the splice site (AG site) at the intron’s 3’ end. It may also further comprise part of the intronic sequence upstream of the branch point. However, it will typically exclude the 5’ splice site. As such, as used herein, the term “exogenous 3’ splice site” includes part of the intron but lacks the 5’ splice site (GT site). Specifically, the

‘exogenous 3’ splice site’ spans from at least the DNA sequence from the branch point to the 3’ splice site at the intron’s 3’ end. Therefore, each additional exogenous 3’ splice site may contain the DNA sequence spanning at least from the branch point to the splice site (AG site) at the 3’ end of the corresponding naturally occurring intron (see examples such as 3’ SS A, B and C at Figure 6).

As used herein, the term ‘5’ splice site’ refers to the splice donor site found at the 5’ end of an intron. The 5’ splice site comprises an almost invariant sequence (i.e. GU in mRNA and GT in DNA) within a larger less highly conserved region. Thus, an exogenous 3’ splice site which lacks or excludes a 5’ splice site does not have the GT site.

As used herein, the term “downstream” refers to a position that is at the 3’ site end of a reference point. Therefore, a splice site that is downstream of an intron is a splice site that is positioned at one or more nucleobase apart from the 3’ end of the intron.

As used herein, the term “upstream” refers to a position that is at the 5’ site end of a reference point. Therefore, a splice site that is upstream of an intron is a splice site that is positioned at one or more nucleobase apart from the 5’ end of the intron.

As used herein, the term “within the intron” refers to any position within the intron itself, as opposed to before the 5’ site end (i.e. upstream of the intron) or after the 3’ site end (i.e. downstream of the intron). Therefore, a splice site that is “within the intron” will be flanked by at least one nucleobase of the intron at both its 3’ and 5’ ends.

As used herein, the term “endogenous splice site” refers to a native splice site inherently present in the naturally occurring intron that was integrated into the construct. That is, the construct/vector in its original state comprises the endogenous splice site. Without wishing to be bound by theory, the inventors of the present disclosure found that the endogenous splice site without additional exogenous splice site (3’ splice site of another intron) may cause abnormal (or incorrect) splicing of the gene of interest, which thereby caused the incomplete or truncated expression of the protein of interest.

As used herein, the term “immediately downstream of an intron” generally refers to about 0 to 50, or more, nucleobases distance from the 3’ end of an intron.

As used herein, the term “intron” refers to non-coding regions found in polynucleotides that are typically removed during pre-mRNA maturation by splicing. Introns may be numbered consecutively on their order within a gene or downstream of a promoter. Accordingly, the first non-coding region in a gene immediately after a promoter may be referred to as Intron 1. In specific promoters, the introns may be referred accordingly. For example, in the CVM promoter, Intron A is the intron downstream of the CVM promoter. Therefore, in some examples, the additional/exogenous splice site as described herein may be provided immediately downstream of Intron A or Intron 1.

As understood in the art, an intron can typically be found within 100 nucleotides downstream of the transcription start site, but upstream of the translation start site ATG. Removal of this intron does not change the open reading frame. Many introns (such as Intron A) are known to have the function of enhancing gene expression.

As used herein, the term “branch point” or “branching point” refers to a short motif which typically contains a conserved adenosine (A) nucleotide that is located upstream of the 3’ acceptor splice site. The branch point is essential for the RNA splicing mechanism and forms a lariat structure during splicing, which is an intermediate form before the intron is fully excised.

As used herein, the “signal peptide” is a peptide that plays an important role in facilitating the secretion of a protein from the cell.

As used herein, the term “abnormal” or “incorrect” splicing refers to an event where an endogenous splicing site in an intron caused an aberrant/undesired truncation or incomplete expression of a protein of interest. In some examples, when an abnormal splicing occurs, the resulting protein is typically a truncated or incomplete version as compared to a full expression of the protein of interest.

The term "and/or", e.g., "X and/or Y" is understood to mean either "X and Y" or "X or Y" and should be taken to provide explicit support for both meanings or for either meaning.

Further, in the description herein, the word “substantially” whenever used is understood to include, but not restricted to, "entirely" or “completely” and the like. In addition, terms such as "comprising", "comprise", and the like whenever used, are intended to be non-restricting descriptive language in that they broadly include elements/components recited after such terms, in addition to other components not explicitly recited. For example, when “comprising” is used, reference to a “one” feature is also intended to be a reference to “at least one” of that feature. Terms such as “consisting”, “consist”, and the like, may in the appropriate context, be considered as a subset of terms such as "comprising", "comprise", and the like. Therefore, in embodiments disclosed herein using the terms such as "comprising", "comprise", and the like, it will be appreciated that these embodiments provide teaching for corresponding embodiments using terms such as “consisting”, “consist”, and the like. Further, terms such as "about", "approximately" and the like whenever used, typically means a reasonable variation, for example a variation of +/- 5% of the disclosed value, or a variance of 4% of the disclosed value, or a variance of 3% of the disclosed value, a variance of 2% of the disclosed value or a variance of 1% of the disclosed value.

Furthermore, in the description herein, certain values may be disclosed in a range. The values showing the end points of a range are intended to illustrate a preferred range. Whenever a range has been described, it is intended that the range covers and teaches all possible sub-ranges as well as individual numerical values within that range. That is, the end points of a range should not be interpreted as inflexible limitations. For example, a description of a range of 1% to 5% is intended to have specifically disclosed sub-ranges 1% to 2%, 1% to 3%, 1 % to 4%, 2% to 3% etc., as well as individually, values within that range such as 1%, 2%, 3%, 4% and 5%. It is to be appreciated that the individual numerical values within the range also include integers, fractions and decimals. Furthermore, whenever a range has been described, it is also intended that the range covers and teaches values of up to 2 additional decimal places or significant figures (where appropriate) from the shown numerical end points. For example, a description of a range of 1% to 5% is intended to have specifically disclosed the ranges 1 .00% to 5.00% and also 1 .0% to 5.0% and all their intermediate values (such as 1 .01 %, 1.02% ... 4.98%, 4.99%, 5.00% and 1.1%, 1.2% ... 4.8%, 4.9%, 5.0% etc.,) spanning the ranges. The intention of the above specific disclosure is applicable to any depth/breadth of a range.

Additionally, when describing some embodiments, the disclosure may have disclosed a method and/or process as a particular sequence of steps. However, unless otherwise required, it will be appreciated that the method or process should not be limited to the particular sequence of steps disclosed. Other sequences of steps may be possible. The particular order of the steps disclosed herein should not be construed as undue limitations. Unless otherwise required, a method and/or process disclosed herein should not be limited to the steps being carried out in the order written. The sequence of steps may be varied and still remain within the scope of the disclosure.

Furthermore, it will be appreciated that while the present disclosure provides embodiments having one or more of the features/characteristics discussed herein, one or more of these features/characteristics may also be disclaimed in other alternative embodiments and the present disclosure provides support for such disclaimers and these associated alternative embodiments.

DESCRIPTION OF EMBODIMENTS

It will be appreciated by a person skilled in the art that other variations and/or modifications may be made to the embodiments disclosed herein without departing from the spirit or scope of the disclosure as broadly described. For example, in the description herein, features of different exemplary embodiments may be mixed, combined, interchanged, incorporated, adopted, modified, included etc. or the like across different exemplary embodiments. The present embodiments are, therefore, to be considered in all respects to be illustrative and not restrictive.

The key to the presently disclosed technology is to insert one or more, such as 1 , 2 or 3 additional 3’ splice sites (DNA fragments) downstream of the usual 3' splice site in an expression construct/vector. In the presence of these additional (exogenous) 3' splice sites, the abnormal splicing of the antibody transcripts is completely prevented, resulting in a significantly enhanced gene expression and antibody production. Unexpectedly, the presently disclosed novel construct/vector achieved over a 6-fold increase in antibody production compared to the most used commercial vector, thus conclusively demonstrating the present invention's superiority over global commercial vectors and existing alternatives.

Hence, in one aspect, there is provided a vector comprising an intron having endogenous 5’ and 3’ splice sites, and one or more exogenous 3’ splice sites downstream of and/or within the intron.

In one aspect, there is provided a recombinant expression construct comprising one or more intron and one or more exon, wherein said construct comprises one or more exogenous splice site downstream and/or upstream of the intron.

In one aspect, there is provided a recombinant expression construct comprising one or more intron and one or more exon, wherein said construct comprises one or more exogenous splice site downstream of and/or within the intron.

In one embodiment, the vector comprises an intron having endogenous 5’ and 3’ splice sites, and one or more exogenous 3’ splice sites downstream of the intron.

In one embodiment, the exogenous splice site is downstream of the intron. Without wishing to be bound by theory, the inventors of the present disclosure believe that the exogenous splice site may be placed at any site downstream of the intron. In some examples, the splice site is about 10 to 20 nucleobases from the 3’ end of the intron. In some examples, the splice site is immediately downstream of the intron, or about 0 nucleobase from the 3’ end of the intron.

In some examples, a transcription unit in an expression construct as described herein may comprise two exons and one intron in between, where the second exon may include the cDNA open reading frame (ORF) encoding the protein to be produced. Therefore, in some examples, the recombinant expression construct as described herein may comprise an intron and two exons unit, wherein the second exon (i.e. exon at 3’ end) comprises the cDNA open reading frame (ORF) encoding the protein of interest.

As would be understood by the person skilled in the art, there can be multiple expression cassettes in one construct. Each cassette contains the regulatory sequence (e.g., a promoter), an intron followed by the coding sequence of the gene to be produced.

In some examples, the exogenous splice site may be inserted about 0 nucleobase, 1 nucleobase, 2 nucleobases, 3 nucleobases, 4 nucleobases, 5 nucleobases, 6 nucleobases, 7 nucleobases, 8 nucleobases, 9 nucleobases, 10 nucleobases, 11 nucleobases, 12 nucleobases, 13 nucleobases, 14 nucleobases, 15 nucleobases, 16 nucleobases, 17 nucleobases, 18 nucleobases, 19 nucleobases, 20 nucleobases, 21 nucleobases, 22 nucleobases, 23 nucleobases, 24 nucleobases, 25 nucleobases, 26 nucleobases, 27 nucleobases, 28 nucleobases, 29 nucleobases, 30 nucleobases, 31 nucleobases, 32 nucleobases, 33 nucleobases, 34 nucleobases, 35 nucleobases, 40 nucleobases, 45 nucleobases, 50 nucleobases, 100 nucleobases, 200 nucleobases, 300 nucleobases, 400 nucleobases, 500 nucleobases, 600 nucleobases, 700 nucleobases, 800 nucleobases, 900 nucleobases, or 1000 nucleobases, or more from the 3’ end of an intron. In some examples, the splice site is about 2 to 20 nucleobases from the 3’ end of the intron. In some examples, the splice site is immediately upstream and/or downstream the intron, or about 0 nucleobase from the intron.

In one embodiment, the exogenous splice site is immediately downstream of the intron.

In one embodiment, the exogenous splice site is about 0 to 50 or more, nucleobases distance from the 3’ end of an intron.

In one embodiment, the exogenous splice site is about 0 to 20 nucleobases distance from the 3’ end of an intron.

In some examples, the splice site is about 0 nucleobase from the 3’ end of the intron, 1 nucleobase from the 3’ end of the intron, 2 nucleobases from the 3’ end of the intron, 3 nucleobases from the 3’ end of the intron, 4 nucleobases from the 3’ end of the intron, 5 nucleobases from the 3’ end of the intron, 6 nucleobases from the 3’ end of the intron, 7 nucleobases from the 3’ end of the intron, 8 nucleobases from the 3’ end of the intron, 9 nucleobases from the 3’ end of the intron, 10 nucleobases from the 3’ end of the intron, 11 nucleobases from the 3’ end of the intron, 12 nucleobases from the 3’ end of the intron, 13 nucleobases from the 3’ end of the intron, 14 nucleobases from the 3’ end of the intron, 15 nucleobases from the 3’ end of the intron, 16 nucleobases from the 3’ end of the intron, 17 nucleobases from the 3’ end of the intron, 18 nucleobases from the 3’ end of the intron, 19 nucleobases from the 3’ end of the intron, 20 nucleobases from the 3’ end of the intron, 21 nucleobases from the 3’ end of the intron, 22 nucleobases from the 3’ end of the intron, 23 nucleobases from the 3’ end of the intron, 24 nucleobases from the 3’ end of the intron, 25 nucleobases from the 3’ end of the intron, 26 nucleobases from the 3’ end of the intron, 27 nucleobases from the 3’ end of the intron, 28 nucleobases from the 3’ end of the intron, 29 nucleobases from the 3’ end of the intron, 30 nucleobases from the 3’ end of the intron, 31 nucleobases from the 3’ end of the intron, 32 nucleobases from the 3’ end of the intron, 33 nucleobases from the 3’ end of the intron, 34 nucleobases from the 3’ end of the intron, 35 nucleobases from the 3’ end of the intron, 40 nucleobases from the 3’ end of the intron, 45 nucleobases from the 3’ end of the intron, 50 nucleobases from the 3’ end of the intron, or more.

In one embodiment, the exogenous splice site is placed between an intron and an exon, or the open reading frame of the gene of interest.

In one embodiment, the splice site is placed downstream of the 3’ end of an intron and immediately before an exon.

In one embodiment, the exogenous 3’ splice site is within the intron. Unexpectedly, the present inventors have established that the various advantages of the present invention, such as a reduction/complete elimination of abnormal/incorrect alternative splicing or increase in protein production levels can also be achieved by inserting one or more exogenous 3’ splice sites within the intron (as opposed to downstream or upstream of the intron).

In one embodiment, the exogenous 3’ splice site is placed between the branch point and the 3’ splice site of the intron.

In another embodiment, the exogenous 3’ splice site is placed between the branch point and the 5’ splice site of the intron.

In one embodiment, the exogenous splice site is a 3’ splice site derived/obtained from another intron.

Without wishing to be bound by theory, it is believed that a 3’ splicing site from any intron known in the art would be compatible with the expression vector as described herein. That is, the exogenous 3’ splicing site as used herein may be derived from sites originating from diverse introns, introns from distinct genes, and even different organisms. Therefore, in some examples, the exogenous 3’ splicing site may be derived from an intron derived from any multi-cellular organism. In some examples, the exogenous 3’ splicing site may be derived from an animal or a plant. In some examples, the exogenous 3’ splicing site may be derived from a Porifera (e g. sea sponges), a Cnidaria (e.g. jellyfish), a Platyhelminthes (e.g. a flatworm), an Annelida (e.g. earthworms), a Mollusca (e.g. a sea slug), an Arthropoda (e.g. insects), a Chordata (e.g. mammals, fish, reptiles, birds, and the like), and the like. In some examples, the exogenous 3’ splicing site may be derived from a mammal. In some examples, a mammal may include, but is not limited to, human, a primate, a member of a murine family (such as a rat, mouse, and the like), a member of a Leporidae family (such as a rabbit, and the like), bovine, porcine, equine, canine, feline, ovine, avian, piscine, caprine, corvine, and the like. The exogenous 3’ splicing site need not be identical to the source intronic sequence, for example it may have 80% or more, such as 85%, 90%, 95%, 99% sequence homology with the intronic sequence.

In one embodiment, the exogenous 3’ splice site sequence is derived/obtained from the first intron of a gene.

In one embodiment, the exogenous 3’ splice site comprises an intronic sequence but lacks the 5’ splice site. Thus, in one embodiment, the exogenous 3’ splice site lacks the 5’ splice site.

In one embodiment, the exogenous 3’ splice site comprises a sequence extending from the branch point to the splice site (AG site) at the 3’ end of the intron.

In one embodiment, the exogenous 3’ splice site comprises a sequence extending from the branch point to the splice site (AG site) at the 3’ end of the intron and lacks the 5’ splice site.

Thus, in one embodiment, the exogenous 3’ splice site comprises a sequence upstream of the branch point, the branch point, and a sequence extending from the branch point to the splice site (AG site).

In another embodiment, the exogenous 3’ splice site comprises a sequence spanning from upstream of the branch point to the 3’ splice site of the intron.

In one embodiment, the exogenous 3’ splice site comprises a sequence extending from a region upstream of the branch point to the splice site (AG) at the 3’ end of an intron, excluding the intron's 5’ splice site (GT).

In some examples, the upstream sequence may be 1-25 nucleobases or more, such as 1-50, 1-100, 1-150 or 1 - 200 nucleobases upstream of the branch point. For example, the upstream sequence may be 1 nucleobase, 2 nucleobases, 3 nucleobases, 4 nucleobases, 5 nucleobases, 6 nucleobases, 7 nucleobases, 8 nucleobases, 9 nucleobases, 10 nucleobases, 11 nucleobases, 12 nucleobases, 13 nucleobases, 14 nucleobases, 15 nucleobases, 16 nucleobases, 17 nucleobases, 18 nucleobases, 19 nucleobases, 20 nucleobases, 21 nucleobases, 22 nucleobases, 23 nucleobases, 24 nucleobases, 25 nucleobases, 26 nucleobases, 27 nucleobases, 28 nucleobases, 29 nucleobases, 30 nucleobases, 31 nucleobases, 32 nucleobases, 33 nucleobases, 34 nucleobases, 35 nucleobases, 40 nucleobases, 45 nucleobases, 50 nucleobases, 60 nucleobases, 70 nucleobases, 80 nucleobases, 90 nucleobases, 100 nucleobases, 110 nucleobases, 120 nucleobases, 130 nucleobases, 140 nucleobases, 150 nucleobases, 160 nucleobases, 170 nucleobases, 180 nucleobases, 190 nucleobases or 200 nucleobases upstream of the branch point,

In one embodiment, the exogenous splice site comprises an adenine nucleotide at its branch point.

In one embodiment, the exogenous splice site comprises GCCACTGACTCT, GCCACTAACTCT, or CTAACCAT, where underlined is the A branchpoint.

In one embodiment, the exogenous 3’ splice site lacks a translation start codon, such as ATG, for example wherein the exogenous 3’ splice site is modified to remove any ATG motifs. Without being bound by theory, the present inventors believe that removing any translation start codons may help to avoid any unnecessary complications due to the presence of a start codon within the exogenous 3’ splice site.

In one embodiment, the exogenous 3’ splice site is one or more selected from the group consisting of, but not limited to: a. SP6 branch point and 3’ splicing site consensus sequences (3’ SS A): GCCACTGACTCTttcctttqtcctgttcccatttccAGGTT (SEQ ID NO: 1), b. Branch point and 3’ splicing site based on consensus sequences of all human genes (3’ SS B):

AATACTCTGAGTCCAAACCGGGCCCCGCCACTAACTCTttcctttttctttttttttttcttttC

AGGTT (SEQ ID NO: 2), and c. b-globin intron (3’ SSC):

AATACTCTGAGTCCAAACCGGGCCCCTCTGCTAACCATGTTCATGCCTTCT

AATACTCTGAGTCCAAACCGGGCCCCGCCACTAACTCTttcctttttctttttttttttcttttC

AGGTT (SEQ ID NO: 2), and c. b-globin intron (3’ SS C):

AATACTCTGAGTCCAAACCGGGCCCCTCTGCTAACCATGTTCATGCCTTCT

In some examples, the construct or vector may comprise one exogenous 3’ splice site, or two exogenous 3’ splice sites, or three exogenous 3’ splice sites, or four exogenous 3’ splice sites, or five exogenous 3’ splice sites, or more than five exogenous 3’ splice sites downstream of the intron.

In one embodiment, the construct or vector comprises two or more, such as three exogenous splice sites. Advantageously, including two or more exogenous 3’ splice sites may have an additive effect, thereby further reducing abnormal/incorrect alternative splicing and/or enhancing gene expression/protein production.

The two or more exogenous 3’ splice sites may be directly linked together (i.e. a fusion) or may be separated by one or more nucleotides/spacers. Thus, in one embodiment, the two or more exogenous 3’ splice sites are fused together. In another embodiment, the two or more exogenous 3' splice sites are separated by one or more nucleotides/spacers.

In one embodiment, the construct or vector comprises: a. the 3’ splice site from SP6 intron and the 3’ splice site based on the consensus sequence of all human introns; b. the 3’ splice site from SP6 intron and the 3’ splice site of human beta-globulin intron; c. the 3’ splice site based on the consensus sequence of all human introns and the 3’ splice site of human beta-globulin intron; d. the 3’ splice site from SP6 intron, the 3’ splice site based on the consensus sequence of all human introns, and the 3’ splice site of human beta-globulin intron; or e. a fusion of the 3’ splice site from SP6 intron, the 3’ splice site based on the consensus sequence of all human introns, and the 3’ splice site of human beta-globulin intron.

In one embodiment, the construct or vector comprises: a. SEQ ID NO: 1 and SEQ ID NO: 2; b. SEQ ID NO: 1 and SEQ ID NO: 3; c. SEQ ID NO: 2 and SEQ ID NO: 3; d. SEQ ID NO: 1 , SEQ ID NO: 2 and SEQ ID NO: 3; e. a fusion of SEQ ID NO: 1 , SEQ ID NO: 2 and SEQ ID NO: 3

GCCACTGACTCTTTCCTTTGTCCTGTTCCCATTTCCAGGTTAATACTCT GAGTCCAAACCGGGCCCCGCCACTAACTCTTTCCTTTTTCTTTTTTTTT TTCTTTTCAGGTTAATACTCTGAGTCCAAACCGGGCCCCTCTGCTAAC CATGTTCATGCCTTCTTCTTTTTCCTACAGGTT (SEQ ID NO: 4); or f. a variant thereof at least 80% identical to any of the above.

The variant thereof may be at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to any of the nucleotide sequences disclosed herein.

In one embodiment, the intron is selected from the group comprising Intron A from the CMV genome, elongation factor 1a, and elongation factor 2.

In one embodiment, the intron is a naturally existing intron, such as Intron A from CMV genome.

In one embodiment, the intron is a truncated version of a naturally existing intron, such as a truncated version of Intron A from the CMV genome. Surprisingly, the present inventors have established that the various advantages of the present invention, such as a reduction/complete elimination of abnormal/incorrect alternative splicing or increase in protein production levels can also be achieved by when inserted downstream of or within a truncated version of an intron, such as a truncated Intron A.

Thus, in one embodiment, the intron is Intron A from the CMV genome or a truncated version of intron A from the CMV genome.

In one embodiment, the construct or vector comprises an endogenous 3’ splice site.

In some examples, the endogenous splice site is not within an exon. In some examples, the endogenous splice site is not within the ORF of the gene of interest.

In some examples, the gene of interest may intrinsically comprise one or more splicing sites. In some examples, the gene of interest may include, but is not limited to, an antigen binding protein, a signal peptide, and the like.

The inventors of the present disclosure found that the construct, intron, or vector as described herein are most effective on enhancing antibody production. Therefore, in some examples, the gene of interest is an antibody. Hence, in one embodiment, the gene of interest encodes an antibody, for example an antibody heavy and/or light chain.

In one embodiment, the endogenous splice site is at the 3’ end of the intron.

In one embodiment, the construct or vector comprises:

In one embodiment, the construct or vector further comprises one or more of a promoter.

In one embodiment, the construct or vector further comprises a promoter selected from the group consisting of rEF1a promoter, hEEF2 promoter, CMV promoter, EF-1a promoter, EF2 promoter, and SV40 promoter.

In one embodiment, the construct comprises a polynucleotide encoding a gene of interest, for example an antibody, such as antibody heavy and/or light chains.

In one embodiment, the construct or vector comprises:

In one embodiment, the construct or vector comprises a polynucleotide encoding an antibody heavy chain and/or light chain with a signal peptide.

In one embodiment, the construct or vector comprises a polynucleotide encoding a heavy chain signal peptide and/or a light chain signal peptide.

The signal peptide may be from any protein, such as any human antibody and is not limited to the signal peptides disclosed herein.

In one embodiment, the construct or vector comprises one or more polynucleotides encoding one or more of the following signal peptides of the antibody heavy chain or light chain:

H1 MELGLSWIFLLAILKGVQC (SEQ ID NO: 5),

H2 MELGLRVWFLVAILEGVQC (SEQ ID NO: 6),

H3 MKHLWFFLLLVAAPRWVLS (SEQ ID NO: 7),

H4 MDWTWRILFLVAAATGAHS (SEQ ID NO: 8),

H5 MDWTWRFLFVVAAATGVQS (SEQ ID NO: 9),

H6 MEFGLSWLFLVAILKGVQC (SEQ ID NO: 10),

H7 MEFGLSWVFLVALFRGVQC (SEQ ID NO: 11),

H8 MDLLHKNMKHLWFFLLLVAAPRWVLS (SEQ ID NO: 12),

In one embodiment, the construct or vector comprises a polynucleotide having a sequence that is at least 75% identical to a sequence selected from the group consisting of:

H1

ATGGAGTTGGGACTGAGCTGGATTTTCCTTTTGGCTATTTTAAAAGGTGTC

CAGTGT (SEQ ID NO: 14)

H2

ATGGAACTGGGGCTCCGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTC

CAGTGT (SEQ ID NO: 15)

H3

ATGAAACACCTGTGGTTCTTCCTCCTGCTGGTGGCAGCTCCCAGATGGGT

CCTGTCC (SEQ ID NO: 16)

H4

ATGGACTGGACCTGGAGGATCCTCTTCTTGGTGGCAGCAGCAACAGGTGC

CCACTCG (SEQ ID NO: 17)

H5

ATGGACTGGACCTGGAGGTTCCTCTTTGTGGTGGCAGCAGCTACAGGTGT

CCAGTCC (SEQ ID NO: 18)

H6

ATGGAGTTTGGGCTGAGCTGGCTTTTTCTTGTGGCGATTCTAAAAGGTGTC

CAGTGT (SEQ ID NO: 19)

H7

ATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTTAGAGGTGTC

CAGTGT (SEQ ID NO: 20)

H8

ATGGACCTCCTGCACAAGAACATGAAACACCTGTGGTTCTTCCTCCTCCTG

GTGGCAGCTCCCAGATGGGTGCTGTCC (SEQ ID NO: 21), and

L1

In some examples, the polypeptide may comprise a sequence that has sequence identity of at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or is 100% identical to the sequences as provided herein. H1 , H2, H3, H4, H5, H6, H7, and H8 represent Ig heavy chain signal peptides. L1 represents Ig kappa light chain signal peptide.

In one embodiment, the construct or vector comprises a polynucleotide encoding for an open reading frame (ORF) of an antigen binding site heavy chain(s) selected from the group consisting of Trastuzumab, Rituximab, a member of IGHV1 family, and a member of IGHV3 family.

In some examples, the construct or vector comprises polynucleotide encoding for a polypeptide selected from the group consisting of Trastuzumab-H2, Rituximab-H4, IGHV1-46, and IGHV3-23.

In one embodiment, the construct or vector further comprises a component that aids one or more functions, including aiding of stability, protection from enzymatic degradation, facilitates export from nucleus to cytoplasm, aids in the initiation of translation, and overall efficiency in protein synthesis.

In one embodiment, the construct or vector further comprises a poly-A-tail signal.

In one embodiment, the construct or vector comprises a nucleic acid sequence as set forth in SEQ ID NO: 24.

In one aspect, there is provided a vector comprising the construct or vector as defined above.

In one embodiment, the vector is a mammalian vector.

In one aspect, there is provided a plasmid comprising the construct or vector as described above.

In one aspect, there is provided a polynucleotide encoding the construct or vector as described above.

In one aspect, there is provided a host cell comprising the construct or vector and/or polynucleotide as described above.

In one embodiment, the cell is a eukaryotic cell.

In one embodiment, the cell is a mammalian cell.

In some examples, the cell is a mammalian cell. In some examples, the cell is a non-human mammalian cell and/or a human cell.

In one embodiment, the cell is a Chinese hamster ovary (CHO) cell.

In one aspect, there is provided a kit or system containing a construct or vector or a cell as defined above.

In one embodiment, the kit or system is for use in the production of a recombinant protein of interest.

In one aspect, there is provided a method of producing (or increasing the production of) a protein of interest, comprising: providing the construct or vector as defined above in an expression system.

In one embodiment, the method increases the production of a protein of interest in the presence of abnormal (or incorrect splicing) when the open reading frame (ORF) is placed downstream of an intron, such as Intron A of CMV.

In another embodiment, the method increases the production of a protein of interest even in the absence of abnormal/incorrect splicing. Without being bound by theory, the present inventors believe the exogenous 3’ splice sites may achieve this effect by binding to intracellular factors to enhance gene expression levels, which in turn increases protein expression levels.

In some examples, the method increases protein production by at least 1-fold, at least 2-folds, at least 3-folds, at least 4-folds, at least 5-folds, at least 6-folds, at least 7- folds, at least 8-folds, at least 9-folds, at least 10-folds, and the like. In some examples, the methods as described herein when compared with commonly used commercial vector increases protein production by at least 1-fold, at least 2-folds, at least 3-folds, at least 4-folds, at least 5-folds, at least 6-folds, at least 7-folds, at least 8-folds, at least 9- folds, at least 10-folds, and the like.

In one aspect, there is a method of preventing abnormal (or incorrect) splicing comprising: providing the construct or vector of as defined above in an expression system.

In one aspect, there is provided a method of preventing abnormal (or incorrect) splicing in the expression of a gene of interest comprising: providing and/or introducing an exogenous splice site downstream and/or upstream of an intron downstream of a promoter region.

In one aspect, there is a method of preventing abnormal (or incorrect) splicing in the expression of a gene of interest comprising: providing and/or introducing an exogenous splice site downstream of an intron and/or within an intron downstream of a promoter region.

In one embodiment, the abnormal (or incorrect) splicing occurs when the open reading frame (ORF) is placed downstream of an intron, such as Intron A of CMV.

In one embodiment, one or more additional exogenous 3’ splice sites are provided and/or introduced downstream or an intron and/or within an intron downstream of a promoter region. Thus, in one embodiment, two or more, such as two, three, four or five exogenous 3’ splice sites are provided and/or introduced downstream or an intron and/or within an intron downstream of a promoter region, In one embodiment, three exogenous 3’ splice sites are provided and/or introduced downstream or an intron and/or within an intron downstream of a promoter region,

In one embodiment, the method provides and/or introduces an exogenous splice site downstream of an intron 3’ splice site of a promoter region.

In one embodiment, the method provides and/or introduces an exogenous splice site within an intron 3’ splice site of a promoter region.

In one embodiment, the method provides and/or introduces an exogenous splice site between the branch point and the 3’ splice site of the intron. In another embodiment, the method provides and/or introduces an exogenous splice site between the branch point and the 5’ splice site of the intron.

In some examples, the endogenous splice sites may cause aberrant splicing of the gene of interest. That is, the gene of interest may inadvertently be spliced to thereby result in the incomplete expression of protein of interest.

In some examples, the endogenous splice sites are found in the introns. In some examples, the endogenous splice sites found in the introns cause undesirable splicing of gene of interest.

In one embodiment, the splice site is about 0 to 50 nucleobases from the intron.

In some examples, the splice site is about 0 nucleobase, 1 nucleobase, 2 nucleobases, 3 nucleobases, 4 nucleobases, 5 nucleobases, 6 nucleobases, 7 nucleobases, 8 nucleobases, 9 nucleobases, 10 nucleobases, 11 nucleobases, 12 nucleobases, 13 nucleobases, 14 nucleobases, 15 nucleobases, 16 nucleobases, 17 nucleobases, 18 nucleobases, 19 nucleobases, 20 nucleobases, 21 nucleobases, 22 nucleobases, 23 nucleobases, 24 nucleobases, 25 nucleobases, 26 nucleobases, 27 nucleobases, 28 nucleobases, 29 nucleobases, 30 nucleobases, 31 nucleobases, 32 nucleobases, 33 nucleobases, 34 nucleobases, 35 nucleobases, 40 nucleobases, 45 nucleobases, or 50 nucleobases from the intron. In some examples, the splice site is about 10 to 20 nucleobases from the intron. In some examples, the splice site is immediately upstream and/or downstream the intron, or about 0 nucleobase from the intron.

In one embodiment, the exogenous splice site is an exogenous 3’ splice site.

In one embodiment, the exogenous 3’ splice site is downstream of the intron.

In one embodiment, the exogenous 3’ splice site is downstream of the 3’ end of the intron.

In one embodiment, the exogenous 3’ splice site is immediately downstream of an intron.

In one embodiment, the splice site is placed between an intron and an exon.

In one embodiment, the splice site is placed at the 3’ end of an intron and immediately before an exon.

In one embodiment, the splice site may include, but is not limited to, the 3’ splice site of SP6 intron, the 3’ splice site based on the consensus sequence of all human introns, the 3’ splice site of human beta-globulin intron, and the like.

In one embodiment, the intron is the first intron immediately downstream of the promoter (i.e. Intron A or Intron 1).

In some examples, the promoters as used in the present disclosure may be any promoters from any mammals or viruses. In some examples, the promoters may include but are not limited to promoters from rat or human.

In one embodiment, the splice site is introduced in promoter/intron pair selected from the group consisting of CMV/lntron A and rEF1a/lntron1.

In one embodiment, the exogenous 3’ splice sites prevent abnormal splicing of the antibody transcripts entirely and boosts antibody production, when placed downstream of the intron.

In one aspect, there is provided a vector or a construct or a cell substantially as described herein.

In one aspect, there is provided a method of improving protein expression or preventing alternative splicing substantially as described herein.

In one aspect, there is provided a method of increasing protein expression or antibody production substantially as described herein.

BRIEF DESCRIPTION OF FIGURES

Figure 1 shows the amino acid sequences of 8 unique heavy chain signal peptides. H1 to H8 represent the eight unique signal peptide sequences that were fused to the heavy chains of trastuzumab and rituximab. L1 is the signal peptide that was fused to the light chain of trastuzumab and rituximab. The signal sequences originate from previous work by the inventors (Haryadi et al., 2015; PLOS ONE).

Figure 2 shows a schematic diagram of 4 mammalian expression vectors that were employed in the Examples. pBEE is an internally constructed expression vector comprising the rat elongation factor 1a promoter region. pCHOl .O and pcDNA3.1 are commercial vectors from Life Technologies. pCMV-lntron A was generated in house.

Figure 3 shows graphs of antibody expression levels from CHO cells transfected with different expression vectors. Trastuzumab and rituximab with eight different signal peptides (H1 to H8) cloned into the four different expression vectors were transiently expressed in CHO cells. Two days after transfection, the antibody levels in the conditioned media were quantified by ELISA.

Figure 4 shows the results of RT-PCR amplification of trastuzumab and rituximab heavy chain transcripts in different transacted CHO cells. CHO cells were transfected with different expression constructs. Total RNA from each sample was extracted and converted to cDNA. The antibody specific cDNA was amplified with specific primers. The TR-PCR products from each CHO cell sample were examined on agarose gels.

Figure 5 shows the results of RT-PCR examination of alternatively spliced trastuzumab and rituximab transcripts. CHO cells were transiently transfected with different antibody-expressing constructs. The total RNA was extracted, and cDNA was generated. The TR-PCR products shown in Fig. 4 was cloned. Up to 100 clones from each transfection sample was sequenced and the results are presented here.

Figure 6 shows the nucleic acid sequences of the presently disclosed 3’ splice sites. The 3’ splice sites from SP6 intron (3’ SS A - dark grey), the 3’ splice site based on the consensus sequence of all human introns (3’ SS B - light grey), and the 3’ splice site of human beta-globulin intron (3’ SS C - black with reverse white text) (SEQ ID NOs: 1 , 2 and 3) were inserted downstream of CMV Intron A (After modification/, SEQ ID NO: 24). The Intron A is highlighted in grey, CMV promoter in dark grey, and CMV IE exon in light grey. The adenine nucleotide (A) at the branch points of each 3’ splice site is in italics. The AGs at the 3’ splice sites are also in italics.

Figure 7 shows results demonstrating that the three 3’ splice sites fused together (3’ SS ABC) effectively prevented alternative splicing of trastuzumab (A) and rituximab (B) transcripts. Trastuzumab or rituximab fused to signal peptides H2, H4, H6 or H7 produced alternatively spliced transcripts in the presence of Intron A. With 3’ SS ABC placed downstream of Intron A, the alternative splicing was completely prevented.

Figure 8 shows results demonstrating that Intron A induced alternative splicing in all hIGHVs which was completely prevented by placing extra 3’ splice sites downstream of Intron A. (A) All ten IGHV cDNAs were expressed in pcDNA3.1 vector (lacking Intron A), no alternative splicing was observed. (B) Intron A is present in the expression vector (pCMV-lntron A), which induced alternative splicing of all hIGHVs. (C) Three 3’ splice sites (3’ SS ABC) positioned downstream of Intron A completely prevented alternative splicing in all ten IGHVs.

Figure 9 shows results demonstrating that A single 3’ splice site is sufficient to prevent the alternative splicing induced by Intron A. A. Single 3’ splice site, 3’ SS A, 3’ SS B, and 3’ SS C, was sufficient to prevent alternative splicing of trastuzumab and rituximab. Different combinations of two 3’ splice sites, 3’ SS AB, 3’ SS AC, and 3’ SS AC, were also able to prevent alternative splicing. B. The same results were observed when IGHV1-46 and IGHV3-23 were tested.

Figure 10 shows the sequencing analysis of the trastuzumab- H2 RT-PCR products with varying downstream 3’ splice sites. As shown before, Intron A caused three alternatively spliced forms: 14% full length, 14% truncated, and 70% another truncated from. All remaining RT-PCR products exhibited clear sequencing results; no alternative splice was detected. The 5’ splice site of Intron A always linked to the last 3’ splice sites, including single, double, or triple splice sites. The triangles represent 3’ SS A, 3’ SS B, and 3’ SS C.

Figure 11 shows results demonstrating that the 3’ splice sites enhance antibody productivity by preventing alternative splicing induced by Intron A. Compared to pcDNA3.1 vector (w/o Intron A), pCMV-lntron A vector produced much less trastuzumab because of alternative splicing. All the 3’ splice sites, single, double or triple 3’ splice sites, enhanced antibody production significantly, by preventing alternative splicing

Figure 12 shows results demonstrating that the 3’ splice sites significantly enhanced antibody production in stably transfected pools. pcDNA3.1 contains CMV promoter only (without Intron A); pCMV-lntron A contains CMV promoter and Intron A, which causes abnormal splicing of the antibody transcript; pCMV-lntron A-3’ SS ABC contains three 3’ splice sites to prevent abnormal splicing. Due to alternative splicing, pCMV-lntron A produced the least amount of antibody, about 1/3 of the antibody produced by pcDNA3.1. With 3’ SS ABC, the alternative splicing was completely prevented, and the antibody production was enhanced more than 6-fold.

Figure 13 shows a schematic diagram of new constructs designed to place 3’ splicing sites at a different position of Intron A. The constructs pCMV, pCMV-lntron A and pCMV-lntron A-3’ SS ABC are identical to those previously used. In the construct pCMV-5’-SS ABC-lntron A, three 3’ splicing sites (SS ABC) were inserted into the Intron A as indicated by the vertical dotted line. The remaining four constructs -- single splice site SS A, SS B, SS C as well as the triple splice sites SS ABC -- were all placed downstream of the truncated Intron A.

Figure 14 shows results demonstrating that the 3’ splice sites prevent abnormal splicing when placed downstream of a truncated version of Intron A or inserted into Intron A.

Figure 15 shows a graph of the antibody yields from the batch culture of bulk pools from five different transfections, cultured in 50 mL tubes. Cells transfected with the pCMV-lntron A construct produced less antibody compared to those transfected with pCMV alone. In contrast, cells transfected with three other constructs showed increased antibody production, as these constructs effectively prevented abnormal splicing. Notably, the antibody yield from these constructs was significantly higher than that achieved with the CMV promoter alone.

Figure 16 shows results demonstrating that Intron A causes abnormal splicing in the wild-type WT DNA (WT DNA) sequence of the trastuzumab antibody but not in the optimized DNA sequence generated using Thermo Fisher Scientific’s GeneArt program (GeneArt DNA). The 3’ splice sites prevented the abnormal splicing of WT DNA caused by Intron A. Since no abnormal splicing was observed in the GeneArt-optimized sequence, 3’ splice sites had no significant impact on the RT-PCR results.

Figure 17 shows results demonstrating that the 3’ splice sites significantly enhanced antibody productivity, even though their function in preventing abnormal splicing was not required. Antibody DNA sequences were optimized using Thermo Fisher Scientific’s GeneArt program and cloned into three vectors: pCMV, pCMV-lntron A, and pCMV-lntron A-SS ABC. the antibody titer in the bulk pool reached over 4.4 g/L in a 30mL/50ml_ TubeSpin fed-batch culture (without any process optimization).

EXAMPLES

Example embodiments of the disclosure will be better understood and readily apparent to one of ordinary skill in the art from the following discussions and if applicable, in conjunction with the figures. It should be appreciated that other modifications may be made without deviating from the scope of the invention. Example embodiments are not necessarily mutually exclusive as some may be combined with one or more embodiments to form new exemplary embodiments. The example embodiments should not be construed as limiting the scope of the disclosure.

Example 1 - Expression constructs for trastuzumab and rituximab expression in CHO cells

Eight unique heavy chain signal peptides (H1 to H8, shown in Figure 1) were fused to the DNA fragments encoding mature trastuzumab and rituximab heavy chains. Subsequently, these DNA fragments were cloned into four different expression vectors: pBEE, pCHOl .O, pcDNA3.1 , and pCMV-lntron A. pBEE is an internal expression vector featuring the rat elongation factor 1a promoter (shown in Figure 2). Among the four vectors, three contain an intron, while only pcDNA3.1 lacks one. pcDNA3.1 and pCHOl.O are commonly used mammalian expression vectors. pBEE and pCMV-lntron A were internally generated vectors. pBEE was created based on rat elongation factor 1a (EF1a).

Example 2 - Transient expression of trastuzumab and rituximab using diverse signal peptides and expression vectors

In 6-well plates, adherent CHO cells were transfected with each heavy chain construct along with double the quantity of the corresponding light chain construct. Two days later, antibody levels in the conditioned media were quantified using standard ELISA. The results are shown in Figure 3. The results showed that the antibody levels varies significantly when the three intron-containing expression constructs were used, except for pcDNA3.1 .

Example 3 - The antibody heavy chain mRNAs in transfected CHO cells were analysed using TR-PCR

Total RNA was extracted from transfected CHO cell samples and converted into cDNA. Subsequently, specific forward and reverse primers were used in PCR amplification of antibody mRNAs. The PRC products were examined on agarose gels. Results showed the generation of multiple DNA products when three of the introncontaining constructs were used, except for pcDNA3.1. These findings suggest that alternative RNA splicing had occurred in the CHO cells when the three constructs were used. No alternative RNA splicing was observed when pcDNA3.1 construct was used (shown in Figure 4). The substantial antibody production variations could potentially be attributed to the alternative splicing shown in Figure 4.

Example 4 - RT-PCR products from each transfected samples were cloned and sequenced to analyse alternative splicing.

To confirm alternative splicing in certain transfected CHO cells, specific RT-PCR products were cloned. Subsequently, up to 100 individual clones per sample underwent DNA sequencing. Sequencing results indeed confirmed extensive alternative splicing of the antibody transcript. Some samples lacked full-length antibody cDNA, while others contained only a fragment of the full-length antibody transcript. The results are shown in Figure 5. As previously discussed, introns were incorporated into certain expression vectors to boost expression levels. However, when the intron is spliced out during mRNA maturation, alternative splicing can significantly reduce the proportion of full-length antibody transcripts, leading to decreased antibody production.

Example 5 - Preventing alternative splicing of antibody transcripts by introducing additional 3’ splice sites down stream of Intron A

To prevent the alternative splicing shown in Figure 4 and Figure 5, we randomly selected three 3’ splice sites and inserted them downstream of the 3’ splice site of Intron A in CMV promoter region. The three splice site sequences are shown in Figure 6 (top), while the DNA sequence for the CMV/lntron A region is shown in the middle. The adenine nucleotide (A) at the branch points of each 3’ splice site is highlighted in red. The AGs at the 3’ splice sites are also highlighted in red. The three 3’splice sites are fused together and positioned downstream of 3’ splice site in CMV Intron A (bottom).

Example 6 - By introducing supplementary 3’ splice sites downstream of Intron A, the alternative splicing of antibody heavy chain transcripts was successfully prevented.

The 3’ splice site from SP6 (named as 3’ SS A), the consensus sequence of all human 3’ splice site (named as 3’ SS B), and the 3’ splice site human beta-globulin

(named 3’ SS C) were fused together and positioned downstream of the Intron A. The combined 3’ splice sites effectively prevented alternative splicing of trastuzumab (H2, H4, H7 as signal peptides) and rituximab (H2, H4, H6 as signal peptides) transcripts (Figure 7).

Example 7 - In the presence of Intron A, alternative splicing is apparent in all hIGHV families; however, this can be effectively prevented by integrating three 3’ splice sites (3’ SS ABC).

Ten hIGHV cDNAs (human immunoglobulin heavy chain variable genes), representing all hIGHV families 1-6, were cloned into pcDNA3.1 (CMV promoter, lacking Intron A), pCMV-lntron A (CMV promoter with Intron A), and pCMV-lntron A-3’ SS ABC (containing three extra 3’ splice sites). Every construct was transiently transfected in CHO cells, followed by total RNA extraction and RT-PCR using specific forward and reverse primers. The RT-PCR products were examined on agarose gels and the results are shown in Figure 8. In the absence of Intron A (pcDNA3.1), no alternative splicing was detected. Conversely, with Intron A present (pCMV-lntron A), multiple alternatively spliced transcripts were observed across all hIGHVs. The alternative splicing was completely prevented when additional 3’ splice sites were placed downstream of Intron A (pCMV-lntron A-3’ SS ABC).

Example 8 - A single 3’ splice site is sufficient to prevent alternative splicing induced by Intron A.

The present inventors have shown that three 3’ splice sites together effectively prevented alternative splicing caused by Intron A. They then tested whether a single 3’ splice stie (3’ SS A, 3’ SS B, or 3’ SS C), or two splice sites (3’ SS AB, 3’ SS AC, and 3’ SS BC) would be enough to prevent the alternative splice induced by Intron A. Three 3’ splice site fusion (3’ SS ABC) was also included as a control. Four antibody heavy chains were tested in this experiment, they are trastuzumab-H2, rituximab-H4, IGHV1-46, and IGHV3-23. The results, shown in Figure 9, indicated that any single 3’ splice site, and a combination of any two 3’ solace sites, were sufficient to prevent alternative splicing in all 4 antibody heavy chains caused by Intron A. Sequencing analysis showed consistent joining of the 5’ splice site of Intron A with the last 3’ splice site in mature mRNA products.

Example 9 - Sequencing analysis of the trastuzumab-H2 RT-PCR products with varying downstream 3’ splice sites

The RT-PCR products obtained from Figure 9A were subjected to sequencing analysis. Figure 10 illustrates the sequencing results. Intron A presence led to three alternatively spliced forms: 14% full length, 14% truncated, and 70% additional truncated from. All remaining RT-PCR products exhibited clear sequencing results, devoid of any alternative splicing. The 5’ splice site of Intron A consistently linked with the final 3’ splice sites, including single, double, or triple splice sites. The results are illustrated in Figure 10.

Example 10 - Additional 3’ splice sites prevent alternative splicing and enhances antibody production in transient transfections.

CHO cells were transfected with constructs encoding trastuzumab heavy chain (Figure 9A), combined with a 1.5-fold excess quantity of trastuzumab light chain constructs. Antibody production was quantified post-transfection using ELISA. Compared to pcDNA3.1 (w/o Intron A), the presence of Intron A dramatically reduced antibody productivity, due to alternative splicing. The presence of 3’ splice sites significantly enhanced antibody productivity, by preventing alternative splicing (Figure 11).

Example 11 - Additional 3’ splice sites dramatically boost antibody production in stably transfected CHO cell pools.

A new set of expression vectors were generated for this work. Each vector contains two identical gene expression cassettes. Vector pcDNA3.1 contains two CMV promoters (without Intron A). The vector pCVM- Intron A carries two CVM promoters, each followed by an Intron A. The third vector features twin expression units: a CMV promoter, an Intron A, and three 3’ splice sites used in this study (pCMV-lntron A-3’ SS ABC). Trastuzumab heavy and light chains were independently cloned into the two sites. Additionally, the SV40 promoter controls the expression of the selection marker, glutamine synthetase (GS). Every vector was transfected into CHO cells, with each transfection performed in duplicated. Following transfection, cells were cultured in a glutamine-free medium until stably transfected pools were established.

To investigate the impact of the 3’ splice site on antibody production of these stable pools, the present inventors performed a simplified “fed-batch” culture. Briefly, inoculate 0.5E6/ml cells into 30 ml pre-warmed fresh media in TubeSpin® Bioreactor 50 (TPP 50mL). Use HyClone™ ActiPro™ cell culture media as the production media. Starting from Day 3, monitor cell count daily and assess culture glucose levels using NOVA. Adjust glucose to 4g/L to maintain glucose concentration between 2-4g/L. On Day 3, 5, 7, 9, add 0.9 ml of Cell Boost™ 7a and 0.09 ml_ Cell Boost™ 7b. Harvest culture on day 12 or earlier when viability drops below 70%. The antibody in the media were quantified by ELISA. Compared to the control, a seven-fold increase in antibody production was observed (Figure 12). These findings revealed a more than 6-fold increase in antibody production. Notably, these pools were not subjected to any enrichment.

Example 12 - The 3’ splice sites can prevent abnormal splicing when placed downstream of a truncated version of Intron A or inserted into Intron A.

To examine the impact of the 3’ splice sites on RNA splicing at different positions relative to Intron A, six new constructs were generated, as shown in Figure 13. In addition to previously tested pCMV, pCMV-lntron A and pCMV-lntron A-3’ SS ABC constructs, pCMV-5’-SS ABC-lntron A was created by inserting three 3’ splicing sites (SS ABC) into Intron A at the position indicated by the dotted line in Figure 13. The SS ABC was inserted near the 3’ end of Intron A, upstream of the branch point which includes an adenine (A) nucleotide within the intron, critical for the splicing reaction. The remaining four constructs -containing single splice site SS A, SS B, SS C, as well as one triple splice sites (SS ABC) - were placed downstream of the truncated Intron A. The Intron A was truncated at the same site where the SS ABC was inserted into, as indicated by the vertical dotted line.

These constructs were transfected into CHO cells, and total RNA was isolated from each transfection for RT-PCR analysis. The results, shown in Figure 14, confirmed that the presence of Intron A caused abnormal splice of the antibody heavy chain (trastuzumab heavy chain with H2 as the signal peptide). However, introducing 3’ splicing sites - either downstream of the truncated Intron A or inserted into Intron A -successfully prevented the abnormal splicing.

Sequencing analysis of the RT-PCR products from each transfection revealed that splicing initiated at the 5’ splicing site of Intron A and terminated at the 3’ sites of the inserted splice sites, as indicated by the line in Figure 13.

Bulk pools from five different transfections were cultured in a batch format using 50 ml_ tubes. Consistent with previous results, cells transfected with the pCMV-lntron A construct produced less antibody compared to those transfected with pCMV alone, supporting the observation that the presence of Intron A induces abnormal splicing. In contrast, cells transfected with three other constructs showed increased antibody production, as the 3’ splice sites in these constructs effectively prevented abnormal splicing. Notably, the antibody yield from these constructs was significantly higher than that achieved with the CMV promoter alone (Figure 15), suggesting Intron A does not have to be a complete Intron. Interestingly, cells transfected with the splicing sites inserted into Intron A (pCMV-5’-SS ABC Intron A) produced less antibody than the other two constructs, namely, pCMV-3’-SS ABC Intron A and pCMV-DIntron A-SS-ABC.

Example 13 - 3' splice sites increase antibody production not only by preventing abnormal splicing but also by enhancing transcription. This effect is evident even when antibody DNA seguences are optimized using the GeneArt program, which minimizes abnormal splicing caused by Intron A

To determine whether 3’ splicing sites increase antibody production also by enhancing the transcriptional activity of the CMV promoter and Intron A, or solely by preventing abnormal splicing, the DNA sequences encoding the heavy and light chains of the trastuzumab antibody were optimized to eliminate the majority of Intron A-induced abnormal splicing. Three antibody-expressing constructs were generated to express trastuzumab with optimized DNA sequences: pCMV, pCMV-lntron A, and pCMV-lntron A-SS ABC. After transfection, total RNA was isolated from each transfection, and trastuzumab heavy chain mRNA was amplified by RT-PCR.

As shown previously, under the control of the CMV promoter, the normal DNA sequence of the trastuzumab heavy chain (WT DNA) was not alternatively spliced in the absence of Intron A. However, when Intron A was present, the same WT DNA underwent alternative splicing, as shown in Figure 16. Introduction of 3’ splice sites prevented the abnormal splicing of the trastuzumab heavy chain (WT DNA). The DNA encoding the trastuzumab antibody was optimized using Thermo Fisher Scientific’s GeneArt program and cloned into the same set of vectors: pCMV, pCMV-lntron A, and pCMV-lntron A-SS ABC. RT-PCR results clearly showed that the presence of Intron A did not cause the abnormal splicing issues observed with the wild-type (WT) DNA (Figure 16). This outcome was expected, as eliminating potential alternative splicing is one of the key features of Thermo Fisher Scientific’s GeneArt program.

The same three constructs — pCMV, pCMV-lntron A, and pCMV-lntron A-SS ABC — used to express the GeneArt-optimized trastuzumab in Figure 16 were transfected into a glutamine synthetase (GS)-knockout CHO-K1 cell line as previously described. Bulk pools from each construct were cultured in a 15-day fed-batch format, and antibody production levels were measured. The results are shown in Figure 17.

The results clearly showed that cells transfected with the pCMV-lntron A-SS ABC construct produced significantly more antibody compared to those transfected with the pCMV-lntron A construct, despite both having similar mRNA quality and no abnormal splicing issues. These findings demonstrate that 3’ splice sites not only prevent abnormal splicing but also enhance gene expression.

As discussed above, each splice site sequence includes the 3’ portion of its corresponding intron. While the DNA sequences for each splice site can vary in length, they all contain the branch point adenine (A) residue — located upstream of the 3’ splice site — which is essential for lariat formation and extends to the 3’ splice site of the intron. An increased number of these 3’ splice sites may have an additive effect, further enhancing gene expression.

In summary, the Examples demonstrate that 3’ splice sites from different introns, whether linked together or used individually, can prevent CMV Intron A-induced abnormal splicing of the antibody genes. Additionally, these sites can enhance gene expression independently of preventing abnormal splicing. 3’ splice sites can be placed downstream of Intron A or inserted into Intron A in an expression construct. This configuration can also prevent abnormal splicing and enhance gene expression in genes other than antibodies.

Sequence analysis has revealed that the intron spliced out in all these constructs begins at the 5’ splice site of Intron A and ends at the most downstream 3’ splice site in the construct, rather than at the 3’ splice site of Intron A or any other 3’ splice site in between (as shown in Figure 10 & Figure 13). This observation raises an interesting question about the molecular mechanism of mRNA splicing. Preventing abnormal splicing obviously leads to increased antibody production. However, the 3’ splice sites surprisingly also significantly enhance antibody production without the need to prevent abnormal splicing. Including introns like Intron A in the expression vector can also cause abnormal splicing of genes other than antibodies. Thus, the presently disclosed invention has the potential to minimize abnormal splicing in other applications besides antibody production.

REFERENCES

1. Shaul O. (2017) How introns enhance gene expression. Int J Biochem Cell Biol. 91(Pt B):145-155.

2. Alan B Rose (2019) Introns as Gene Regulators: A Brick on the Accelerator. Front Genet. 2019 Feb 7;9:672. Doi: 10.3389/fgene.2018.00672. eCollection 2018.

3. B S Chapman, R M Thayer, K A Vincent, and N L Haigwood Effect of intron A from human cytomegalovirus (Towne) immediate-early gene on heterologous expression in mammalian cells. (1991) Nucleic Acids Res. 19(14): 3979-3986.

4. Z L Xu, H Mizuguchi, A Ishii-Watabe, E Uchida, T Mayumi, T Hayakawa (2001) Optimization of transcriptional regulatory elements for constructing plasmid vectors. Gene. 2001 Jul 11;272(1-2): 149-56. Doi: 10.1016/s0378- 1119(01)00550-9.

5. Wei Xia, Peter Bringmann, John McClary, Patrick P Jones, Warren Manzana, Ying Zhu, Soujuan Wang, Yi Liu, Susan Harvey, Mary Rose Madlansacay, Kirk McLean, Mary P Rosser, Jean MacRobbie, Catherine L Olsen, Ronald R Cobb (2006) High levels of protein expression using different mammalian CMV promoters in several cell lines. Protein Expr Purif. 2006 Jan;45(1):115-24. Doi: 10.1016/j.pep.2005.07.008. Epub 2005 Aug 9.

6. Haryadi et al (2015) Optimization of heavy chain and light chain signal peptides for high level expression of therapeutic antibodies in CHO cells. PLOS ONE 10(2): e0116878

APPLICATIONS

The presently disclosed constructs/vectors have various applications, such as the following:

• Reducing or completely eliminating alternative splicing caused by introns typically included in commercial and prior art expression vectors;

• Significantly increasing levels of protein production, in particular antibodies, in expression systems, such as in Chinese hamster ovary (CHO) cells, where abnormal/incorrect alternative splicing occurs; and

• Significantly increasing levels of protein production, in particular antibodies, in expression systems, such as in Chinese hamster ovary (CHO) cells, even in cases where abnormal/incorrect alternative splicing does not occur/is not observed, for example in cases where the antibody coding region is optimized and abnormal splicing has already been eliminated.

Claims

1 . A vector comprising an intron having endogenous 5’ and 3’ splice sites, and one or more exogenous 3’ splice sites downstream of and/or within the intron.

2. The vector of claim 1 , wherein the exogenous 3’ splice site is downstream of the intron, for example immediately downstream of the intron.

3. The vector of any one of the preceding claims, wherein the exogenous 3’ splice site is placed between an intron and an exon, or the open reading frame of a gene of interest, such as wherein the exogenous 3’ splice site is placed downstream of the 3’ end of an intron and immediately before an exon.

4. The vector of claim 1, wherein the exogenous 3’ splice site is within the intron, for example wherein the exogenous 3’ splice site is placed downstream of the branch point of the intron.

5. The vector of claim 4, wherein the exogenous 3’ splice site is placed between the branch point and the end of 3’ splice site of the intron.

6. The vector of claim 4, wherein the exogenous 3’ splice site is placed between the branch point and the 5’ splice site of the intron.

7. The vector of any one of the preceding claims, wherein the exogenous 3’ splice site is a 3’ splice site derived/obtained from another intron.

8. The vector of any one of the preceding claims, wherein the exogenous 3’ splice site is derived/obtained from a first intron of a gene.

9. The vector of any one of the preceding claims, wherein the exogenous 3’ splice site comprises an intronic sequence but lacks the 5’ splice site (GT).

10. The vector of any one of the preceding claims, wherein the exogenous 3’ splice site comprises a sequence extending from the branch point to the splice site (AG site) at the 3’ end of an intron.

11 . The vector of any one of the preceding claims, wherein the exogenous 3’ splice site comprises a sequence extending from the branch point to the splice site (AG site) at the 3’ end of an intron, and excludes the 5’ splice site (GT site) of the intron.

12. The vector of any one of the preceding claims, wherein the exogenous 3’ splice site further comprises a sequence upstream of the branch point, for example 1- 25 or more nucleobases, such as 1-50, 1-100, 1-150, or 1 - 200 nucleobases upstream of the branch point.

13. The vector of any one of the preceding claims, wherein the exogenous 3’ splice site comprises a sequence extending from upstream of the branch point to the splice site (AG site) at the 3’ end of an intron, excluding the 5’ splice site of the intron (GT).

14. The vector of any one of the preceding claims, wherein the exogenous 3’ splice site comprises an adenine nucleotide at its branch point.

15. The vector of any one of the preceding claims, wherein the exogenous 3’ splice site comprises GCCACTGACTCT, GCCACTAACTCT, or CTAACCAT, where the underlined is the A branchpoint.

16. The vector of any one of the preceding claims, wherein the exogenous 3’ splice site comprises AGGTT, for example wherein the exogenous 3’ splice site terminates at the 3’ end with AGGTT.

17. The vector of any one of the preceding claims, wherein the exogenous 3’ splice site lacks a translation start codon, such as ATG, for example wherein the exogenous 3’ splice site is modified to remove any ATG motifs.

18. The vector of any one of the preceding claims, wherein the exogenous 3’ splice site is one or more selected from the group comprising: the 3’ splice site from SP6 intron, the 3’ splice site based on the consensus sequence of all human introns, the 3’ splice site of human beta-globulin intron, and the like.

19. The vector of any one of the preceding claims, wherein the exogenous 3’ splice site is one or more selected from the group consisting of: a. SP6 branch point and 3’ splicing site consensus sequences (3’ SS A): GCCACTGACTCTttcctttQtcctottcccatttccAGGTT (SEQ ID NO: 1), b. Branch point and 3’ splicing site based on consensus sequences of all human genes (3’ SS B):

AATACTCTGAGTCCAAACCGGGCCCCGCCACTAACTCTttcctttttctttttttttttcttttC AGGTT (SEQ ID NO: 2), and c. b-globin intron (3’ SSC):

AATACTCTGAGTCCAAACCGGGCCCCTCTGCTAACCATGTTCATGCCTTCT TCTTTTTCCTACAGGTT (SEQ ID NO: 3), where the underlined sequence is the conserved sequence surrounding the A (bold), and d. a variant thereof at least 80% identical to any of the above.

20. The vector of any one of the preceding claims, wherein the exogenous 3’ splice site is one or more selected from the group consisting of: a. SP6 branch point and 3’ splicing site consensus sequences (3’ SS A): GCCACTGACTCTttcctttqtcctqttcccatttccAGGTT (SEQ ID NO: 1), b. Branch point and 3’ splicing site based on consensus sequences of all human genes (3’ SS B):

AATACTCTGAGTCCAAACCGGGCCCCGCCACTAACTCTttcctttttctttttttttttcttttC

AGGTT (SEQ ID NO: 2), and c. b-globin intron (3’ SS C):

AATACTCTGAGTCCAAACCGGGCCCCTCTGCTAACCATGTTCATGCCTTCT TCTTTTTCCTACAGGTT (SEQ ID NO: 3), where the underlined sequence is the conserved sequence surrounding the A (bold).

21. The vector of any one of the preceding claims, wherein the vector comprises two or more, such as two, three, four or five exogenous 3’ splice sites, in particular three exogenous 3’ splice sites.

22. The vector of any one of the preceding claims, wherein the vector comprises: a. the 3’ splice site from SP6 intron and the 3’ splice site based on the consensus sequence of all human introns; b. the 3’ splice site from SP6 intron and the 3’ splice site of human beta-globulin intron; c. the 3’ splice site based on the consensus sequence of all human introns and the 3’ splice site of human beta-globulin intron; d. the 3’ splice site from SP6 intron, the 3’ splice site based on the consensus sequence of all human introns, and the 3’ splice site of human beta-globulin intron; or e. a fusion of the 3’ splice site from SP6 intron, the 3’ splice site based on the consensus sequence of all human introns, and the 3’ splice site of human beta-globulin intron.

23. The vector of any one of the preceding claims, wherein the vector comprises: a. SEQ ID NO: 1 and SEQ ID NO: 2; b. SEQ ID NO: 1 and SEQ ID NO: 3; c. SEQ ID NO: 2 and SEQ ID NO: 3; d. SEQ ID NO: 1 , SEQ ID NO: 2 and SEQ ID NO: 3; e. a fusion of SEQ ID NO: 1 , SEQ ID NO: 2 and SEQ ID NO: 3

GCCACTGACTCTTTCCTTTGTCCTGTTCCCATTTCCAGGTTAATACTCT GAGTCCAAACCGGGCCCCGCCACTAACTCTTTCCTTTTTCTTTTTTTTTT TCTTTTCAGGTTAATACTCTGAGTCCAAACCGGGCCCCTCTGCTAACCA TGTTCATGCCTTCTTCTTTTTCCTACAGGTT (SEQ ID NO: 4); or f. a variant thereof at least 80% identical to any of the above.

24. The vector of any one of the preceding claims, wherein the intron is selected from the group comprising: a naturally existing intron without alteration, such as Intron A from the CMV genome, or a recombinant/engineered intron, such as a truncated version of a naturally existing intron.

25. The vector of any one of the preceding claims, wherein the intron is selected from the group comprising Intron A from the CMV genome, elongation factor 1a, and elongation factor 2.

26. The vector of any one the preceding claims, wherein the intron is Intron A from CMV genome or a truncated version of Intron A from the CMV genome.

27. The vector of any one of the preceding claims, wherein the intron comprises its own 5’ splice site, a branch point, and its own (endogenous) 3’ splice site.

28. The vector of any one of the preceding claims, wherein the vector comprises:

29. The vector of any one of the preceding claims, wherein the intron is the first intron immediately downstream of the promoter (for example Intron 1 or Intron A).

30. The vector of any one of the preceding claims, wherein the vector further comprises one or more of a promoter, for example selected from the group consisting of rEF1a promoter, hEEF2 promoter, CMV promoter, EF-1a promoter, EF2 promoter, and SV40 promoter.

31. The vector of any one of the preceding claims, wherein the vector comprises a polynucleotide encoding a gene of interest, for example an antibody, such as an antibody heavy and/or light chain.

32. The vector of any one of the preceding claims, wherein the vector comprises:

33. The vector of any one of the preceding claims, wherein the vector comprises a polynucleotide encoding an antibody heavy chain and/or light chain with a signal peptide.

34. The vector of any one of the preceding claims, wherein the vector comprises one or more polynucleotides encoding one or more of the following signal peptides of the antibody heavy chain or light chain:

H1 MELGLSWIFLLAILKGVQC (SEQ ID NO: 5),

H2 MELGLRWVFLVAILEG QC (SEQ ID NO: 6),

H3 MKHLWFFLLLVAAPRWVLS (SEQ ID NO: 7),

H4 MDWTWRILFLVAAATGAHS (SEQ ID NO: 8),

H5 MDWTWRFLFVVAAATGVQS (SEQ ID NO: 9),

H6 MEFGLSWLFLVAILKGVQC (SEQ ID NO: 10),

H7 MEFGLSWVFLVALFRGVQC (SEQ ID NO: 11),

H8 MDLLHKNMKHLWFFLLLVAAPRWVLS (SEQ ID NO: 12), L1 MDMRVPAQLLGLLLLWLSGARC (SEQ ID NO: 13), and a variant of any of the above having a sequence identity of at least 80%.

35. The vector of any one of the preceding claims, wherein the vector comprises a polynucleotide having a sequence that is at least 75% identical to a sequence selected from the group consisting of:

H1

ATGGAGTTGGGACTGAGCTGGATTTTCCTTTTGGCTATTTTAAAAGGTGTC

CAGTGT (SEQ ID NO: 14) H2 ATGGAACTGGGGCTCCGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTC

CAGTGT (SEQ ID NO: 15)

H3

ATGAAACACCTGTGGTTCTTCCTCCTGCTGGTGGCAGCTCCCAGATGGGT

CCTGTCC (SEQ ID NO: 16)

H4

ATGGACTGGACCTGGAGGATCCTCTTCTTGGTGGCAGCAGCAACAGGTGC CCACTCG (SEQ ID NO: 17)

H5

ATGGACTGGACCTGGAGGTTCCTCTTTGTGGTGGCAGCAGCTACAGGTGT CCAGTCC (SEQ ID NO: 18)

H6

ATGGAGTTTGGGCTGAGCTGGCTTTTTCTTGTGGCGATTCTAAAAGGTGTC

CAGTGT (SEQ ID NO: 19) H7 ATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTTAGAGGTGTC CAGTGT (SEQ ID NO: 20)

H8

ATGGACCTCCTGCACAAGAACATGAAACACCTGTGGTTCTTCCTCCTCCTG GTGGCAGCTCCCAGATGGGTGCTGTCC (SEQ ID NO: 21), and L1

36. The vector of any one of the preceding claims, wherein the vector comprises a polynucleotide encoding for an open reading frame (ORF) of an antigen binding site heavy chain(s) selected from the group consisting of Trastuzumab, Rituximab, a member of IGHV1 family such as IGHV1-46, and a member of IGHV3 family such as IGHV3-23.

37. The vector of any one of the preceding claims, wherein the vector further comprises a poly-A-tail signal.

38. The vector of any one of the preceding claims, comprising a nucleic acid sequence as set forth in SEQ ID NO: 24.

39. The vector of any one of the preceding claims, wherein the vector is selected from the group comprising: pBEE (rat EF1 -alpha promoter with intron), pCHOl .O (human EF-2 promoter with intron), pcDNA3.1 (CMV promoter without intron), pCMV-lntron A (CMV promoter with Intron A), and the like.

40. A polynucleotide encoding the vector of any of the preceding claims.

41. A host cell comprising the vector and/or polynucleotide of any one of the preceding claims.

42. A kit or system containing a vector or a cell according to any one of the preceding claims.

43. A method of producing (or increasing the production of) a protein of interest, comprising: providing the vector of any one of claims 1 to 39 in an expression system.

44. A method according to claim 43, wherein the method increases the production of a protein of interest in the presence of abnormal (or incorrect) splicing when the open reading frame (ORF) is placed downstream of an intron, such as Intron A.

45. A method according to claim 43, wherein the method increases the production of a protein of interest even in the absence of abnormal (or incorrect) splicing.

46. A method of preventing abnormal (or incorrect) splicing, comprising: providing the vector of any one of claims 1 to 39 in an expression system.

47. A method of producing (or increasing the production of) a protein of interest, comprising: providing and/or introducing an exogenous 3’ splice site downstream of and/or within an intron downstream of a promoter region.

48. A method of preventing abnormal (or incorrect) splicing in the expression of a gene of interest comprising: providing and/or introducing an exogenous 3’ splice site downstream of and/or within an intron downstream of a promoter region.

49. The method of any one of claims 39 to 48, wherein the method provides and/or introduces an exogenous 3’ splice site downstream of an intron 3’ splice site of a promoter region, for example wherein the exogenous 3’ splice site is immediately downstream of an intron.

50. The method of any one of claims 39 to 49, wherein the method provides and/or introduces an exogenous 3’ splice site within an intron 3’ splice site of a promoter region, for example between the branch point and the 5’ splice site of the intron.

51. The method of any one of claims 39 to 50, wherein the vector comprising the gene of interest comprises an intron that comprises 5’ and 3’ endogenous splice sites.

52. The method of any one of claims 9 to 51 , wherein the exogenous 3’ splice site is about 0 to 50 nucleobases from the intron.

53. The method of any one of claims 39 to 52, wherein the exogenous 3’ splice site is placed between an intron and an exon, for example at the 3’ end of an intron and immediately before an exon.

54. The method of any one of claims 39 to 53, wherein the exogenous 3’ splice site is selected from the group comprising the 3’ splice site of SP6 intron, the 3’ splice site based on the consensus sequence of all human introns, the 3’ splice site of human beta-globulin intron, and the like.

55. The method of any one of claims 39 to 54, wherein the intron is the first intron immediately downstream of the promoter (i.e. Intron A or Intron 1).

56. The method of any one of claims 39 to 55, wherein the promoter is selected from the group consisting of rEF1a promoter, hEEF2 promoter, CMV promoter, EF-1a promoter and EF2 promoters from other mammals, and SV40 promoter.

57. The method of any one of claims 39 to 56, wherein the exogenous 3’ splice site is introduced in a promoter/intron pair selected from the group consisting of CMV/lntron A and rEF1a/lntron1.