WO2014068048A1

WO2014068048A1 - Expression system

Info

Publication number: WO2014068048A1
Application number: PCT/EP2013/072798
Authority: WO
Inventors: Andreas Herrmann; Beat THALMANN; Arndt-René KELTER
Original assignee: Celonic Ag
Priority date: 2012-11-05
Filing date: 2013-10-31
Publication date: 2014-05-08
Also published as: EP2914730A1

Abstract

The subject matter relates to a method for the increased production of a POI comprising: a) providing a mammalian host cell which has been recombinantly engineered to overexpress at least one of (i) the cgrTtc36 protein comprising the amino acid sequence of SEQ ID 1, or an amino acid sequence with at least 70% sequence identity to SEQ ID 1, or (ii) the cgrSnord78 ncRNA comprising the nucleotide sequence of SEQ ID 4, or a nucleotide sequence with at least 65% sequence identity to SEQ ID 4, preferably a cgrSnord78 ncRNA consisting of a nucleotide sequence selected from the group consisting of SEQ ID 3, 4, 5, 6 and 7, or a nucleotide sequence with at least 60% sequence identity to any of the foregoing, b) introducing a nucleic acid encoding the POI into the host cell of step a); c) culturing the host cell of step b) in a culture medium; and recovering the POI from the host cell or culture medium; and further a respective host cell line, and an expression cassette comprising a nucleic acid encoding at least one of (i) the cgrTtc36 protein comprising the amino acid sequence of SEQ ID 1, or an amino acid sequence with at least 70% sequence identity to SEQ ID 1, or (ii) the cgrSnord78 ncRNA comprising the nucleotide sequence of SEQ ID 4, or a nucleotide sequence with at least 65% sequence identity to SEQ ID 4, preferably a cgrSnord78 ncRNA consisting of a nucleotide sequence selected from the group consisting of SEQ ID 3, 4, 5, 6 and 7, or a nucleotide sequence with at least 60% sequence identity to any of the foregoing; and a heterologous expression control sequence operably linked thereto, and further comprising a nucleic acid encoding a POI. Further, the subject matter relates to an isolated nucleic acid encoding the cgrTtc36 protein.

Description

EXPRESSION SYSTEM

The invention relates to a method for increased production of a POI employing improved expression system.

BACKGROUND

Many proteins for commercial applications are produced in cell culture, from cells that have been engineered to produce unusually high levels of a particular protein of interest. Culturing cells for the commercial production of proteins is a costly and time consuming process. In order to provide commercially viable processes it is desirable to use cell lines which produce large quantities of product with each production run. However, it is difficult to maintain a cell culture that produces large quantities of desired product mainly because the cells may have low productivity: in other words, they do not produce a large quantity of product per unit of time.

Development of protein expression systems, which maximize the quantity of therapeutic protein produced per liter of cell culture will minimize the resources necessary to produce a given quantity of the protein. It is, thus, desirable to use commercially viable systems which produce large quantities of proteins.

Many proteins are preferably produced in mammalian cell lines, e.g. Chinese hamster ovary (CHO) cell lines, which are widely used for recombinant production of therapeutic or other commercially relevant proteins. CHO cell lines efficiently produce proteins that are correctly folded and have desired post-translational modifications. Further, CHO cell lines have gained acceptance and approval by regulatory agencies for use in clinical manufacturing of recombinant protein therapeutics.

Altered expression of endogenous genes and/or the introduction of additional expressible genetic constructs may enhance recombinant protein production. Lee et al. (Journal of Biotechnology 143 (2009) 34-43) describe the overexpression of heat shock proteins (HSPs) in CHO cells for extended culture viability and improved recombinant production. CHO cells expressing recombinant interferon-gamma were engineered to overexpress two HPSs (HSP27 and HSP70). As a result, the onset of apoptosis in CHO cell cultures was delayed, thus, the culture lifespan could be extended in Fed Batch cultures. Still, there is a particular need for the development of improved expression systems for the high yield production of proteins in cell culture.

SUMMARY OF THE INVENTION

It is the objective of the present invention to provide an improved expression system for use in mammalian cell culture and methods for the production of recombinant proteins.

The object is solved by the subject matter as claimed.

According to the invention there is provided a method for the production of a protein of interest (POI) comprising:

a) providing a mammalian host cell which has been recombinantly engineered to overexpress as compared to a wild-type host cell, at least one of

(i) the cgrTtc36 protein comprising the amino acid sequence of SEQ ID 1 , or an amino acid sequence with at least 70% sequence identity to SEQ ID 1 , or

(ii) the cgrSnord78 ncRNA comprising the nucleotide sequence of SEQ ID 4, or a nucleotide sequence with at least 65% sequence identity to SEQ ID 4, preferably a cgrSnord78 ncRNA consisting of a nucleotide sequence selected from the group consisting of SEQ ID 3, 4, 5, 6 and 7, or a nucleotide sequence with at least 60% sequence identity to any of the foregoing,

b) introducing a nucleic acid encoding the POI into the host cell of step a);

c) culturing the host cell of step b) in a culture medium; and recovering the POI from the host cell or culture medium.

Such overexpression as compared to a wild-type host cell provides for the increased productivity of the production method.

Any of the cgrTtc36 protein and cgrSnord78 ncRNA are herein referred to as "factor" of the invention; both, the cgrTtc36 protein and cgrSnord78 ncRNA, are herein referred to as "factors" of the invention, or nucleic acids or proteins of the invention.

Specifically, said host cell is cultured under conditions that induce increased expression of the cgrTtc36 protein and/or the cgrSnord78 ncRNA as compared to a wild-type host cell.

Specifically, the cgrTtc36 protein is consisting of an amino acid sequence of SEQ ID 1 , or a functionally active variant or fragment thereof. Specifically, the cgrSnord78 ncRNA is consisting of an amino acid sequence of SEQ ID 1 , or a functionally active variant or fragment thereof.

According to a specific embodiment, the cgrSnord78 ncRNA is selected from the group consisting of the full-length cgrGasS with a nucleotide sequence of SEQ ID 5, the cgrGasS splice variant 1 with a nucleotide sequence of SEQ ID 6 (cgrGas5_ 237bp), which has introns bearing cgrSnord44 and cgrSnord78, the nucleic acid sequence encoding cgrGasS, splice variant 2 (788bp), with putative intron bearing cgrSnord44 (SEQ ID 7), and the ncRNA consisting of cgrSnord78 with a nucleotide sequence of SEQ ID 3 or SEQ ID 4, or functionally active variants or fragments thereof.

According to the invention a host cell is specifically employed that overexpresses the cgrTtc36 protein and/or the cgrSnord78 ncRNA at a level that increases the cell density (cells/ml) in the cell culture and/or the specific productivity (pg/cell/day) and/or the volumetric productivity (g/L/h) to produce the POI .

The preferred overexpression level is at least 1 .5-fold, preferably at least 5-fold or at least 10 or at least 20-fold, as compared to the level in the host cell, e.g. a CHO host cell, without such overexpression, or the wild-type host cell.

According to a specific embodiment, the method of the invention further comprises isolation and optionally purification of the POI.

Specifically, the POI is a therapeutically or industrially relevant protein, e.g. bioactive proteins employed in the biomedical and biotechnology industries, preferably selected from the group consisting of antibodies and antibody fragments, enzymes, fusion proteins, cytokines, growth factors, clotting factors, hormones, pharmaceutical drug substances and vaccines.

According to a specific embodiment, the host cell is a production cell line of cells selected from the group consisting of CHO, PerC6, CAP, HEK, HeLa, NS0, SP2/0, YB2/0, EB66, hybridoma and Jurkat.

More specifically, the host cell is obtained from CHO-K1 , CHO-DG44 or CHO-S cells.

According to another aspect of the invention there is provided a host cell line for the production of a POI, comprising a vector expressing at least one of

(i) the cgrTtc36 protein comprising the amino acid sequence of SEQ ID 1 ,or an amino acid sequence with at least 70% sequence identity to SEQ ID 1 , or (ii) the cgrSnord78ncRNA comprising the nucleotide sequence SEQ ID 4, or a nucleotide sequence with at least 65% sequence identity to SEQ ID 4, preferably an cgrSnord78 ncRNA consisting of a nucleotide sequence selected from the group consisting of SEQ ID 3, 4, 5, 6 and 7, or a nucleotide sequence with at least 60% sequence identity to any of the foregoing, which further comprises a nucleic acid encoding a POI, specifically to express said POI .

According to a preferred embodiment, the host cell comprises a heterologous expression control sequence operably linked to a nucleic acid encoding the cgrTtc36 protein and/or the cgrSnord78 ncRNA and/or the POI.

Said host cell line is specifically selected from the group consisting of CHO,

PerC6, CAP, HEK, HeLa, NS0, SP2/0, YB2/0, EB66, hybridoma and Jurkat cells, preferably CHO-K1 , CHO-DG44 or CHO-S cells.

Specifically, the host cell line of the invention is a production cell line.

According to another aspect of the invention there is provided a method of increasing production of a POI comprising the steps of: culturing the host cell line of the invention in culture medium under conditions that permit expression of the cgrTtc36 protein and/or the cgrSnord78 ncRNA at a level that increases the cell density (cells/ml) in the cell culture and/or the specific productivity (pg/cell/day) and/or the volumetric productivity (g/L/h) and/or the titer (g/L) as compared to a wild-type host cell, to produce the POI; and recovering the POI from the host cell or culture medium.

According to another aspect of the invention there is provided an expression cassette comprising a nucleic acid encoding at least one of

(ii) the cgrSnord78 ncRNA comprising the nucleotide sequence of SEQ ID 4, or a nucleotide sequence with at least 65% sequence identity to SEQ ID 4, preferably an cgrSnord78 ncRNA consisting of a nucleotide sequence selected from the group consisting of SEQ ID 3, 4, 5, 6 and 7, or a nucleotide sequence with at least 60% sequence identity to any of the foregoing;

and a heterologous expression control sequence operably linked thereto, wherein the expression cassette further comprises a nucleic acid encoding a POI . Such expression cassette is suitably provided for co-expressing at least one of the factors of the invention and the POI. Specifically, said expression cassette is comprised in an expression construct, e.g. an expression vector.

A specific aspect of the invention refers to an expression construct comprising a) a nucleic acid encoding at least one of

(ii) the cgrSnord78 ncRNA comprising the nucleotide sequence of SEQ ID 4, or a nucleotide sequence with at least 65% sequence identity to SEQ ID 4, preferably a cgrSnord78 ncRNA consisting of a nucleotide sequence selected from the group consisting of SEQ ID 3, 4, 5, 6 and 7, or a nucleotide sequence with at least 60% sequence identity to any of the foregoing; and

b) a heterologous expression control sequence operably linked thereto; and c) further comprising a nucleic acid encoding a POL

According to a specific aspect there is further provided a set of expression cassettes comprising

a) an expression cassette comprising a nucleic acid encoding at least one of

b) a heterologous expression control sequence operably linked thereto; and c) an expression cassette comprising a nucleic acid encoding a POL

Such set of expression cassettes may be included in one or more expression vectors, e.g. a set of expression vectors, wherein one expression vector comprises a first expression cassette comprising the nucleic acid encoding the factor of the invention, and a second expression vector comprises the expression cassette comprising the nucleic acid encoding the POL The set of expression vectors is suitably used in a method employing co-transfection of the host cell with the first and the second expression vector. According to a further aspect, there is provided an isolated nucleic acid encoding the cgrTtc36protein comprising the amino acid sequence of SEQ ID 1 , or an amino acid sequence with at least 95%, preferably at least 98% sequence identity.

Yet, according to another aspect there is provided an isolated nucleic acid encoding the cgrSnord78 ncRNA comprising or consisting of the nucleotide sequence of SEQ ID 4 or a nucleotide sequence with at least 65% sequence identity to SEQ ID

4, preferably a nucleotide sequence selected from the group consisting of SEQ ID 3, 4,

5, 6 and 7, or a nucleotide sequence with at least 60% sequence identity to any of the foregoing.

FIGURES

Figure 1 : Amino acid sequence of crgTtc36 (SEQ ID 1 )

Figure 2: Nucleic acid sequence encoding the crgTtc36 protein (SEQ ID 2) Figure 3: Intronic sequence of crgSnord78 (SEQ ID 3): Exon sequences are underlined

Figure 4: Putative sequence of ncRNA cgrSnord78 (SEQ ID 4)

Figure 5: Nucleic acid sequence (full length ncRNA, 2029bp) encoding crgSnord78, carrying all introns and snoRNAs, i.e. cgrSnord44, 47, 77/80, 78 and 79 (SEQ ID 5)

Figure 6: Nucleic acid sequence encoding cgrGasS, splice variant 1 (1237bp), with introns bearing cgrSnord44 and cgrSnord78 (SEQ ID 6)

Figure 7: Nucleic acid sequence encoding cgrGasS, splice variant 2 (788bp), with putative intron bearing cgrSnord44 (SEQ ID 7)

Figure 8: Comparison of aggregation between K20-3/Mock (control) and K20-

3/cgrTtc36. Mock cells are strongly aggregated, in which cgrTtc36 overexpressing K20-3 cells predominantly show single cells and small aggregates up to 10% of maximal aggregation of K20-3/Mock. Both figures were taken of late exponentially grown cells. DETAILED DESCRIPTION OF THE INVENTION

Specific terms as used throughout the specification have the following meaning. The term "cell line" as used herein shall mean an established clone of a particular cell type that has acquired the ability to proliferate over a prolonged period of time. The term "host cell line" refers to a cell line of primary host cells as used for expressing an endogenous or recombinant gene to produce polypeptides, which is herein always understood to include polypeptides and proteins, such as a POI . In some embodiments, the cells have been transfected with heterologous (exogenous) DNA coding for a desired protein and/or containing control sequences that activate expression of linked sequences, whether endogenous or heterologous.

A "production host cell line" or "production cell line" is commonly understood to be a cell line ready-to-use for cultivation in a bioreactor to obtain the product of a production process, such as a POI. The term "mammalian host cell" shall mean any cell of mammalian origin, which may be cultivated to produce a POI. It is well understood that the term does not include human beings.

A production cell line preferably used according to the invention are selected from the group consisting of CHO, PerC6, CAP, HEK, HeLa, NSO, SP2/0, YB2/0, EB66, hybridoma and Jurkat in particular a CHO cell line, such as selected from the group consisting of CHO-K1 , CHO-DG44 and CHO-S cells.

The term "cell density" or "viable cell density"(vcd) as used interchangeably herein shall mean the total number of cells that are surviving in the cell culture medium in a particular volume, generally per ml. The term "cell viability" refers to number of cells, which are alive compared to the total number of cells, both dead and alive, expressed as a percentage. The cell density in a cell culture may be determined by a standard assay, e.g. by haemocytometer cell counting, fluorescent colorimetric viability determination assays (e.g. calcein, MTT, XTT) or instrumental cell counting (e.g. CASY, Coulter Counter). For example, viable cells are determined by their capability of excluding a dye such as trypan blue, eosin or propidiumiodid in a dye exclusion assay. Such assays are commonly known in the art.

Mammalian cells growing in suspension at high densities sometimes aggregate or clump, thereby reducing the productivity of the cells and their use in a production host cell line. Adding d extra n sulphate or commercially available antidumping agents to the culture media could solve that problem. But such additives have the disadvantage of interfering with effective DNA delivery in host cells.

A factor of the invention, in particular the cgrTtc36 protein, was found to advantageously increase the cell density of mammalian host cells in cell culture, e.g. to a level of at least 1.5-fold preferably at least 2.5-fold. It is advantageous to provide such cell densities for effective POI production on a pilot or industrial scale.

Moreover, overexpressing a factor of the invention, specifically the crgTtc36 protein, could achieve the cell density increase and at the same time provide for the low level of aggregates of the host cell or host cell debris, e.g. to a level of aggregates of less than 10% of the aggregate volume, preferably less than 5% to total diminishment of aggregate formation as measured by a standard assay (e.g. optical determination, Coulter Counter).

According to the invention, the cell density in the culture of a mammalian host cell line could be effectively increased avoiding the aggregation of the host cells. This was measured by optical determination or estimation by haemocytometer and plate observation or automatic aggregate distribution measurement (e.g. Coulter Counter). By overexpressing at least one of the factors of the invention, in particular the cgrTtc36 protein, the host cell culture specifically exhibited decreased levels of aggregates in the cell culture medium, e.g. less than 10% of the aggregate volume, preferably less than 5%, to total diminishment of aggregate formation (Figure 1 ).

The terms "cgrTtc36" or "cgrTtc36 protein" as used herein shall refer to a polypeptide or protein comprising the amino acid sequence of SEQ ID 1 , or an amino acid sequence with at least 70% sequence identity to SEQ ID 1 , specifically at least 80%, more specifically at least 90%, 95%, 98% or 99% sequence identity, and specifically encompasses the native amino acid sequence cgrTtc36 (SEQ ID 1 ) and functionally active variants or fragments, further defined herein, and further encompasses analogs or orthologs derived from species other than Cricetulus griseus.

The cgrTtc36 protein may be isolated from a variety of sources, such as from CHO cells or prepared by recombinant and/or synthetic methods. The cgrTtc36 protein may be encoded by a nucleic acid sequence, such as comprising or consisting of SEQ ID 2, or any derivative therefrom, such as codon optimized cDNA.

A functionally active variant of the protein comprising or consisting of an amino acid sequence encoded by the nucleotide sequence of SEQ ID 2 may be suitably used, e.g. a functionally active variant with (point) mutations or with additional amino acids, at the N-terminal and/or at the C-terminal end to prolong the sequence by less than 100 amino acids, specifically less than 75 amino acids, more specifically less than 50 amino acids, more specifically less than 25 amino acids, or else less than 10 amino acids. A functionally active variant may comprise or consist of the amino acid sequence of SEQ ID 1 , or the respective nucleotide sequence, and a tag, e.g. an MBP or HIS (6x-20x) or FLAG (e.g. 3xFLAG) or HPC or GST or STREP II peptide tag. As cgrTtc36 protein comprising the amino acid sequence of SEQ ID 1 , a fusion protein may be specifically employed, wherein the amino acid sequence of SEQ ID 1 is prolonged by additional amino acid residues of another polypeptide or protein.

A "native sequence cgrTtc36" comprises a protein having the same amino acid sequence as a cgrTtc36 derived from nature. Such native sequence cgrTtc36 can be isolated from nature or can be produced by recombinant and/or synthetic means. The term "native sequence cgrTtc36" specifically encompasses naturally-occurring truncated or secreted forms (e.g. an extracellular domain sequence), naturally- occurring variant forms (e.g. alternatively spliced forms) and naturally-occurring allelic variants of the cgrTtc36. According to a specific embodiment, the present invention specifically provides for the overexpression of the cgrTtc36 protein, encompassing the native amino acid sequence of SEQ ID 1 , or a functionally active variant or fragment thereof, specifically a functionally active variant comprising or consisting of an amino acid sequence with at least 70% sequence identity to SEQ ID 1 , specifically at least 80%, more specifically at least 90%, 95%, 98% or 99% sequence identity. In one embodiment of the invention, the native sequence cgrTtc36 is a mature or full-length native sequence cgrTtc36 consisting of the amino acid SEQID 1 .

The terms "cgrSnord78" or "cgrSnord78 ncRNA" as used herein shall refer to a nucleotide sequence comprising the nucleotide sequence of SEQ ID 4, or a nucleotide sequence with at least 65% sequence identity to SEQ ID 4, specifically at least 70%, more specifically at least 75% or at least 80%, or at least 85%, more specifically at least 90%, 95%, 98% or 99% sequence identity, in particular the native intronic- sequence cgrSnord78 (SEQ ID 3) or an effective part thereof including the nucleotide sequence of SEQ ID 4, and further functionally active variants, e.g. comprising or consisting of a nucleotide sequence with at least 65% sequence identity to SEQ ID 4, specifically at least 70%, more specifically at least 75% or at least 80%, or at least 85%, more specifically at least 90%, 95%, 98% or 99% sequence identity, preferably a cgrSnord78 ncRNA consisting of a nucleotide sequence selected from the group consisting of SEQ ID 3, 4, 5, 6 and 7, or a nucleotide sequence with at least 60% sequence identity, specifically at least 65%, more specifically at least 70%, more specifically at least 75% or at least 80%, or at least 85%, more specifically at least 90%, 95%, 98% or 99% sequence identity to any of the foregoing, or fragments, further defined herein, and further encompasses analogs or orthologs derived from species other than Cricetulus griseus.

The cgrSnord78 ncRNA may be isolated from a variety of sources, such as from CHO cells or prepared by recombinant and/or synthetic methods. The cgrSnord78 intron (SEQ ID 3) may provide a nucleic acid sequence, such as SEQ ID 4, or any derivative therefrom. The cgrSnord78 ncRNA (e.g. SEQ ID 3 and/or SEQ ID 4) of the invention may be derived from an intron sequence of the hamster growth arrest specific 5 (Gas5) transcript gene (cgrGasS), which is represented by the nucleotide sequence of SEQ ID 5. The Snords (snoRNA, small nucleolar RNA, C/D box) of such cgrGasS are respective introns with some homologies with analogous sequences derived from different species. It is well understood that the term "cgrSnord78 ncRNA" as used according to the invention also encompasses any non-coding RNA with at least the cgrSnord78 intron of cgrGasS and optionally further intron or other sequences of cgrGasS (SEQ ID 5).

A functionally active variant of the polynucleotide comprising or consisting of the sequence of SEQ ID 4 may be suitably used, e.g. a functionally active variant with mutations or with additional bases, at the 5-prime or 3-prime end to prolong the sequence by e.g. less than 10 bases.

A "native sequence cgrSnord78" comprises a polynucleotide having the same nucleotide sequence as a cgrSnord78 derived from nature. Such native sequence cgrSnord78 can be isolated from nature or can be produced by recombinant and/or synthetic means. The term "native sequence cgrSnord78" specifically encompasses naturally-occurring truncated forms, naturally-occurring variant forms (e.g. alternatively spliced forms) and naturally-occurring allelic variants of the cgrSnord78. According to a specific embodiment, the present invention specifically provides for the overexpression of the cgrSnord78 ncRNA, encompassing the native nucleotide sequence of SEQ ID 4 or a functionally active variant or fragment thereof. In one embodiment of the invention, the native sequence cgrSnord78 is a full-length native intronic sequence cgrSnord78 consisting of the bases SEQ ID 3. The term "ncRNA" as used herein shall refer to a non-coding RNA which is a functional RNA molecule that is primarily not translated into a protein. The DNA sequence from which a non-coding RNA is transcribed is also called a RNA gene. Thus, the DNA encoding the ncRNA factor of the invention is considered a RNA gene and, e.g. comprised in an expression cassette or the host cell line of the invention, providing for the ncRNA overexpression. The ncRNA factor of the invention specifically includes small nucleolar RNA (snoRNAs) of box C/D family (Snord/SNORD). Box C/D snoRNAs are putatively involved in 2'0-methylation of the large 28S ribosomal RNA (rRNA) subunit at position G4593 in metazoa (Tycowski, et al. Current Biology (2004)14 (22)) and/or in alternative splicing.

Herein, the cgrTtc36 protein and cgrSnord78 ncRNA are called "factors of the inventions", and each of the cgrTtc36 protein and cgrSnord78 ncRNA are called "factor of the invention". The respective amino acid and nucleic acid sequences are herein called, "sequences of the invention" and "nucleic acids of the invention", respectively.

The genes and nucleotide sequences of the invention include both the naturally occurring sequences as well as mutant forms. Likewise, the proteins of the invention encompass naturally occurring proteins as well as variations and modified forms thereof. Functionally active variants - when overexpressed in a host cell - will continue to possess the desired activity to increase the cell density in a host cell culture and/or to increase the specific productivity of a host cell.

Preferably, the mutations that will be made in the DNA encoding the variant will not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure.

The deletions, insertions, and substitutions of the sequences encompassed herein are not expected to produce significant changes in the characteristics of the factor. However, when it is difficult to predict the exact effect of the substitution, deletion, or insertion in advance of doing so, one skilled in the art will appreciate that the effect will be evaluated by routine screening assays, e.g. as exemplified herein.

The term "functionally active variant" as used herein, means anything other than a native sequence, which is derived from or relates to an active factor or sequence of the invention. Preferably the invention provides for functionally active variants of the cgrTtc36 protein of the invention, which are comprising or consisting of at least about 70% amino acid sequence identity, preferably at least 80%, more preferably at least 90%, more preferably at least 95% or at least 98% or at least 99% or even at least

99.5%, with the amino acid sequence of SEQ ID 1 .

Preferably, the invention provides for functionally active variants of the cgrSnord78 ncRNA of the invention, which are comprising or consisting of at least about 60% nucelotide sequence identity, preferably at least 65%, more preferred at least 70%, more preferred at least 75%, more preferred at least 80%, more preferred at least 85%, more preferred at least 90%, more preferred at least 95%, more preferred at least 98% or at least 99% or even at least 99.5%, with the nucleotide sequence of SEQ ID 3 or 4.

Such variants of the factors of the invention are considered functionally active, if having substantially the same or improved activity of the native sequence, in particular to mediate the improved production of a POI .

Such variants include, for instance, proteins wherein one or more amino acid residues are added, or deleted, at the N-or C-terminus, as well as within one or more internal domains. Specific functionally active variant as used according to the invention comprise additional amino acids at the N-terminal and/or at the C-terminal end, to prolong a sequence of the invention, e.g. by less than 100 amino acids, specifically less than 75 amino acids, more specifically less than 50 amino acids, more specifically less than 25 amino acids, or else less than 10 amino acids. Further specific functionally active variants may be fusion proteins, wherein a sequence of the invention is prolonged by additional amino acid residues of another polypeptide or protein.

By "fragment" is intended a portion of the nucleotide sequence or a portion of the amino acid sequence. Functionally active fragments of a nucleotide sequence may retain the desired activity of the native polynucleotide and hence - when overexpressed in a host cell - the activity to increase the cell density in a host cell culture and/or to increase the specific productivity and/or to increase the volumetric productivity of a host cell. Such fragments are considered functionally active, if having substantially the same activity of the native sequence.

Fragments of a nucleotide sequence may range from at least 20 nucleotides, preferably at least 100 nucleotides, up to the full-length nucleotide sequence encoding a factor of the invention. Functionally active fragments may comprise at least 50% of the polynucleotide, preferably at least 60, 70, 80 or 90%. A fragment of a protein of the invention specifically will comprise or consist of at least 10 amino acids, specifically at least 25 amino acids, more specifically at least 50 amino acids, more specifically at least 75 amino acids, or at least 100 contiguous amino acids, or up to the total number of amino acids present in a full-length protein of the invention.

A functionally active fragment of a protein of the invention can be prepared by isolating a portion of a nucleotide sequence of the invention, expressing the encoded portion of the protein, e.g. by recombinant expression in vitro or ex vivo, and assessing the activity of the encoded fragment.

A functionally active fragment of a polynucleotide factor (e.g. the crgSnord78 ncRNA) of the invention can be prepared by isolating a portion of a nucleotide sequence of the invention, expressing the fragmented RNA sequence, e.g. by recombinant expression in vitro or ex vivo, and assessing the activity of the fragment.

"Percent (%) amino acid sequence identity" or "Percent (%) nucleotide sequence identity" as used herein with respect to the protein or nucleotide sequences of the invention shall mean the percentage of amino acid or nucleotide residues in a candidate sequence that are identical with the amino acid or nucleotide residues in the protein or ncRNA sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. The % identity values used herein are generated byWU-BLAST-2 and BLAST which was obtained from Altschul et al., Methods in Enzymology, (1996). 266: 460-480 and Altschul et al., J. Mol. Biol. (1990), 215 (3): 403-10, respectively. WU-BLAST-2 uses several search parameters, most of which are set to the default values. The adjustable parameters are set with the following values: overlap span = 1 , overlap fraction = 0. 125, word threshold (T) = 1 1 . The HSP S and HSP S2 parameters are dynamic values and are established by the program itself depending upon the composition of the particular sequence and composition of the particular database against which the sequence of interest is being searched. A % amino acid or nucleotide sequence identity value is determined by the number of matching identical residues divided by the total number of residues of the "longer" sequence in the aligned region. The "longer" sequence is the one having the most actual residues in the aligned region (gaps introduced by WU- Blast-2 to maximize the alignment score are ignored). The term "cell culture medium" or "culture medium" as used herein shall refer to a solution containing nutrients to support cell survival under conditions in which cells can grow and produce a desired protein. A person of ordinary skill in the cell culture art will know without undue experimentation what components make-up the appropriate cell culture medium. Typically, these solutions provide essential and non-essential amino acids, vitamins, carbon energy sources, lipids, and trace elements required by a cell for growth and survival.

The cell culture specifically employed according to the invention may be a serum-free culture, e.g. comprising other components, such as plasma proteins, hormones, and growth factors, as an alternative to serum.

According to the invention, the cell culture may be a Batch culture, continuous culture, or Fed Batch culture. In the present invention, any culture can be employed, but the Fed Batch culture or the continuous culture is preferably employed, and the Fed Batch culture is most preferred.

The Batch culture is a process that allows cells to grow by addition of a small amount of a seed culture solution to the culture medium, without addition of a fresh medium during culturing or without discharge of the culture medium used for the culture.

The continuous culture is a culturing process that involves continuous addition of a fresh medium and continuous discharge of the medium used for the culture. A specific embodiment of the continuous culture is a perfusion culture.

The Fed Batch culture is a method positioned between the Batch culture and the continuous culture and is also called semi-Batch culture. The Fed Batch culture is a culturing process that involves continuous or consecutive addition of a fresh medium without continuous discharge of the medium used for the culture, unlike the continuous culture. The culture medium to be added during the Fed Batch culture is not necessarily the same as that of the culture medium that has been used for the culture. Thus, a different medium or only a specific component may be fed.

The term "expression" or "expression system" refers to nucleic acid molecules containing a desired coding sequence and control sequences in operable linkage, so that hosts transformed or transfected with these sequences are capable of producing the encoded proteins. In order to effect transformation, the expression system may be included in a vector: however, the relevant DNA may also be integrated into the host chromosome. Expression may refer to secreted or non-secreted expression products. The term "expression cassette" as used herein sha!l refer to DNA sequences that are required for the transcription of cloned recombinant nucleotide sequences, i.e. of recombinant genes and the translation of their mRNA in a suitable host organism. Expression cassettes and specifically vectors usually comprise an origin for autonomous replication in the host cells, selectable markers (e.g. an amino acid synthesis gene or a gene conferring resistance to antibiotics such as zeocin or G418 or hygromycin B or puromycin or phleomycin), a number of restriction enzyme cleavage sites, a suitable promoter sequence and a transcription terminator, which components are operably linked together. The terms "plasmid" and "vector" as used herein include autonomously replicating nucleotide sequences as well as genome integrating nucleotide sequences.

The term "control sequences" or "expression control sequences" as used herein shall refer to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism. The control sequences that are suitable for mammalian host cells, for example, include control elements, like promoters, polyadenylation signals, and enhancers. A heterologous control sequence is understood as a sequence other than a sequence naturally associated with and operably linked to another DNA sequence, e.g. a nucleic acid of the invention or a gene of interest encoding a POI.

"Control sequences" are particularly those non-translated regions of an expression cassette or a vector, e.g., enhancers, promoters, 5' and 3' untranslated regions, which interact with host cellular proteins to carry out transcription and translation. Such elements may vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, may be used. Specific initiation signals may also be used to achieve more efficient translation of sequences encoding a factor of the invention. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding a factor of the invention, its initiation codon, and upstream sequences are inserted into the appropriate expression cassette, no additional transcriptional or translational control signals may be needed. However, in cases where only a protein coding sequence, or a fragment thereof, is inserted, heterologous (exogenous) translational control signals, including the ATG initiation codon, are optimally provided. Heterologous or exogenous translational elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of enhancers which are appropriate for the particular cell system that is used. A number of promoters can be used in the practice of the invention, e.g. selected to overexpress any of the factors of the invention and/or to support expression of a POI in the host cell, e.g. constitutive or inducible promoter for expression in mammalian cells, preferably a constitutive promoter.

An expression cassette may be employed with a plurality of restriction sites for insertion of a nucleic acid of the invention and/or a gene of interest encoding a POI. The expression cassette may additionally contain selectable marker genes.

The procedures used to ligate DNA sequences, e.g. providing or coding for the factors of the present invention and/or the POI, a promoter, a terminator and further sequences, respectively, and to insert them into suitable vectors containing the information necessary for integration or host replication, are well known to persons skilled in the art, e.g. described by J. Sambrook et al., "Molecular Cloning 2nd ed.", Cold Spring Harbor Laboratory Press (1989).

In mammalian host cells as used according to the invention, a number of expression systems are advantageously utilized. The preferred expression system may consist of chEF-1 promoter, hEF1 a promoter, CMV, CMV,_e (immediate-early enhancer/promoter)), SV40 promoter, PGK promoter, intronic sequences, the subject of invention, a subsequent IRES (internal ribosomal entry site), a resistance gene (e.g. against zeocin or G418 or hygromycin b or puromycin or phleomycin) and a final polyadenylation sequence (e.g. BGH, SV40) for proper transcription termination. Thereby, the expression of the factors of invention is directly controlled through selection pressure. Controls were applied without employing a factor of invention.

The term "isolated" as used herein with respect to the factors or nucleic acids or proteins of the invention and a POI, respectively, shall have the following meaning.

When used to describe the proteins disclosed herein, the term "isolated" means proteins i.e. polypeptides or proteins that have been identified and separated and/or recovered from cell culture or its natural environment. Contaminant components of cell culture or its natural environment are materials that would typically interfere with the possible uses for the protein, and may include other proteinaceous or non- proteinaceous solutes. In preferred embodiments, the protein will be purified to a certain degree, e.g. at least 90%, preferably at least 95%, more preferred at least 98% or at least 99% purity (w/w)and prepared by at least one purification step. A POI as produced according to the invention specifically is purified and substantially free of cellular material, e.g. as recovered from a culture medium, and includes preparations of the POI having less than about 10%, 5%, 3%, 2% or 1 % (w/w) of contaminating proteins.

An "isolated" nucleic acid molecule, e.g. encoding any of the cgrTtc36 or a POI, or the cgrSnord78 ncRNA, is understood as a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in the natural source of the nucleic acid. An isolated nucleic acid molecule is other than in the form or setting in which it is found in a cell nature. Isolated nucleic acid molecules therefore are distinguished from the nucleic acid molecules as they exist in natural or recombinant cells. However, isolated nucleic acid molecules, such as a molecule encoding a factor of the invention or a POI, include nucleic acid molecules contained in recombinant cells, where the nucleic acid molecule is in a chromosomal location different from that of natural cells.

Preferably, an "isolated" nucleic acid is free of sequences (preferably protein encoding sequences) that naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated nucleic acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, or less than 1 kb of nucleotide sequences that naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived.

The term specifically applies to purified protein compositions or nucleic acid compositions, which contain the purified compound substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.

The term "substantially pure" or "purified" or "substantially free" of contaminants as used herein shall refer to a preparation comprising at least 90% (w/w), preferably at least 95%, 98%, or 99% of a compound, such as a nucleic acid molecule or a factor of the invention or a POI. Purity is typically measured by methods appropriate for the compound (e.g. chromatographic methods, polyacrylamide gel electrophoresis, HPLC analysis, and the like).

The term "operably linked" as used herein shall mean a functional linkage between expression control sequences and a nucleic acid providing an expression product, e.g. encoding a protein to be expressed, or an RNA to be expressed. A nucleic acid is typically understood as being "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, a promoter or enhancer is operably linked to a coding sequence, if it affects the transcription of the sequence; a ribosome binding site is operably linked to a coding sequence, if it is positioned so as to facilitate translation. Generally, "operably linked" means that the DNA sequences being linked are near each other, contiguous and/or in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice. The definition of "operably linked" may also be extended to describe the products of chimeric genes. As such, "operably-linked" may also refer to the linking of two or more peptides/polypeptides by at least one peptide linker.

The present invention specifically provides for the expression cassette where an expression control sequence is operatively linked to a nucleic acid encoding or providing at least one of the factors of the invention, e.g. in a way to overexpress the cgrTtc36 and/or the cgrSnord78 ncRNA. Thereby a host cell transformed with such expression cassette will be able to overexpress a recombinant POI. In a preferred recombinant expression vector at least one of the nucleic acid sequences, the control sequence and/or the coding sequences may be heterologous.

The expression of a factor of the invention and/or a POI may be achieved employing separate expression systems and expression cassettes for each of the proteins to be expressed, or else the same expression system or cassette.

The term "protein of interest" or "POI" as used herein shall refer to one or more chains of amino acids, linked via sequential peptide bonds. As used herein, the term "protein" is synonymous with "polypeptide". In certain embodiments, a POI is a recombinant protein, such as encoded by a heterologous nucleic acid molecule that has been transformed into a host cell. In further embodiments, a POI is a recombinant protein, such as encoded by a nucleic acid molecule that is endogenous to the host cell, where expression of such an endogenous POI is altered by transfecting a host cell with a heterologous nucleic acid molecule that may, for example, contain one or more regulatory sequences and/or encode a factor that enhances expression of the POI. Methods and compositions of the present invention may be used to produce any POI, including, but not limited to proteins having therapeutic, pharmaceutical, industrial, diagnostic, agricultural, and/or any of a variety of other properties that are useful in commercial, experimental and/or other applications. In certain embodiments, proteins produced using methods and/or compositions of the present invention may be processed and/or modified. For example, a protein to be produced in accordance with the present invention may be glycosylated, and e.g. comprise a glycosylation pattern characteristic of the mammalian host cell, such as a CHO glycosylation, or else a modified glycosylation, such as to resemble or to obtain the human type glycosylation.

Specific examples of a POI as produced according to the invention are selected from the group consisting of antibodies and antibody fragments, enzymes, fusion proteins, cytokines and hormones.

The term "recombinant" as used herein shall mean "being prepared by genetic engineering" or "the result of genetic engineering", e.g. specifically employing heterologous sequences incorporated in a recombinant host cell.

Nucleic acid molecules of the present invention are preferably recombinant nucleic acid molecules, so to overexpress the factors of the inventions and optionally the POI. As used herein, "recombinant" refers to an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated segments of nucleic acids by genetic engineering techniques. "Recombinant" also includes reference to a cell or expression cassette, that has been modified by the introduction of a heterologous nucleic acid or a cell derived from a cell so modified, but does not encompass the alteration of the cell or vector by naturally occurring events (e.g., spontaneous mutation, natural transformation/transduction/transposition) such as those occurring without deliberate human intervention.

Thus, a "recombinant host cell" comprises at least one "recombinant nucleic acid". A recombinant host cell specifically comprises an expression cassette, such as a vector or cloning vector, or it has been genetically engineered to contain a recombinant nucleic acid sequence. A "recombinant protein" is produced by expressing a respective recombinant nucleic acid in a host.

The invention specifically refers to the production of a recombinant POI. It is also preferred that the host cell as used according to the invention is produced by recombinant engineering to overexpress at least one of the cgrTtc36 protein and the cgrSnord78 ncRNA, e.g. employing strong promoters, expression enhancers and/or by recombinant expression constructs comprising one or more copies of the nucleic acid molecules of the invention, e.g. more than 5, preferably more than 10, preferably more than 50, preferably more than 100 copies, or by activity modulators, such as cofactors.

The term "overexpression" as used herein with respect to the expression product of a host cell, such as a recombinant protein or a factor of the invention, shall mean the increase of the expression product as obtained in a cell culture, or an expression product obtained within the cell, e.g. in the cytoplasm . By such overexpression an increased level of the factor of the invention may be specifically produced, e.g. an expression level (e.g. a copy number) or an activity level.

For example, a soluble expression product may be determined to be overexpressed by the increased amount in the culture medium, or a membrane-bound product may be determined to be overexpressed by the increased amount in a cell fraction. According to a specific example, the expression product of a factor of the invention may be determined to be overexpressed by the increased amount of the nucleic acid, such as mRNA, e.g. determining the copy number or mRNA copy number.

The term specifically applies to the level or amount that is at least 2 -fold, preferably at least 5-fold, preferably at least 25-fold, preferably at least 100-fold, preferably at least 1 .000-fold, or preferably at least 10.000-fold, as compared to a wild type host cell, specifically expressing at normal levels. Such overexpression may be obtained, e.g. by recombination constructs comprising the nucleic acid sequence of a factor of the invention, such as to add the amount of expression products to endogenous factors, or to employ regulatory elements, such as a promoter, e.g. a promoter stronger than the endogenous promoter, or one or more expression enhancers, which directly or indirectly increase the expression of the endogenous factors.

The term "wild type host cell" specifically includes the wild-type cell of the same type as the recombinant host cell, and the recombinant host cell expressing the factor of the invention at substantially the same level as the wild-type cell, or at a level produced by the host cell without such overexpression, e.g. a recombinant host cell that has been engineered with a vector that does not provide for the expression of the factor of the invention such as control or Mock cells, or in particular a recombinant host cell expressing the POI, but not overexpressing the factor of the invention.

In this regard the wild -type host cell is specifically understood not to overexpress the factor of the invention, specifically to produce a level of the factor of the invention, e.g. an expression level (e.g. a copy number) or an activity level, which is the same as the level of the wild-type cell, or substantially the same, e.g. with a variance of less than +/- 70%, or less than +/- 60%, or less than +/- 50%, or less than +/- 40%, or less than +/- 30%, or less than +/- 20%, or less than +/- 10%, or less than +/- 5%, or less than +/- 2%.

Such overexpression of at least one of the factors of the invention in a host cell may result in the increase of the yield of a recombinant POI produced by the same host cell. The host cell as used according to the invention specifically is recombinantly engineered to overexpress both, the factor of the invention and the POI, herein also referred to as co-overexpression .

Alternative measures to overexpress any of the factors of the invention and/or the POI may be through addition or co-expression of expression enhancers or helper factors. Expression enhancers are e.g. enhancer as well as intronic sequences upstream and downstream of promoter sequences respectively (e.g. chEF-1 promoter, hEF1 a promoter, SV40 promoter, PGK promoter, CMV, CMV,_e (immediate-early enhancer/promoter)) as well as intronic sequences, an IRES (internal ribosomal entry site) and strong polyadenylation sequences (e.g. BGH, SV40) for proper transcription termination. A preferred expression system employs a vector comprising a CMV,_e (immediate-early enhancer/promoter) as well as subsequent intronic sequences, the subject of invention, a subsequent IRES (internal ribosomal entry site), a resistance gene (e.g. against zeocin or G418 or hygromycin b or puromycin or phleomycin) and a final polyadenylation sequence (e.g. BGH, SV40) for proper transcription termination.

The term "cell specific productivity" or "specific productivity" as used herein with respect to a recombinant host cell and a method for the increased production of POI , shall refer to the specific, as in per cell, product expression rate. The specific productivity is generally measured in picograms per cell per day (pg/cell/day).The phrase "expression" refers to the transcription and the translation that occurs within a host cell. Generally, the level of expression relates to the amount of protein being produced by the host cell.

The specific productivity to produce a POI by the host according to the invention preferably provides for an increase of at least 1 .25 fold, more preferably at least 1 .5, at least 1 .75 fold, or at least 2 fold, in some cases an increase of more than 3 fold can be shown, when compared to the expression of the product without overexpressing a factor of the present invention. The term "volumetric productivity" as used herein shall refer to the amount of POI produced per volume of medium per unit of time (g/L/h).

The volumetric productivity to produce a POI by the host according to the invention preferably provides for an increase of at least 1 .25 fold, more preferably at least 1 .5, at least 1 .75 fold, or at least 2 fold, in some cases an increase of more than 3 fold can be shown, when compared to the expression of the product without overexpressing a factor of the present invention.

The POI is preferably expressed by the subject host cell and cell culture according to the invention to produce yields of at least 1 mg/L, preferably at least 10 mg/L, preferably at least 100 mg/L, preferably at least 1 g/L, most preferred at least 5g/L.

The host cell according to the invention is preferably tested for its production capacity or yield by the following test: ELISA, HPLC, or other suitable tests.

The term "substantially the same activity" as used herein with respect to the activity of a variant or fragment of a factor of the invention to increase the cell density of a host cell culture and/or to increase the specific productivity of the host cell in the cell culture, shall refer to the activity as indicated by substantially the same cell density and/or the same expression yield of a POI into the culture medium by the recombinant host cell. For example, a culture medium POI level is obtained by substantially the same activity being at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98% of the POI level in the culture medium as provided by the protein of SEQ ID 1 or SEQ ID 3 or 4, respectively. In another example, a cell density level is obtained by substantially the same activity being at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98% of the cell density level as obtained with the protein and/or ncRNA of SEQ ID 1 or SEQ ID 3 or 4, respectively. Specifically such cell density is obtained in a cell culture comprising a low amount of cell aggregates.

Therefore, the present invention can provide the first time a mammalian cell culture system for optimized productivity to produce a recombinant POI . Improved culture characteristics, such as increased POI titer, increased cell specific or volumetric productivity, increased cell viability, increased viable cell density or decreased accumulation cell aggregates, can effectively contribute to the increased productivity of the cell. Specifically, productivity of the ce!i culture can be enhanced by the increased cell density, in particular avoiding significant formation of cell aggregates, such as aggregates of the host cells optionally with cell debris. More specifically, the specific or volumetric productivity of each cell can be increased by the overexpression of at least one of the factors of the invention. The preferred co-expression of at least one of the factors of the invention and the POI in the same host cell may be provided by suitable recombinant means.

Such advantageous activities of the overexpressed factors of the invention could not be foreseen. Both factors, cgrTtc36 and cgrSnord78, had unknown functions in mammalian host cells or functions that do primarily relate to the improved activities.

Surprisingly, the cgrTtc36 overexpressing cell line according to the present invention, e.g. the hlgG-producing CHO cell line, may reach a cell density up to 150% and a hlgG-titer up to 250% (Viability >80%) respectively compared with the Mock control. Therefore, the specific productivity for cgrTtc36-overexpressing cells may be increased in Batch cultures and may possess a high potential for optimised Fed Batch processes. In addition, cell aggregation is massively reduced by overexpression of cgrTtc36even at high cell densities, which can increase protein yield by increased cell suspension grade. On the other hand, aggregated cells are prone to reduced moistening as well as substrate uptake and therefore prone to expeditiously initiate early steps of apoptosis. Overall, the absence of significant aggregation, as determined by less than 10% compared to cell lines without cgrTtc36 overexpression, may lead to reduced costs by the increased productivity and also in cleaning (adhesive cells and debris) and initial downstream processing (reduced protease activity due to higher viability).

Therefore, the invention advantageously provides techniques for generation of cell lines with ability to grow at high cell density and/or with increased volumetric as well as specific productivity, e.g. by insertion and overexpression of a single element (protein/ncRNA). The subject of the present invention specifically makes use of conventional molecular biological, recombinant DNA techniques, protein biochemical as well as cell culture methods within the skill of the art, unless otherwise depicted.

Specifically the cell culture as employed according to the invention is typically performed under sterile, controlled temperature and atmospheric conditions in adherent culture, e.g., on microcarrier beads, or preferably in suspension culture such as in roller bottles, shake flasks, small scale bioreactors, and/or large-scale bioreactors. For industrial scale POI production, typically bioreactors of at least 1000 L preferably at least 10000 L up to 30000 L are employed.

By the specifically advantageous culture characteristics of the host cells of the invention, and specifically by the improved cell viability properties, the generation time could be significantly increased, e.g. to provide for the high POI expression level, e.g. at least at a level of 1 g/L preferably at least 5 g/L even after about 20 generations of cultivation, preferably at least 30 generations, more preferably at least 40 generations, most preferred of at least 50 generations, e.g. up to 300 generations, preferably in serum-free cell culture.

The recombinant host cell of the invention is surprisingly stable, which is a great advantage when used for industrial scale protein production.

Though a variety of proven mammalian cells may be used as recombinant hosts according to the invention, a specific embodiment employs CHO, preferably in serum- free cell cultures, which are widely used for the expression of recombinant POI .

Suitable growth conditions can vary and depend on the chosen production host and are generally known in the art. Typically, cells are grown at a temperature in the range of about 25°C to about 40°C in an appropriate medium. Suitable growth media as used in the present invention are common commercially prepared media such as complex media with FCS (DME , F12), serum -free media (with hydrolysates) as well as chemically defined media. Other defined or synthetic growth media may also be used and the appropriate medium for growth of the particular host cells known by one skilled in the art. The cell culture media used in the methods of the present invention may be liquid media, preferably serum-free, specifically synthetic media including water, an osmolality regulator, a buffer, an energy source, amino acids including L- glutamine, an inorganic or recombinant iron source and a recombinant or synthetic growth factor and optionally non-ferrous metal ions, vitamins and cofactors. The components of the medium may be primarily inorganic, synthetic or recombinant. Some components may be obtained from complex sources, including a plant, fungal, yeast or bacterial source, provided such sources are not potential sources of infectious pathogens capable of causing disease.

Suitable pH ranges for the cultivation are typically between pH 5.0 to pH 9.0, a pH in the range of 6.0 to 8.0 being preferred. Fermentation of mammalian cells is typically performed under aerobic conditions. The methods described herein may be practiced using either Batch, Fed Batch or continuous processes and that any known mode of cell culture would be suitable according to the invention, e.g. employing techniques as common and well-known in the art, such as described in Thomas D. Brock in Biotechnology: A Textbook of Industrial Microbiology, Second Edition (1989) Sinauer Associates, Inc., Sunderland, Mass.

According to the present invention many different expression cassettes or vectors known in the art may be suitably used. A recombinant vector may be suitable for use in cloning, sequencing, and/or otherwise manipulating the nucleic acid sequence of the invention and a gene of interest encoding a POI , such as by expressing and/or delivering the nucleic acid sequence of choice into a host cell to form a recombinant cell. Such a vector typically contains heterologous nucleic acid sequences, that is nucleic acid sequences that are not naturally found adjacent to nucleic acid sequence to be delivered, although the vector can also contain regulatory nucleic acid sequences (e.g., promoters, untranslated regions) which are naturally found adjacent to nucleic acid molecules that are to be expressed or transferred by the host cells. The vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a plasmid. The vector can be maintained as an extrachromosomal element, e.g. a plasmid, or it can be integrated into the chromosome of the recombinant microorganism. The entire vector can remain in place within a host cell, or under certain conditions, the plasmid DNA can be deleted, leaving behind the nucleic acid molecule of the present invention. The integrated nucleic acid molecule can be under chromosomal promoter control, under native or plasmid promoter control, or under a combination of several promoter controls. Single or multiple copies of the nucleic acid molecule can be integrated into the chromosome. In one embodiment, a recombinant vector of the present invention contains at least one selectable marker for host cells according to the present invention.

Suitable vectors for use in mammalian host cells are e.g. pcDNA3.1 derived. Specifically, a vector selected from the group consisting of mammalian promoter (e.g. CMV, C Vie (immediate-early enhancer/promoter), SV40, PGK, hEF1a, chEF1 ), a multiple cloning site (MCS), polyadenylation sequence (BGHpA, SV40pA), mammalian resistance gene (e.g. DHFR, gluthathionsynthetase or for applying (zeocin or G418 or hygromycin B or puromycin or phleomycin) and bacterial segments (e.g. antibiotic resistance, origin of replication: ori) may be used with CHO host cells. Standard recombinant DNA and molecular cloning techniques may be used according to the invention, specifically to generate the production host cell suitable to produce the recombinant POL Such methods and techniques are e.g. described by Sambrook, J. and Russell, D., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001 ).

In certain embodiments, the transformation procedure used may depend upon the host to be transformed. Methods for introduction of heterologous polynucleotides into mammalian cells are well known in the art and include, but are not limited to, nucleofection, electroporation, dextran-mediated transfection, calcium phosphate precipitation, polybrene mediated transfection, protoplast fusion, encapsulation of the polynucleotide(s) in liposomes, and direct microinjection of the DNA into nuclei.

Following transformation of a suitable mammalian host cell with a nucleotide sequence providing or encoding a factor of the invention and optionally a POI, cells demonstrating stable expression of the recombinant protein are identified and isolated. Stable expression of a recombinant protein is achieved by transfection of appropriate DNA vectors into host cells, followed by selection (stable genome integration) as well as isolation and testing of individual clones demonstrating highest expression of recombinant protein, in accordance with methods known in the art. Based on growth and production in small-scale spinners and larger scale bioreactors, a specific cell line is chosen as the cell line for manufacturing of the recombinant protein.

The clones are typically selected based on production and growth characteristics in various suspension vessels, among the culture characteristics to be determined being cell density and specific productivity. For example, Enzyme Immunoassays (EIAs) may be performed to select the clone that produces the highest cell density, the lowest level of cell aggregates, the highest specific productivity and the highest level of recombinant protein.

The clone with the fastest doubling time that reaches the highest density in culture may be selected for use in commercial production.

Recombinant proteins are typically prepared under highly pure conditions to minimize the risk of contamination from the cell culture. Further purification steps may be employed to remove cell proteins. Large quantities of a purified POI are obtained e.g. by affinity chromatography (binding to specific molecules, e.g. protein A/G for Fc- containing POIs), size-exclusion chromatography (size distribution) and/or ion- exchange chromatography. According to a specific example, CHO-S cells [CHO-K1 cells (ATCC, #CCL- 61™) directly adapted to chemically defined medium (HyClone CM1035, Thermo, Logan, Utah)] were subject to mutagenesis with either ethylmethanesulphonate, ICR- 191 (both Sigma, Munich, Germany) or other relevant DNA alkylating as well as intercalating agents clones with beneficial properties, and mutant clones generated and isolated. This random process allows the generation of various potential clones for high yield biopharmaceutical production.

Using cDNA microarrays, transcriptomic (e.g. NGS by HiSeq 2000) as well as proteomic methods such as DIGE, LC/MS/MS and LC/MS/MALDI-TOF factors of production relevance could be found and subsequently verified by qRT-PCR (e.g. Corbett Rotor-Gene 3000, Qiagen, Hilden, Germany) and Western Blot. Furthermore, by overexpression or suppression in blank or production CHO-S cells verified factors could be validated and proven under real conditions.

By such techniques, the factor cgrTtc36 could be identified to be deregulated in CHO-K1 derived mutants with the ability to grow at high cell densities as well as increased growth rate. Finally, through overexpression of cgrTtc36, the maximal cell density was found to be increased 1 .75-fold in non-productive CHO-S and 1 .5-fold in production cell lines producing a POI, in this case human IgG. The specific productivity was found to be increased to 171 % in Batch and 1 16% infed Batch cultures. The volumetric titer was enhanced during both processes due to increase cell density.

Further, the factor Gas5 could be identified to be deregulated in CHO-K1 derived mutants with the ability to grow at high cell densities as well as increased growth rate. Finally, through overexpression of the CHO-K1 Gas5 (full length, 2029bp) (cgrGasS or cgrGas5₂029b_P) or its splice variants cgrGas5i₂₃₇bp and cgrGas5₇₈8b_P no significant cell increases could be observed in non-productive CHO-S. In addition, overexpression of cgrSnord78 (Alntron of 1237bp and 788 bp cgrGasS variant) lead to no significant cell density changes, but surprisingly to an increased specific productivity, once overexpressed in K20-3 hlgG production cell line, increased to 1.5- fold in Batch and 2-fold in Fed Batch cultures, respectively.

The present invention is described in further detail in the following examples, which are not in any way intended to limit the scope of the invention as claimed. EXAMPLES

Example 1 : Overexpression of cqrTtc36 or cqrSnord78 in b!ank CHO-S cells and in the hlqG production cell line K20-3 a) General methods

Gene delivery can be done through electroporation or nucleofection (AmaxaNucleofector, Lonza, Cologne), by lipofection (delivery by liposome/DNA vehicles) or by delivery of precipitated DNA/M^{2+ 3÷} complexes (M^2+/3+: e.g. Ca²⁺, Sr²*, Mg²⁺, Al³⁺, Cr³⁺). Other useful methods are sonoporation, microinjection, ballistic DNA- delivery or protoplast fusion.

After Gene delivery the cells can be selected by a resistance gene (e.g. against Neomycin, Hygromycin, Puromycin, Zeocin^®) as well as e.g. DHFR or Glutamine synthetase system for approx. 10-21 days. These selection genes can be expressed by a separated promoter (e.g. SV40, CMV, CMV_ie (immediate-early enhancer/promoter), hEF1 a, chEF-1a or directly controlled by the expression of the gene of interest (GOI) with an IRES sequence upstream to the resistance gene.

The Batch and Fed Batch cultures can be performed in Bioreactor filter tubes 50 (TPP, Transadingen, Switzerland) in triplicates (n_bi₀iogicai = 3) under identical conditions.

All cultures as described in the Examples section were performed in CM1035 (HyClone, Thermo, Logan, Utah) supplemented with 5 mM L-Glutamin (Gibco, Darmstadt, Germany) with or without initial feed concentration of 10%. Feeds could be e.g. CD CHO EfficientFeed A and B (used as 50%/50%, Gibco, Darmstadt, Germany) or IS CHO Feed-CD XP (Trinova Biochem GmbH, Giessen, Germany). During a Fed Batch process a feed ratio up to 30-32% can be applied using a mixture of 80% Feed + 40 mM L-glutamine.

The standard cultivation settings are, unless otherwise mentioned: 5-15 ml Medium, 200 rpm, Shaker amplitude (e.g. SK-300, JejoTech, Japan or Ovan Midi, Ovan, Spain) of 30 mm, 4.5-5.0 % CO₂, 36.8 ± 0.5°C, Airation (BFT50): A-D.

Cell counts can be estimated by Neubauer haemocytometer (Brand, Wetheim, Germany) with prior trypsination with Trypsin 0.5%/EDTA (Gibco, Darmstadt, Germany) and erythrosine B (Roth, Karlsruhe Germany) or Trypan Blue (Fluka, Buchs SG, Switzerland) staining or counted by instrumental cell counters (Coulter Counter from Beckman, Krefeld, Germany; CASY, Cedex or Cellavista from Innovatis, Roche, Mannheim, Germany).

hlgG concentrations were measured by ELISA standard procedures. Each samples technical replicates (n=2) were applied.

Titers, volumetric productivities as well as specific productivities of two or more cell lines were compared using the last data sets at viabilities above 75-85% with a maximal difference of ±5% viability between compared data sets. b) Primer and vector of cgrTtc36

Primer

Vector (SEQ ID 10)

GTTTAAACGCGTGCC/ACCATGGGGACTCCAAATGATCAGGCAGTGCTGCAGGCC ATCTTCAACCCCAACACACCATTTGGAGATGTCATTGACTTGGACCTGGAAGAAG CAAAGAAAGAAGATGAAGATGGAGTTTTCCCTCAAGAACAGTTGGAGCAGTCCAA AGCTCTGGAGTTGCAGGGAGTGAGGGCAGCAGAAGCTGGGGACCTCCACACAG CCCTGGAGAAGTTTGGCCAAGCTATCTGCCTGCTACCTGAGAGAGCCTCTGCCTA CAACAACCGGGCTCAAGCCCGGAGGCTCCAGGGGGATGTAGCAGGCGCCCTGG AGGACTTGGAGCGCGCAGTGACGCTGAGCGGCGGCCAGGGTCGCGCCGCCCG CCAGAGCTTCGTGCAGCGCGGACTGCTGGCGCGATTGCAAGGCCGAGACGACG ACGCCCGCAGGGACTTCGAGCAGGCAGCGCGACTGGGCAGCCCGTTCGCGCGG CGCCAGCTGGTGCTGCTCAACCCGTACGCCGCGCTGTGCAACCGCATGCTGGCC GACATGATGGGGCAGCTACGCGCGCCCAGTAACGGGCGCTGACTAGT

Underlined ... restriction sites: 3'-Site (Pmel), 5'-Site (Spel)

Italic ... Kozac sequence

Bold ... Mlu\

Rest ... coding sequence c) Primer and vector of cgrSnord78 Primer

Vector (SEQ ID 13)

CCT AGGTTG AG TAA G TA TTGGAA TCCAA CACCGGCTATAGGCCAG TTT A GA GAGGCATGCCACGCTTGTGGA TGTCAGACATCTGCGTGTGTTGTCTCGTGAATGT G TTA G G TTT A GTTGGACTATGCTCTAATCGGGG TTTTTG TAA TGA TG TTGA TC CAA A TG TC TGA C TGA AAA TAA CA TA CA TG TA GA CA G CAAA TTAAA CA C TGA A GAA TCCT G TGA CAGGCAACTAA GAA TAA TTGGA TGA TGCTTAGCA TA TTTG TAA GAGGTG TTT TC TTTTAA TTC TA G CAA CTGG TTG CA TG TTTG CA TTTG GATGGC TTG C TTTG G TAA GAA GCTAG TTA CTGGGCTCTTGG TTT A TG C TAA TGA GCAGGGTTATTTGCAGTATT A TGCAA CAGTTAA TTCTTAGTACTTAA TTTTTTA TGTCCAA TTTGGCCTTTTAAA TTA CCTA Τ7ΤΤΛΤ™ GGTAGGAGTACTCTAGA

Bold ... Exon

Italic ... Intron

Underlined ... restriction sites: 5'-Site (Avrll), 3'-Site (Xbal) d) FedBatch experiments in CHO-S cells: Overexpression of cgrTtc36

In the following the results of overexpression of cgrTtc36 in CHO-S during a FedBatch culture process are shown (Table 1 ). Table 1 : Fed Batch results of transfected CHO-S. Following, the maximal cell densities and respective cell densities were compared and are bold as well as italic. Feed (80% CD CHO EfficientFeed A/B + 40 mM L-glutamin) was applied as indicated (start: day 4) to the medium (with 10% CD CHO EfficientFeed A/B) for reaching the indicated feed ratio. CHO-S cells with both Mock (vector without cgrTtc36) and cgrTtc36 overexpression were compared. The values are shown in percents regarding the maximum of CHO-S/Mock viable cell density (vcd) and are indicated with the standard deviation (S.D., n_bioiogicai = 3).

Table 2: FedBatch results of transfected CHO-S (repeat). Following, the maximal cell densities and respective cell densities were compared and are bold as well as italic. Feed (80% CD CHO EfficientFeed A/B + 40 mM L-glutamin) was applied as indicated (start: day 4) to the medium (with 10% CD CHO EfficientFeed A/B) for reaching the indicated feed ratio. CHO-S cells with both Mock (vector without cgrTtc36) and cgrTtc36 overexpression were compared. The values are shown in percents regarding the maximum of CHO-S/Mock viable cell density (vcd) and are indicated with the standard deviation (S.D., n_bi₀iogicai = 3). Table 2:

In both FedBatch cultures the cell densities for CHO-S/cgrTtc36 cells were increased (177.8 % ± 5.4 % (Tablel ) and 188.0% ± 4.6%, respectively) in respective to the Mock expressed CHO-S cells. In addition, beside the maximal viable cell density the overall viability was increased in CHO-S/cgrTtc36 cells about one day (Table 2, >80% viability) to 3 days (Table 1 , >70% viability). e) Batch experiments in hlgG production cell clone K20-3 (CHO-S):

Overexpression of cgrTtc36

The most interesting point for biopharmaceutical product formation and production should remain the influence of cgrTtc36 overexpression on titer, volumetric as well as specific productivity. Here, results for cgrTtc36 overexpression in hlgG production CHO-S cell clone K20-3 are shown (Table 3). Table 3: Batch results of Mock or cgrTtc36 overexpressing K20-3 cells. The maximal hlgGtiters≥ 80% were compared and are bold as well as italic. K20-3 cells with both Mock (vector without cgrTtc36) and cgrTtc36 overexpression were compared during unregulated Batch cultivation. The values are shown in percents regarding the value at viability of >80% for K20-3/Mock (Bold) and are indicated with the standard deviation (S.D., n_bl0iogicai = 3). vcd: viable cell density.

Batch K20-3/Mock K20-3/cgrTtc36

integrated normalised normalised Viability normalised normalised Viability time vcd hlgGtiter vcd hlgGtiter

[d] [%] [%] [%] [%] [%] [%]

0.00 10.0 92.3 10.0 97.1

0.77 7.7 ± 0.7 93.6 ± 1.7 12.6 ± 0.5 97.5 ± 1.1

1.94 14.5 ± 0.2 98.0 ± 1.0 24.5 ± 0.7 99.4 ± 0.0

3.04 36.9 ± 3.9 97.1 ± 0.6 56.0 ± 3.5 98.9 ± 0.6

3.97 62.8 ± 6.9 96.7 ± 0.7 90.8 ±2.7 98.9 ± 0.4

5.11 97.3 ± 9.3 38.4 ± 1 .2 94.4 ± 1.6 132.0 ± 1.0 71.2 ± 8.1 97.3 ± 0.4

6.94 100.0 ± 6.9 100.0 ± 84.6 ± 3.2 141 .7 ± 4.2 128.8 ± 96.6 ± 1.7

16.8 15.0

8.00 108.7 ± 8.5 106.3 ± 3.5 78.0 ± 0.5 1 19.0 ± 158.5 ± 90.4 ± 3.6

16.5 1 1.8

9.01 105.7 ± 126.5 ± 75.1 ± 1.5 1 1 1 .0 ± 4.6 169.4 ± 85.7 ± 3.1

1 1 .9 17.4 19.3

10.03 62.0 ± 2.7 124.4 ± 61.9 ± 1.3 92.3 ± 6.4 278.6 ± 68.7 ± 3.3

29.1 73.7

10.82 37.0 ± 5.1 128.2 ± 4.9 39.1 ± 2.1 59.0 ± 1.5 204.9 ± 54.9 ± 0.5

27.2 The hlgGtiters at viabilities greater than 80% are 1 .7-fold increased in cgrTtc36 overexpressing K20-3 cells (for better comparison, data sets with similar viabilities, hence 84.6% and 85.7% were chosen). In addition, viable cell densities (vcd) are 1 .3- fold increased in cgrTtc36 overexpressing K20-3 cells regarding to the maximal viable cell density of Mock expressing K20-3 cells.

The K20-3/cgrTtc36 cells also possess a prolonged culture time at viabilities greater than 80% of additional two days regarding to control cells (Mock).

The size of aggregates determined in the cell culture was estimated and compared to aggregate volume of Mock cell line: cgrTtc36 overexpressing K20-3 cells showed only 0-10% of aggregates compared to Mock overexpressing K20-3 cells (Figure 8). f) FedBatch experiments in hlgG production cell clone K20-3 (CHO-S): Overexpression of crgTtc36

Here, the FedBatch results for cgrTtc36 overexpression in hlgG production CHO-S cell clone K20-3 is shown (Table 4). The mode of this FedBatch process closely followed the manufacturer's recommendations and was not optimised. Table 4: FedBatch results of Mock or cgrTtc36 overexpressing K20-3 cells. The maximal hlgGtiters≥ 80% (the last hlgG value above 80% viability) were compared and are bold as well as italic. Feed (80% IS CHO Feed-CD XP + 40 mM L-glutamin) was applied to the medium (with 10% IS CHO Feed-CD XP) as indicated (start: day 5) for reaching the indicated feed ratio. K20-3 cells with both Mock (vector without cgrTtc36) and cgrTtc36 overexpression were compared. The values are shown in percents regarding the maximal K20-3/Mock viable cell density (vcd) or hlgGtiter at >80% viability and are indicated with the standard deviation (S.D., n biological = 3). vcd: viable cell density. Table 4:

FedBatch K20-3/Mock K20-3/cgrTtc36

integrated Feed normalised normalised Viability normalised normalised Viability time ration vcd hlgGtiter vcd hlgGtiter

[d] [%] [%] [%] [%] [%] [%] [%]

0.00 8.1 95.5 8.1 95.9

1.16 8.0 ± 0.1 94.7 ± 10.4 ± 0.2 97.4 ±

0.4 0.9

2.18 16.0 ± 0.2 97.5 ± 21 .9 ± 0.6 98.5 ±

0.5 0.6

3.14 31.9 ± 1.1 97.8 ± 45.2 ± 0.5 98.8 ±

0.7 0.4

4.11 3.0 61.9 ± 0.7 16.0 ± 1.9 97.0 ± 82.1 ± 2.7 10.6 ± 5.0 97.4 ±

0.7 0.9

6.02 5.9 100.0 ± 40.9 ± 97.1 ± 130.4 ± 31 .4 ± 3.9 99.2 ±

3.2 50.8 0.4 2.9 0.4

7.90 8.7 99.9 ± 4.2 86.5 ± 94.6 ± 140.3 ± 63.0 ± 96.0 ±

19.3 0.8 12.0 20.9 2.3

8.94 12.2 87.2 ± 4.5 100.0 ± 87.1 ± 149.0 ± 84.0 ± 94.8 ±

12.2 1.2 1 1 .4 12.5 2.8

9.95 17.3 65.6 ± 1 1 1.8 ± 66.4 ± 137.7 ± 152.3 ± 93.4 ±

14.4 8.9 3.3 9.8 42.9 1 .2

11.06 22.0 62.9 ± 8.5 125.9 ± 61 .0 ± 1 17.0 ± 188.2 ± 85.1 ±

27.4 3.2 7.4 38.2 7.4

12.09 30.0 129.3 ± 250.2 ± 84.3 ±

9.3 66.2 3.4

14.07 30.0 24.3 ± 199.2 ± 37.2 ±

10.6 18.6 7.6 The hlgG titers at viabilities greater than 80% are 2.5-fold increased in cgrTtc36 overexpressing K20-3 cells and therefore higher increased than in Batch cultures (last data sets >80% viability and with similar viabilities, hence 87.1 % and 84.3% were chosen). The specific productivity in cgrTtc36 overexpressing K20-3 cells (Fed Batch) is 1 .2-fold increased regarding to the Mock expressing cells and even 1 .5-fold increased to the K20-3/cgrTtc36 Batch culture (Table 3) (values >80% viability).

Interestingly, viable cell densities (vcd) are 1 .5-fold increased in cgrTtc36 overexpressing K20-3 cells regarding to the maximal viable cell density of Mock expressing K20-3 cells. Therefore, in Fed Batch culture the titer, volumetric and specific productivity as well as the viable cell density is increased compared to the Mock control.

Again, the duration of viable culture was increased by cgrTtc36 overexpression for more than three days.

The size of aggregates determined in the cell culture was estimated and compared to aggregate volume of Mock cell line: cgrTtc36 overexpressing K20-3 cells showed only 0-10% of compared to Mock overexpressing K20-3 cells (Figure 8). g) Comparison between cgrGasS and cgrSnord78 expression (Fed Batch) Following cgrGasS variants were tested:

cgrGas5_2029bp: full length ncRNA, carries all introns and snoRNAs (cgrSnord44, 47, 77/80, 78 and 79), SEQ ID 5

cgrGas5_1237bp: splice variant 1 , with introns bearing cgrSnord44 and cgrSnord78, SEQ ID 6

cgrGas5_788bp: splice variant 2, with putative intron bearing cgrSnord44

(possibly not actively spliced), SEQ ID 7

The function of Gas5 (or its synonym cgrGas5, for the CHO-derived Gas5 variant) is at least in CHO cells still poorly understood. GAS5 (growth-arrest specific 5, the human homolog of cgrGasS, homologous only in intronic regions: 83%-97% exclusive gaps) is known to be associated in growth arrest and to be suppressed in some tumours with poor prognosis/outcome. Therefore, the overexpression of cgrGasS and its splicing variants were interesting, whether the growth was decreased or even increased (i.e. the cell density), furthermore, since the poor homology between the Gas5/GAS5 species variants. Surprisingly, the cell densities of CHO-S cell lines overexpressing cgrGas5_2029bp, cgrGas5_1237bp and cgrGas5_788bp were not significantly increased or decreased (Table 5). Moreover, the viability course during batch culture was prolonged in following order (regarding data sets at Day 14): CHO- S/cgrGas5_1237bp > CHO-S/cgrGas5_788bp > CHO-S/cgrGas5_2029bp > CHO- S/Mock. The two cell lines possessing either spliced cgrGasS variants CHO- S/cgrGas5_1237bp and CHO-S/cgrGas5_788bp, whose differ only in a single intron possessing cgrSnord78, showed a rather similar viability course. But surprisingly, CHO-S/cgrGas5_1237bp showed a 1.7-fold increased maximal cell density compared to CHO-S/cgrGas5_788bp (maximal cell densities are bond and italic as well, table 5). Therefore, it was assumed that the additional intron possessing cgrSnord78 would be the cause of the slightly higher viability as well as the significant higher maximal cell density between CHO-S/cgrGas5_1237bp and CHO-S/cgrGas5_788bp.

Following the results of overexpression of cgrGas5_2029bp, cgrGas5_1237bp and cgrGas5_788bp in CHO-S during a FedBatch culture process are shown (Table 5).

Table 5: FedBatch results of CHO-S cells transfected with cgrGasS variants and Mock control. Following, maximal cell densities as well as maximal viabilities (day 14) are bold and italic. CHO-S cells with Mock (vector without cgrGasS variants) and cgrGas5_2029bp, cgrGas5_1237bp as well as cgrGas5_788bp overexpression were compared. Feed (80% CD CHO EfficientFeed A/B + 40 mM L-glutamin) was applied as indicated (start: day 4) to the medium (with 10% CD CHO EfficientFeed A/B) for reaching the indicated feed ration. The values are shown in percents regarding the maximum of CHO-S/Mock viable cell density (vcd) and are indicated with the standard deviation (S.D., n_bioiogicai = 2).

Table 5:

Based on these data, it was assumed that cgrSnord78 itself could increase maximal cell density or even other cell parameters. h) Batch experiments in hlgG production cell clone K20-3 (CHO-S): Overexpression of crgSnord78 The most interesting point for biopharmaceutical product formation and production should remain the influence of cgrSnord78 overexpression on titer, volumetric as well as specific productivity. Here, results for cgrSnord78 overexpression in hlgG production CHO-S cell clone K20-3 is shown (Table 6). Table 6: Batch results of Mock or cgrSnord78 overexpressing K20-3 cells. K20- 3 cells with both Mock (vector without cgrSnord78) and cgrSnord78 overexpression were compared during unregulated Batch cultivation. The values are shown in percents regarding cell viability at >80% for K20-3/Mock and are indicated with the standard deviation (S.D., n_bi₀iogicai = 3). vcd: viable cell density.

Batch K20-3/Mock K20-3/cgrSnord78

[d] [%] [%] [%] [%] [%] [%]

0.00 9.2 92.3 9.2 94.9

0.77 7.0 ± 0.7 93.6 ± 1.7 8.7 ± 0.8 96.4 ± 3.3

1.94 13.3 ± 0.2 98.0 ± 1.0 21.5 ± 1.8 99.4 ± 0.1

3.04 34.0 ± 3.6 97.1 ± 0.6 47.4 ± 3.9 98.9 ± 0.5

3.97 57.8 ± 6.4 96.7 ± 0.7 79.5 ± 3.9 98.9 ± 0.4

5.1 1 89.6 ± 8.6 38.4 ± 1 .2 94.4 ± 1.6 70.9 ± 6.1 53.5 ± 3.7 92.5 ± 3.2

6.94 92.0 ± 6.4 100.0 ± 84.6 ± 3.2 64.8 ± 5.2 107.8 ± 5.8 87.1 ± 3.3

16.8

8.00 100.0 ± 7.8 106.3 ± 3.5 78.0 ± 0.5 76.3 ± 1.9 1 19.3 ± 86.4 ± 2.1

14.7

9.01 97.2 ± 1 1.0 126.5 ± 75.1 ± 1.5 63.9 ± 4.8 162.8 ± 80.5 ± 5.9

17.4 24.2

10.03 57.1 ± 2.5 124.4 ± 61.9 ± 1.3 57.8 ± 1.4 186.9 ± 9.1 76.1 ± 1.1

29.1

10.82 34.0 ± 4.7 128.2 ± 4.9 39.1 ± 2.1 1 1.8 ± 0.7 179.2 ± 21 .4 ± 1.2

1 1.4

Surprisingly, the hlgG titers at viabilities greater than 75% are at least 1 .5-fold increased in cgrSnord78 overexpressing K20-3 cells even the maximal cell density is slightly decreased (1 .5-fold for day 10, viability: 76.1 % ± 1 .1 %, compared with Mock at day 9, viability: 75.1 % ± 1 .5%, or 1.5-fold for day 9, viability: 80.5% ± 5.9%, compared with Mock at day 8, viability: 78,0% ± 0,5%, or 1 .6-fold for day 9, viability: 80.5% ± 5.9%, compared with Mock at day 7, viability: 84.6% ± 3.2%, or 1 .8-fold for day 10, viability: 76.1 % ± 1 .1 %, compared with Mock at day 8, viability: 78.0% ± 0.5%). Therefore, the specific productivity for cgrSnord78 overexpressing K20-3 cells at viabilities greater than 75% is at least 1 .4-fold increased compared to Mock expressing K20-3 cells (1 .5-fold for day 10, viability: 76.1 % ± 1 .1 %, compared with Mock at day 9, viability: 75.1 % ± 1 .5%, or 1 .4-fold for day 9, viability: 80.5% ± 5.9%, compared with Mock at day 8, viability: 78,0% ± 0,5%, or 1.4-fold for day 10, viability: 76.1 % ± 1 .1 %, compared with Mock at day 8, viability: 78.0% ± 0.5%).

The K20-3/cgrSnord78 cells also possess a prolonged culture time at viabilities greater than 75% of additional one day regarding to control cells (Mock). i) FedBatch experiments in hlgG production cell clone K20-3 (CHO-S): Overexpression of cgrSnord78 Here, the FedBatch results for cgrSnord78 overexpression in hlgG production

CHO-S cell clone K20-3 is shown (Table 7). The mode of this FedBatch process closely followed the manufacturer's recommendations and was not optimised.

Table 7: FedBatch results of Mock or cgrSnord78 overexpressing K20-3 cells. Following, maximal cell densities as well as the hlgG titer at viabilities greater than 80% are bold and italic. In addition, the hlgG titer at viabilities greater than 90% are underlined, bold and italic. K20-3 cells with both Mock (vector without cgrSnord78) and cgrSnord78 overexpression were compared. Feed (80% IS CHO Feed-CD XP + 40 mM L-glutamin) was applied to the medium (with 10% IS CHO Feed -CD XP) as indicated (start: day 5) for reaching the indicated feed ration. The values are shown in percents regarding the maximal K20-3/Mock viable cell density (vcd) or hlgG titer at >80% viability and are indicated with the standard deviation (S.D., n_bioiogicai = 3). vcd: viable cell density. Table 7:

FedBatch K20-3/ ock K20-3/cgrSnord78

integrated integrated normalised normalised Viability normalised normalised Viability time time vcd hlgGtiter vcd hlgGtiter

[d] [d] [%] [%] [%] [%] [%] [%]

0.00 0.00 8.1 95.5 8.1 94.0

1.16 1.16 8.0 ±0.1 94.7 ± 0.4 7.4 ±0.1 92.7 ± 0.4

2.18 2.18 16.0 ± 0.2 97.5 ± 0.5 16.7 ± 0.3 96.9 ± 0.4

3.14 3.14 31.9 ± 1.1 97.8 ± 0.7 32.0 ± 0.5 98.5 ± 0.0

4.11 4.11 61.9 ± 0.7 16.0 ± 1.9 97.0 ± 0.7 62.0 ± 1.2 30.7 ± 98.7 ± 0.4

14.1

6.02 6.02 100.0 ± 40.9 ± 97.1 ±0.4 101.0 ± 54.4 ± 99.2 ± 0.0

3.2 50.8 4.9 12.8

7.90 7.90 99.9 ±4.2 86.5 ± 94.6 ± 0.8 122.3 ± 135.2 ± 97.0 ± 0.3

19.3 4.2 24.2

8.94 8.94 87.2 ±4.5 100.0 ± 87.1 ± 1.2 108.9 ± 242.7 ± 94.2 ± 1.6

12.2 9.3 .

9.95 9.95 65.6 ± 111.8 ± 66.4 ±3.3 78.6 ± 242.5 ± 86.1 ± 2.5

14.4 8.9 14.7 52.9

11.06 11.06 62.9 ± 8.5 125.9 ± 61.0 ±3.2 74.5 ± 6.9 187.0 ± 77.1 ± 7.1

27.4 49.6

12.09 12.09 44.5 ± 3.5 131.8 ± 52.9 ± 5.2

29.4

Surprisingly, the hlgG titers at viabilities greater than 80% are 2.4-fold increased in cgrSnord78 overexpressing K20-3 cells (K20-3/cgrSnord78 at day 10, viability: 86.1 % ± 2.5%, compared with Mock at day 9, viability: 87.1 % ± 1 .2%) and even more increased (2.8-fold) at viabilities greater than 90% (K20-3/cgrSnord78 at day 9, viability: 94.2% ± 1 .6%, compared with Mock at day 8, viability: 94.6% ± 0.8%).

The specific productivity in cgrSnord78 overexpressing K20-3 cells (FedBatch) is 1 .9-fold increased for viabilities greater than 80% or.2.1 -fold increased for viabilities greater than 90% compared to the Mock expressing cells and even between 1 .3-fold to 1 .5-fold increased compared to the K20-3/cgrSnord78 Batch culture (Table 6).

Interestingly, at comparable viabilities greater than 80%, which are usually taken for culture harvesting, the hlgG titer between FedBatch (Table 7) and Batch (Table 6) for K20-3/cgrSnord78 is 2.6-fold increased (FedBatch at viability of 86.1 % ± 2.5% against Batch at 86,4% ± 2,1 %) or for K20-3/Mock 1 .3-fold increased, respectively (FedBatch at viability of 87.1 % ± 1 .2% against Batch at 84,6% ± 3,2%). Therefore, besides the higher overall hlgG titer and productivity K20-3/cgrSnord78 cells reach compared to Mock control cells, the potential for increasing POI titer is 2 -fold or higher enhanced applied in FedBatch culture.

In addition, viable cell densities (vcd) are 1 .2-fold increased in cgrSnord78 overexpressing K20-3 cells compared to the maximal viable cell density of Mock expressing K20-3 cells.

Taken together, in FedBatch culture the titer and specific productivity as well as the viable cell density is increased compared to the Mock control. Again, the duration of viable culture was increased by cgrSnord78 overexpression for one day.

Claims

1 . A method for the production of a POI comprising:

b) introducing a nucleic acid encoding the POI into the host cell of step a);

2. The method according to claim 1 , wherein said host cell is cultured under conditions that induce increased expression of the cgrTtc36 protein and/or the cgrSnord78 ncRNA as compared to a wild-type host cell.

3. The method according to any of claims 1 or 2, wherein said host cell expresses the cgrTtc36 protein and/or the cgrSnord78 ncRNAat a level that increases the cell density (cells/ml) in the cell culture and/or the titer (g/L) and/or the specific productivity (pg/cell/day) and/or the volumetric productivity (g/L/h) to produce the POI.

4. The method according to any of claims 1 to 3, comprising isolation and optionally purification of the POI.

5. The method according to any of claims 1 to 4, wherein the POI is a therapeutically or industrially relevant protein, preferably selected from the group consisting of antibodies and antibody fragments, enzymes, fusion proteins, cytokines, growth factors, clotting factors, hormones, pharmaceutical drug substances and vaccines.

6. The method according to any of claims 1 to 5, wherein said host cell is a production cell line of cells selected from the group consisting of CHO, PerC6, CAP, HEK, HeLa, NSO, SP2/0, YB2/0, EB66, hybridoma and Jurkat.

7. The method according to claim 6, wherein the host cell is obtained from CHO-

K1 , CHO-DG44 or CHO-Scells.

8. A host cell line for the production of a POI, comprising an expression construct expressing at least one of

(ii) the cgrSnord78 ncRNA comprising the nucleotide sequence SEQ ID 4, or a nucleotide sequence with at least 65% sequence identity to SEQ ID 4, preferably a cgrSnord78 ncRNA consisting of a nucleotide sequence selected from the group consisting of SEQ ID 3, 4, 5, 6 and 7, or a nucleotide sequence with at least 60% sequence identity to any of the foregoing,

and further comprising a nucleic acid encoding a POI.

9. The host cell line according to claim 8, wherein the host cell comprises a heterologous expression control sequence operably linked to a nucleic acid encoding the cgrTtc36 protein and/or the cgrSnord78 ncRNAand/or the POI.

10. The host cell line according to claim 9, selected from the group consisting of CHO, PerC-6, CAP, HEK, HeLa, NSO, SP2/0, hybridoma and Jurkat cells, preferably CHO-K1 , CHO-DG44 or CHO-S cells.

1 1 . A method of increasing production of a POI comprising the steps of: culturing the host cell line of any of claims 8 to 10 in culture medium under conditions that permit expression of the cgrTtc36 protein and/or the cgrSnord78 ncRNA at a level that increases the cell density (cells/ml) in the cell culture and/or the titer (g/L) and/or the specific productivity (pg/cell/day) and/or the volumetric productivity (g/L/h) as compared to the culture of a wild-type host cell, to produce the POI; and recovering the POI from the host cell or culture medium.

12. Expression cassette or expression construct comprising

a) a nucleic acid encoding at least one of

b) a heterologous expression control sequence operably linked thereto; and c) further comprising a nucleic acid encoding a POI.

13. Set of expression cassettes comprising

a) an expression cassette comprising a nucleic acid encoding at least one of (i) the cgrTtc36 protein comprising the amino acid sequence of SEQ ID 1 , or an amino acid sequence with at least 70% sequence identity to SEQ ID 1 , or

b) a heterologous expression control sequence operably linked thereto; and c) an expression cassette comprising a nucleic acid encoding a POI.

14. An isolated nucleic acid encoding the cgrTtc36 protein comprising the amino acid sequence of SEQ ID 1 , or an amino acid sequence with at least 95%, preferably at least 98% sequence identity.