ES2902044T3 - Promoter variants - Google Patents

Abstract

An isolated and/or artificial pG1-x promoter, which is a functional variant of the Pichia pastoris carbon source-regulatable pG1 promoter identified by SEQ ID 1, which pG1-x promoter consists of, or comprises, at least a part of SEQ ID 1, whose part of SEQ ID 1 is at least 293 bp long, whose pG1-x promoter comprises the following promoter regions a) at least two copies of a core regulatory promoter region, whose core regulatory promoter region comprises the sequences of nucleotides of SEQ ID 2 and SEQ ID 3, wherein SEQ ID 2 and/or SEQ ID 3 comprise one or more transcription factor binding sites (TFBS); and b) a non-core regulatory promoter region, which is any region within the pG1-x promoter sequence other than the core regulatory region; wherein the pG1-x promoter has sequence identity to the corresponding region of SEQ ID 1, which is at least 80% to SEQ ID 2 and SEQ ID 3, and at least 50% to any region other than SEQ ID 2 or SEQ ID 3; and further wherein the pG1-x promoter is characterized by increased promoter strength and/or induction ratio compared to the pG1 promoter, wherein - promoter strength is increased by at least 1.1-fold in the state induced compared to the pG1 promoter, and/or - the induction ratio is increased by at least 1.1-fold compared to the pG1 promoter.

Description

DESCRIPTION

Promoter variants

technical field

The invention relates to an isolated artificial promoter, which is a variant or functional derivative of the Pichia pastoris carbon source regulatable pG1 promoter identified by SEQ ID 1, whose promoter is referred to herein as pG1-x which is characterized by elements and promoter-specific traits.

Background

The methylotrophic yeast Pichia pastoris (syn. Komagataella sp.) is a well-established protein-producing host. Numerous strain engineering approaches to P. pastoris have improved the productivity of various products and efforts have also been devoted to promoters for production purposes (Prielhofer, R., M. Maurer, J. Klein, J. Wenger, C. Kiziak , B. Gasser and D. Mattanovich, (2013) Induction without methanol: novel regulated promoters enable high-level expression in Pichia pastoris. Microb Cell Fact 12: 5). Gene promoters are key features for the expression of a gene of interest (GOI): RNA transcription from a downstream (3') GOI is directed by the upstream (5') promoter sequence. RNA polymerase II (RNAPII) is responsible for the transcription of mRNA in eukaryotes. RNAPII promoters consist of a core promoter and several cis-acting DNA elements: proximal promoter, enhancers, silencers, and border/insulator elements. Yeast core promoters are typically located close (-75/+50 bp) to the major transcriptional start site, often contain inappropriate TATA boxes (up to 2 bases different from the consensus TATA sequence), and lack promoter elements that they are typically found in other organisms. Transcriptional regulation responds to different conditions and is carried out by cis-acting elements and corresponding regulatory proteins (transcription factors (TFs)).

For biotechnological applications, promoters are used that allow constitutive or regulated/inducible gene expression. Production methods using P. pastoris are favorably applied to carbon source-dependent promoters, such as the methanol-inducible P ^aox . In this way, the growth phase can be separated from the potentially difficult protein production phase. A set of promoters was recently reported (Prielhofer et al., 2013), which is also controlled by the carbon source, but does not depend on methanol for its induction: these promoters share the trait of repression by excess glycerol and induction by limiting glucose. pG1 (SEQ ID 1), the strongest of these promoters, is fully induced below 0.05 g/L glucose; natively controls the expression of a high-affinity glucose transporter gene GTH1. Glucose uptake characteristics depend on the presence of high- and low-affinity glucose transporters. Seventeen hexose transport ( HXT) genes in S. cerevisiae ( HXT1-17) are expressed as a function of glucose concentration, but only two homologous HXTs are found in P. pastoris (pAS_chr1-4_0570 and PAS_chr2-1_0054, designated PpHxt1 and PpHxt2). PpHxt1 was identified to be the main low-affinity transporter in P. pastoris, while high-affinity glucose transport is facilitated by two other genes, namely PAS_chr3_0023 and PAS_chr1-3_0011 ( GTH1, the gene controlled by pG1) Prielhofer et al., 2013).

While S. cerevisiae has a high glucose uptake capacity and glucose (fermentative) metabolism, P. pastoris has a lower glucose uptake rate and lower respiratory glucose metabolism. Furthermore, P. pastoris is able to take up glucose at much lower extracellular concentrations than S. cerevisiae (K ^m of high-affinity transporters in the pM range in P. pastoris vs. mM range in S. cerevisiae). The fundamental difference in glucose uptake behavior is also shown in the transcriptional control of related genes and can also be seen in the evolved functions of transcriptional regulators p. eg PpAft1 and PpMxr1 (homologue of ScAdr1).

Studies of P. pastoris promoters and random mutagenesis of P ^{aox 1} and the P ^gap glyceraldehyde-3-phosphate dehydrogenase promoter resulted in libraries with promoter variants possessing different activities, altered induction behavior compared to wild-type promoter and identification of several important P ^{aox 1} transcription factor binding sites (TFBS) (WO2006/089329 A2).

The pG1 promoter and its fragments are described in more detail in WO2013/050551 A1.

WO2014067926A1 discloses the expression of a protein of interest using specific leader sequences. The leader was used with various promoters. As an illustrative promoter, the pG1 promoter is used.

Struhl K. (Proceedings of the National Academy of Sciences of the United States of America 1982, 78(7):4461-4465) describes the mapping of deletions of the yeast his3 promoter region. It concludes that the TATA box, a sequence in front of most eukaryotic genes, is not sufficient for wild-type promoter function and suggests that the yeast promoter appears to be more complex than a simple RNA-polymerase interaction site. DNA.

Quandt et al. (Nucleic Acids Research 1995, 23(23) 4878-4884) describe tools for consensus matching of nucleotide sequence data to identify regulatory motifs based on analysis of sequence data. A consensus pattern library was created and possible sequence matches were detected using a software tool (MatInspector).

Summary of the invention

The object of the invention is to provide improved regulatable promoters with respect to carbon source regulation and promoter strength. Another object is to provide such a promoter for improved POI production and/or POI production within a reduced period of time.

The object is resolved by the subject matter claimed.

According to the invention, an isolated and/or artificial pG1-x promoter is provided, which is a functional variant of the Pichia pastoris carbon source-regulatable pG1 promoter identified by SEQ ID 1, whose part of SEQ ID 1 has a length of at least 293 bp, whose pG1-x promoter comprises the following promoter regions:

a) at least two copies of a central regulatory region, whose central regulatory promoter region comprises the nucleotide sequences of SEQ ID 2 and SEQ ID 3, where SEQ ID 2 and/or SEQ ID 3 comprise one or more binding sites transcription factor (TFBS); Y

b) a non-core regulatory region, which is any region within the pG1-x promoter sequence other than the core regulatory region;

wherein the pG1-x promoter has sequence identity to the corresponding region of SEQ ID 1, which is at least 80% in SEQ ID 2 and SEQ ID 3, and at least 50% in any region other than SEQ ID 2 or SEQ ID 3; and further wherein the pG1-x promoter is characterized by increased promoter strength and/or induction ratio compared to the pG1 promoter, wherein

- promoter strength is increased by at least 1.1-fold in the induced state compared to the pG1 promoter, and/or

- the induction ratio is increased by at least 1.1-fold compared to the pG1 promoter.

Specifically, the Pichia pastoris pG1 promoter identified by SEQ ID 1 is any one of SEQ ID 7, 8 or 9, more specifically SEQ ID 9 as used herein by reference in the Examples.

Specifically, the pG1-x promoter is not one of the prior art promoters designated pG1 (SEQ ID 264), nor pG1a (SEQ ID 265), pG1b (SEQ ID 266), pG1c (SEQ ID 267), pG1d (SEQ ID 268), pG1e (SEQ ID 269) or ^pG1f (SeQ ^{ID 270), as described in WO2013050551 A1.}

According to a specific embodiment, the pG1-x promoter according to the invention is a carbon source regulatable promoter characterized by

- a promoter strength of at least 1.1-fold, or at least 1.2-fold, or at least 1.3-fold, or at least 1.4-fold, or at least 1.5-fold, or at least 1.6-fold times, or at least 1.7 times, or at least 1.8 times, or at least 1.9 times, or at least 2 times, or at least 2.1 times, or at least 2.2 times, or at least at least 2.3 times, or at least 2.4 times, or at least 2.5 times, or at least 2.6 times, or at least 2.7 times, or at least 2.8 times, or at least 2.9 times, or at least 3 times, or at least 3.3 times, or at least 3.5 times, or at least 3.8 times, or at least 4 times, or at least 4.5 times, or at least 5-fold, or at least 5.5-fold, or at least 6-fold higher in the induced state compared to the pG1 promoter, and

- the ability to be regulated by carbon source determined by an induction ratio that is equal to or greater than the induction ratio achieved with the pG1 promoter.

According to a further specific embodiment, the pG1-x promoter according to the invention is a carbon source regulatable promoter characterized by

- the same or greater strength of the promoter in the induced state compared to the pG1 promoter, and

- the ability to be regulated by carbon source determined by an induction ratio that is at least 1.1 times, or at least 1.2 times, or at least 1.3 times, or at least 1.4 times, or at least 1.5 times, or at least 1.6 times, or at least 1.7 times, or at least 1.8 times, or at least 1.9 times, or at least 2 times, or at least 2.1 times, or at least 2.2 times, or at least 2.3 times, or at least 2.4 times, or at least 2.5 times, or at least 2.6 times, or at least 2.7 times, or at least 2.8 times greater, or at least 2.9 times, or at least 3 times, or at least 3.3 times, or at least 3.5 times, or at least 3.8 times, or at least 4 times, or at least 4 0.5-fold or at least 5-fold or at least 5.5-fold or at least 6-fold higher compared to the rate of induction achieved with the pG1 promoter.

According to a further specific embodiment, the pG1-x promoter according to the invention is a carbon source regulatable promoter characterized by

- a promoter strength of at least 1.1-fold, or at least 1.2-fold, or at least 1.3-fold, or at least 1.4-fold, or at least 1.5-fold, or at least 1.6-fold times, or at least 1.7 times, or at least 1.8 times, or at least 1.9 times, or at least 2 times, or at least 2.1 times, or at least 2.2 times, or at least at least 2.3 times, or at least 2.4 times, or at least 2.5 times, or at least 2.6 times, or at least 2.7 times, or at least 2.8 times, or at least 2.9 times, or at least 3 times, or at least 3.3 times, or at least 3.5 times, or at least 3.8 times, or at least 4 times, or at least 4.5 times, or at least 5-fold, or at least 5.5-fold, or at least 6-fold higher in the induced state compared to the pG1 promoter, and

- the ability to be regulated by carbon source determined by an induction ratio that is at least 1.1 times, or at least 1.2 times, or at least 1.3 times, or at least 1.4 times, or at least 1.5 times, or at least 1.6 times, or at least 1.7 times, or at least 1.8 times, or at least 1.9 times, or at least 2 times, or at least 2.1 times, or at least 2.2 times, or at least 2.3 times, or at least 2.4 times, or at least 2.5 times, or at least 2.6 times, or at least 2.7 times, or at least 2.8 times greater, or at least 2.9 times, or at least 3 times, or at least 3.3 times, or at least 3.5 times, or at least 3.8 times, or at least 4 times, or at least 4 0.5-fold or at least 5-fold or at least 5.5-fold or at least 6-fold higher compared to the rate of induction achieved with the pG1 promoter.

Specifically, promoter strength is determined by the level of expression of a protein of interest (POI), such as a model protein (eg, Green Fluorescent Protein, GFP, including, eg, enhanced GFP, eGFP, Genbank accession number U57607), and/or transcription rate, compared to the pG1 promoter. The promoter strength of pG1-x is specifically at least 1.2-fold, or at least 1.3-fold, or at least 1.4-fold, or 1.5-fold, or at least 1.6-fold, or at least 1.7 times, or at least 1.8 times, or at least 1.9 times, or at least 2 times, or at least 2.1 times, or at least 2.2 times, or at least 2.3 times , or at least 2.4 times, or at least 2.5 times, or at least 2.6 times, or at least 2.7 times, or at least 2.8 times greater, or at least 2.9 times, or at least 3 times, or at least 3.5 times, or at least 4 times, or at least 4.5 times, or at least 5 times, or at least 5.5 times, or at least 6 times, or at at least 6.5 times, or at least 7 times, or at least 7.5 times, or at least 8 times, or at least 8.5 times, or at least 9 times, or at least 9.5 times, or at least 10-fold higher compared to, for example, the pG1 promoter.

Herein, the pG1 promoter can serve as a reference or control to determine improved function of the promoter. Such a control pG1 promoter can be used in parallel control experiments using the same host cell and expression system, or as an internal control within the same host cell culture. Such control experiments to qualify promoter function as compared to the pG1 promoter are preferably carried out in P. pastoris host cell cultures, in particular P. pastoris expressing a model protein, such as GFP or eGFP.

Induction of the pG1-x promoter refers specifically to induction of transcription, specifically including further translation and optional expression of said POI.

Said transcription rate is determined as a measure of promoter strength and specifically refers to the amount of transcripts obtained by fully inducing said promoter.

Said transcription rate can be determined by the strength of transcription in the fully induced state, which is obtained, for example, under glucose-limited chemostat culture conditions and is expressed relative to the transcription rate of the pG1 promoter.

Preferably, the transcription analysis is quantitative or semi-quantitative, preferably using qRT-PCR, DNA microarrays, RNA sequencing, and transcriptome analysis.

Promoter strength compared to pG1 promoter strength can be determined by the following standard assay: P. pastoris strains expressing eGFP under the control of the promoter to be tested are screened in 24 deep-well plates at 25°C with shaking at 280 rpm with 2 ml of culture per well. Glucose feed beads (6mm, Kuhner, CH) are used to generate glucose-limiting growth conditions. Cells are analyzed for eGFP expression in the induced state (feed count YP 1, for 20-28 hours).

Such a promoter is considered derepressed and fully induced, if the culture conditions provide approximately maximal induction, e.g. eg at glucose concentrations of less than 0.4 g/L, preferably less than 0.04 g/L, specifically less than 0.02 g/L. The fully induced promoter preferably exhibits a transcription rate of at least 20%, more preferably at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, and at least 100% or even higher transcription rate. transcription of at least 150% or at least 200% compared to the native pGAP promoter. The rate of transcription can be determined, for example, by the amount of transcripts from a reporter gene, such as eGFP, as described in the Examples section below, by growing a clone in liquid culture. Alternatively, the rate of transcription can be determined by the strength of transcription in a microarray, where the microarray data shows the difference in expression level between the repressed and unrepressed state and a high signal intensity in the fully induced state compared to a control.

Said native pGAP promoter specifically is an endogenous or eukaryotic cell homologous promoter that can be used as a host cell to determine the expression of a POI, and serves as a standard or reference promoter for comparison purposes.

For example, a native P. pastoris pGAP promoter is the unmodified endogenous promoter sequence in P. pastoris, as used to control GAPDH expression in P. pastoris, eg, having the sequence shown in Figure 7 : P. pastoris native pGAP promoter sequence (GS115) (Se C ID 260). If P. pastoris is used as a host to produce a POI according to the invention, the strength or transcription rate of the pG1-x promoter according to the invention is compared to such native P. pastoris pGAP promoter, and/or compared to the promoter native pG1.

As another example, a native S. cerevisiae pGAP promoter is the unmodified endogenous promoter sequence in S. cerevisiae, used to control GAPDH expression in S. cerevisiae. If S. cerevisiae is used as a host to produce a POI, the strength or rate of transcription from the pG1-x promoter is compared to that native S. cerevisiae pGAP promoter.

Therefore, the relative transcription strength or rate of a promoter according to the invention is usually compared to the native pGAP promoter of a cell of the same species or strain that is used as a host to produce a POI.

The induction ratio is a key parameter in determining the regulation of the present pG1-x promoter, and establishes the activity or strength of the promoter in the induced state relative to the activity or strength of the promoter in the repressed state. For example, the expression level of a model protein (eg, GFP or eGFP) and/or the rate of transcription in the repressed state are determined after repression by excess glycerol, and the expression level of the protein Pattern and/or transcription rate are determined in the induced state after induction by limiting glucose feed.

Specifically, the ratio of induction is determined by the ratio of the expression level (eg, GFP or eGFP) in the induced versus repressed state. The induction rate of the pG1 -x promoter is specifically the same or higher compared to the pG1 promoter. In specific cases, the induction ratio is at least 2 times, or at least 3 times, or at least 4 times, at least 5 times, or at least 6 times, or at least 7 times, at least 8 times, or at least at least 9-fold, or at least 10-fold higher, compared to the pG1 promoter.

The ratio of induction compared to the strength of the pG1 promoter can be determined by the following standard assay: P. pastoris strains expressing eGFP under the control of the promoter to be tested are screened in 24 deep-well plates. at 25°C with shaking at 280 rpm with 2 mL of culture per well. Glucose feed beads (6mm, Kuhner, CH) are used to generate glucose-limiting growth conditions. Cells are analyzed for eGFP expression during repression (YP 1% glycerol, exponential phase) and induction (YP 1 feed bead, over 20-28 hours).

Specifically, the pG1-x promoter has a promoter activity or strength (eg, transcriptional activity or transcriptional strength) in the derepressed (induced) state, which is at least 2.5-fold, or at least 3-fold, or at at least 4 times, at least 5 times, or at least 6 times, or at least 7 times, at least 8 times, or at least 9 times, or at least 10 times higher than in the repressed state.

Specifically, the core regulatory region incorporates the nucleotide sequences of SEQ ID 2 and SEQ ID 3, meaning that the sequences of SEQ ID 2 and 3 are comprised of the pG1-x promoter sequence in any order, preferably in close proximity to each other. Yep. eg with up to 10, 20, 50 or 100 bp between the sequences of SEQ ID 2 and 3.

Specifically, SEQ ID 2 and/or SEQ ID 3 contain one or more transcription factor binding sites (TFBS).

Specifically, the nucleotide sequences of SEQ ID 2 and SEQ ID 3, each or both sequences together represent a TFBS or at least a part thereof that is considered functional, is recognized by the respective transcription factor. Such nucleotide sequence of s Eq ID 2 or SEQ ID 3 (or a functional variant thereof) is considered essential and is incorporated into the pG1-x promoter either in unmodified form or as a functional variant thereof with al least 80% sequence identity, or at least 85%, or at least 90%, or at least 95%, up to 100% sequence identity.

Specifically, the pG1-x promoter comprises a nucleotide sequence other than SEQ ID 2 and SEQ ID 3, having at least 50% sequence identity with a corresponding region in the pG1 promoter, specifically, at least 60% or at least 70%, or at least 80%, or at least 90% sequence identity in the core regulatory region or in the non-core regulatory region. Specifically, the nucleotide sequence within the core regulatory region that is anything other than SEQ ID 2 and SEQ ID 3 is at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95%, or at least 98% sequence identity with the region corresponding in the pG1 promoter. Specifically, the nucleotide sequence in the non-core regulatory region may have less than 90%, or less than 80%, or less than 70%, or less than 60% sequence identity with a corresponding region in the pG1 promoter.

Specifically, the core regulatory region comprises or consists of the nucleotide sequence of SEQ ID 4, or a functional variant thereof that comprises the TFBS, preferably a functional variant with at least 80%, or at least 90%, or at least 95%, or at least 98% sequence identity.

Specifically, the core regulatory region is incorporated into a major regulatory region represented by SEQ ID 5, or a functional variant thereof comprising the TFBS, preferably a functional variant with at least 80%, or at least 90%, or at least 95%, or at least 98% sequence identity.

Specifically, the one or more TFBS is a TFBS for any of the transcription factors selected from the group consisting of Rgt1, Cat8-1, and Cat8-2.

Specifically, TFBS are recognized by the transcription factors Rgt1 and/or Cat8-1 and/or Cat8-2. TFBS are characterized by certain consensus sequences, which may vary for the same factor. Specific transcription factors are identified as follows:

Rgt1 is a glucose-responsive transcriptional activator and repressor that regulates the expression of several glucose transporter (HXT) genes. P. pastoris Rgt1 is characterized by the amino acid sequence of SEQ ID 261 (FIG. 7).

Cat8-1 and Cat8-2 are transcriptional activators of zinc groups that bind to carbon source response elements, required for derepression of a variety of genes under non-fermentative growth conditions. P. pastoris Cat8-1 and Cat8-2 are characterized by the amino acid sequences of SEQ ID 262 and 263, respectively (FIG. 7).

Specifically, the core regulatory region comprises a deletion of one or more nucleotides between the nucleotide sequences of SEQ ID 2 and SEQ ID 3. Deletions may be one or more point mutations, and refer to 1, 2, 3, 4, 5, 6, 7, 8 or all 9 nucleotides between SEQ ID 2 and SEQ ID 3, compared to the corresponding region of SEQ ID 1.

Specifically, the core regulatory region comprises an insertion of one or more nucleotides between the nucleotide sequences of SEQ ID 2 and SEQ ID 3. The insertions may be one or more point mutations, and refer to at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides located between SEQ ID 2 and SEQ ID 3.

Specifically, the core regulatory region comprises a substitution of one or more nucleotides between the nucleotide sequences of SEQ ID 2 and SEQ ID 3. The substitutions may be one or more point mutations, and refer to 1,2, 3, 4, 5, 6, 7, 8 or all 9 nucleotides located between SEQ ID 2 and SEQ ID 3.

Any of the specific deletions, insertions or substitutions can be combined to obtain the pG1-x promoter.

According to a specific aspect, the pG1-x promoter comprises at least two copies of the core regulatory region or the major regulatory region, either the original core regulatory region or the functional variant comprising at least one mutation. Specifically, the pG1-x promoter may comprise at least two, three or four copies of the core regulatory region and/or at least two, three or four copies of the major regulatory region.

According to another specific aspect, the pG1-x promoter comprises at least two, three, four, five, six, seven or eight copies of one or more TFBS selected from the group consisting of Rgt1, Cat8-1 and Cat8-2.

Specifically, the pG1-x promoter is an improved functional variant of the pG1 promoter that comprises a deletion of one or more nucleotides at the 5' end of the pG1 sequence, preferably leaving at least 280 nucleotides from the 3' region of the pG1 sequence or a functional variant of the 3' region.

According to a specific embodiment, the pG1-x promoter comprises at least one or at least two T motifs identified by any of SEQ ID 12-29. The T motif specifically consists of any of

a) a sequence of contiguous T (thymines) which is referred to herein as T ⁿ or (T) ⁿ , preferably wherein n = 13-20; preferably wherein the T motif is T14, T15 or T16;

b) a sequence characterized by A (adenine) in the first position, followed by a sequence of contiguous T (thymines), which is referred to herein as ATn or A(T) ⁿ , preferably where n = 13-20, in some cases preferably where n = 13-22;

c) a sequence characterized by T (thymine) in the first position, and A (adenine) in the second position, followed by a sequence of contiguous T (thymines), which is referred to herein as TATn or TA(T) ⁿ , preferably where n = 13-20;

d) a sequence characterized by a sequence of contiguous T (thymines) and A (adenine) at the last position, which is referred to herein as TnA or (T) ⁿ A, preferably where n = 13-20;

e) a sequence characterized by a sequence of contiguous T (thymines) followed by A (adenine) at the penultimate position, and T (thymine) at the last position, which is referred to herein as TnAT or (T) ⁿ AT, preferably where n = 13-20; either

d) a sequence of c) or e) wherein A (adenine) is substituted for T (thymine), which is referred to herein as TTTn or TnTT or T(A/T)Tn or T(A/T)( T) ⁿ , or Tn(A/T)T or (T) ⁿ (A/T)T, preferably wherein n = 13-20, e.g. eg resulting in a motif T consisting of a sequence of (T) ⁿ where n = 15-22.

Any of the T motifs specified in a) to d) above may be combined in a promoter sequence, e.g. such that the promoter sequence comprises a T motif that is a TA(T) ⁿ motif, where n = 13-20, and another T motif that is a (T) ⁿ motif, where n = 13-22 .

The T motif optionally comprises an extension, such that it extends by one or more "A"s (eg, 1, 2, or 3 adenines) and optionally further extends by "T" (eg, 1, 2 or 3 thymines) at the 3' end and/or at the 5' end of the T motif, the extension of which is also referred to herein as the extended T motif.

Herein, the term "T motif" will always include the T motif that is extended or not, therefore, the term specifically includes both the T motif that does not comprise the extension, and the extended T motif. Specifically, the T motif comprises or consists of the nucleotide sequence that is any of SEQ ID 12-29. Any one, two or more of the T motifs may be incorporated into the pG1-x promoter with or without extension of the motif.

According to a specific aspect, the extension of the T motif is an elongation of the "TA" sequence at its 5' end, to obtain a 5' "TAT" end.

According to another specific aspect, the extension of the T motif is an elongation of the "TAA" sequence at its 5' end, to obtain a 5' "TAAT" end.

According to another specific aspect, the extension of the T motif is an elongation of the "AT" sequence at its 3' end, to obtain a 3' "TAT" end.

According to another specific aspect, the extension of the T motif is an elongation of the "AAT" sequence at its 3' end, to obtain a 3' end of "TAAT".

According to a specific aspect, the T motif is located upstream of the central regulatory region and, optionally, upstream of the main regulatory region.

According to another specific aspect, the T motif is located downstream of the central regulatory region and, optionally, downstream of the main regulatory region.

Specifically, the pG1-x promoter comprises a 3' terminal nucleotide sequence that incorporates at least part of a translation start site. A translation start site is specifically known as a Kozak consensus sequence in eukaryotes, and a sequence suitable for supporting gene expression.

Specifically, the translation start site

a) originates from the pG1 promoter and consists of or comprises the nucleotide sequence of SEQ ID 6, or a functional variant thereof with at least 90% sequence identity; either

b) originates from any other Pichia pastoris promoter, or a functional variant thereof with at least 90% sequence identity.

Illustrative alternative 3'-terminal promoter regions that can be used in place of the 3'-terminal region of the pG1 promoter, or in place of the nucleotide sequence of SEQ ID 6, are obtained, e.g. eg, from any of the following promoters: pAOX1, pAOX2, pDAS1, pDAS2, pFLD, pGAP, or pTEF2.

According to a specific embodiment, the promoter is up to 2000 bp in length. The specific pG1-x promoter has a length that is shorter than that of the pG1 promoter, such as at least 293 bp or 300 bp, or at least 328 bp, or at least 350 bp, or at least 400 bp in length. , or at least 500 bp.

Specifically, the pG1-x promoter may comprise a sequence originating from a fragment of the pG1 promoter. According to a specific aspect, the pG1-x promoter is a variant or derivative of a parental fragment of pG1, comprising at least the 3' region of SEQ ID 1 that extends at least 50%, or 60%, or 70%, or 80%, or at least 90% of the pG1 sequence.

Specifically, the nucleotide sequence of pG1-x is derived from the nucleotide sequence of the pG1 promoter comprising a deletion at or in the 5' terminal region, e.g. eg a cut of the nucleotide sequence at the 5' end, to obtain a specific length ranging from the 3' end to a variable 5' end, such as with a nucleotide sequence length of at least 293 bp or 300 bp, or at least 328 bp, or at least 350 bp, or at least 400 bp, or at least 500 bp to the length of the pG1 promoter fragment comprising a deletion of at least 1, or at least 10, or at least minus 100 bp.

However, the length of the promoter can also be increased, to obtain a length that is longer than the length of the pG1 promoter, specifically a length of up to 1500 bp, or up to 2000 bp. Specifically, the length can be within any of the ranges: 293 bp - 1500 bp, 293 bp - 2000 bp, 328 bp - 1500 bp, or 328 2000 bp.

According to a specific aspect, the invention provides an isolated and/or artificial pG1-x promoter, comprising or consisting of the nucleotide sequence selected from the group consisting of any of

a) SEQ ID 37-44, preferably any of SEQ ID 45-76;

b) SEQ ID 77-80, preferably any of SEQ ID 81-112;

c) SEQ ID 113-114, preferably any of SEQ ID 115-130;

d) SEQ ID 131-132, preferably any of SEQ ID 133-148; either

e) SEQ ID 185-186, preferably any of SEQ ID 187-202;

or a nucleotide sequence having at least 80% sequence identity to any of the foregoing, wherein the pG1-x promoter is characterized by increased promoter strength and/or rate of induction compared to promoter Pichia pastoris pG1 identified by SEQ ID 1, wherein

- the strength of the promoter is at least 1.1-fold higher in the induced state compared to the pG1 promoter, and/or

- the induction ratio is at least 1.1 times higher compared to the pG1 promoter.

A functional variant of such a pG1-x promoter of a)-e) above is preferably characterized by any of the specific features described for the functional variant of the pG1 promoter as described herein.

Specifically, the functional variant of any of the pG1-x promoters of sections a) - e) above, preferably a functional variant of any of SEQ ID 45-76, is characterized by one or more of the following features

a) the sequence is a functional variant of the promoter sequence of any of the pG1-x promoters of sections a) - e) above that comprises a deletion of one or more nucleotides at the 5' end of the promoter sequence, preferably leaving at least 280 nucleotides of the 3' region of the promoter sequence or a functional variant of the 3' region, preferably comprising a 5' deletion of the promoter sequence of 50, 100, 150, 200, 250 or 300 nucleotides up to, but not including, the major regulatory region together with any sequence downstream or 3' of said major regulatory region, in the case of more than 1 major regulatory region, the deletion of the 5' end of the promoter sequence is up to, but not including, the first or most of the 5' major regulatory region;

b) the sequence comprises one or more TFBS, preferably wherein the TFBS is for any of the transcription factors selected from the group consisting of Rgt1, Cat8-1 and Cat8-2;

c) the core regulatory region comprises the nucleotide sequence of SEQ ID 4, or a functional variant thereof comprising one or more TFBS, preferably a functional variant with at least 80% sequence identity,

d) the core regulatory region is incorporated into a major regulatory region represented by SEQ ID 5, or a functional variant thereof comprising the TFBS, preferably a functional variant with at least 80% sequence identity;

e) the core regulatory region comprises a deletion of one or more nucleotides between the nucleotide sequences of SEQ ID 2 and SEQ ID 3;

f) the sequence comprises at least two copies of the core regulatory region or the major regulatory region; g) the sequence further comprises at least one or at least two T motifs identified by any of SEQ ID 12-29; preferably wherein the T motif is located upstream or downstream of the core regulatory region, and optionally upstream or downstream of the core regulatory region;

h) the sequence comprises a 3' terminal nucleotide sequence comprising at least part of a translation start site;

i) the sequence is elongated to a length of up to 2000 bp.

The invention further provides the pG1-x promoter in isolated form.

Specifically, provided is isolated pG1-x promoter nucleic acid comprising the pG1-x promoter as described herein, or a nucleic acid comprising complementary sequence. Specifically, the complementary sequence is a sequence that hybridizes under stringent conditions to the pG1-x promoter.

Specifically, the nucleic acid is operably linked to a nucleotide sequence encoding a protein of interest (POI), which nucleic acid is not natively associated with the nucleotide sequence encoding the POI. The POI is specifically a heterologous polypeptide or protein.

Specifically, the nucleotide sequence further comprises a nucleotide sequence that encodes a signal peptide that enables secretion of the POI, preferably wherein the nucleotide sequence that encodes the signal peptide is located adjacent to the 5' end of the nucleotide sequence that encodes the POI.

Specifically, the signal peptide is selected from the group consisting of signal sequences from the S. cerevisiae alpha-mating factor prepro-peptide, the signal peptides from the P. pastoris acid phosphatase gene (PHO1), and extracellular protein X ( EPX1) (Heiss, S., V. Puxbaum, C. Gruber, F. Altmann, D. Mattanovich and B. Gasser, (2015) Multistep processing of the secretion leader of the extracellular protein Epx1 in Pichia pastoris and implications on protein localization Microbiology).

Specifically, the POI is a eukaryotic protein, preferably a mammalian protein.

In specific cases, a POI is a multimeric protein, specifically a dimer or tetramer.

According to specific embodiments, the POI is a heterologous protein, preferably selected from therapeutic proteins, including antibodies or fragments thereof, enzymes and peptides, protein antibiotics, toxin fusion proteins, carbohydrate-protein conjugates, structural proteins, regulatory proteins, vaccines and vaccine-like proteins or particles, procedural enzymes, growth factors, hormones, and cytokines, or a metabolite of a POI, specifically including a recombinant cell culture cell metabolite that expresses a gene of interest under the transcriptional control of a promoter of the invention.

A specific POI is an antigen-binding molecule, such as an antibody, or a fragment thereof. Specific POIs include antibodies such as monoclonal antibodies (mAb), immunoglobulin (Ig) or class G immunoglobulin (IgG), heavy chain antibodies (HcAb) or fragments thereof such as antigen-binding fragments (Fab) , Fd, single chain variable fragment (scFv), or genetically modified variants thereof such as, for example, Fv dimers (diantibodies), Fv trimers (triantibodies), Fv tetramers or mini-antibodies and single-domain antibodies such as VH or vHh or V-NAR. Additional antigen-binding molecules may be selected from (alternative) scaffold proteins such as e.g. eg Genetically modified Kunitz domains, Adnectins, Affibodies, Anticalines and DARPins. The term "scaffold" describes a multifaceted group of stably folded and compact proteins, differing in size, structure, and origin, that serve as the starting point for the generation of antigen-binding molecules. Inspired by the structure-function relationships of antibodies (immunoglobulins), such an alternative protein scaffold provides a robust and conserved structural framework that supports an interaction site that can be remodeled for strict and specific recognition of a given (bio)molecular target.

According to a specific embodiment, a fermentation product is made using the POI, a metabolite or a derivative thereof.

The invention further provides an expression construct comprising the nucleic acid as described herein, preferably an autonomously replicating vector or plasmid, or a vector or plasmid that integrates into the chromosomal DNA of a host cell.

Specifically, the expression construct comprises the pG1-x promoter, operably linked to a nucleotide sequence encoding a POI under the transcriptional control of said promoter, which promoter is not natively associated with the POI coding sequence. Specifically, the expression construct is a vector.

The invention further provides a recombinant host cell comprising the expression construct as described herein, preferably a eukaryotic cell, such as a cell. mammalian, insect, yeast, filamentous fungus or plant, preferably a yeast or filamentous fungal cell, more preferably a yeast cell of the genus Saccharomyces or Pichia.

Specifically, the yeast is selected from the group consisting of Pichia, Candida, Torulopsis, Arxula, Hansenula, Yarrowia, Kluyveromyces, Saccharomyces, Komagataella, preferably a methylotrophic yeast.

A specifically preferred yeast is Pichia pastoris, Komagataella pastoris, K. phaffii, or K. pseudopastoris, such as, e.g. g., any of the P. pastoris strains CBS 704, CBS 2612, CBS 7435, CBS 9173-9189, DSm Z 70877, X-33, GS115, KM71, and SMD1168.

According to a specific aspect, the recombinant host cell comprises multiple copies of the nucleic acid sequence and/or multiple copies of the expression construct. For example, the recombinant cell comprises 2, 3, 4 or more copies (gene copy number, GCN).

The invention further provides a stable culture of the recombinant host cell as described herein.

According to a specific embodiment, a cell is used, which has a higher specific growth rate in the presence of a surplus carbon source relative to limited carbon source conditions.

The invention further provides a method of producing a POI by culturing a recombinant host cell line as described herein, comprising the steps of

a) cultivating the cell line under conditions to express said POI, and

b) retrieve the POI.

Specifically, said method is carried out under the transcriptional control of the carbon source regulatable pG1-x promoter, wherein said pG1-x promoter has at least one of the promoter strength and regulatable traits improved compared to the pG1 promoter. .

According to a specific embodiment, the cell line is grown under batch, fed-batch, or continuous culture conditions, and/or in media containing limited carbon substrate.

Specifically, the cultivation is performed in a bioreactor starting with a batch phase as the first stage, followed by a fed-batch phase or a continuous cultivation phase as the second stage.

Specifically, host cells are cultured in a medium rich in carbon source during the high growth rate phase (eg, at least 50%, or at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or up to maximum growth rate) and produce POI during a phase of low growth rate (eg, less than 90%, preferably less than 80%, less than 70%, less than 60%, less than 50% or less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, less than 3% , less than 2%, less than 1%, less than 0.5%, less than 0.4%, less than 0.3% or less than 0.2% of the maximum growth rate) p. eg while limiting the carbon source, preferably by feeding a defined minimal medium.

Specifically, POI is expressed under conditions that limit growth, e.g. eg culturing the cell line at a growth rate less than the maximum growth rate, typically less than 90%, preferably less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less less than 30%, less than 20%, less than 10%, less than 5%, less than 3%, less than 2%, less than 1%, less than 0.5%, less than 0.4%, less than 0.3%, or less than 0.2% of the maximum growth rate of the cells. Typically, the maximum growth rate is individually determined for a specific host cell.

Specifically, the cultivation method comprises

a) a first step using a basal carbon source that represses the pG1-x promoter, followed by

b) a second step that does not use or uses a limited amount of a complementary carbon source that derepresses or induces the pG1-x promoter to induce POI production.

Specifically, the batch phase is carried out until the basal carbon source that is initially added to the cell culture is consumed by the cell line. The dissolved oxygen (DO) increase method can be used to determine the consumption of the basal carbon source during the batch phase.

According to a specific embodiment, the discontinuous phase is characterized by a continuous decrease in the partial pressure of oxygen (pO2) signal and wherein the end of the discontinuous phase is characterized by an increase in pO2. Typically, while the basal carbon source is consumed during the batch phase and without adding additional carbon sources as is typical in batch phases, the partial pressure of oxygen (pO2) signal will continuously decrease to, say, below 65 %, such as for example 30%. Following consumption of the basal carbon source, the pO2 may increase, e.g. e.g., above 30% such as, for example, above 65%, or more indicating the appropriate time point to switch to the fed-batch system using feed medium to add an additional carbon source under carbon source limited conditions.

Specifically, the pO2 drops to less than 65% or less saturation during the batch phase followed by a rise above 65% or more saturation at the end of the batch. Specifically, the discontinuous phase is carried out until an increase in the partial pressure of oxygen (pO2) signal above 65% saturation, specifically above any of 70%, 75%, 80% or 85%.

Specifically, the batch phase is carried out for about 20 to 36 hours.

The term "about" with respect to the cultivation time will mean /- 5% or /- 10%.

For example, the specific batch execution time of about 20 to 36 hours means a duration of 18 to 39.6 hours, specifically 19 to 37.8 hours.

According to a specific embodiment, the batch phase is performed using 40 to 50 g/L of glycerol, specifically 45 g/L of glycerol as the basal carbon source in batch media, and the cultivation is performed at 25°C for about 27 at 30 h, or at 30°C for about 23 to 36 h, or at any temperature between 25°C and 30°C for a culture time of 23 to 36 h. Decreasing the glycerol concentration in the batch medium would decrease the duration of the batch phase, while increasing the glycerol in the batch medium would even prolong the batch phase. As an alternative to glycerol, glucose can be used, e.g. eg in roughly the same amounts.

In a typical POI expression and cell culture system, where a batch phase is followed by a fed-batch phase, specifically, cultivation in the fed-batch phase is performed for anywhere from about 15 to 80 h, about from 15 to 70 hours, about 15 to 60 hours, about 15 to 50 hours, about 15 to 45 hours, about 15 to 40 hours, about 15 to 35 hours, about 15 to 30 hours, about 3 to 35 p.m., about 3 to 10 p.m., or about 3 to 8 p.m.; preferably about 20 to 40 hours. Specifically, cultivation in the fed-batch phase is performed for any of about 80 h, about 70 h, about 60 h, about 55 h, about 50 h, about 45 h, about 40 h, around 35h, around 33h, around 30h, around 25h, around 20h, or around 15h.

Any such fed-batch culture of less than 120 hrs or less than 100 hrs or up to 80 hrs, which results in satisfactory production of POI thereby obtaining a high yield, is referred to herein as "rapid fermentation". Specifically, the volume specific product formation rate (rP) is the amount of product (mg) formed per Volume Unit (L) and Time Unit (h) (mg(L h)-1). The volume specific product formation rate is also called the space-time yield (STY) or volumetric productivity.

Specifically, fed-batch cultivation is performed such that a spatio-temporal yield of about 30 mg (L h)-1 (i.e. 30 mg (L h)-1 /- 5% or /- 10%) . Specifically a spatio-temporal yield of about 30 mg (L h)-1 is achieved in about 30 hours of fed batch, specifically at least any of 27, 28, 29, 30, 31, 32 or 33 mg can be achieved ( L h)'1 in less than any of 33 hrs, 32 hrs, 31 hrs, 30 hrs, 29 hrs, 28 hrs, 27 hrs, 26 hrs or 25 hrs of fed-batch time.

Specifically, the batch phase is performed as a first step a) and the fed-batch phase is performed as a second step b).

Specifically, the second stage b) employs a feeding medium in a fed-batch phase that provides the complementary carbon source in a growth-limiting amount to maintain the specific growth rate within the range of 0.04 I r1 to 0, 2 h-1, preferably less than 0.2, 0.15, 0.1 Ir1 or 0.15 h-1.

Specifically, the fed-batch and fed-batch culture method employs a yeast host cell, e.g. eg a yeast from either the genus Saccharomyces or the genus Pichia or the genus Komagataella, or a yeast from a genus other than Pichia, such as K. lactis, Z. rouxii, P. stipitis, H. polymorpha, or Y. lipolytic, preferably Pichia pastoris or Komagataella pastoris. Specifically, yeast is used in rapid fermentation.

Specifically, the fed-batch and fed-batch culture method employs the pG1-x promoter which is any one of SEQ ID 37-44, preferably any one of SEQ ID 45-76. In particular, the pG1-x promoter is characterized by SEQ ID 39, preferably SEQ ID 49.

Specifically, POI is produced at a transcription rate of at least 15% compared to the cell's native pGAP promoter.

According to a specific embodiment, the basal carbon source is different from the complementary carbon source, e.g. eg quantitatively and/or qualitatively different. The quantitative difference may provide the different conditions for repressing or derepressing the promoter activity.

According to a further specific embodiment, the basal and complementary carbon sources comprise the same type of molecules or carbohydrates, preferably at different concentrations. According to a further specific embodiment, the carbon source is a mixture of two or more different carbon sources.

Any type of organic carbon suitable for eukaryotic cell culture can be used. According to a specific embodiment, the carbon source is a hexose, such as glucose, fructose, galactose, or mannose, a disaccharide, such as sucrose, an alcohol, such as glycerol or ethanol, or a mixture thereof.

According to a specifically preferred embodiment, the basal carbon source is selected from the group consisting of glucose, glycerol, ethanol, or mixtures thereof, and complex nutrient material. According to a preferred embodiment, the basal carbon source is glycerol.

According to a further specific embodiment, the complementary carbon source is a hexose such as glucose, fructose, galactose and mannose, a disaccharide such as sucrose, an alcohol such as glycerol or ethanol, or a mixture thereof. According to a preferred embodiment, the complementary carbon source is glucose.

Specifically,

a) the basal carbon source is selected from the group consisting of glucose, glycerol, ethanol, a mixture thereof, and complex nutrient material; Y

b) the complementary carbon source is a hexose, such as glucose, fructose, galactose, or mannose, a disaccharide, such as sucrose, an alcohol, such as glycerol or ethanol, or a mixture of any of the foregoing.

Said culturing steps specifically comprise culturing the cell line in the presence of said carbon sources, thus in a culture medium comprising said carbon sources, or in step b) also in the absence of a complementary carbon source.

Derepressing (or inducing) conditions can be suitably achieved by specific means. The second stage b) optionally employs a feed medium that does not provide the complementary carbon source or provides it in a limited amount.

Specifically, the feed medium is chemically defined and free of methanol.

The feed medium can be added to the culture medium in liquid form or also in an alternative form, such as a solid, e.g. eg in the form of a tablet or other sustained release medium, or a gas, e.g. eg carbon dioxide. However, according to a preferred embodiment, the limited amount of a complementary carbon source added to the cell culture medium may even be zero. Preferably, under conditions of a limited carbon substrate, the concentration of a complementary carbon source in the culture medium is 0-1 g/L, preferably less than 0.6 g/L, more preferred less than 0.3 g /L, more preferred less than 0.1 g/L, preferably 1-50 mg/L, more preferred 1-10 mg/L, specifically preferred 1 mg/L or even below, such as below detection limit measured with a suitable conventional assay, e.g. eg determined as residual concentration in the culture medium after consumption by the growing cell culture.

In a preferred method, the limited amount of the complementary source provides a residual amount in the cell culture that is below the detection limit determined in the fermentation broth at the end of a production phase or at the output of a fermentation process. , preferably when harvesting the fermentation product.

Specifically, the second stage b) employs a feed medium that provides the complementary carbon source in a growth-limiting amount to maintain the specific growth rate within the range of 0.001 h-1 to 0.2 h-1, preferably 0.005 h-1 to 0.15 h-1.

figures

Figure 1: Sequence analysis of pG1 for carbon source-related TFBS using MatInspector. pG1 (also known as P ^{gth 1} ), was initially amplified and cloned from position -965 to -1 (965 bp length, sequence is given in Figure 6 (SEQ ID 1, in particular SEQ ID 9 has been used) Numbers indicate TFBS that were selected for deletion (listed in Table 2) Associated matrix families are F$CSRE (Carbon Source Response Elements, hatched boxes), F$ADR (Yeast Metabolic Regulator, dotted boxes), F$MGCM (Gal4 class monomeric motifs, solid boxes), and F$YMIG (yeast GC Box proteins, white boxes).Other TFBS may be affected by deletions (detailed matching information matrix is provided in Table 1) .The black shaded box indicates the major regulatory region of pG1 that was identified by screening for shortened pG1 variants.The asterisk indicates the position of the prominent tAt motif (position -390 to - 374) which is also selected for deletion and mutation. Alternative 5' starts of shortened variants of the pG1 promoter are marked with arrows and the length of the corresponding variant.

Figure 2: Screening data for shortened pG1 promoter variants. Geometric mean population-specific eGFP fluorescence (fluorescence related to cell volume) is shown for clones expressing eGFP under pG1 control (clone no. 8, GCN verified from 1) or a shortened pG1 variant (each 2 clones grown in triplicate, selected in pre-screens) under growth repression and induction conditions. Wild-type P. pastoris cells without expression were used as a negative control. Samples were taken during the suppressive preculture and after 24 and 48 hours of induction with feeding beads.

Figure 3: Screening Data for TFBS Deletion Variants and TAT Mutation Geometric mean population-specific eGFP fluorescence (fluorescence related to cell volume) is shown for clones expressing eGFP under the control of pG1 ( clone #8, GCN verified from 1) or a pG1 variant (up to 9 clones grown in 3 wells pooled) under growth repression and induction conditions. Wild-type P. pastoris cells were used as a negative control.

Figure 4: Screening data of pG1 duplication variants. Geometric mean population-specific eGFP fluorescence (fluorescence related to cell volume) is shown for clones expressing eGFP under pG1 control (clone no. 8, GCN verified from 1) or a pG1 variant (up to 9 clones grown in 3 wells, selected in pre-screens were pooled) under growth repression and induction conditions. Wild-type P. pastoris cells were used as a negative control.

Figure 5: Fed-batch culture of pG1 and pG1 variants expressing eGFP . Relative fluorescence of eGFP was measured from bioreactor samples (diluted to similar biomass densities) using a plate reader and is displayed over the feeding time. (end of batch set to 0) in batch (A) and fed-batch culture (B). A clone expressing eGFP under control of pG1 (#8) was compared with clones expressing under control of a pG1 deletion variant (pG1-A2, SEQ ID 211), a TAT mutation (pG1-T16, SEQ ID 257 , and a duplicative variant (pG1-D1240) (SEQ ID 49).

Figure 6: pG1 and pG1-x promoter sequences

Figure 6a: Reference sequences

Figure 6b: Sequences of the pG1-x promoter

Individual Sequence Elements:

Position 8 (SEQ ID 2): ATAAATGGA (eg, position -293 to -285 in SEQ ID 8):

Position 9 (SEQ ID 3): CATATTTTTCCGGTT (eg, position -275 to -261 in SEQ ID 8)

Central region: (SEQ ID 4): ATAAATGGACGCCTGCTCCATATTTTTCCGGTT (eg, position -293 to -261 in SEQ ID 8)

Major Regulatory Region: (SEQ ID 5): (eg, position -328 to -211 in SEQ ID 8):

CCGGATAAGAGAATTTT GTTT GATTAT CCGTT CGGA TAAA TGGACGCCTGC

TCCA TA 7"nT7~CCGG7TATTACCCCACCTGGAAGTGCCCAGAATTTTCCGGGGATT

ACGGATAATAC

3'-terminal nucleotide sequence (SEQ ID 6): TTC.CACC.C.T.T

Directions in sequences:

• Primary regulatory region: bold

• Central regulatory region: bold, italic and underlined , SEQ ID 2 and 3 double underlined

• T motif: Italicized and underlined, may be optionally extended (at the 5'-terminus of the T motif) by a preceding TA sequence, or (at the 3'-terminus of the T motif) by a subsequent AT sequence

• 3'-terminal region: subay.a.dñ .c.with Jíne.a..discontinuous

• The least relevant region for promoter activity in the reference pG1 sequences (P ^{gth 1} ):

underline_adj3_co_n_una_!Ln_ea _de_g.dashes _y_Ru_nlo_s: one or more nucleotides up to all nucleotides within the region from the 5'-terminus to -328 (region underlined in Fig. 6a with a line of dashes and dots) can be substituted or deleted, or may insert additional nucleotides within such a region, however, preferred embodiments still comprise at least one T motif that is (T)n (n = 13-20) with or without preceding nucleotides A or TA; or with or without subsequent A or AT nucleotides. Such a less relevant region that can be partially or totally deleted is the region from the 5' terminus to the first region or 5' major regulatory region (bold) in any one of SEQ ID 37 to SEQ ID 202; Preferably, up to 50, 100, 150, 200, 250, 300, 320 or 325 nucleotides from the 5'-terminus of any one of SEQ ID 37 to SEQ ID 202 may be deleted.

Deletion: de] (underlined)

(T) ⁿ motifs (n = 13-20): may optionally be extended at their 5' end, e.g. eg by "A" or "TA"; or at its 3' end, e.g. eg for "A" or "AT"

^or (T) ¹³ : SEQ ID 12: TTTTTTTTTTTTT

^or (T) ¹⁴ : SEQ ID 13: TTTTTTTTTTTTTT

or (T) ¹⁵ : SEQ ID 14: TTTTTTTTTTTTTTT

or (T) ¹⁶ : SEQ ID 15: TTTTTTTTTTTTTTTT

or (T) ¹⁷ : SEQ ID 16: TTTTTTTTTTTTTTTTT

or (T) ¹⁸ : SEQ ID 17: TTTTTTTTTTTTTTTTTT

or (T) ¹⁹ : SEQ ID 18: TTTTTTTTTTTTTTTTTTT

or (T) ²⁰ : SEQ ID 19: TTTTTTTTTTTTTTTTTTTT

TA(T) ⁿ motifs (n = 13-20), can optionally be mutated to replace the "A" at position 2 with a "T" (A/T)

^or TA(T) ¹³ : SEQ ID 20: TATTTTTTTTTTTTTT

or TA(T) ¹³ (replaced by A/T),

SEQ ID 14 (see (T) ¹⁵ ): TTTTTTTTTTTTTTT

or TA(T) ¹⁴ : SEQ ID 21: TATTTTTTTTTTTTTT

o TA(T) ¹⁴ (replaced by A/T),

SEQ ID 15 (see (T) ¹⁶ ): TTTTTTTTTTTTTTTT

or TA(T) ¹⁵ : SEQ ID 22: TATTTTTTTTTTTTTTTT

o TA(T) ¹⁵ (replaced by A/T),

SEQ ID 16 (see (T) ¹⁷ ): TTTTTTTTTTTTTTTTT

or TA(T) ¹⁶ : SEQ ID 23: TATTTTTTTTTTTTTTTT

o TA(T) ¹⁶ (replaced by A/T),

SEQ ID 17 (see (T) ¹⁸ ): TTTTTTTTTTTTTTTTTT

or TA(T) ¹⁷ : SEQ ID 24: TATTTTTTTTTTTTTTTTTT

o TA(T) ¹⁷ (replaced by A/T),

SEQ ID 18 (see (T) ¹⁹ ): TTTTTTTTTTTTTTTTTTT

or TA(T) ¹⁸ : SEQ ID 25: TATTTTTTTTTTTTTTTTTT

o TA(T) ¹⁸ (replaced by A/T),

SEQ ID 19 (see (T)2ü): TTTTTTTTTTTTTTTTTTTT

or TA(T) ¹⁹ : SEQ ID 26: TATTTTTTTTTTTTTTTTTTTT

or TA(T) ¹⁹ (substituted A/T),

SEQ ID 28 (ie, (T) ²¹ ): TTTTTTTTTTTTTTTTTTTTT

or TA(T)20: SEQ ID 27: TATTTTTTTTTTTTTTTTTTTT

or TA(T)20 (replaced by A/T),

or SEQ ID 29 (i.e. (T)22): TTTTTTTTTTTTTTTTTTTTTT

Figure 7: P. pastoris native pGAP promoter sequence (GS115) (SEQ ID 260)

Figure 7 continued : Transcription factor sequences

Rgt1 (PAS_chr1-3_0233) (SEQ ID 261)

Cat8-2 (PAS_chr4_0540) (SEQ ID 262)

Cat8-1 (PAS_chr2-1_0757) (SEQ ID 263)

Figure 8 : Prior art sequences pG1 (SEQ ID 264), pG1a (SEQ ID 265), pG1b (SEQ ID 266), pG1c (SEQ ID 267), pG1d (SEQ ID 268), pG1e (SEQ ID 269) or pG1f (SEQ ID 270), as described in WO2013050551 A1

Figure 9: Fed-batch culture of selected embodiment pG1-3 of SEQ ID 39 (pG1-D1240 (SEQ ID 49)) expressing an alternative scaffold protein as a model protein using (A) the standard fed-batch protocol, ( B) Fed-batch optimized protocol with spatio-temporal yield ("rapid fermentation") adapted from Maurer et al. (Microbial Cell Factories, 2006, 5:37)

Detailed description of the invention

Specific terms used throughout the specification have the following meaning.

The term "carbon source", also referred to as "carbon substrate", as used herein, shall mean a fermentable carbon substrate, typically a carbohydrate source, suitable as an energy source for microorganisms, such as those capable of to be metabolized by host organisms or production cell lines, in particular sources selected from the group consisting of monosaccharides, oligosaccharides, polysaccharides, alcohols including glycerol, in purified form, in minimal media or provided in raw materials, such as a nutrient material complex. The carbon source can be used according to the invention as a single carbon source or as a mixture of different carbon sources.

A "basal carbon source" as used according to the invention is typically a carbon source suitable for cell growth, such as a nutrient for eukaryotic cells. The basal carbon source can be provided in a medium, such as basal medium or complex medium, but also in a chemically defined medium containing a purified carbon source. The basal carbon source is typically provided in an amount to support cell growth, particularly during the growth phase in a culture procedure, for example to obtain cell densities of at least 5 g/L cell dry mass, preferably at least 10 g/L cellular dry mass, or at least 15 g/L cellular dry mass, e.g. eg exhibiting viabilities of greater than 90% during conventional subculturing steps, preferably greater than 95%.

According to the invention, the basal carbon source is typically used in an excess or surplus amount, which is understood as an excess that provides energy to increase biomass, e.g. eg during the cultivation of a cell line with a high specific growth rate, such as during the growth phase of a cell line in a fed-batch or fed-batch culture procedure. This amount left over is particularly greater than the limited amount of a supplemental carbon source (as used under limited growth conditions) to achieve a residual concentration in the fermentation broth that is measurable and typically at least 10-fold higher, preferably at least 50 times or at least 100 times greater than during the feeding of the limited amount of the complementary carbon source.

A "complementary carbon source" as used in accordance with the invention is typically a complementary substrate that facilitates the production of fermentation products by production cell lines, particularly in the production phase of a culture procedure. The production phase specifically follows a growth phase, e.g. eg in a continuous, fed-batch, batch culture procedure. The complementary carbon source specifically may be contained in the feed of a fed-batch process. The complementary carbon source is typically employed in cell culture under limited carbon substrate conditions, ie using the carbon source in a limited amount.

A "limited amount" of a carbon source or a "limited carbon source" is understood herein to refer specifically to the type and amount of a carbon substrate that facilitates the production of fermentation products by production cell lines. , in particular in a cultivation method with controlled growth rates lower than the maximum growth rate. The production phase specifically follows a growth phase, e.g. eg in a continuous, fed-batch, batch culture procedure. Cell culture methods may employ batch culture, continuous culture, and fed-batch culture. Batch culture is a culture method by which a small amount of a seed culture solution is added to a medium and cells are cultured without adding an additional medium or discharging a culture solution during culture. Continuous cultivation is a cultivation method by which a medium is continuously added and discharged during cultivation. Continuous culture also includes perfusion culture. Fed-batch culture, which is an intermediate between batch culture and continuous culture and also known as fed-batch culture, is a culture method whereby a medium is added continuously or sequentially during culture but, unlike fed-batch culture, continuous culture, a culture solution is not discharged continuously.

A fed-batch process that relies on feeding a growth-limiting nutrient substrate to a culture is specifically preferred. The fed-batch strategy, including single fed-batch or repeated fed-batch fermentation, is typically used in bioindustrial processes to achieve high cell density in the bioreactor. The controlled addition of the carbon substrate directly affects the growth rate of the crop and helps prevent overflow metabolism or the formation of unwanted metabolic by-products. Under limited carbon source conditions, the carbon source may be contained specifically in the feed of a fed-batch process. Therefore, the carbon substrate is provided in a limited amount.

Also, in chemostat or continuous culture as described herein, the growth rate can be strictly controlled.

Limited amount of a carbon source is particularly understood herein to be the amount of a carbon source necessary to maintain a production cell line under limited growth conditions, e.g. eg in a production phase or mode of production. Such a limited amount can be employed in a fed-batch process, where the carbon source is contained in a feed medium and is fed to the crop at low feed rates for sustained energy supply, e.g. eg to produce a POI, keeping the biomass at low specific growth rates. Typically, a feed medium is added to a fermentation broth during the production phase of a cell culture.

The limited amount of a carbon source can be determined, for example, by the residual amount of the carbon source in the cell culture broth, which is below a predetermined threshold or even below the detection limit measured in a conventional assay (carbohydrate). The residual amount would typically be determined in the fermentation broth by collecting a fermentation product.

The limited amount of a carbon source can also be determined by defining the average feed rate of the carbon source to the fermenter, e.g. eg as determined by the amount added throughout the culturing procedure, e.g. eg phase per fed batch, per culture time, to determine an average amount calculated per time. This average feeding rate is kept low to ensure full use of the complementary carbon source by the cell culture, e.g. eg between 0.6 g L-1 h-1 (g of carbon source per L of initial fermentation volume and h of time) and 25 g L-1 h-1, preferably between 1.6 g L-1 h-1 and 20 g L-1 h-1.

The limited amount of a carbon source can also be determined by measuring the specific growth rate, whose specific growth rate is kept low, e.g. eg less than the maximum specific growth rate, during the production phase, e.g. eg within a predetermined range, such as in the range of 0.001 h-1 to 0.20 h-1, or 0.005 h-1 to 0.20 h-1, preferably between 0.01 h-1 and 0.15 h -one.

Specifically, a chemically defined, methanol-free feed medium is used.

The term "chemically defined" with respect to cell culture medium, such as minimal medium or fed medium in a fed-batch process, shall mean a culture medium suitable for in vitro cell culture of a production cell line, in which all chemical components and (poly)peptides are known. Typically, a chemically defined medium is completely free of animal-derived components and represents a pure and uniform cell culture environment.

The term "cell line" as used herein refers to an established clone of a particular cell type that has acquired the ability to proliferate over an extended period of time. The term "host cell line" refers to a cell line as used to express an endogenous or recombinant gene or metabolic pathway products to produce polypeptides or cellular metabolites mediated by such polypeptides.

A "production host cell line" or "production cell line" is commonly understood as a cell line ready for use for cultivation in a bioreactor to obtain the product of a production process, such as a POI. The terms "eukaryotic host" or "eukaryotic cell line" shall mean any eukaryotic cell or organism, which can be cultured to produce a POI or host cell metabolite. It is well understood that the term does not include human beings.

The terms "cell culture" or "culture", also called "fermentation", with respect to a host cell line, means the maintenance of cells in an artificial environment, e.g. eg, in vitro, under conditions favorable to the growth, differentiation, or continued viability, in an active or quiescent state, of cells, specifically in a controlled bioreactor according to methods known in the industry.

When a cell culture is grown using the culture medium of the present invention, the cell culture is contacted with the medium in a culture vessel or with the substrate under conditions suitable for supporting growth of the cell culture. In certain embodiments, a culture medium as described herein is used to grow cells in accordance with conventional cell culture techniques that are well known in the art. In various aspects of the invention, a culture medium is provided that can be used for the growth of eukaryotic cells, specifically yeast or filamentous fungi.

Cell culture media provide the nutrients necessary to maintain and grow cells in a controlled, artificial, in vitro environment. Characteristics and compositions of cell culture media vary depending on the particular cellular requirements. Important parameters include osmolality, pH, and nutrient formulations. Nutrient feeding can be done continuously or batchwise according to methods known in the art. The culture media used according to the invention are particularly useful for producing recombinant proteins.

Whereas a batch process is a culture mode in which all the nutrients necessary for cell growth are contained in the initial culture medium, without an additional supply of additional nutrients during fermentation, in a fed-batch process, after a discontinuous phase, a feeding phase takes place in which one or more nutrients are supplied to the culture by feeding. The purpose of nutrient feeding is to increase the amount of biomass to also increase the amount of recombinant protein. Although in most cultivation methods the feeding mode is critical and important, the present invention employing the promoter of the invention is not restricted with respect to a certain cultivation mode.

In certain embodiments, the method of the invention is a fed-batch process. Specifically, a host cell transformed with a nucleic acid construct encoding a desired recombinant POI is cultured in growth phase medium and passaged into production phase medium to produce a desired recombinant POI.

In another embodiment, the host cells of the present invention are cultured continuously, e.g. eg in a chemostat. A continuous fermentation process is characterized by a defined, constant and continuous rate of feed of fresh culture medium to the bioreactor, whereby the culture broth is withdrawn at the same time from the bioreactor at the same defined, constant removal rate. and continues. By keeping the culture medium, feed rate, and removal rate at the same constant level, the culture parameters and conditions in the bioreactor remain constant.

A stable cell culture as described herein is specifically understood to refer to a cell culture that maintains genetic properties, specifically by maintaining a high level of POI production, e.g. eg at least at a pg level, even after about 20 generations of culture, preferably at least 30 generations, more preferably at least 40 generations, most preferably at least 50 generations. Specifically, a stable recombinant host cell line is provided which is considered to be of great advantage when used for industrial scale production.

The cell culture of the invention is particularly advantageous for industrial manufacturing scale methods, e.g. eg with regard to volume and technical system, combined with a culture mode that is based on nutrient feeding, in particular a fed-batch or fed-batch process, or a continuous or semi-continuous process (eg chemostat).

The terms "expression" or "expression system" or "expression cassette" refer to nucleic acid molecules containing a desired coding sequence and control sequences in operable connection, such that hosts transformed or transfected with these sequences are capable of producing the encoded proteins or metabolites of host cells. To effect transformation, the expression system can be included in a vector; however, the relevant DNA can also be integrated into the host chromosome. The term can refer to secreted or non-secreted expression products, including polypeptides or metabolites.

"Expression constructs" or "vectors" or "plasmids" used herein are defined as DNA sequences that are required for the transcription of cloned recombinant nucleotide sequences, i.e., of recombinant genes and the translation of their mRNA into a suitable host organism. The vectors of expression or plasmids generally comprise an origin for autonomous replication in host cells, selectable markers (eg, an amino acid synthesis gene or a gene that confers resistance to antibiotics such as zeocin, kanamycin, G418, or hygromycin), various restriction enzyme cleavage sites, a suitable promoter sequence and a transcription terminator, the components of which are operably linked to each other. The terms "plasmid" and "vector" as used herein include autonomously replicating nucleotide sequences as well as nucleotide sequences that make up the genome.

The expression construct of the invention specifically comprises a promoter of the invention, operably linked to a nucleotide sequence encoding a POI under the transcriptional control of said promoter, which promoter is not natively associated with the POI coding sequence.

The term "heterologous" as used herein with respect to a nucleotide or amino acid sequence or protein, refers to a compound that is foreign, i.e. "exogenous", eg, not found in nature, with respect to a given host cell; or naturally occurring in a given host cell, for example, is "endogenous", however, in the context of a heterologous construct, e.g. eg, employing a heterologous nucleic acid. The heterologous nucleotide sequence that is found endogenously can also occur in an unnatural amount, e.g. eg greater than expected, or greater than that found naturally, in the cell. The heterologous nucleotide sequence, or a nucleic acid comprising the heterologous nucleotide sequence, possibly has a different sequence from the endogenous nucleotide sequence but encodes the same protein that is found endogenously. Specifically, heterologous nucleotide sequences are those that are not found in the same relationship to a host cell in nature. Any recombinant or artificial nucleotide sequence is understood to be heterologous. An example of a heterologous polynucleotide is a nucleotide sequence not natively associated with the promoter according to the invention, e.g. eg to obtain a hybrid promoter, or operably linked to a coding sequence, as described herein. As a result, a hybrid or chimeric polynucleotide can be obtained. A further example of a heterologous compound is a polynucleotide encoding a POI operably linked to a transcriptional control element, e.g. eg, a promoter of the invention, to which a naturally occurring endogenous POI coding sequence is not normally operably linked.

The term "variant" as used herein in the context of the present invention shall refer to any sequence with specific sequence identity or homology to a comparable parental sequence. A variant is specifically any sequence derived from a parent sequence, e.g. eg, by size variation, such as elongation (terminal or non-terminal, such as "interstitial", ie, with deletions or insertions within the nucleotide sequence) or fragmentation, mutation, hybridization (including combination of sequences).

The pG1-x promoter as described herein is specifically an artificial variant of the native (wild-type) pG1 promoter. Although there is a certain degree of sequence identity to the native structure, it is well understood that the materials, methods and uses of the invention, e.g. eg which refer specifically to isolated nucleic acid sequences, amino acid sequences, expression constructs, transformed host cells, and recombinant proteins, are "man-made" or synthetic and are therefore not considered a result of "law of the nature".

The promoter referred to herein as "pG1-x promoter" is a variant of the pG1 promoter and its nucleotide sequence can be produced by mutagenesis of the pG1 promoter which is used as the "parent" sequence to produce a variant. A pG1-x promoter includes a promoter comprising two, three, four or more copies of SEQ ID 2, SEQ ID 3, SEQ ID 4 or SEQ ID 5.

A series of pG1-x promoters is illustrated, e.g. g., by the promoter comprising or consisting of any of the sequences illustrated in Figure 6b, in particular any of the following sequences:

a) SEQ ID 37-44, preferably any of SEQ ID 45-76;

b) SEQ ID 77-80, preferably any of SEQ ID 81-112;

c) SEQ ID 113-114, preferably any of SEQ ID 115-130;

d) SEQ ID 131-132, preferably any of SEQ ID 133-148;

e) SEQ ID 185-186, preferably any of SEQ ID 187-202

A pG1-x promoter also includes 3' fragments of any one of SEQ ID 37 to SEQ ID 202 in which part or all of the 5' terminus to the first region or 5' major regulatory region has been deleted; Preferably, up to 50, 100, 150, 200, 250, 300, 320 or 325 nucleotides are removed from the 5' terminus of any one of SEQ ID 37 to SEQ ID 202.

The pG1-x promoter is characterized by having an increased promoter strength and/or induction ratio compared to the pG1 promoter, where

- the strength of the promoter is at least 1.1-fold higher in the induced state compared to the pG1 promoter, and/or

- the induction ratio is at least 1.1 times higher compared to the pG1 promoter.

Other variants of pG1-x are feasible, for example, using the pG1-x promoter illustrated in Figure 6b, or size variants, in particular elongated variants or fragments thereof, as "parent" sequences to produce variants by gene mutagenesis. certain regions, in particular such, that the essential elements and functions of the promoter are maintained or even improved. Variants of the pG1-x promoter can, for example, be obtained from any of the illustrated pG1-x promoter sequences by mutagenesis to produce sequences suitable for use as promoters in recombinant cell lines. Such a variant promoter can be obtained from a library of mutant sequences by selecting library members with predetermined properties. Variant promoters may have the same or even improved properties, e.g. eg enhanced in promoter strength, induction of p O i production, with increased differential effect under repressive and derepressive conditions (in particular, the rate of induction). The variant promoter may also comprise a nucleotide sequence of analogous sequences, e.g. eg from eukaryotic species other than Pichia pastoris or from a genus other than Pichia, such as K. lactis, Z. rouxii, P. stipitis, H. polymorpha.

The term "functionally active" as used herein with respect to, e.g. e.g., a promoter variant, the pG1-x promoter or a variant of a pG1-x promoter as described herein or a pG1 promoter variant, means a variant sequence resulting from modification of a parent sequence by mutagenesis , specifically by insertion, deletion or substitution of one or more nucleotides within the sequence or at one or both distal ends of the sequence, and whose modification does not affect (in particular impairs) the activity of this sequence. With respect to the pG1-x promoter as described herein, function and activity are specifically characterized by the activity and strength of the promoter, as well as the rate of induction.

Functionally active promoter variants as described herein are specifically characterized as exhibiting substantially the same promoter activity as the pG1 promoter (+/- 10%, or /- 5%), or even higher.

Functionally active promoter variants as described herein are specifically characterized as exhibiting substantially the same regulatable properties as the pG1 promoter, e.g. measured by the induction ratio (+/- 10%, or /- 5%), or an even higher induction ratio.

The term "promoter" as used herein refers to a DNA sequence capable of controlling the expression of a functional RNA or coding sequence. Promoter activity can be assessed by its transcriptional efficiency. This can be determined directly by measuring the amount of mRNA transcript from the promoter, e.g. eg by Northern Blot or indirectly by measuring the amount of gene product expressed from the promoter.

The pG1-x promoter as described herein specifically initiates, regulates or otherwise mediates or controls the expression of an encoding DNA. The promoter DNA and the coding DNA may be from the same gene or from different genes, and may be from the same organism or from different organisms.

It is specifically understood that the pG1-x promoter as described herein is a regulatable promoter, in particular a carbon source regulatable promoter with different promoter strength in the repressed and induced state.

The strength of the promoter of the invention refers specifically to its transcriptional strength, represented by the efficiency of transcription initiation that occurs at that promoter at high or low frequency. The higher the transcription strength, the more frequently transcription will occur at that promoter. Promoter strength is important, because it determines how often a given mRNA sequence is transcribed, giving higher priority to the transcription of some genes over others, leading to a higher concentration of the transcript. A gene that encodes a protein that is required in large quantities, for example, typically has a relatively strong promoter. RNA polymerase can only perform one transcription task at a time, and therefore must prioritize its work to be efficient. Differences in promoter strength are selected to allow for this prioritization.

According to the invention, the regulatable promoter is relatively strong in the fully induced state, which is typically understood as the state of approximately maximal activity.

Relative strength is commonly determined relative to a comparable promoter, such as the pG1 promoter, or a conventional promoter, such as the respective pGAP promoter of the cell being used as the host cell. Transcription frequency is commonly understood as the rate of transcription, e.g. eg determined by the amount from a transcript in a suitable assay, e.g. eg RT-PCR or Northern blot. For example, the transcriptional strength of a promoter according to the invention is determined in the host cell which is P. pastoris and compared to the native P. pastoris pGAP promoter.

The strength of a promoter to express a gene of interest is commonly understood as the strength of expression or the ability to support a high level/rate of expression. For example, the expression and/or transcription strength of a promoter of the invention is determined in the host cell which is P. pastoris and compared to the native P. pastoris pGAP promoter.

Comparative transcriptional strength using the pGAP promoter as a reference (standard) can be determined by conventional means, for example by measuring the amount of transcripts, e.g. eg using a microarray, or also in cell culture, such as by measuring the amount of respective gene expression products in recombinant cells. An illustrative test is depicted in the Examples section.

In particular, the transcription rate can be determined by the strength of transcription on a microarray, or with quantitative real-time PCR (qRT-PCR) where the microarray or qRT-PCR data show the difference in expression level between conditions. with high growth rate and low growth rate conditions, or conditions employing different media compositions, and a high signal intensity compared to the native pGAP promoter.

The expression rate can be determined, for example, by the amount of expression of a reporter gene, such as eGFP.

The pG1-x promoter as described herein exerts a relatively high transcriptional strength, reflected by a transcription rate or transcriptional strength of at least 15% compared to the native pGAP promoter in the host cell, sometimes called "homologous pGAP promoter". Preferably, the rate or strength of transcription is at least 20%, in specifically preferred cases at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% and at least 100% or even more, such as at least 150% or at least 200% compared to the native pGAP promoter, e.g. eg determined in the eukaryotic cell selected as the host cell to produce the POI.

The native pGAP promoter typically initiates expression of the gap gene encoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which is a constitutive promoter present in most living organisms. GAPDH (EC 1\2\1\12), a key enzyme of glycolysis and gluconeogenesis, plays a crucial role in the catabolic and anabolic metabolism of carbohydrates.

The native pGAP promoter is specifically active in a recombinant eukaryotic cell in a manner similar to that in a native eukaryotic cell of the same species or strain, including unmodified (nonrecombinant) or recombinant eukaryotic cell. Such a native pGAP promoter is commonly understood to be an endogenous promoter, thus homologous to the eukaryotic cell, and serves as a standard or reference promoter for comparison purposes.

For example, a native P. pastoris pGAP promoter is the unmodified endogenous promoter sequence in P. pastoris, as used to control GAPDH expression in P. pastoris, eg, having the sequence shown in Figure 13 : P. pastoris native pGAP promoter sequence (GS115) (SEQ ID 260). If P. pastoris is used as a host to produce a POI according to the invention, the strength or rate of transcription of the promoter according to the invention is compared to such native P. pastoris pGAP promoter.

As another example, a native S. cerevisiae pGAP promoter is the unmodified endogenous promoter sequence in S. cerevisiae, which is used to control GAPDH expression in S. cerevisiae. If S. cerevisiae is used as a host to produce a POI according to the invention, the strength or rate of transcription of the promoter according to the invention is compared to such a native S. cerevisiae pGAP promoter.

Thus, the relative expression or transcriptional strength of a promoter according to the invention is usually compared to the native pGAP promoter of a cell of the same species or strain that is used as a host to produce a POI.

The term "regulatable" with respect to a pG1-x promoter or a pG1 promoter as used herein shall refer to a promoter that is repressed in a eukaryotic cell in the presence of an excess amount of a carbon source (nutrient or basal substrate) in the growth phase of a batch culture, and derepressed to exert strong promoter activity in the production phase of a production cell line, e.g. eg upon reduction of the amount of carbon, such as upon feeding a growth-limiting carbon source (supplementary nutrient or substrate) to a crop according to the fed-batch strategy. In this sense, the term "regulatable" is understood as "carbon source limit-regulatable" or "glucose limit-regulatable", referring to the de-repression of a promoter by carbon consumption, reduction, deficiency or depletion, or by limited addition of the carbon source so that it is easily consumed by cells.

The functionally active pG1-x promoter as described herein is a relatively strong regulatable promoter that is silenced or repressed under conditions of cell growth (growth phase) and activated or de-represses under production conditions (production phase) and is therefore suitable for inducing POI production in a production cell line by limiting the carbon source.

Specifically, the promoter as described herein is carbon source regulatable with differential promoter strength as determined in a test comparing its strength in the presence of glucose and glucose limitation, demonstrating that it is still repressed at relatively high glucose concentrations, preferably at concentrations of at least 10 g/L, preferably at least 20 g/L. Specifically, the promoter according to the invention is fully induced at limited concentrations of glucose and threshold concentrations of glucose that fully induce the promoter, which threshold is less than 20 g/L, preferably less than 10 g/L, less than 1 g /L, even less than 0.1 g/L or less than 50 mg/L, preferably with a complete transcriptional strength of p. eg at least 50% of that of the native homologous pGAP promoter, at glucose concentrations of less than 40 mg/L.

Preferably, the induction ratio is understood as a differential promoting force that is determined by the initiation of POI production upon switching to inducing conditions below a predetermined carbon source threshold, and compared to the force in the repressed state. . Transcriptional strength is commonly understood as the strength in the fully induced state, ie showing approximately maximal activities under derepressed conditions. The differential strength of the promoter is e.g. eg determined according to the efficiency or yield of POI production in a recombinant host cell line under derepression conditions compared to repression conditions, or also by the amount of a transcript. The regulatable promoter according to the invention has a preferred differential promoter strength, which is at least 2-fold, more preferably at least 5-fold, even more preferred at least 10-fold, more preferred at least 20-fold, most preferably at least 30-fold. , 40, 50 or 100 times in the de-repressed state compared to the repressed state, also understood as multiplicity of induction.

The term "sequence identity" of a variant compared to a parental sequence indicates the degree of identity (or homology) in which two or more nucleotide sequences have the same or conserved base pairs in a corresponding position, to some degree, to a degree close to 100%. A homologous sequence typically has at least about 50% nucleotide sequence identity, preferably at least about 60% identity, more preferably at least about 70% identity, more preferably at least about 80% identity, more preferably at least about 90% identity, more preferably at least about 95% identity.

The "percent (%) identity" with respect to the nucleotide sequence, e.g. g., from a promoter or a gene, is defined as the percentage of nucleotides in a candidate DNA sequence that are identical to the nucleotides in the DNA sequence, after aligning the sequence and introducing gaps, if necessary, to achieve the maximum percentage of sequence identity, and do not consider conservative substitutions as part of the sequence identity. Alignment for the purpose of determining percent nucleotide sequence identity can be accomplished in a number of ways that are within the skill of the art, for example, using publicly available computer software. Those skilled in the art can determine the appropriate parameters to measure alignment, including the algorithms necessary to achieve maximal alignment over the full length of the sequences being compared. For purposes of the present invention, sequence identity between two nucleotide sequences is determined using the NCBI BLAST program version 2.2.29 (06-Jan-2014) with blastn set to the following illustrative parameters: Word Size: 11 ; Expected value: 10; Gap Penalty: Existence = 5, Extension = 2; Filter = activated by low complexity; Match/Mismatch Scores: 2, -3; Filter “String” cord: L; m.

The term "mutagenesis" as used in the context of the present invention shall refer to a method of providing mutants of a nucleotide sequence, e.g. eg by insertion, deletion and/or substitution of one or more nucleotides, to obtain variants thereof with at least one change in the coding or non-coding region. Mutagenesis can be by random, semi-random, or site-directed mutation. Specific pG1-x promoter variants are obtained from the pG1 promoter sequence by a mutagenesis method using the pG1 nucleotide sequence as the parent sequence. Such a method of mutagenesis encompasses those methods of nucleic acid engineering or de novo synthesis of a nucleotide sequence using the sequence information of the pG1 promoter as a template. Specific mutagenesis methods apply rational promoter engineering.

The pG1-x promoter can be produced by mutagenesis of the pG1 promoter, and variants of the pG1-x promoter can be further produced as described herein, including functionally active variants, using standard techniques. The promoter can e.g. eg modified to generate promoter variants with altered expression levels and regulatory properties. For example, a library of promoters can be prepared by mutagenesis of selected promoter sequences, which can be used as parent molecules, e.g. eg to tune gene expression in eukaryotic cells by screening variants for expression under different fermentation strategies and selecting suitable variants. A synthetic library of variants, e.g. eg to select a promoter who meets the requirements to produce a selected POI. Such variants may have higher expression efficiency in eukaryotic host cells and differential expression under limiting and carbon source-rich conditions. Typically, large randomized gene libraries with a high diversity of genes, which can be selected according to a specifically desired genotype or phenotype.

Some of the preferred pG1-x promoters as described herein are size variants of the pG1 promoter and comprise more than one copy of certain promoter elements or regions, or comprise one or more fragments (same or different) of the pG1 promoter. .

Specific mutagenesis methods provide point mutations of one or more nucleotides in a sequence, in particular tandem point mutations, such as to change at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or even more nucleotides. continuous within the promoter nucleotide sequence. Such mutation is typically at least one of a deletion, insertion and/or substitution of one or more nucleotides. The promoter sequence may be mutated at the distal ends, particularly within the 5' region amounting to up to 50% of the nucleotide sequence, which may be highly variable without substantially losing promoter activity. The promoter sequence may be specifically mutated within the major regulatory region, however it is preferred that the sequence identity to the parent major regulatory region of pG1 and in particular the parent core regulatory region is high, such as e.g. eg at least 80%. Within the core regulatory region, but outside the core regulatory region, sequence variability can be greater to obtain less than 80% sequence identity.

The core regulatory region specifically incorporates SEQ ID 2 and SEQ ID 3, which represent transcription factor binding sites (TFBS), and an interstitial region between SEQ ID 2 and SEQ ID 3.

The nucleotide sequence identified as SEQ ID 2 comprises at least part of the TFBS recognized by Rgt1, Cat8-1 and Cat8-2.

The nucleotide sequence identified as SEQ ID 3 comprises at least part of the TFBS recognized by Rgt1, Cat8-1 and Cat8-2.

Specifically, the nucleotide sequence between SEQ ID 2 and SEQ ID 3 (the interstitial sequence) may be mutated to a non-homologous sequence (eg, with less than 50% sequence identity) or even deleted.

Any mutation within SEQ ID 2 and SEQ ID 3 is specifically conservative, ie such as to maintain (or enhance) recognition by the respective transcription factor. Upon engineering such conservative mutants, the sequence identity within the nucleotide sequence of SEQ ID 2 and/or SEQ ID 3 is at least 90%, preferably at least 95%.

The major regulatory region comprises or consists of the nucleotide sequence identified by SEQ ID 5. Such a region comprises the core regulatory region and the additional non-core regulatory region, which comprises essential elements of the pG1 promoter and which can mutate to some extent to produce the pG1 promoter. pG1-x promoter as described herein.

Specific regions of site-directed mutagenesis are, e.g. eg, the non-core regulatory region of the pG1 or pG1-x promoter (within or outside the core regulatory region). However, specific mutants can also be prepared by mutagenesis methods directed at the core regulatory region of the promoter, maintaining a certain degree of sequence identity to maintain promoter function. Other specific regions are outside or inside the main regulatory region. Specifically, the promoter may comprise a hybrid nucleotide sequence, e.g. eg comprising the core regulatory region of the pG1 promoter and one or more alternative regions or promoters (native or artificial), for example, the translation start site in the 3' region (specifically the 3' end comprising the least 10 terminal nucleotides, or at least 15 terminal nucleotides) from a promoter other than the pG1 promoter to replace the translation start site of the pG1 promoter.

Specific mutations refer to the duplication of selected regions (or motifs) of the pG1 promoter, e.g. eg, the T motif or the extended T motif. Such selected motifs may be lengthened by additional nucleotides or shortened at one or both distal ends of the motif, or within the motif. The native pG1 sequence comprises a TAT motif consisting of the nucleotides "T" followed by "A" followed by T15 (SEQ ID 14). Such a TAT motif 5-TATTTTTTTTTTTTTTTT-3' (SEQ ID 22) has been found to have a positive effect on the strength of the promoter, which can even be increased by duplicating the TAT motif, or by inserting at least 2, 3 or 4 copies of the TAT motif, since either the same TAT motif or using an alternative T motif, the extended T motif (eg, a TAT motif), comprising at least the T13 motif (SEQ ID 12).

The invention further encompasses a nucleotide sequence that hybridizes under stringent conditions to the pG1-x promoter.

As used herein, the term "hybridization" or "hybridizing" is intended to mean the process during which two nucleic acid sequences anneal to each other with stable and specific hydrogen bonds to form a double strand under appropriate conditions. . Hybridization between two complementary sequences or sufficiently complementary sequences depends on the operating conditions used, and in particular on stringency. Stringency can be understood to indicate the degree of homology; how much the higher the stringency, the higher the percentage of homology between the sequences. The stringency can be defined in particular by the base composition of the two nucleotide sequences and/or by the degree of mismatches between these two nucleotide sequences. Varying the conditions, e.g. eg salt concentration and temperature, a given nucleic acid sequence may be allowed to hybridize only to its exact complement (high stringency) or to any somewhat related sequence (low stringency). Increasing the temperature or lowering the salt concentration may tend to increase the selectivity of a hybridization reaction.

As used herein, the phrase "hybridization under stringent hybridization conditions" is preferably understood to refer to hybridization under conditions of some stringency. In a preferred embodiment, "stringent hybridization conditions" are conditions in which the homology of the two nucleic acid sequences is at least 70%, preferably at least 80%, preferably at least 90%, that is, under conditions wherein hybridization is only possible if the double strand obtained during this hybridization preferably comprises at least 70%, preferably at least 80%, preferably at least 90% AT bonds and CG bonds.

Stringency may depend on reaction parameters, such as the concentration and type of ionic species present in the hybridization solution, the nature and concentration of denaturing agents, and/or the hybridization temperature. Appropriate conditions can be determined by those skilled in the art, e.g. eg as described by Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, 1989).

The terms "isolate" or "isolate" as used herein with respect to a nucleic acid, POI, or other compound shall refer to such compound that has been sufficiently separated from the environment with which it would be naturally associated, to exist in "substantially pure" form. "Isolated" does not necessarily mean the exclusion of artificial or synthetic mixtures with other compounds or materials, or the presence of impurities which do not interfere with the fundamental activity, and which may be present, for example, due to incomplete purification. In particular, the isolated nucleic acid molecules of the present invention are also intended to include those "chemically synthesized", and in particular those not naturally found in P. pastoris or any other organism, referred to herein as "artificial". With reference to the nucleic acids of the invention, the term "isolated nucleic acid" or "isolated nucleic acid sequence" is sometimes used. This term, when applied to DNA, refers to a DNA molecule that is separated from the sequences of which it is immediately contiguous in the natural genome of the organism in which it originated. For example, an "isolated nucleic acid" may comprise a DNA molecule inserted into a vector, such as a plasmid or viral vector, or integrated in the genomic DNA of a prokaryotic or eukaryotic cell or host organism An "isolated nucleic acid" (either DNA or RNA) may additionally represent a molecule produced directly by biological or synthetic means and separated from other components present during its production.

The term "operably linked" as used herein refers to the association of nucleotide sequences in a single nucleic acid molecule, e.g. eg a vector, such that the function of one or more nucleotide sequences is affected by at least one other nucleotide sequence present in said nucleic acid molecule. For example, a promoter is operably linked to a recombinant gene coding sequence when it is capable of effecting expression of that coding sequence. As a further example, a nucleic acid encoding a signal peptide is operably linked to a nucleic acid sequence encoding a POI, when it is capable of expressing a protein in the secreted form, such as a preform of a mature protein or the mature protein. . Specifically, such nucleic acids operably linked to each other can be linked immediately, ie, without other nucleic acid elements or sequences, between the nucleic acid encoding the signal peptide and the nucleic acid sequence encoding a POI.

A promoter sequence is typically understood to be operably linked to a coding sequence, if the promoter controls transcription of the coding sequence. If a promoter sequence is not natively associated with the coding sequence, its transcription is not controlled by the promoter in native (wild-type) cells or the sequences recombine with different contiguous sequences.

The term "protein of interest (POI)" as used herein refers to a polypeptide or protein that is produced by recombinant technology in a host cell. More specifically, the protein may be a polypeptide that is not naturally found in the host cell, i.e., a heterologous protein, or it may be native to the host cell, i.e., a protein homologous to the host cell, but is produced, for example, by transformation with a self-replicating vector containing the POI-encoding nucleic acid sequence, or following recombinant integration of one or more copies of the POI-encoding nucleic acid sequence into the host cell genome , or by recombinant modification of one or more regulatory sequences that control the expression of the gene encoding POl, e.g. eg of the promoter sequence. In some instances, the term POI as used herein also refers to any host cell product metabolite mediated by the recombinantly expressed protein.

POl can be specifically recovered from cell culture in purified form, e.g. eg substantially pure.

The terms "substantially pure" or "purified" as used herein shall refer to a preparation comprising at least 50% (w/w), preferably at least 60%, 70%, 80%, 90% or 95 % of a compound, such as a nucleic acid molecule or a POI. Purity is measured by appropriate methods for the compound (eg, chromatographic methods, polyacrylamide gel electrophoresis, HPLC analysis, and the like).

The term "recombinant" as used herein shall mean "prepared by or as a result of genetic engineering." Thus, a "recombinant microorganism" comprises at least one "recombinant nucleic acid". A recombinant microorganism specifically comprises an expression vector or a cloning vector, or has been genetically modified to contain a recombinant nucleic acid sequence. A "recombinant protein" is produced by expressing a respective recombinant nucleic acid in a host. A "recombinant promoter" is a genetically engineered non-coding nucleotide sequence suitable for use as a functionally active promoter as described herein.

In general, the recombinant nucleic acids or organisms referred to herein can be produced by recombination mechanisms well known to one of skill in the art. In accordance with the present invention, conventional techniques of molecular biology, microbiology, and recombinant DNA may be employed within the skill of the art. Such mechanisms are fully explained in the literature. See, p. Maniatis, Fritsch & Sambrook, "Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, (1982).

According to a preferred embodiment of the present invention, a recombinant construct is obtained by ligating the promoter and relevant genes into an expression vector or construct. These genes can be stably integrated into the host cell genome by transforming the host cell using such vectors or expression constructs.

Expression vectors may include, but are not limited to, cloning vectors, modified cloning vectors, and specifically designed plasmids. The preferred expression vector as used in the invention may be any expression vector suitable for expression of a recombinant gene in a host cell and is selected depending on the host organism. The recombinant expression vector can be any vector that is capable of replication or integration into the genome of the host organisms, also called host vector.

Appropriate expression vectors typically comprise additional regulatory sequences suitable for expressing DNA encoding a POI in a eukaryotic host cell. Examples of regulatory sequences include operators, enhancers, ribosome binding sites, and sequences that control the initiation and termination of transcription and translation. The regulatory sequences can be operably linked to the DNA sequence to be expressed.

To allow expression of a recombinant nucleotide sequence in a host cell, the expression vector may provide the promoter according to the invention adjacent to the 5' end of the coding sequence, e.g. eg upstream of the gene of interest (GOI) or a signal peptide gene that allows secretion of the POI. Thus, transcription is regulated and initiated by this promoter sequence.

The term "signal peptide" as used herein shall refer specifically to a native signal peptide, a heterologous signal peptide, or a hybrid of a native and heterologous signal peptide, and may be specifically heterologous or homologous to the host organism that produces a protein. POI. The function of the signal peptide is to allow POI to be secreted to enter the endoplasmic reticulum. It is usually a short peptide chain (3 to 60 amino acids in length) that directs the transport of a protein out of the plasma membrane, facilitating separation and purification of a heterologous protein. Some signal peptides are cleaved from protein by signal peptidase after the proteins are transported.

Illustrative signal peptides are signal sequences of the S. cerevisiae alpha-mating factor prepropeptide and the signal peptides of the P. pastoris acid phosphatase (PHO1) gene and extracellular protein X (EPX1) (Heiss et al., 2015; WO2014067926A1).

Expression vectors comprising one or more of the regulatory elements (such as the pG1-x promoter and optionally a signal sequence) can be constructed to drive expression of a POI, and the expressed yield is compared to constructs with conventional regulatory elements. in order to test the function of the relevant sequences. The identified nucleotide sequences can be amplified by PCR using specific nucleotide primers, cloned into an expression vector and transformed into a eukaryotic cell line, e.g. eg using a yeast vector and a P. pastoris strain, for high-level production of several different POIs. To estimate the effect of the pG1-x promoter as described herein on the amount of recombinant POI so produced, the eukaryotic cell line can be grown in shake flask experiments and fed-batch or chemostat fermentations compared to strains that they comprise a conventional pG1 promoter or the pGAP promoter, in the respective cell. In particular, the choice of promoter has a great impact on the production of recombinant proteins.

POI can be produced using the recombinant host cell line by culturing a transformant thus obtained in an appropriate medium, isolating the expressed product or metabolite from the culture, and optionally purifying it by a suitable method.

Transformants according to the present invention can be obtained by introducing such vector DNA, e.g. eg Plasmid DNA, in a host and selecting transformants expressing the POI or host cell metabolite in high yields. Host cells are treated to enable them to incorporate foreign DNA by methods conventionally used for transformation of eukaryotic cells, such as the electric pulse method, the protoplast method, the lithium acetate method, and modified methods thereof. P. pastoris is preferably transformed by electroporation. Preferred transformation methods for uptake of the recombinant DNA fragment by the microorganism include chemical transformation, electroporation, or transformation by protoplast formation. Transformants according to the present invention can be obtained by introducing such vector DNA, e.g. eg Plasmid DNA, in a host and selecting transformants expressing the relevant protein or host cell metabolite in high yields.

Several different approaches are preferred for the production of the POI according to the method of the invention. Substances can be expressed, processed and optionally secreted by transforming a eukaryotic host cell with an expression vector harboring recombinant DNA encoding a relevant protein and at least one of the regulatory elements as described above, preparing a culture of the transformed cell, making growing the culture, inducing POI transcription and production, and recovering the product from the fermentation process.

The host cell according to the invention is preferably tested for its ability to express or yield by the following test: ELISA, activity assay, HPLC or other suitable tests.

The invention specifically allows for the fermentation process on a pilot or industrial scale. The industrial process scale would preferably employ a volume of at least 10 L, specifically at least 50 L, preferably at least 1 m ³ , preferably at least 10 m ³ , most preferably at least 100 m ³ .

Industrial-scale production conditions are preferred, which refer to e.g. eg to fed-batch culture in reactor volumes of 100 L to 10 m ³ or more, employing typical process times of several days, or continuous processes in fermenter volumes of about 50 - 1000 L or more, with dilution rates of about 0.02-0.15 hr ^-1 .

Suitable culturing techniques may encompass culturing in a bioreactor starting with a batch phase, followed by a short exponential fed-batch phase at a high specific growth rate, followed further by a fed-batch phase at a low specific growth rate. . Another suitable culture technique may comprise a batch phase followed by a continuous culture phase at a low dilution rate.

A preferred embodiment includes batch culture to provide biomass followed by fed-batch culture for high yield POI production.

It is preferred to cultivate the host cell line as described herein in a bioreactor under growth conditions to obtain a cell density of at least 1 g/L cell dry weight, more preferably at least 10 g/L dry weight. cell, preferably at least 20 g/L cell dry weight. It is advantageous to provide such yields of biomass production on a pilot or industrial scale.

A growth medium that allows biomass accumulation, specifically a basal growth medium, typically comprises a carbon source, a nitrogen source, a sulfur source, and a phosphate source. Typically, such medium further comprises trace elements and vitamins, and may further comprise amino acids, peptone or yeast extract.

Preferred nitrogen sources include NH ⁴ H ² PO ⁴ , or NH ³ or (NH ⁴ ) ² SO ⁴ ;

Preferred sulfur sources include MgSO ⁴ , or (NH ⁴ ) ² SO ⁴ or K ² SO ⁴ ;

Preferred phosphate sources include NH ⁴ H ² PO ⁴ , or H ³ PO ⁴ or NaH ² PO ⁴ , KH ² PO ⁴ , Na ² HPO ⁴ or K ² HPO ^{4 ;}

Other typical media components include KCl, CaCl ² and trace elements such as: Fe, Co, Cu, Ni, Zn, Mo, Mn, I, B;

Preferably, the medium is supplemented with vitamin B ⁷ ;

A typical growth medium for P. pastoris comprises glycerol, sorbitol or glucose, NH ⁴ H ² PO ⁴ , MgSO ⁴ , KCl, CaCh, biotin and trace elements.

In the production phase, a production medium with only a limited amount of a complementary carbon source is specifically used.

Preferably, the host cell line is grown in a mineral medium with a suitable carbon source, which further simplifies the isolation procedure significantly. An example of a preferred mineral medium is one that contains a usable carbon source (eg, glucose, glycerol, sorbitol, or methanol), salts containing the macroelements (potassium, magnesium, calcium, ammonium, chloride, sulfate, phosphate ) and trace elements (copper, iodide, manganese, molybdate, cobalt, zinc and iron salts and boric acid) and optionally vitamins or amino acids, e.g. eg to complement the auxotrophies.

Specifically, the cells are cultured under conditions suitable to effect expression of the desired POI, which may be purified from the cells or culture medium, depending on the nature of the expression system and the protein expressed, e.g. eg whether the protein is fused to a signal peptide and whether the protein is soluble or membrane bound. As will be understood by one of skill in the art, culture conditions will vary depending on factors including the type of host cell and the particular expression vector employed.

A typical production medium comprises a complementary carbon source and additionally NH ⁴ H ² PO ⁴ , MgSO ⁴ , KCl, CaCl ² , biotin and trace elements.

For example, the complementary carbon source feed added to the fermentation may comprise a carbon source with up to 50% by weight of usable sugars. The low feed rate of supplemental medium will limit the effects of product or by-product inhibition on cell growth, thus a high yield of product based on substrate provision will be possible.

The fermentation is preferably carried out at a pH ranging from 3 to 7.5.

Typical fermentation times are about 24 to 120 hours with temperatures in the range of 20°C to 35°C, preferably 22-30°C.

POI is preferably expressed using conditions to produce yields of at least 1 mg/L, preferably at least 10 mg/L, preferably at least 100 mg/L, most preferably at least 1 g/L.

It is understood that the methods disclosed herein may further include culturing said recombinant host cells under conditions that allow expression of the POI, preferably in the secreted form or also as an intracellular product. A recombinantly produced POI or host cell metabolite can then be isolated from the cell culture medium and further purified by techniques well known to one of skill in the art.

The POI produced in accordance with the invention can typically be isolated and purified using techniques of the state of the art, including increasing the concentration of the desired POI and/or decreasing the concentration of at least one impurity.

If POI is secreted by cells, it can be isolated and purified from culture medium using state-of-the-art techniques. Secretion of the recombinant expression products from the host cells is generally advantageous for reasons including facilitation of the purification process, since the products are recovered from the culture supernatant rather than the complex mixture of proteins that results when the cells are purified. yeast cells rupture to release intracellular proteins.

Cultured transformant cells can also be sonically or mechanically, enzymatically, or chemically disrupted to obtain a cell extract containing the desired POI, from which the POI is isolated and purified.

As isolation and purification methods to obtain a recombinant polypeptide or protein product, methods such as methods using difference in solubility such as salt addition precipitation and solvent precipitation, methods using difference in solubility can be used. on molecular weight, such as ultrafiltration and gel electrophoresis, methods using difference in electrical charge, such as ion exchange chromatography, methods using specific affinity, such as affinity chromatography, methods using difference in hydrophobicity, such as reverse phase high performance liquid chromatography, and methods using the difference in isoelectric point, such as isoelectric focusing.

The highly purified product is essentially free of contaminating proteins and preferably has a purity of at least 90%, more preferably at least 95%, or even at least 98%, up to 100%. Purified products can be obtained by purification of cell culture supernatant or alternatively from cell debris.

As isolation and purification methods, the following conventional methods are preferred: cell disruption (if POI is obtained intracellularly), cell separation (debris) and washing by Microfiltration or Tangential Flow Filter (TFF) or centrifugation, POI purification by precipitation or thermal treatment, activation of pOi by enzymatic digestion, purification of POI by chromatography, such as ion exchange (IEX), hydrophobic interaction chromatography (HlC), affinity chromatography, size exclusion chromatography (SEC) or HPLC , concentration POI precipitation and washing by ultrafiltration steps.

Isolated and purified POI can be identified by conventional methods such as Western blotting, HPLC, activity assay or ELISA.

The POI can be any eukaryotic, prokaryotic, or synthetic polypeptide. It can be a secreted protein or an intracellular protein. The present invention also provides for the recombinant production of functional homologues, functionally equivalent variants, derivatives and biologically active fragments of naturally occurring proteins. Functional homologues are preferably identical to, or correspond to, and have the functional characteristics of a sequence.

A POI referred to herein may be a product homologous to the eukaryotic host cell or heterologous, preferably for therapeutic, prophylactic, diagnostic, analytical or industrial use.

The POIs are preferably heterologous recombinant polypeptides or proteins, produced in a eukaryotic cell, preferably a yeast cell, preferably as secreted proteins. Examples of proteins preferably produced are immunoglobulins, immunoglobulin fragments, aprotinin, tissue factor pathway inhibitor or other protease inhibitors, and insulin or insulin precursors, insulin analogs, growth hormones, interleukins, tissue plasminogen activator, transforming growth factor a or b, glucagon, glucagon-like peptide 1 (GLP-1), glucagon-like peptide 2 (GLP-2), GRPP, factor VII, factor VIII, factor XIII, platelet-derived growth factor 1, albumin enzymes, such as lipases or proteases, or a functional homologue, functional equivalent variant, derivative and biologically active fragment with similar function to that of the native protein. The POI may be structurally similar to the native protein and may be obtained from the native protein by the addition of one or more amino acids to one or both of the C- and N-terminus or the side chain of the native protein, substitution of one or more amino acids at one or more different sites in the native amino acid sequence, deletion of one or more amino acids at one or both ends of the native protein or at one or more sites in the amino acid sequence, or insertion of one or more amino acids at one or more sites in the native amino acid sequence. Such modifications are well known for several of the proteins mentioned above.

A POI can also be selected from among substrates, enzymes, inhibitors or cofactors that provide biochemical reactions in the host cell, with the aim of obtaining the product of said biochemical reaction or a cascade of several reactions, e.g. eg to obtain a metabolite from the host cell. Illustrative products can be vitamins, such as riboflavin, organic acids and alcohols, which can be obtained in higher yields upon expression of a recombinant protein or POI according to the invention.

In general, the host cell, which expresses a recombinant product, can be any eukaryotic cell suitable for recombinant expression of a POI.

examples of preferred mammalian cells are BHK, CHO (CHO-DG44, CHO-DUXB11, CHO-DUKX, CHO-K1, CHOK1SV, CHO-S), HeLa, HEK293, MDCK, NIH3T3, NS0, PER.C6, SP2/0 and VERO.

Examples of preferred yeast cells used as host cells in accordance with the invention include, but are not limited to the genus Saccharomyces (eg Saccharomyces cerevisiae), the genus Pichia (eg P. pastoris or P. methanolica) , the genus Komagataella ( K. pastoris, K. pseudopastoris, or K. phaffii), Hansenula polymorpha, Yarrowia lipolytica, Schefferomyces stipitis, or Kluyveromyces lactis.

The most recent bibliography divides and changes the name Pichia pastoris to Komagataella pastoris, Komagataella phaffii and Komagataella pseudopastoris. In this document, Pichia pastoris is used as a synonym for all Komagataella pastoris, Komagataella phaffii and Komagataella pseudopastoris.

Preferred yeast host cells are obtained from methylotrophic yeast, such as from Pichia or Komagataella, e.g. eg Pichia pastoris, or Komagataella pastoris, or K. phaffii, or K. pseudopastoris. Examples of the host include yeasts such as P. pastoris. Examples of P. pastoris strains include CBS 704 (=NRRL Y-1603 = DSMZ 70382), CBS 2612 (=NRRL Y-7556), CBS 7435 (=NRRL Y-11430), CBS 9173-9189 (CBS strains: CBS-KNAW Fungal Biodiversity Center, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands) and DSMZ 70877 (German Collection of Microorganisms and Cell Cultures), but also Invitrogen strains such as X-33, GS115, KM71 and SMD1168. Examples of S. cerevisiae strains include W303, CEN.PK, and the BY series (EUROSCARF collection). All of the strains described above have been successfully used to produce transformants and express heterologous genes.

A preferred yeast host cell according to the invention, such as a P. pastoris or S. cerevisiae host cell, contains heterologous or recombinant promoter sequences, which may be obtained from a different P. pastoris or S. cerevisiae strain. of the production host. In another specific embodiment, the host cell according to the invention comprises a recombinant expression construct according to the invention comprising the promoter from the same genus, species or strain as the host cell.

According to the invention, it is preferred to provide a P. pastoris host cell line comprising a pG1-x promoter sequence as described herein operably linked to the nucleotide sequence encoding POI.

If the POI is a homologous protein for the host cell, that is, a protein naturally found in the host cell, the expression of the POI in the host cell can be modulated by exchanging its native promoter sequence for a promoter sequence. according to the invention.

This purpose can be achieved, e.g. eg by transforming a host cell with a recombinant DNA molecule comprising sequences homologous to the target gene to allow site-specific recombination, the promoter sequence, and a suitable selectable marker for the host cell. Site-specific recombination will take place to operably link the promoter sequence to the nucleotide sequence encoding the POI. This results in the expression of the POI from the promoter sequence according to the invention rather than from the native promoter sequence.

It is specifically preferred that the pG1-x promoter has increased promoter activity relative to the native POI promoter sequence.

According to a specific embodiment, the POI production method employs a recombinant nucleotide sequence encoding POI, which is provided on a plasmid suitable for integration into the host cell genome, in single copy or multiple copies by cell. The recombinant nucleotide sequence encoding the POI can also be provided on an autonomously replicating plasmid in a single or multiple copies per cell.

The preferred method as described herein employs a plasmid, which is a eukaryotic expression vector, preferably a yeast expression vector. Expression vectors may include, but are not limited to, cloning vectors, modified cloning vectors, and specifically designed plasmids. The preferred expression vector as used in the invention may be any expression vector suitable for expression of a recombinant gene in a host cell and is selected depending on the host organism. The recombinant expression vector may be any vector that is capable of replicating or integrating into the genome of the host organisms, also called a host vector, such as a yeast vector, carrying a DNA construct according to the invention. A preferred yeast expression vector is for expression in yeast selected from the group consisting of methylotrophic yeasts represented by the genera Hansenula, Pichia, Candida and Torulopsis.

In the present invention, it is preferred to use plasmids derived from pPICZ, pGAPZ, pPIC9, pPICZalpha, pGAPZalpha, pPIC9K, pGAPHis or pPUZZLE as a vector.

According to a preferred embodiment of the present invention, a recombinant construct is obtained by ligating the relevant genes into a vector. These genes can be stably integrated into the host cell genome by transforming the host cell using such vectors. The polypeptides encoded by the genes can be produced using the recombinant host cell line by culturing a transformant, thus obtained, in an appropriate medium, isolating the expressed POI from the culture and purifying them by a method appropriate to the expressed product, in particular to separate the POI from contaminating proteins.

Expression vectors may comprise one or more phenotypic selectable markers, e.g. eg a gene encoding a protein that confers antibiotic resistance or provides an autotrophic requirement. Yeast vectors commonly contain an origin of replication from a yeast plasmid, an autonomously replicating sequence (ARS) or, alternatively, a sequence used for integration into the host genome, a promoter region, sequences for polyadenylation, sequences for transcription termination and a selectable marker.

Procedures used to ligate DNA sequences and regulatory elements, e.g. eg pG1-x promoter and gene(s) encoding POI, promoter and terminator, respectively, and for inserting them into suitable vectors containing information necessary for host integration or replication, are well known to those skilled in the art. technique, e.g. eg described by J. Sambrook et al., (A Laboratory Manual, Cold Spring Harbor, 1989).

It will be understood that the vector, which uses the regulatory elements according to the invention and/or the POI as integration target, can be constructed by first preparing a DNA construct containing the complete DNA sequence encoding the regulatory elements and/or POI and subsequently inserting this fragment into a suitable expression vector, or sequentially inserting DNA fragments containing genetic information for the individual elements, followed by ligation.

Multiple cloning vectors, which are vectors having a multiple cloning site, can also be used according to the invention, wherein a desired heterologous gene can be incorporated into a multiple cloning site to provide an expression vector. In expression vectors, the promoter is positioned upstream of the POI gene and regulates expression of the gene. In the case of multiple cloning vectors, because the POI gene is inserted into the multiple cloning site, the promoter is placed upstream of the multiple cloning site.

The DNA construct provided to obtain a recombinant host cell according to the invention can be synthetically prepared by established conventional methods, e.g. eg the phosphoramidite method.

The DNA construct may also be of cDNA or genomic origin, for example, obtained by preparing a cDNA or genomic library and screening DNA sequences encoding all or part of the polypeptide of the invention by hybridization using probes. synthetic oligonucleotides according to standard techniques (Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, 1989). Finally, the DNA construct may be of mixed synthetic and genomic origin, mixed synthetic and cDNA, or mixed genomic and cDNA prepared by annealing fragments of synthetic, genomic or cDNA origin, as appropriate, the fragments corresponding to various parts of the construct. of complete DNA, according to conventional techniques.

In another preferred embodiment, the yeast expression vector can be stably integrated into the yeast genome, e.g. eg by homologous recombination.

A transformant host cell according to the invention obtained by transforming the cell with the regulatory elements according to the invention and/or the POI genes may preferably first be cultured under conditions for it to grow efficiently to a large number of cells. When preparing the cell line for POI expression, culture techniques are chosen to produce the expression product.

The above description will be more fully understood with reference to the following examples. However, such examples are merely representative of methods of practicing one or more embodiments of the present invention and should not be construed as limiting the scope of the invention.

examples

Example 1: 5' Shortening of pG1 Reveals the Major Regulatory Region of pG1

The native (wild-type) pG1 promoter has been isolated from P. pastoris ( Komagatella phaffii) strain CBS2612 (CBS strains: CBS-KNAW Fungal Biodiversity Center, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands). As determined by Sanger sequencing and subsequent BLAST analysis, the pG1 promoter sequence of CBS2612 had greater than 95% sequence identity with the respective regions in the genomic sequences of strains GS115 (Invitrogen) (upstream of PAS_chr1 -3_0011) and CBS7435 (upstream of P7435_Chr1-0007) or K. pastoris DSMZ 70382 (DSMZ strains: German Collection of Microrganisms and Cell Cultures) (upstream of PIPA00372). During analysis of the genomic region of pG1, its GTH1 gene was found to have a different start annotation in strains CBS7435 (P7435_Chr1-0007) and DSMZ 70382 (PIPA00372) than in GS115 (PAS_chr1-3_0011). Unlike GS115 and CBS2612, the coding sequence has a start annotation 36 bp further downstream in the genomic sequences of the other two strains.

To identify the relevant regulatory region of pG1, 8 shortened pG1 variants were cloned from CBS2612 starting at alternative 5' positions -858, -663, -492, -371, -328, -283, -211 and -66. to position -1 (see Figure 1 , numbering based on the start of the GTH1 gene locus PAS_chr1-3_0011). These shortened promoter variants were screened for eGFP expression in deep-well plates as described in Example 8 to test repression (glycerol) and induction (glucose feed beads) properties compared to the original version of . 965 bp of pG1 (Figure 2). No differences in eGFP signal were found for all length variants in the repression condition, demonstrating that promoter repression was not restricted in any of the shortened variants. After 48 hours of induction, expression capacity remained fully functional for promoter variants up to 328 bp in length. The 283 bp variant was only about two-thirds as strong as the original pG1 promoter. The two shorter length variants (211 and 66 bp) appeared to be almost non-functional. These results indicate that the region between position -400 and -200 contains important regulatory features.

Example 2: A High Density of TFBS Related to the Predicted Carbon Source Marks the Major Regulatory Region of the pG1 Promoter

The pG1 promoter sequence (1000 bp upstream of the PAS_chr1-3_0011 gene) was searched for matrix families belonging to the "fungi" and "general core promoter element" matrix groups using the Genomatix MatInspector. 111 putative TFBS belonging to 46 different matrix families were found.

(Table 1). The most common template families in the analyzed sequence were Gal4-class monomeric motifs (F$MGCM, 12 binding sites), homeodomain-containing transcriptional regulators (F$HOMD, 6 binding sites), fungal basic leucine zipper family (F$BZIP, 5 binding sites) and yeast GC-Box proteins (F$YMIG, 5 binding sites). A very high density of TFBS binding sites was observed between position -400 to -200 with approximately two-thirds of the mentioned TFBS (most common matrix families) being found there (18 of 28). Regarding the general core promoter elements, the Matlnspector did not identify yeast or fungal related motifs, but a TATA box can be found starting at position -26.

A prominent motif was identified, e.g. eg at position -390 to -375, which was named TAT14 due to its sequence 5'-TATTTTTTTTTTTTTT-3' (SEQ ID 21) or TAT15 due to its sequence 5'-TATTTTTTTTTTTTTT-3' (SEQ ID 22). Such poly(A:T) stretches in promoter regions are known to negatively affect nucleosome binding and stimulate TF binding at nearby sites in yeast.

Example 3: The carbon source-related transcription factors Mxr1, Rgt1, Cat8-1, Cat8-2 and Mig1 were revealed to be important for the regulatory properties of pG1

Transcription factor binding sites with predicted dependence on glucose or carbon source were selected for further analysis (see Figure 1 and Table 2). pG1 variants with deletions of the respective regions were generated using overlap extension PCR.

Table 3 lists all selected TFBS and indicates all TFBS that are (partially) affected by the deletion (detailed list in Table 2). For some deletions (eg, A9 and A10), some nucleotides of the respective TFBS were left intact to keep the close neighbor TFBS functional and separately examine its effect.

All TFBS deletion and TAT mutation variants were screened for eGFP expression as described in Example 8 under repression (glycerol) and induction (glucose feed count) conditions (FIG. 3). It is important to consider that individual TF/TFBS are generally not sufficient to comply with the regulation of a promoter. TFBS deletions also imply that the promoter sequence may be affected by newly formed adjunct sequence, by altered distances between TFBS, or by higher order property changes (chromatin organization). The same TFBS at different promoter positions may have different functions, also due to other adjacent TFBS. In closely spaced TFBS, tFs may act synergistically or restrict the binding of other TFs due to steric hindrance.

Four different carbon source-related TF families were deleted in the pG1 promoter variants (see Table 2 and Table 3): Yeast metabolic regulator (F$ADR; arrays: F$ADR1.01), monomeric motifs Gal4 class (F$MGCM; matrices: F$RGT1.01, F$RGT1.02), carbon source sensitive elements (F$CSRE, matrices: F$CSRE.01, F$SIP4.01) and Yeast GC Box Proteins (F$YMIG; matrices: F$MIG1.01 and F$MIG1.02). The corresponding transcription factors in S. cerevisiae are Adr1, Rgt1, Sip4/Cat8 and Mig1, respectively.

Carbon source-dependent promoters are controlled by glucose repression and/or induction by carbohydrates or other non-sugar carbon sources. Glucose repression is mainly carried out by the protein kinase complex Snf1, the transcriptional repressor Mig 1 and protein phosphatase 1. Downstream factors regulate e.g. eg respiratory genes (Hap4), gluconeogenesis genes (Cat8, Sip4) and glucose transporters (Rgt1) in S. cerevisiae.

P. pastoris has two homologues of Mig1, named Mig 1-1 and Mig 1-2, the second of which possibly acts as a carbon catabolite repressor. When glucose is available, Mig1 acts as a repressor, while Rgt1 acts as a transcriptional activator. To fulfill the repressor function, Mig 1 is dephosphorylated and imported into the nucleus where it recruits the co-repressors Ssn6 and Tup1.

By limiting glucose, Rgt1 is dephosphorylated and acts as a transcriptional repressor. Rgt1 function is controlled by its phosphorylation state (Rgt1 has four phosphorylation sites), and induction of regulated promoters does not require Rgt1 dissociation in S. cerevisiae, as is typically observed for transcriptional repressors.

The carbon source-sensitive zinc finger transcription factor Adr1 is required for transcriptional activation of the glucose-repressible alcohol dehydrogenase ( ADH2) gene in S. cerevisae. The homologue of Adr1 in P. pastoris is Mxr1 (PAS_chr4_0487), the key regulator of methanol metabolism, and was reported to be a positive-acting transcription factor that is essential for strong induction of P ^aox on methanol. The TFBS 5' CYCC 3' core motif referred to for Mxr1 coincides with both F$ADR1.01 sites found in the pG1 promoter sequence.

The carbon source response element (CSRE) is bound by the transcriptional activators Sip4 and Cat8 and functions by inducing the expression of gluconeogenesis genes in S. cerevisiae. Two P. pastoris homologues of Sc Cat8 can be found: Cat8-1 (PAS_chr2-1_0757) and Cat8-2 (PAS_chr4_0540), both being the best blastp hits for ScSip4. Cat8-2 is weakly similar to ScCat8, and potentially plays an important role in derepressive conditions.

Example 4: pG1 promoter deletion variants reveal the TFBS responsible for its repression and induction

Of the 5 deletion variants residing upstream (5') of the pG1 major regulatory region identified above (see shaded box in Figure 1 and Table 2), variants pG1-A1, -A2, and -A4 appear to have a beneficial effect on promoter strength while pG1-A3 and A5 deletion variants had no effect on GFP expression compared to the original pG1 promoter (SEQ ID 9). This result suggests that 5' shortening of the promoter could be beneficial for genetic modification of pG1. TFBS deletions within the major regulatory region of pG1 (pG1-A6 to -A12, see Figure 1 and Table 2 ) had different impacts on eGFP expression, but none showed increased induction without losing properties. of repression. Therefore, it is assumed that the major regulatory region of pG1 must be maintained in genetically modified pG1 promoter variants to maintain its tight regulation. Therefore, without In this region, a much smaller induction in glucose limitation was observed in Example 1 (pG1-328 and pG1-283, Figure 2 ).

Mig1 binding sites were deleted in pG1-A3, -A4, -A10 and -A11 (FMIG1.02 in A3, FMIG1.01 in A4, A10 and A11), where pG1-A10 and pG1- A11 also includes the F$ADR1.01 and F$RGT1.02 deletions, respectively. A slightly tighter repression was found for A3, while A4 had unchanged repression, but improved levels of eGFP after induction.

The release of repression observed for A10 and the induction of the weaker promoter of A10 and A11 could also be linked to F$RGT1 binding sites in this region (F$RGT1.01 and F$RGT1.02 deleted in A9 and A11). Furthermore, Mig 1 might play a bifunctional role in pG1 regulation: two MIG1 genes are found in P. pastoris ( MIG1-1, MIG1-2) and were shown to be reverse regulated depending on glucose availability.

Deletion of F$ADR1.01 increased eGFP levels in the pG1-A1 variant, although deletion of the Mxr1 (positive regulator of methanol metabolism in Pp, homologue of ScADR1) binding site would be expected to significantly weaken the promoter. . Combined deletion of F$ADR1.01 with F$MIG1.01 in pG1-A10 released promoter repression on glycerol and weakened its induction, which is a conclusive response to TFBS deletion of Mig1.

In the major regulatory region, the F$RGT1.02 binding site was deleted in variants pG1-A6 (two sites), -A7, -A8, -A11 and -A12, and F$RGT1.o1 was deleted in A9 . The variant harboring the paired F$RGT1.02 site deletion (A6, binding sites on opposite strands 7 bp shift) showed slight release of repression and reduced induction. Variants A7 and A8 contain closely spaced F$RGT1.02 sites, with the former on the negative strand and the latter on the positive strand; also A8 contains the deletion of an F$SIP4.01 site. The first (A7) showed a slight release of repression and increased induction, while the second (A8) had a much weaker induction (but had unchanged promoter repression). This indicates an important role for the transcriptional activator Cat8-1 and/or Cat8-2 (stronger homologs for ScSip4) for the induction of pG1. The A9 variant was created to suppress closely located F$RGT1.01 and F$CSRE.01 TFBSs (binding sites on opposite strands), and the dramatic loss of repression indicates an important role for these TFBSs in tightly controlling pG1, most likely through the binding of Rgt1, Cat8-1 and/or Cat8-2. The F$RGT1.02 deletion in the pG1-Al2 variant had no effect on eGFP expression yield. Interestingly, CAT8-2 transcription is strongly upregulated in glucose limitation compared to glucose surplus, whereas RGT1 and CAT8-2 were not transcriptionally regulated under the conditions tested.

Example 5: The Strength of the pG1 Promoter Depends on the Poly(A:T) TAT14 Stretch

The TAT motif is located approximately 80 bp upstream (5', eg, position -390 to -374) of the major regulatory region of pG1. Repeat sequencing of the 5' region of GTH1 in P. pastoris CBS2612, CBS7435 or GS115 resulted in the detection of 15 /- 1 T in the TAT motif. To elucidate its impact on promoter yield, the TAT14 motif was selected for deletion (pG1-ATAT14) and mutation (at T16, T18 and T20; pG1-T16, pG1-T18, pG1-T20). Primers (see primers #37-42 in Table 4) were initially designed to obtain T18, T20 and T22, but variants with different lengths (T16, T20 and T18, respectively) were obtained and used. Deletion of the TAT14 motif resulted in lower GFP signals, while its prolongation increased the expression strength of pG1. This indicates that the use of a long TAT14 motif would be beneficial for the genetic modification of pG1.

Example 6: Partial Sequence Duplications of the Major Regulatory Region of pG1 Significantly Enhance Its Strength of Expression

Two duplication variants (pG1-D1240 (SEQ ID 49) and pG1-D1427 (SEQ ID 85), numbers indicate the lengths of the respective promoter variants) of the pG1 promoter were generated by PCR amplification of two sequence fragments ( -472 to -188 and -472 to -1) and insertion using the Psi and BglII restriction sites (positions 509-514 and 525-530). The duplication sections start upstream of the deleted TFBS in pG1-A5 and end after the major regulatory region of pG1 for the first variant (pG1-D1240), while the second duplication (pG1-D1427) goes all the way to the 3' end. from the pG1 promoter. These variants were screened for eGFP expression in the same manner as described for the TFBS deletion and TAT14 mutation variants (see Example 8). Both duplication variants showed stricter repression at excess glycerol and stronger induction at limiting glucose. (Figure 4).

The post-transformational stability of the pG1-D1240 duplication variant clone no. 3 was tested by performing three consecutive batch cultures without selection pressure, which is equal to approximately 20 generations. eGFP expression was stable throughout the culture time (data not shown). By comparison, a typical P. pastoris bioreactor process starts with OD600 = 1 (-0.2-0.4 g/L YDM) in the batch phase and ends with ~100 g/L YDM after the batch phase. per batch fed and therefore takes approximately 10 generations.

Example 7: Verification of pG1 Promoter Variant Yield in Fed-Batch Bioreactor Culture

In order to verify the performance of the promoter variants generated under bioprocess conditions, some variants were selected for fed-batch culture based on their altered eGFP expression behavior: pG1-A2 (SEQ ID 211) was the variant enhanced upstream of the major regulatory region, and pG1-T16 (SEQ ID 257) and pG1-D1240 (SEQ ID 49) showed higher eGFP expression levels in glucose-limiting without losing promoter repression under conditions with glycerol. Bioreactor culture, initiated with a glycerol batch phase followed by a fed-batch optimized for spatiotemporal yield (Prielhofer et al., 2013), was performed for one clone of each and compared to the control pG1 strain # . 8 for eGFP expression (see Figure 5 and Table 5 ).

The fed-batch fermentations were performed in DASGIP reactors with a final working volume of 0.7 L.

The following means were used:

Starting solution of trace salts PTMi contained per liter

6.0 g CuSO*5H ² O, 0.08 g Nal, 3.36 g MnSO ^4- H ² O, 0.2 g Na ² MoO ⁴ ^2H ² O, 0.02 g H ³ BO ³ , 0.82 g CoCl ² , 20.0 g ZnCl ² , 65.0 g FeSO*7H ² O, 0.2 g biotin, and 5.0 mL H ² SO ⁴ (95% -98%).

Batch media glycerol content per liter

2 g Citric Acid Monohydrate (C ⁶ H ^s O and H ² O), 39.2 g Glycerol, 12.6 g NH ⁴ H ² PO ⁴ , 0.5 g MgSO ⁴ ^7H ² O, 0.9 g of KCl, 0.022 g of CaC^2H ² O, 0.4 mg of biotin and 4.6 mL of starting solution of trace salts of PTM1. HCl was added to adjust the pH to 5.

Glucose fed loading medium content per liter

464 g of glucose monohydrate, 5.2 g of MgSO ⁴ ^7 H ² O, 8.4 g of KCl, 0.28 g of CaCh^ 2 H ² O, 0.34 mg of biotin and 10.1 mL of trace salts stock solution PTM1.

Dissolved oxygen was controlled at DO=20% with stirrer speed (400-1200 rpm). The aeration rate was 24 L h ^{' 1} of air, the temperature was controlled at 25°C and the pH set point of 5 was controlled with the addition of NH ⁴ OH (25%).

To start the fermentation, 400 mL of batch medium were sterile filtered into the fermenter and inoculated from a selective preculture of the respective P. pastoris clone with an initial optical density (OD600) of 1. The batch phase of approximately 25 h (reaching a dry biomass concentration of approximately 20 g/L) was followed by a glucose-limited fed-batch beginning with exponential feeding for 7 h and a constant feed rate of 15 g/L for 13 h, leading to at a final concentration of dry biomass of approximately 100 g/L. Samples were taken during batch and fed-batch phase and analyzed for eGFP expression using a plate reader (Infinite 200, Tecan, CH). Therefore, the samples were diluted to an optical density (OD600) of 5. The results are shown in Figure 5 as relative fluorescence per bioreactor (FL/r).

The gene copy number of these three clones was analyzed by real-time PCR and resulted in a GCN for all of them (data not shown). All pG1 variants showed good repression in the batch phase and strong expression in the induced state (Table 5). The strong enhancement of the pG1-D1240 duplication variant could be verified under bioreactor conditions, pG1-D1240 clone no. 3 showed a 50% increase in GFP fluorescence at the end of the fed batch compared to pG1. Although the signal had already increased at the end of the batch, the induction rate was even slightly higher than for the original pG1. In addition to screening, clone pG1-A2 num. 3 had a slight increase in signal at the end of the batch, and approximately 10% weakening of the signal at the end of the fed batch. pG1-T16 clone no. 3 of the TAT14 mutation variant showed the strongest signal at the end of the batch, and lagged behind the duplication variant at the end of the fed batch, achieving an improvement of approximately 20% over pG1 no. 8 control, similar to the result of the scrutiny. The different induction behavior of the clones in the batch phase is explained by the derepression due to the decrease in glycerol concentration throughout the batch phase (see Figure 5A). In general, fed-batch cultures could largely confirm the results obtained in small-scale screening.

Achievements and Conclusions

Gene promoters with carbon source-dependent regulation are favorable for the application of bioprocesses since the production phase can be separated from the growth phase. Potential enhancement of promoter-based protein production can be achieved by finding optimal growth conditions (eg, growth rate, feeding strategy) or by directly manipulating the promoter sequence (eg, mutations, deletions).

Several variants of the pG1 promoter with shortened length, TFBS deletions, TAT motif mutations and fragment duplications were constructed. Thus, the major regulatory region of pG1, including its important TFBS, was identified. Analysis of TFBS deletions indicates that transcription factors Rgt1 and Cat8-1 and/or Cat8-2 play an essential role for pG1 repression and induction: two motifs consisting of F$RGT1 and F$CSRE were deleted. that join in the same position on opposite strands. Deletion of the first part (pG1-A8, position -293 to -285; RGT1: (+) -310 to -299, CSRE: (-) -299 to -285) caused a weakening of promoter induction, while that deletion of the second part (pG1-A9, position -275 to -261; RGT1: (-) -275 to -259, CSRE: (+) -276 to -260) led to decreased promoter repression . Thus, regulatory motifs that are essential and characteristic for the regulation of pG1 were identified.

The role of transcriptional regulators Mig1 (F$MIG1) and Mxr1 (F$ADR1) could be more important in other conditions such as glucose excess or methanol induction. Other transcription factors that bind to or near that region could also contribute to pG1 regulation.

Poly(A:T) stretches are known to play a role in promoter sequences, and it could be shown that the TAT motif in pG1, which is located upstream (eg, position -390 to -375) of the main regulatory region, is essential for its strength. Elongation of this motif at T16, T18 and T20 had a positive effect on promoter behavior.

The pG1 deletion variants revealed that 5' shortening could also be beneficial for promoter genetic modification. TFBSs for Mxr1, Mig1, Rgt1, and Cat8 deleted upstream of the major regulatory region of pG1 enhanced eGFP expression, although this effect was not seen for 5'-shortened promoter variants.

Two variants with partial sequence duplications achieved greatly improved expression capabilities compared to wild-type pG1.

Distinctive features of good pG1 expression behavior, which is a strong basis for rational genetic modification of the promoter, could be assigned: 5' shortening, use of TAT motif and optional mutation/elongation and duplication of fragments. The performance of the pG1 variant in small-scale screening could be successfully verified in fed-batch cultures.

Abbreviations:

CSRE: carbon source response element, F$: fungus-specific TF array, GCN: gene copy number, GOI: gene of interest, Pp: Pichia pastoris, Sc: Saccharomyces cerevisiae, TF: transcription factor(s) , TFBS: transcription factor binding site(s), YDM: yeast dry matter

Example 8: Determination of Repression, Induction, Expression Level of pG1-x (Expression Level Compared to pG1), Induction Ratio

The strength of the promoter compared to the pG1 promoter and the rate of induction can be determined by the following standard assay: P. pastoris strains are screened in 24 deep-well plates at 25°C with shaking at 280 rpm with 2 mL of culture per well. Glucose feed beads (6mm, Kuhner, CH) are used to generate glucose-limiting growth conditions. Cells are analyzed for eGFP expression during repression (YP 1% glycerol, exponential phase) and induction (YP 1 feed bead, over 20-28 hours) using flow cytometry. Specific eGFP fluorescence is calculated from fluorescence intensity and forward scatter for at least 3000 data points of flow cytometry data. Forward scatter is a relative measure of cell volume. Specific eGFP fluorescence equals fluorescence intensity (FI) divided by forward scatter (FSC) at 1.5, i.e. FI/FSC15 (Hohenblum, H., N. Borth, and D. Mattanovich, (2003) Assessing viability and cell-associated product of recombinant protein producing Pichia pastoris with flow cytometry. J Biotechnol 102: 281-290). From these data, the geometric mean of the population-specific fluorescence is used, and normalized by subtracting the background signal from non-producing P. pastoris wild-type cells. The eGFP fluorescence specific to the glycerol condition is termed "Repression", and the eGFP fluorescence specific to the glucose-limited condition (glucose feed beads) is termed "Induction". Therefore, only Repression and Induction values from the same screening and flow cytometry measurement can be compared and used for calculations. To determine the relative strength of the pG1-x promoter, eGFP expression levels in the induced state of the pG1-x promoters were compared to the original pG1 promoter by dividing the Induction value of a strain comprising the pG1-x promoter by the Induction value of a strain comprising the original pG1 promoter. The Induction ratio is calculated by dividing the Induction value by the Repression value of the same strain/promoter. Repression, Induction, relative pG1-x promoter strength and Induction ratio are shown in Table 6 for various promoter variants.

Other examples have shown that by using a pG1-x promoter comprising or consisting of the nucleotide sequence of SEQ ID 49 a model protein (POI) was produced in P. pastoris in much higher yields (an increased multiplicity of more than 3.5-fold), fed-batch experiments) compared to the unmodified pG1 promoter (SEQ ID 7 reference).

Example 9: Comparison of "rapid fermentation" and conventional fermentation

Abstract: Significantly reduced fermentation times for expression of an alternative scaffold protein could be obtained as a model protein under the control of a pG1-3 embodiment of the promoter of SEQ ID 39 (pG1-D1240 (SEQ ID 49)) using a protocol fed-batch with optimized spatio-temporal yield instead of using a conventional fed-batch regimen.

A clone expressing a model protein under the control of pG1-D1240 (SEQ ID 49) was selected for fed-batch cultures. Fed-batch cultures were performed in DASGIP reactors (Eppendorf, Germany) with a final working volume of 0.5 L. Media and trace element solution were prepared as previously described in Example 7, except for the concentration of glycerol in the discontinuous glycerol medium was 45 g/L. During cultivation, the dissolved oxygen level was controlled at OD = 30% with the speed of the shaker (400-1200 rpm). The aeration rate was 1 vvm of air, the temperature was controlled at 25°C and the pH set point of 5.0 was controlled with the addition of NH4OH (25%). To start the bioreactor culture, 250 mL of batch medium were inoculated from a preculture of the respective clone of P. pastoris with an initial optical density (OD600) of 1.0. The discontinuous phase with glycerol lasted approximately 30 hours and reached a dry biomass concentration of 25 to 29 g/L. The glycerol fed-batch phase was followed by a glucose-limited fed-batch. Two different fed-batch culture modes were compared: (A) a conventional fed-batch protocol using a constant feed rate, (B) a fed-batch protocol with optimized spatiotemporal yield ("Rapid Fermentation"), where the rate Glucose feed was optimized to maximize the volumetric productivity of the fermentation.

For conventional culture, a constant glucose feed rate of 1.25 mL I r 1 was selected. The fed-batch culture was maintained for 100 h (126 h total culture time), resulting in a concentration final dry biomass of approximately 90 g L-1. For "Rapid Fermentation", a model-based optimization algorithm was adopted (Maurer et al., Microbial Cell Factories, 2006, 5:37), where the optimized volumetric glucose feed rate F(t) was approximated by a linearly increasing function: F(t) [mL h-1] = 0.3234 mL Ir2 * t 3.3921 mL h-1. The fed-batch phase was maintained for t = 33 h (60 h total culture time), resulting in a final dry biomass concentration of approximately 140 g L-1.

Samples were taken at the end of the batch and during the fed-batch phase. Product titers were analyzed from clarified supernatants using a Low Molecular Weight Protein Expression HT Reagent Kit and the Caliper LabChip GXI System (Perkin Elmer, USA). A purified alternative scaffold protein standard was used as a reference standard for absolute quantification.

Figure 9 shows the generation of product and biomass during the total cultivation time for conventional cultivation. (A) and the "rapid fermentation" (B). In comparison, final product titers of 6.4 g L-1 and 4.3 g L-1 could be achieved after 60 h and 126 h for "Rapid Fermentation" and conventional fermentation, respectively. In other words, a 1.4-fold higher titer (1.2-fold higher broth titers resp.) could be found in a significantly shorter fermentation time (-66 h) when glucose feed is supplemented during expression. under the pG1-D1240 promoter (SEQ ID 49) as described for "Rapid Fermentation" instead of using the conventional feeding regimen described.

to ace

Table 2: Affected TFBS of pG1 promoter sequence in deletion mutants pG1-A1 to A12. Sequence analysis was performed using MatInspector from Genomatix. Glucose- and carbon-related TFBSs that were selected for deletion are shown in bold and the corresponding ID (1-12) and deleted positions are indicated in columns 1 and 2.

Table 3: TFBS positions and deletions of TFBS deletion variants of pG1 TFBS targeted and affected in TFBS deletion variants of pG1 (pG1-A1 to A12) are listed. Specific TFBS related to the carbon source are shown in bold. Detailed information for all TFBS and for suppressed TFBS is provided in Table 1 and Table 2, respectively.

Table 4: Primer sequences

Table 5: Fed-batch culture of pG1 (herein referred to as pG1 #8) and pG1-x variants (herein also referred to as pG1 variants) expressing eGFP Relative fluorescence of eGFP is shown for the end of the batch and for the end of the fed batch. Time points were set to 0 at the end of the batch. A clone expressing eGFP under the control of pG1 (#8) was compared with clones expressing under the control of a pG1 deletion (pG1-A2), a TAT14 mutation (pG1-T16), and a duplicative variant (pG1- D1240). Biomass concentrations (YDM) in the batch and the fed batch were as expected.

Table 6: Promoter strength compared to pG1 and promoter induction ratio of pG1 variants, from deep well comparative screening. The expression strength of the (induced) pG1-x variants is related to the level of eGFP expression obtained with the original pG1 promoter. The induction ratio is calculated from the GFP level in the induced and repressed state.

Claims (20)

1. An isolated and/or artificial pG1-x promoter, which is a functional variant of the Pichia pastoris carbon source-regulatable pG1 promoter identified by SEQ ID 1, which pG1-x promoter consists of, or comprises, at least a part of SEQ ID 1, which part of SEQ ID 1 is at least 293 bp long, whose pG1-x promoter comprises the following promoter regions a) at least two copies of a central regulatory promoter region, whose central regulatory promoter region comprises the nucleotide sequences of SEQ ID 2 and SEQ ID 3, where SEQ ID 2 and/or SEQ ID 3 comprise one or more binding sites to the transcription factor (TFBs); Y b) a non-core regulatory promoter region, which is any region within the pG1-x promoter sequence other than the core regulatory region; wherein the pG1-x promoter has sequence identity to the corresponding region of SEQ ID 1, which is at least 80% to SEQ ID 2 and SEQ ID 3, and at least 50% to any region other than SEQ ID 2 or SEQ ID 3; and further wherein the pG1-x promoter is characterized by increased promoter strength and/or induction ratio compared to the pG1 promoter, wherein - promoter strength is increased by at least 1.1-fold in the induced state compared to the pG1 promoter, and/or - the induction ratio is increased by at least 1.1-fold compared to the pG1 promoter. 2. The pG1-x promoter of claim 1, wherein the core regulatory region comprises the nucleotide sequence of SEQ ID 4, or a functional variant of SEQ ID 4 with at least 80% sequence identity, comprising one or plus TFBS. 3. The pG1-x promoter of claim 1 or 2, wherein the core regulatory region is incorporated into a major regulatory region represented by SEQ ID 5, or a functional variant of SEQ ID 5 with at least 80% sequence identity , comprising one or more TFBS. 4. The pG1-x promoter of any one of claims 1 to 3, comprising one or more TFBS for any of the transcription factors selected from the group consisting of Rgt1, Cat8-1 and Cat8-2. 5. The pG1-x promoter of any of claims 1 to 4, wherein said core regulatory promoter region comprises a deletion of one or more nucleotides between the nucleotide sequences of SEQ ID 2 and SEQ ID 3 compared to the corresponding region of SEQ ID 1. 6. The pG1-x promoter of any of claims 1 to 5, comprising at least one or at least two T motifs identified by any of SEQ ID 12-29. 7. An isolated and/or artificial pG1-x promoter, comprising or consisting of the nucleotide sequence selected from the group consisting of any of a) SEQ ID 37-44, preferably any of SEQ ID 45-76; b) SEQ ID 77-80, preferably any of SEQ ID 81-112; c) SEQ ID 113-114, preferably any of SEQ ID 115-130; d) SEQ ID 131-132, preferably any of SEQ ID 133-148; either e) SEQ ID 185-186, preferably any of SEQ ID 187-202; or a nucleotide sequence having at least 80% sequence identity to any of the foregoing, wherein the pG1-x promoter is characterized by increased promoter strength and/or rate of induction compared to promoter Pichia pastoris pG1 identified by SEQ ID 1, wherein - promoter strength is increased by at least 1.1-fold in the induced state compared to the pG1 promoter, and/or - the induction ratio is increased by at least 1.1-fold compared to the pG1 promoter. 8. The pG1-x promoter of claim 7, comprising or consisting of the nucleotide sequence selected from the group consisting of any of SEQ ID 37-44, preferably any of SEQ ID 45-76. 9. The pG1-x promoter of any of claims 1 to 8, which is operably linked to a nucleotide sequence encoding a protein of interest (POI), which nucleic acid is not natively associated with the nucleotide sequence encoding encodes the POI. 10. The nucleic acid of claim 9, further comprising a nucleotide sequence encoding a signal peptide that enables secretion of the POI, preferably wherein the nucleotide sequence encoding the signal peptide is located adjacent to the 5' end of the nucleotide sequence encoding the POI. An expression construct comprising the nucleic acid of claim 9 or 10, preferably an autonomously replicating vector or plasmid, or a vector or plasmid that integrates into the chromosomal DNA of a host cell. 12. A recombinant host cell comprising the expression construct of claim 11, preferably a eukaryotic cell, more preferably a yeast or filamentous fungal cell, most preferably a yeast cell of the genus Saccharomyces or Pichia. 13. A method of producing a POI by culturing a recombinant host cell line of claim 12, comprising the steps of a) cultivating the cell line under conditions to express said POI, and b) retrieve the POI. 14. The method of claim 13, wherein the culture comprises a) a first step using a basal carbon source that represses the pG1-x promoter, preferably wherein the basal carbon source is selected from the group consisting of glucose, glycerol, ethanol, a mixture thereof and complex nutrient material , followed by b) a second step that does not use or uses a limited amount of a complementary carbon source that derepresses the pG1-x promoter to induce production of the POI, preferably wherein the complementary carbon source is a hexose such as glucose, fructose , galactose or mannose, a disaccharide, such as sucrose, an alcohol, such as glycerol or ethanol, or a mixture of any of the foregoing. 15. The method of claim 14, wherein the second step b) employs a feeding medium that provides the complementary carbon source in a growth-limiting amount to maintain the specific growth rate within the range of 0.001 h-1 a 0.2 Ir1, preferably 0.005 h-1 to 0.15 h-1. 16. The method of claims 14 or 15, wherein the cultivation is carried out in a bioreactor starting with a batch phase as the first stage, followed by a fed-batch phase or a continuous cultivation phase as the second stage, wherein the phase discontinuous is done during around 20 to 36h; and the cultivation in the fed-batch phase is carried out during any of about 15 to 80 hrs, about 15 to 70 hrs, about 15 to 60 hrs, about 15 to 50 hrs, about 15 to 45 hrs, about from 3 to 40 p.m., about 3 to 35 p.m., about 3 to 30 p.m., about 3 to 10 p.m., or about 3 to 8 p.m.; preferably about 20 to 40 hours. 17. The method of any of claims 13 to 16, wherein the recombinant host cell is yeast from either the Saccharomyces genus or Pichia genus or Komagataella genus, preferably Pichia pastoris or Komagataella pastoris. 18. The method of any of claims 13 to 17, wherein the pG1-x promoter is any of SEQ ID 37 44, preferably any of SEQ ID 45-76, preferably wherein the pG1-x promoter comprises SEQ ID 39, more preferably SEQ ID 49. 19. The method of any of claims 13 to 18, wherein the POI is produced at a transcription rate of at least 15% compared to the cell's native pGAP promoter. 20. The method of any of claims 13 to 19, wherein the POI is a heterologous protein, preferably selected from therapeutic proteins, including antibodies or fragments thereof, enzymes and peptides, protein antibiotics, toxin fusion proteins, products carbohydrate-protein conjugates, structural proteins, regulatory proteins, vaccines and vaccine-like proteins or particles, procedural enzymes, growth factors, hormones and cytokines, or a metabolite of a POI.