WO2025110412A1 - 식물에서 감수분열의 염색체 교차 재조합을 증가시키는 j3 샤페론 및 이의 용도 - Google Patents

식물에서 감수분열의 염색체 교차 재조합을 증가시키는 j3 샤페론 및 이의 용도 Download PDF

Info

Publication number
WO2025110412A1
WO2025110412A1 PCT/KR2024/012205 KR2024012205W WO2025110412A1 WO 2025110412 A1 WO2025110412 A1 WO 2025110412A1 KR 2024012205 W KR2024012205 W KR 2024012205W WO 2025110412 A1 WO2025110412 A1 WO 2025110412A1
Authority
WO
WIPO (PCT)
Prior art keywords
crossover
protein
chaperone
plant
function
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
PCT/KR2024/012205
Other languages
English (en)
French (fr)
Inventor
최규하
김재일
김희진
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
POSTECH Research and Business Development Foundation
Original Assignee
POSTECH Research and Business Development Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by POSTECH Research and Business Development Foundation filed Critical POSTECH Research and Business Development Foundation
Publication of WO2025110412A1 publication Critical patent/WO2025110412A1/ko
Anticipated expiration legal-status Critical
Pending legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/06—Processes for producing mutations, e.g. treatment with chemicals or with radiation
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/10—Seeds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]

Definitions

  • the present invention relates to a J3 chaperone for increasing chromosome crossover recombination in meiosis in plants and uses thereof, and more particularly, to a method for increasing the number of crossover recombination of homologous chromosomes during meiosis in plant cells by inhibiting the expression of a J3 protein derived from Arabidopsis thaliana, inducing a loss-of-function mutant by inserting T-DNA into a J3 protein coding gene, or inducing a loss-of-function mutant of a wild-type J3 endogenous protein by expressing a J3 protein dominant-negative mutant gene.
  • This invention was carried out with the support of the Rural Development Administration, Samsung Future Technology Foundation, and Seo Kyung-bae Science Foundation (Project No. PJ013370012020, SSTF-BA2202-09, and SUHF-17020079).
  • Meiotic recombination is initiated by the formation of a programmed DNA double-strand break (DSB) that is repaired using a homologous chromosome as a template to produce a crossover or noncrossover.
  • DSB DNA double-strand break
  • class I and class II Two pathways for crossover have been identified: class I and class II.
  • the class I pathway promotes most crossovers and is mediated by the crossover-promoting ZMM proteins (Zip1-4, Mer3, and Msh4-5) and the MLH1-MLH3 heterodimeric endonuclease (MutL ⁇ ).
  • ZMM proteins stabilize recombination intermediates such as the displacement loop (D-loop) and double Holliday junctions and recruit MutL ⁇ to form crossovers.
  • Crossovers via the class I pathway are characterized by interference, which inhibits the formation of additional crossovers at adjacent distances.
  • crossovers via the class II pathway are incoherent and involve the endonuclease MUS81.
  • Incoherent crossovers are limited by several crossover-repressing factors, including the plant FANCM and RECQ4A/4B helicases.
  • ZMMs the ZIP3/HEI10 (Human Enhancer of Invasion-10) family of SUMO and/or ubiquitin E3 ligases play a key role in regulating the number and location of interference-sensitive crossovers in a level-dependent manner.
  • HEI10 begins to localize on early leptotene chromosomes and gradually increases along the synaptic complex (SC), a protein structure that forms between homologous chromosomes.
  • SC synaptic complex
  • HEI10 E3 ligases diffuse along the SC and localize as small dots in the synapsed early pachytene, together with hundreds of recombination intermediates. Similar to biomolecular condensates that exhibit phase separation in the liquid phase, HEI10 proteins localize to defined crossover sites in one or a few larger condensates at the expense of smaller condensates in late pachytene. To explain these dynamics, control of crossing over number, and interference, a diffusion-mediated HEI10 coarsening model has been proposed. Mutants lacking the function of the ZYP1 protein, which organizes SC cross-filaments in Arabidopsis, exhibit a loss of interference and an increase in class I crossing over.
  • HORMA domain protein of the SC axis component is required to promote class I crossing over and mediate interference.
  • Cross-over interference is limited by HCR1 (HIGH CROSSOVER RATE1, PROTEIN PHOSPHATASE X 1), which potentially dephosphorylates HEI10 in Arabidopsis.
  • HCR1 HGH CROSSOVER RATE1, PROTEIN PHOSPHATASE X 1
  • posttranslational modifications of crossover-promoting factors such as phosphorylation, SUMOylation, ubiquitination, and proteasomal proteolysis, are involved in controlling meiotic recombination in Saccharomyces cerevisiae , Schizosaccharomyces pombe , Caenorhabditis elegans , and mouse.
  • the molecular mechanisms mediating the proteolysis and dynamics of HEI10, a key crossover-promoting factor among plant crossover regulators are largely unknown.
  • chromosome recombination events that occur during meiosis is a major obstacle in terms of time and cost for the combination of useful traits in breeding.
  • a new crossover suppressor was discovered through genetic screening using an Arabidopsis thaliana fluorescent seed crossover measurement system.
  • Korean Patent No. 2410996 discloses 'Protein phosphatase 4 complex for increasing chromosome crossover recombination in meiosis in plant cells and its use', but does not describe 'J3 chaperone for increasing chromosome crossover recombination in meiosis in plants and its use' of the present invention.
  • the present invention was derived from the above-mentioned needs, and the present inventors screened an Arabidopsis fluorescent seed reporter line treated with EMS (Ethyl methanesulfonate) to obtain an hcr3 (high crossover rate 3 ) mutant having an increased crossover rate compared to the wild type, and confirmed through SHOREmap analysis that the HCR3 is a gene encoding the J3 chaperone, which is a member of the HSP40 protein family conserved in all eukaryotes including bacteria and plants.
  • EMS Ethyl methanesulfonate
  • J3 of the present invention is a novel crossover suppressor that regulates crossover regulation factors at the protein level and can increase the crossover rate through loss-of-function or dominant-negative mutations.
  • the present invention provides a method for increasing the number of crossover recombination of homologous chromosomes during meiosis of a plant cell, comprising a step of inhibiting the function of the J3 chaperone protein.
  • the present invention provides a method for producing a transgenic plant having an increased number of crossover recombination of homologous chromosomes compared to a wild type, the method comprising the steps of inhibiting the expression of a J3 chaperone protein coding gene in a plant cell, inserting T-DNA into a J3 chaperone protein coding gene to induce a loss-of-function mutant, or increasing the expression of a J3 chaperone dominant-negative mutant protein coding gene.
  • the present invention provides a transgenic plant having an increased number of crossover recombination of homologous chromosomes compared to a wild type produced by the above method, and a transformed seed thereof.
  • the present invention provides a composition for increasing the number of homologous chromosome crossover recombination during meiosis of a plant cell, comprising as an active ingredient a substance that inhibits the function of the J3 chaperone protein.
  • the Arabidopsis J3 gene according to the present invention functions as a meiotic crossover suppressor gene, the number of crossovers per chromosome increases when a loss-of-function mutation is induced or a dominant-negative mutation is expressed. Even if a crop has two or more homologous genes of J3 , the number of crossovers can be effectively increased by inhibiting the normal function of the J3 homologous genes without inducing loss-of-function mutations of all the J3 homologous genes by expressing a dominant-negative mutation. Since the increase in the number of crossovers can shorten the period of crossbreeding and accelerate the creation of a quantitative trait locus map, the method of the present invention can be usefully utilized in the agricultural field.
  • Figure 1 shows the process of obtaining Arabidopsis hcr3 (high crossover rate 3) mutants with increased crossover rate through genetic screening using a fluorescent seed reporter line ( 420 GR/GR ).
  • Figure 1a shows the process of creating a screening population by treating 420 GR/++ plants with EMS (Ethyl-methane-sulfonate).
  • Figure 1b is a representative picture of the fluorescent seed line ( 420 GR/++ ) used for screening for crossover-increasing mutants and the analysis result using the image analysis program CellProfiler.
  • Figure 1c is the result of measuring the crossover frequency of hcr3 /+, hcr3 , and hcr3 BC 1 F 2.
  • GR/GR is a fluorescent tagged line (FTL) in which green (eGFP) and red (dsRed) markers are located at an interval of 5.1 Mbp in the sub-telomeric region of chromosome 3, and its genetic background is Columbia (Col).
  • Figure 1d shows the location of the hcr3 mutation confirmed by sequencing the genome of 50 BC 1 F 2 individuals, showing that it is located on chromosome 3.
  • Figure 2a shows that the hcr3 mutation occurred in the 4th exon of the At3g44110 gene encoding the J3 chaperone (G ⁇ A).
  • Figure 2b shows the evolutionarily well-conserved J3 phylogenetic tree.
  • Figure 2c shows the results confirming that the increased crossover rate was restored to the wild-type level when J3 genomic DNA was introduced into the j3-1 mutant.
  • Figure 2d shows that the crossover rate increased when hcr3 was introduced into the wild type, showing that the hcr3 mutation has dominant-negative properties.
  • Figure 3a shows the positions of fluorescent seed and pollen reporter lines used for crosses.
  • Figure 3b shows that the number of crosses increased in the crosses between hcr3 and various fluorescent seed reporter lines compared to the crosses with the wild type.
  • Figure 3c shows that the number of crosses increased in the crosses between hcr3 and various fluorescent pollen cross reporter lines compared to the crosses with the wild type.
  • Figure 3d shows that the female-specific crossover rate increased in the 420 fluorescent seed reporter line.
  • Figure 4 shows the increase in genome-wide crossover when the hcr3 dominant-negative mutation was ectopically expressed in the hybrid generation.
  • Figure 4a is the preparation process of F 2 plants for genotyping-by-sequencing (GBS) analysis for creating a crossover map.
  • Figure 4b shows that crossovers increased in meiosis of J3:J3 G155R Col/Ler hybrid F 1.
  • Figure 4c shows that the average crossovers per individual of J3:J3 G155R Col/Ler hybrid F 2 increased to 15.1 compared to 7.7 in the wild type.
  • Figure 4d shows that the increase in crossovers of J3:J3 G155R Col/Ler increases from the centromere to the telomere region.
  • Figures 4e and 4f show that the crossover rates in each sex increased by about 2-fold.
  • Figures 4g and 4h show that an additional increase in the number of crossovers occurs when the J3 dominant-negative mutation in recq4a / b is expressed, compared to the recq4a/ b loss-of-function mutation.
  • Figures 4i and 4j show that the pattern of increased crossover rates of hcr3 is similar to that when HEI10 is overexpressed.
  • Figure 5a shows that there is no significant change in chromosome behavior during meiosis in hcr3
  • Figures 5b and 5c show that the number of RAD51, which marks DSB sites, is unchanged
  • Figure 5d shows that the axis element ASY1 is unchanged in hcr3 and J3 loss-of-function mutants.
  • Figures 6a and 6b show that the number of MLH1 foci overlapping the intersection site is increased in hcr3 .
  • Figures 6c and 6d show that the number of HEI10 foci in the late anaphase is increased by about 30% in hcr3 compared to the wild type.
  • the distance between two HEI10 foci on one chromosome is closer in hcr3 than in the wild type.
  • Figure 6e shows that the GBS analysis results show that the distance between two intersection points on one chromosome is close to a random distribution in hcr3 , which weakens the interference effect.
  • Figure 7a shows that when hcr3 is double mutated with fancm , crossovers increase further than in the single mutants.
  • the results show that when hcr3 is double mutated with zip4 or hei10 , the crossover rate is the same as in the zip4 or hei10 single mutants.
  • Figure 7b shows that in the hcr3 and recq4a/b double mutants, crossovers increase further than in the single mutants.
  • Figure 7c shows that when hcr3 is double mutated with mus81 , the decrease in the crossover rate with respect to the hcr3 single mutant is similar to the difference in the crossover rates between the wild type and the mus81 single mutant.
  • Figure 7d shows that at high temperature (28°C), a greater increase in the crossover rate occurs in hcr3 compared to the wild type.
  • Figure 7e shows the results of confirming that in the double and triple mutants of hcr3 , class I crossover suppressors identified in previous studies, hcr1 and hcr2 increase further than in the single mutants.
  • Figure 7f shows the results of RNA base sequence analysis graphically represented as a heat map.
  • Figures 8a and 8b show the results of a Western blot experiment confirming that the protein levels of HEI10-HA, PTD-HA, and MSH5-HA proteins were higher in the hcr3 and j3-1 genotypes when expressed in Arabidopsis protoplasts.
  • Figures 8c and 8d show the results of a Western blot experiment confirming that the HEI10-Myc, PTD-Myc, and MSH5-Myc proteins were detected in higher amounts in flower buds containing meiotic progenitor cells when co-expressed with the J3 dominant-negative mutant than in the J3 wild type.
  • Figures 8e and 8f show the results of a Western blot confirming that the HEI10 protein was present in higher amounts in the hcr3 , j3-1 , and J3:J3 G155R genotypes than in the wild type in flower buds containing meiotic progenitor cells.
  • the present invention provides a method for increasing the number of crossover recombination of homologous chromosomes during meiosis of a plant cell, comprising a step of inhibiting the function of the J3 chaperone protein.
  • Homologous chromosomes are chromosomes that are almost the same size and shape, inherited from each parent, that pair up in the cell during meiosis. These homologous chromosomes undergo a crossover, where some of the chromosomes of the homologous chromosomes are exchanged (recombined) during the prophase of meiosis I, and this crossover of homologous chromosomes contributes to the formation of genetic diversity.
  • the inhibition of the function of the J3 chaperone protein may be achieved by, but is not limited to, inhibiting the expression of a J3 chaperone protein coding gene, inducing a loss-of-function mutant by inserting T-DNA into the J3 chaperone protein coding gene, or increasing the expression of a J3 chaperone dominant-negative mutant protein coding gene.
  • the expression inhibition of the J3 protein coding gene of the present invention can be performed by inserting the J3 protein coding gene into a VIGS (virus-induced gene silencing) vector or an RNAi vector, which is an expression inhibition vector, and more preferably, by transforming a plant cell with a recombinant vector that specifically mediates silencing of the J3 protein coding gene at the meiotic stage, but is not limited thereto.
  • VIGS virus-induced gene silencing
  • RNAi vector which is an expression inhibition vector
  • the J3 chaperone protein may be composed of an amino acid sequence of SEQ ID NO: 3, and the J3 chaperone dominant-negative mutant protein may be one in which the 155th amino acid in the amino acid sequence of SEQ ID NO: 3 is substituted from glycine to arginine, but is not limited thereto.
  • mutant-negative mutation in the present invention refers to a mutation that exhibits a mutant trait by inhibiting the normal function of a wild-type allele product through antagonism. Such mutations usually produce gene products with altered molecular functions and exhibit a dominant or semi-dominant phenotype relative to the wild-type allele. Despite the presence of a wild-type allele, it exhibits the characteristics of a dominant effect by leading the expression of the mutant trait, and it is characterized by exhibiting the characteristics of a negative effect in that it exhibits a loss-of-function phenotype.
  • the expression of the J3 chaperone dominant negative mutant protein coding gene may be regulated by a constitutive promoter or a meiosis-specific promoter, but is not limited thereto.
  • the meiosis-specific promoter may be, but is not limited to, a SPO11-1 (SPORULATION 11-1) promoter or a DMC1 (DNA meiotic recombinase 1) promoter.
  • the scope of the J3 chaperone protein includes a protein having an amino acid sequence represented by SEQ ID NO: 3 and a functional equivalent of the protein.
  • the term "functional equivalent” refers to a protein having at least 70%, preferably 80%, more preferably 90%, and even more preferably 95% sequence homology with the amino acid sequence represented by SEQ ID NO: 3 as a result of addition, substitution, or deletion of amino acids, and exhibiting substantially the same physiological activity as the protein represented by SEQ ID NO: 3.
  • substantially the same physiological activity refers to an activity that increases the number of crossover recombination of homologous chromosomes during meiosis of a plant cell compared to a wild type, i.e., a non-transformant, through functional inhibition of the J3 protein.
  • the present invention provides a gene encoding the J3 protein.
  • the gene encoding the J3 protein of the present invention may include a base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2.
  • a homolog of the base sequence is included within the scope of the present invention.
  • the gene may include a base sequence having a sequence homology of 70% or more, more preferably 80% or more, even more preferably 90% or more, and most preferably 95% or more, with the base sequence of SEQ ID NO: 1 or SEQ ID NO: 2, respectively.
  • the "% of sequence homology" for a polynucleotide is determined by comparing two optimally aligned sequences with a comparison region, and a portion of the polynucleotide sequence in the comparison region may include additions or deletions (i.e., gaps) compared to a reference sequence for the optimal alignment of the two sequences (which does not include additions or deletions).
  • the method for increasing the number of crossover recombination according to the present invention can additionally inhibit the expression or function of one or more crossover suppressor proteins simultaneously with the inhibition of the function of the J3 chaperone protein, but is not limited thereto.
  • the crossover suppressor proteins can be, but are not limited to, FANCM (Fanconi anemia group M protein), RECQ4A (ATP-dependent DNA helicase Q-like 4A), RECQ4B, FIGL1 (AAA-ATPase FIDGETIN-LIKE 1), HCR1 (HIGH CROSSOVER RATE 1/PROTEIN PHOSPHATASE X1), or HCR2 (HIGH CROSSOVER RATE 2/HEAT SHOCK FACTOR BINDING PROTEIN).
  • crossing-over suppressor protein can further increase the number of crossing-over recombination of homologous chromosomes during meiosis in plant cells.
  • the present invention also provides a method for producing a transgenic plant having an increased number of crossover recombination of homologous chromosomes compared to a wild type, the method comprising the steps of inhibiting the expression of a J3 chaperone protein coding gene in a plant cell, inserting T-DNA into a J3 chaperone protein coding gene to induce a loss-of-function mutant, or increasing the expression of a J3 chaperone dominant-negative mutant protein coding gene.
  • the J3 chaperone protein is composed of an amino acid sequence of sequence number 3
  • the J3 chaperone dominant-negative mutant protein may be one in which the 155th amino acid in the amino acid sequence of sequence number 3 is substituted from glycine to arginine.
  • the inhibition of expression of the J3 chaperone protein coding gene or the increase in expression of the J3 chaperone dominant-negative mutant protein coding gene is not limited thereto, and preferably, expression may be specifically regulated at the meiotic stage, but is not limited thereto.
  • recombinant in the present invention refers to a cell which replicates a heterologous nucleic acid, expresses said nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid.
  • a recombinant cell may express a gene or gene fragment not found in the native form of said cell, either in sense or antisense form.
  • a recombinant cell may also express a gene found in the native cell, but which gene has been modified and reintroduced into the cell by artificial means.
  • the term "recombinant expression vector” means a bacterial plasmid, a phage, a yeast plasmid, a plant cell virus, a mammalian cell virus, or other vector.
  • any plasmid or vector can be used as long as it can replicate and stabilize in the host.
  • Important characteristics of the expression vector are that it has an origin of replication, a promoter, a marker gene, and a translation control element.
  • Expression vectors containing suitable transcription/translation control signals can be constructed by methods known to those skilled in the art. Such methods include in vitro recombinant DNA techniques, DNA synthesis techniques, and in vivo recombinant techniques.
  • the DNA sequence can be effectively linked to a suitable promoter in the expression vector to drive mRNA synthesis.
  • the expression vector can also contain a ribosome binding site as a translation initiation site and a transcription terminator.
  • VIGS Virus-induced gene silencing
  • PTGS Post-transcriptional gene silencing
  • the VIGS vector can be used as a transient expression vector that can temporarily express a foreign gene in a plant into which a foreign gene has been introduced, and as a plant expression vector that can permanently express a foreign gene in a plant into which a foreign gene has been introduced.
  • a preferred example of a plant expression vector is a Ti plasmid vector, which, when present in a suitable host such as Agrobacterium tumefaciens , is capable of transferring part of itself, the so-called T-region, into a plant cell.
  • Other types of Ti plasmid vectors cf.
  • EP 0 116 718 B1 are currently used to transfer hybrid DNA sequences into plant cells, or into protoplasts from which new plants can be produced, wherein the hybrid DNA has been suitably inserted into the genome of the plant.
  • a particularly preferred form of Ti plasmid vector is a so-called binary vector, as claimed in EP 0 120 516 B1 and in US Pat. No. 4,940,838.
  • the expression vector will preferably comprise one or more selectable markers.
  • markers are nucleic acid sequences having a property that can be selected, typically by chemical means, and are any genes that can distinguish transformed cells from untransformed cells. Examples include, but are not limited to, herbicide resistance genes such as glyphosate or phosphinothricin, antibiotic resistance genes such as kanamycin, G418, Bleomycin, hygromycin, chloramphenicol.
  • the promoter may optionally be a plant promoter known in the art, such as a T7 promoter, an SP6 promoter, a CaMV 35S promoter, an actin promoter, a ubiquitin promoter, a pEMU promoter, a MAS promoter, or a histone promoter, and may include a meiosis-specific promoter capable of specifically inhibiting the expression of a target gene at the meiotic stage of a cell, such as the SPO11-1 (SPORULATION 11-1) promoter or the DMC1 (DNA meiotic recombinase 1) promoter, but is not limited thereto.
  • a plant promoter known in the art such as a T7 promoter, an SP6 promoter, a CaMV 35S promoter, an actin promoter, a ubiquitin promoter, a pEMU promoter, a MAS promoter, or a histone promoter
  • a meiosis-specific promoter capable of specifically inhibiting the
  • promoter means a region of DNA upstream from a structural gene and refers to a DNA molecule to which RNA polymerase binds to initiate transcription.
  • a "plant promoter” is a promoter capable of initiating transcription in a plant cell.
  • terminators can be used, and examples thereof include, but are not limited to, nopaline synthase (NOS), rice ⁇ -amylase RAmy1 A terminator, and phaseolin terminator.
  • NOS nopaline synthase
  • rice ⁇ -amylase RAmy1 A terminator a terminator that terminates the RNA sequence
  • phaseolin terminator a terminator that terminates the RNA sequence.
  • terminators it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of terminators is highly desirable in the context of the present invention.
  • Transformation of plants refers to any method for transferring DNA into plants. Such transformation methods do not necessarily require regeneration and/or tissue culture periods. Transformation of plant species is now commonplace for plant species, including both dicotyledonous and monocotyledonous plants. In principle, any transformation method can be used to introduce the hybrid DNA according to the invention into a suitable progenitor cell.
  • Methods include the calcium/polyethylene glycol method for protoplasts (Krens, FA et al, 1982, Nature 296, 72-74; Negrutiu I et al, 1987, Plant Mol Biol 8, 363-373), electroporation of protoplasts (Shillito RD et al, 1985 Bio/Technol 3, 1099-1102), microinjection with plant elements (Crossway A et al, 1986, Mol Gen Genet 202, 179-185), particle bombardment of various plant elements (Klein TM et al, 1987, Nature 327, 70), infection by (non-complete) viruses in Agrobacterium tumefaciens-mediated gene transfer by infiltration of plants or transformation of mature pollen or microspores (EP 0 301 316, etc.) can be suitably selected.
  • a preferred method according to the present invention comprises Agrobacterium-mediated DNA transfer.
  • the manufacturing method of the present invention includes a step of regenerating a transformed plant from the transformed plant cell. Any method known in the art can be used for the method of regenerating a transformed plant from a transformed plant cell.
  • the present invention also provides a transgenic plant having an increased number of crossover recombination of homologous chromosomes compared to a wild type produced by the above method, and a transformed seed thereof.
  • the plant may be a dicotyledonous plant such as Arabidopsis thaliana, potato, eggplant, tobacco, pepper, tomato, burdock, crown daisy, lettuce, balloon flower, spinach, radish, sweet potato, carrot, water parsley, cabbage, Chinese cabbage, mustard greens, watermelon, melon, cucumber, pumpkin, gourd, strawberry, soybean, mung bean, kidney bean, pea, or a monocotyledonous plant such as rice, barley, wheat, rye, corn, sugarcane, oats, onion, and preferably a dicotyledonous plant, and more preferably Arabidopsis thaliana, but is not limited thereto.
  • a dicotyledonous plant such as Arabidopsis thaliana, potato, eggplant, tobacco, pepper, tomato, burdock, crown daisy, lettuce, balloon flower, spinach, radish, sweet potato, carrot, water parsley, cabbage, Chinese cabbage, mustard greens, watermelon, melon, cucumber, pumpkin,
  • the present invention also provides a composition for increasing the number of homologous chromosome crossover recombination during meiosis of a plant cell, comprising as an active ingredient a substance that inhibits the function of the J3 chaperone protein.
  • the J3 chaperone protein function inhibitor may be at least one selected from the group consisting of compounds, peptides, peptide mimetics, substrate analogs, aptamers, and antibodies that specifically bind to the J3 chaperone protein; or at least one selected from the group consisting of antisense oligonucleotides, siRNA (small interfering RNA), shRNA (small hairpin RNA), miRNA (microRNA), and ribozymes that inhibit the expression of a J3 chaperone protein coding gene, but is not limited thereto.
  • composition of the present invention may further include a function inhibitor of one or more crossover inhibition proteins selected from the group consisting of FANCM (Fanconi anemia group M protein), RECQ4A (ATP-dependent DNA helicase Q-like 4A), RECQ4B, FIGL1 (AAA-ATPase FIDGETIN-LIKE 1), HCR1 (HIGH CROSSOVER RATE 1/PROTEIN PHOSPHATASE X1), and HCR2 (HIGH CROSSOVER RATE 2/HEAT SHOCK FACTOR BINDING PROTEIN), but is not limited thereto.
  • FANCM Feanconi anemia group M protein
  • RECQ4A ATP-dependent DNA helicase Q-like 4A
  • RECQ4B FIGL1 (AAA-ATPase FIDGETIN-LIKE 1)
  • HCR1 HIGH CROSSOVER RATE 1/PROTEIN PHOSPHATASE X1
  • HCR2 HCROSSOVER RATE 2/HEAT SHO
  • the function inhibitor of the FANCM, RECQ4A, RECQ4B, FIGL1, HCR1, and HCR2 proteins may be an antibody or aptamer specific for each protein; or miRNA, siRNA, or antisense RNA capable of inhibiting the expression of each protein coding gene.
  • Arabidopsis plants were grown under light conditions of 22°C, 50-60% humidity, and 16/8 h light/dark cycle. Seeds were cultured in the dark at 4°C for 3-4 days for germination. FTL (Fluorescent tagged line) expressed in seeds and FTL lines expressed in pollen were used in the invention (Wu, G., et al., (2015) Genetics 200:35-45; Melamed-Bessudo, C., et al., (2005) Plant J. 43:458-66).
  • T-DNA insertion lines j3-1 (SALK_132923), zip4-2 (SALK_068052), mus81-2 (SALK_107515), hei10-2 (SALK_014624) and the EMS mutant fancm-1 were provided by NASC (Nottingham Arabidopsis Stock Centre).
  • NASC Nottingham Arabidopsis Stock Centre
  • the wild-type allele was genotyped using the primer sets j3-1_geno_F and j3-1_geno_R, and the T-DNA allele was genotyped using the primer sets j3-1_geno_F and LBb1.3.
  • hcr3 genotyping was performed by PCR amplification using hcr3_dCAPS_BamHI_F and hcr3_dCAPS_R, followed by BamHI digestion. Genotyping of zip4-2 , mus81-2 , and fancm-1 was performed using previous methods (Yelina, NE et al., (2015) Genes Dev. 29:2183-202; F. Hartung et al., (2006), Nucleic Acids Research, 34(16):4438-4448).
  • Primer information used in the present invention Primer Sequence (5'-3') (Sequence number) hcr3 _dCAPS_BamHI_F CACATTTCAAGGAGGGCTCCAGATTTGGATC (4) hcr3 _dCAPS_R GCTATATGTGTCCTAGGTTCAT (5) LBb1.3 ATTTTGCCGATTTCGGAAC (6) j3-1 _geno_F TGTTGAATTTTGATCCGATCTG (7) j3-1 _geno_R CCCTTTCTCTTGAACTTTGGG (8) pPZP211-gJ3_GA_F GCCTGCAGGTCGACTCTAGAGAAATCAGTGATGATGATCAAATTACTTAC (9) pPZP211-gJ3_GA_R AGGCGCCCTCGAGTTGAACTCTTTTTAAAATACAACTGGTATG (10) pJ3(2.2 kb)_Lv0_F(GGAG) CCGAAGACGGCTCAGGAGCCA
  • Crossover frequencies were analyzed by counting fluorescent and non-fluorescent seeds of FTL/++ hemizygous plants using the CellProfiler image analysis program.
  • CellProfiler can quantify green exclusively fluorescent seeds (N Green ), red exclusively fluorescent seeds (N Red ), and total seeds (N Total ), and crossover frequencies (cM) were calculated using the following formula. Welch's t-test was used to verify the significance of crossover frequencies between genotypes.
  • Pollen FTLs were generated in a qrt-1 mutant background and contain four pollen products of male meiosis ligated together.
  • FTLs express eYFP (Y), dsRed (R), or eCFP (C) under the control of the LAT52 promoter.
  • Measurements of pollen tetrad FTL-based crossing over frequency and interference were performed using DeepTetrad (Berchowitz, LE & Copenhaver, GP (2008) Nat. Protoc. 3:41-50; Lim, EC et al., (2020) Plant J. 101:473-483).
  • DeepTetrad is a deep-learning-based image analysis system that can recognize pollen tetrad types in FTL intervals.
  • the FTL interval ( I1bc, I1fg, I2fg, I3bc and I5ab ) produces 12 tetramolecular types: no recombination (A), single crossover interval 1 (B; SCO-i1), single crossover interval 2 (C; SCO-i2), two-strand double crossover (D; 2st DCO), three-strand double crossover a (E; 3st DCOa), three-strand double crossover b.
  • F (F; 3st DCOb), four-strand double crossover (G; 4st DCO), non-parental ditype interval 1, non-crossover interval 2 (H; NPD-i1 NCO-i2), non-crossover interval 1, non-parental ditype interval 2 (I; NCO-i1 NPD-i2), non-parental ditype interval 1, single crossover interval 2 (J; NPD-i1) SCO-i2), single crossover interval 1, non-parental ditype interval 2 (K; SCO-i1 NPD-i2) and non-parental ditype interval 1, non-parental ditype interval 2 (L; NPD-i1 NPD-i2).
  • Fluorescent seed states were identified using DeepTetrad, and crossover frequencies and interferences were calculated using Perkin's equation.
  • the lysate was stirred and reacted on ice for 30 minutes, then centrifuged at 4°C, 3,000g for 25 minutes, and the pellet was used for DNA extraction using CTAB (Cetyl trimethylammonium bromide).
  • CTAB Cetyl trimethylammonium bromide
  • the extracted and purified DNA was cut into 200-500 bp sizes using a Bioruptor sonicator.
  • the purified DNA was used for library construction using the Illumina Truseq Nano DNA LT library prep kit, and the hcr3 BC 1 F 2 library was sequenced using the Illumina Genome Analyser (100 bp paired) Hiseq 2000 instrument.
  • SHOREmap (v.3.0) was used to align paired-end reads to the TAIR10 reference genome using the GenomeMapper tool. Raw reads were trimmed based on quality values with a Phred score cutoff of +33 or +64 using the SHORE import function, and the SHORE consensus function was used to detect sequence variations between hcr3 BC 1 F 2 and the TAIR10 reference assembly. Single nucleotide polymorphisms (SNPs) with high marker scores (>40) were used for allele frequency analysis using the SHOREmap backcross function. Mutations were screened for those with (i) an allele frequency ⁇ 80% and (ii) non-synonymous mutations, splice site, or premature stop codon changes within predicted genes. Candidate mutations were also tested based on their location within genes with predicted or known functions related to meiosis, nuclear protein localization, and known molecular functions provided in the TAIR database.
  • a 4.1-kb genomic DNA fragment containing the 2.2-kb promoter and gene of HCR3/J3 was amplified using the primer sets pPZP211-gJ3_GA_F and pPZP211-gJ3_GA_R.
  • the PCR product was cloned into the pPZP211 vector using the Gibson assembly method.
  • the cloned vector was introduced into Agrobacterium GV3101-pSoup strain by electroporation, and the Agrobacterium strain was transformed into plants by floral dipping. T 1 plants were selected through genotyping using kanamycin resistance and a specific primer set of the HCR3/J3 transgene.
  • the neighbour-joining method was used to construct the J3 phylogenetic tree.
  • the amino acid sequences used in the multiple sequence alignment are as follows: AtJ3, AtJ2, OsDNAJ (XP 015630926.1), SlDNAJ-like (NP 001234241.2), GmDNAJ (NP 0001354212.1), PpDNAJ (XP024402168.1), XlDNAJA2 (NP 001080625.1), DrDNAJ (NP 998658.1), CeDNAJ (NP 493570.1), HsDNAJA1 (NP 001530.1), DmDnaJ-like-2 (NP 650283.1), ScYDJ1, SpMas5 (NP 595428.1), EcHSP40.
  • HCR3 dominant negative allele wild-type genomic DNA containing the promoter and 5'-UTR of the J3, DMC1, RPS5A, REC8, ASY1, SPO11-1 , or SDS gene was amplified with forward and reverse primers and cloned into the Lv0 vector (pICH41331).
  • HCR3/J3 genomic DNA was amplified from the genomic DNA of the hcr3 mutant plant with forward and reverse primers and cloned into the Lv0 vector (pICH41331).
  • Each promoter and the hcr3 Lv0 vector were assembled into the Lv1 position 2 vector (pICH47742).
  • the constructed Lv1 vector was assembled into the Lv2 binary vector (pAGM4723) together with a linker (pICH41744) and the antibiotic resistance gene BAR (pICSL11017).
  • the Lv2 binary vector was introduced into Agrobacterium strain GV3101-pSoup and transformed Arabidopsis thaliana via the flower stalk immersion method.
  • genomic DNA was extracted from J3:J3 G155R Col/Ler F 2 96 individuals using CTAB. 150 ng of DNA was fragmented (final volume 15 ⁇ l) with 0.3 unit of dsDNA Shearase (Zymo Research), and the sheared DNA was end-repaired in 30 ⁇ l of reaction solution (3 units of T4 DNA polymerase (New England Biolabs), 10 units of T4 polynucleotide kinase (Thermo Fisher Scientific), 1.25 units of Klenow fragment (New England Biolabs), and 0.4 mM dNTPs) for 30 min at 20°C. DNA fragments were purified using AMPure XP magnetic SPRI beads (Beckman-Coulter, A63881).
  • DNA was A-tailed and ligated with barcoded Illumina adapters in a 20 ⁇ l reaction volume according to a previously described method (Rowan, BA, et al., (2015) G3 (Bethesda). 5:385-98). Eight DNA libraries were pooled, washed, and eluted in 30 ⁇ l elution buffer (10 mM Tris-HCl, pH 8.0). 30 ⁇ l of the mixture was added to a tube containing 16 ⁇ l of AMPure XP magnetic SPRI beads, incubated at room temperature for 5 min, placed on a magnetic rack for 2 min, and then the supernatant (42 ⁇ l) was transferred to a new tube and mixed with 0.23-fold SPRI beads.
  • Chromosome experiments of Arabidopsis meiotic progenitor cells were prepared from fixed flower buds and stained with DAPI as previously reported (Chelysheva, L. et al. (2010) Cytogenet. Genome Res. 129:143-53). Cells in the anaphase to metaphase were immunostained for ASY1 and J3, cells in the late metaphase were immunostained for HEI10, and cells in the copy phase to metaphase were immunostained for MLH1. Meiotic progenitor cells in the anaphase were immunostained for ASY1 and RAD51 using fresh flower buds.
  • ⁇ -ASY1 rat, 1:200 or 1:500 dilution
  • ⁇ -ZYP1 rabbit, 1:200 dilution
  • ⁇ -MLH1 rabbit, 1:200 dilution
  • ⁇ -RAD51 rabbit, 1:300 dilution
  • Microscopy was performed using a DeltaVision personal DV microscope (Applied precision/GE Healthcare) equipped with a CDD Coolsnap HQ2 camera. Image capture was performed using SoftWoRx software version 5.5.
  • Protoplast transient expression vectors were constructed using Golden Gate Cloning. PCR-amplified HCR3/J3, HEI10, PTD, and MSH5 genomic DNAs were cloned into the Lv0 universal vector (pICH41331). The Lv0 vector, which contains the coding region lacking the stop codon for epitope tagging, was assembled into the Lv1 vector (pICH4742) using the 35S promoter vector (pICH51266), N-terminal or C-terminal vectors (Myc tag/pICSL50010 and HA tag/pICSL50009), and NOS terminator vector (pICH41421).
  • the HCR3/J3 Lv1 vector constructed by the above method and each of the HEI10, PTD, and MSH5 Lv1 vectors were assembled into the Lv2 binary vector (pAGM4723) together with a linker (pICH41744) and the antibiotic resistance gene BAR (pICSL11017).
  • the completed Lv2 binary vector was introduced into Agrobacterium strain GV3101-pSoup, and Arabidopsis thaliana was transformed by the flower stalk dipping method.
  • Plasmid DNA and mesophyll protoplasts were prepared according to a previously described method (Hwang, I. & Sheen, J. (2001) Nature 413:383-389). 4x104 protoplasts were transfected with 40 ⁇ g total plasmid DNA and cultured at room temperature for 10 h.
  • Total proteins were extracted using extraction buffer (50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 5 mM EDTA, 1 mM dithiothreitol, protease inhibitor cocktail (Roche), and 1% Triton X-100), and the extracted buffer was developed by SDS-PAGE using 8% polyacrylamide gel, transferred to nitrocellulose membrane, and confirmed using anti-HA-HRP (1:2,000 Roche 12013819001) or anti-Myc-HRP (1:2,000 Santa Cruz sc-9E10) antibody.
  • extraction buffer 50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 5 mM EDTA, 1 mM dithiothreitol, protease inhibitor cocktail (Roche), and 1% Triton X-100
  • the J3 chaperone contributes to protein stabilization under conditions such as high temperatures that are not suitable for plant growth.
  • a loss-of-function mutant of J3 has a reduced ability to respond to environmental changes, and a double mutation with J2 , a homologous gene of J3 , causes plant lethality in the early stage of development. Therefore, in order to express the dominant-negative mutant of J3 in a meiotic manner, a meiosis-specific promoter was used to confirm the pattern of increased crossover rate (Fig. 2e). When the SPO11-1 promoter was used, plants showing a higher increase in crossover rate than the endogenous J3 promoter were obtained, and it was confirmed that this aspect increased the crossover rate in proportion to the expression amount of the J3 dominant-negative mutant (Fig. 2f).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Botany (AREA)
  • Environmental Sciences (AREA)
  • Developmental Biology & Embryology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Physiology (AREA)
  • Virology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

본 발명은 식물에서 감수분열의 염색체 교차 재조합을 증가시키는 J3 샤페론 및 이의 용도에 관한 것으로, 보다 구체적으로는 J3 샤페론 단백질의 기능을 저해하여 식물 세포의 감수분열 동안에 상동 염색체의 교차 재조합 수를 증가시키는 방법에 관한 것이다. 본 발명의 교차 수 증가 방법을 이용하면 작물 육종의 가속화 및 양적형질 지도 작성의 가속화를 극대화할 수 있을 것이다.

Description

식물에서 감수분열의 염색체 교차 재조합을 증가시키는 J3 샤페론 및 이의 용도
본 발명은 식물에서 감수분열의 염색체 교차 재조합을 증가시키는 J3 샤페론 및 이의 용도에 관한 것으로, 보다 상세하게는 애기장대 유래 J3 단백질의 발현을 저해하거나, J3 단백질 코딩 유전자에 T-DNA를 삽입하여 기능상실 돌연변이체를 유도하거나 또는 J3 단백질 우성 음성 돌연변이 유전자를 발현시켜 야생형이 가지고 있는 J3 내인단백질의 기능상실을 유도하는 방법을 통해 식물 세포의 감수분열 동안에 상동 염색체의 교차 재조합 수를 증가시키는 방법에 관한 것이다.
본 발명은 농촌진흥청, 삼성미래기술육성재단 및 서경배과학재단의 지원을 받아 수행되었다(과제번호 PJ013370012020, SSTF-BA2202-09 및 SUHF-17020079).
감수분열 재조합은 프로그래밍된 DNA 이중 가닥 절단(double strand break, DSB)의 형성에 의해 시작되어 교차(crossover) 또는 비교차를 생성하기 위해 상동 염색체를 주형으로 사용하여 복구되는 과정에서 만들어진다. 200개 이상의 DSB 형성에도 불구하고, 극히 일부만이 교차로 진행되어 염색체 쌍당 하나 또는 두 개의 교차가 발생한다.
교차가 일어나는 두 가지 경로인 클래스 I과 클래스 Ⅱ가 밝혀져 있다. 클래스 I 경로는 대부분의 교차를 촉진하며, 교차촉진인자인 ZMM 단백질(Zip1-4, Mer3 및 Msh4-5)과 MLH1-MLH3 이종이량체 엔도뉴클레아제(MutLγ)에 의해 일어난다. ZMM 단백질은 대치고리(displacement loop, D-loop) 및 이중 홀리데이 접합과 같은 재조합 중간체를 안정화하고 MutLγ를 모집하여 교차를 이룬다. 클래스 I 경로에 의한 교차는 인접한 거리에 또다른 교차가 형성되는 것을 억제하는 간섭 현상이 존재한다. 대조적으로, 클래스 Ⅱ 경로에 의해 일어나는 교차는 비간섭적이며 엔도뉴클레아제 MUS81이 관여한다. 비간섭 교차는 식물의 FANCM 및 RECQ4A/4B 헬리카제를 포함한 여러 교차 억제 인자에 의해 제한된다. ZMM 중에서 SUMO 및/또는 유비퀴틴 E3 연결효소인 ZIP3/HEI10 (Human Enhancer of Invasion-10) 계열은 발현양에 의존적으로 간섭에 민감한 교차 수와 위치를 조절하는데 중요한 역할을 한다. HEI10은 초기 세사기(leptotene) 염색체 상에 놓이기 시작해서 상동 염색체 사이에 만들어지는 단백질 구조인 시냅시스 복합체(SC)를 따라 점차적으로 증가한다. 애기장대(Arabidopsis thaliana)에서 HEI10 E3 연결효소는 SC를 따라 확산되고 시냅스된 초기 태사기(pachytene)에 작은 점으로 수백 개의 재조합 중간체와 함께 위치하게 된다. 액체상태 내 상분리 현상을 보이는 생체분자 응축물과 마찬가지로 HEI10 단백질은 후기 태사기에 작은 응축물들을 희생시키면서 하나 또는 몇 개의 큰 응축물로 지정된 교차 부위에 집중된다. 이러한 동역학, 교차 수 제어 및 간섭을 설명하기 위해 확산 매개 HEI10 조대화 모델(diffusion-mediated HEI10 coarsening model)이 제안되었다. 애기장대에서 SC 가로 필라멘트 구조를 이루는 ZYP1 단백질의 기능을 소실시킨 돌연변이에서는 간섭이 사라지고 클래스 I 교차가 증가된다. SC 축 요소의 HORMA 도메인 단백질은 클래스 I 교차를 촉진하고 간섭을 중재하는 데 필요하다. 교차 간섭은 애기장대에서 HEI10을 잠재적으로 탈인산화시키는 HCR1 (HIGH CROSSOVER RATE1, PROTEIN PHOSPHATASE X 1)에 의해 제한된다. 일관되게 인산화, 수모화(SUMOylation), 유비퀴틴화 및 프로테아솜 단백질분해와 같은 교차 촉진 인자의 번역 후 변형은 사카로마이세스 세레비지애(Saccharomyces cerevisiae), 스키조사카로마이세스 폼베(Schizosaccharomyces pombe), 예쁜꼬마선충(Caenorhabditis elegans) 및 마우스의 감수분열 재조합을 제어하는데 관여한다. 그러나 식물의 교차 조절 인자 중 주요 교차 촉진 인자인 HEI10의 단백질 분해 및 동역학을 중재하는 분자 메커니즘은 거의 알려져 있지 않다.
감수분열 동안 제한적으로 일어나는 염색체의 재조합 수는 육종에서 유용형질 조합에 시간과 비용적 측면에서 큰 걸림돌로 작용한다. 본 발명에서는 애기장대 형광 종자 교차 측정 시스템을 이용하여 새로운 교차 억제 인자를 유전학적 스크리닝을 통해 찾고자 하였다.
한편, 한국등록특허 제2410996호에는 '식물 세포에서 감수분열의 염색체 교차 재조합을 증가시키는 Protein phosphatase 4 복합체 및 이의 용도'가 개시되어 있으나, 본 발명의 '식물에서 감수분열의 염색체 교차 재조합을 증가시키는 J3 샤페론 및 이의 용도'에 대해서는 기재된 바가 없다.
본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명자들은 EMS (Ethyl methanesulfonate)를 처리한 애기장대 형광 종자 리포터 라인을 스크리닝하여 교차율이 야생형에 비해 증가된 hcr3 (high crossover rate 3) 돌연변이체를 확보하였고 SHOREmap 분석을 통해 상기 HCR3가 박테리아에서부터 식물을 포함한 모든 진핵생물에서 보존된 HSP40 단백질족인 J3 샤페론을 암호화하고 있는 유전자임을 확인하였다. 또한, hcr3 돌연변이체를 다른 종류의 형광 종자 또는 꽃가루 리포터 라인을 교배하거나 잡종 세대를 만들어 GBS (genotyping by sequencing) 분석을 수행한 결과, 유전체 전체에서 교차율이 증가되었음을 확인하였다. 웨스턴 블롯으로 교차 조절 인자들의 발현양을 분석한 결과, hcr3, J3G155R (J3 단백질의 우성 음성 돌연변이형)가 발현양과 교차율이 비례관계에 있는 HEI10 E3 연결효소를 단백질 수준에서 조절하여 교차 수를 제한함을 확인하였다. 상기 결과를 통해, 본 발명의 J3가 단백질 수준에서 교차 조절 인자를 조절하는 새로운 교차 억제 인자로서 기능상실 또는 우성 음성 돌연변이를 통해 교차율을 증가시킬 수 있음을 확인함으로써, 본 발명을 완성하였다.
상기 과제를 해결하기 위해, 본 발명은 J3 샤페론 단백질의 기능을 저해하는 단계를 포함하는, 식물 세포의 감수분열 동안에 상동 염색체의 교차(crossover) 재조합 수를 증가시키는 방법을 제공한다.
또한, 본 발명은 식물 세포에서 J3 샤페론 단백질 코딩 유전자의 발현을 저해하거나, J3 샤페론 단백질 코딩 유전자에 T-DNA를 삽입하여 기능상실 돌연변이체를 유도하거나, J3 샤페론 우성 음성 돌연변이 단백질 코딩 유전자의 발현을 증가시키는 단계를 포함하는, 야생형에 비해 상동 염색체의 교차 재조합 수가 증가된 형질전환 식물체의 제조방법을 제공한다.
또한, 본 발명은 상기 방법으로 제조된 야생형에 비해 상동 염색체의 교차 재조합 수가 증가된 형질전환 식물체 및 이의 형질전환된 종자를 제공한다.
또한, 본 발명은 J3 샤페론 단백질의 기능을 저해하는 물질을 유효성분으로 포함하는, 식물 세포의 감수분열 동안에 상동 염색체 교차 재조합 수 증가용 조성물을 제공한다.
본 발명에 따른 애기장대 J3 유전자는 감수분열 교차 억제 유전자로 작동하므로, 기능상실 돌연변이를 유도하거나 우성 음성 돌연변이를 발현시키면 염색체당 교차 수가 증가된다. 작물에서 J3의 상동유전자를 두 개 이상 가지고 있더라도 우성 음성 돌연변이를 발현시킴으로써 모든 J3 상동유전자의 기능상실 돌연변이를 유도하지 않아도 J3 상동유전자의 정상적인 기능을 저해하여 교차 수를 효과적으로 증가시킬 수 있다. 교차 수 증가는 교배 육종의 연한을 단축시키고, 양적형질좌지도 작성을 가속화시킬 수 있으므로, 본 발명의 방법은 농업 분야에 유용하게 활용될 수 있을 것이다.
도 1은 형광 종자 리포터 라인(420 GR/GR)을 활용하여 유전학적 스크리닝을 통해 교차가 증가한 애기장대 hcr3 (high crossover rate 3) 돌연변이체를 확보하는 과정을 보여준다. 도 1a는 420 GR/++ 식물체에 EMS (Ethyl-methane-sulfonate)를 처리하여 스크리닝 집단을 제작한 과정을 보여준다. 도 1b는 교차 증가 돌연변이 스크리닝에 활용한 형광 종자 라인(420 GR/++)과 이미지 분석 프로그램 CellProfiler로 분석한 대표 그림이다. 도 1c는 hcr3/+, hcr3, hcr3 BC1F2의 교차 빈도 측정 결과이다. 420 (GR/GR)은 3번 염색체의 sub-telomeric 부위에 녹색(eGFP)과 빨간색(dsRed) 마커가 5.1 Mbp 간격으로 위치한 FTL (Fluorescent tagged line)로, 유전적 배경은 Columbia (Col)이다. 도 1d는 BC1F2 50개체의 유전체를 시퀀싱하여 hcr3의 돌연변이 위치를 확인한 것으로, 염색체 3번에 위치함을 보여준다.
도 2a는 hcr3 돌연변이가 J3 샤페론을 코딩하는 At3g44110 유전자의 4번째 엑손에 발생한 것(G→A)을 보여준다. 도 2b는 진화적으로 잘 보존된 J3의 계통도를 보여준다. 도 2c는 J3 게노믹 DNA를 j3-1 돌연변이체에 도입하여 증가되었던 교차율이 다시 야생형 수준으로 회복되는 것을 확인한 결과이다. 도 2d는 야생형에 hcr3를 도입하였을 때 교차율이 증가한 결과로 hcr3 돌연변이가 우성 음성의 성질을 가지는 것을 보여준다.
도 3a는 교배에 사용된 형광 종자 및 꽃가루 리포터 라인의 위치를 보여준다. 도 3b는 hcr3와 다양한 형광 종자 리포터 라인의 교배 결과에서 야생형과의 교배 결과에 비해 교차 수가 증가함을 보여준다. 도 3c는 hcr3와 다양한 형광 꽃가루 교차 리포터 라인의 교배 결과에서 야생형과의 교배 결과에 비해 교차 수가 증가함을 보여준다. 도 3d는 420 형광 종자 리포터 라인에서 암수 특이적 교차율의 증가를 보여준다.
도 4는 hcr3 우성 음성 돌연변이를 잡종 세대에서 이소성 발현시켰을 때의 유전체 수준의 교차 증가를 보여준다. 도 4a는 교차 지도 작성을 위한 GBS (genotyping-by-sequencing) 분석용 F2 식물체의 준비 과정이다. 도 4b는 J3:J3G155R Col/Ler 잡종 F1의 감수분열에서 교차가 증가했음을 보여준다. 도 4c는 J3:J3G155R Col/Ler 잡종 F2 개체당 교차 평균이 야생형 7.7에 비해 15.1개로 증가했음을 보여준다. 도 4d는 동원체에서 텔로미어 지역으로 갈수록 J3:J3G155R Col/Ler의 교차의 증가폭이 커짐을 보여준다. 도 4e와 4f는 암수 각각의 교차율이 2배 가량 증가했음을 보여준다. 도 4g와 4h는 recq4a/b 기능상실 돌연변이보다 recq4a/b에 J3 우성 음성 돌연변이가 발현되었을 때 추가적인 교차 수 증가가 일어나는 것을 보여준다. 도 4i와 4j는 hcr3의 교차율 증가 양상이 HEI10 과발현되었을 때와 유사함을 보여준다.
도 5a는 hcr3에서 감수분열 동안 염색체 행동에 큰 변화가 없음을 보여주고, 도 5b 및 5c는 DSB 위치를 표지하는 RAD51의 수가 변화 없음을 보여준다. 도 5d는 축 요소(axis element)인 ASY1이 hcr3와 J3 기능상실 돌연변이에서 변화 없음을 보여준다.
도 6a 및 6b는 교차 위치에 겹치는 MLH1 foci 수가 hcr3에서 증가함을 보여준다. 도 6c 및 6d는 후기 태사기에서 HEI10 foci 수가 야생형에 비해 hcr3에서 30% 가량 증가함을 보여준다. 또한 한 염색체 상에서 두 HEI10 foci의 거리가 hcr3에서 야생형보다 더 가까워졌음을 보여준다. 도 6e는 GBS 분석 결과 hcr3에서 한 염색체 상에서 두 교차 지점의 거리가 무작위 분포에 가까워져 간섭 효과가 약해졌음을 보여준다.
도 7a는 hcr3가 fancm과 이중 돌연변이가 되었을 때 단일 돌연변이보다 교차가 추가로 증가함을 보여준다. 또한, hcr3가 zip4 또는 hei10과 이중 돌연변이가 되었을 때, zip4 또는 hei10 단일 돌연변이와 같은 수준의 교차율을 보임을 나타내는 결과이다. 도 7b는 hcr3와 recq4a/b 이중 돌연변이에서 단일 돌연변이보다 교차가 추가로 증가함을 보여준다. 도 7c는 hcr3가 mus81과 이중 돌연변이가 되었을 때 hcr3 단일 돌연변이와의 교차율 감소폭이 야생형과 mus81 단일 돌연변이의 교차율 차이와 유사함을 보여준다. 도 7d는 고온 조건(28℃)에서 야생형에 비해 hcr3에서 더 큰 교차율의 증가가 일어남을 보여준다. 도 7e는 기존 연구에서 밝혀진 클래스 I 교차 억제 인자인 hcr1 및 hcr2와 hcr3의 이중 및 삼중 돌연변이에서 추가적인 교차율 증가를 확인한 결과이다. 도 7f는 RNA 염기서열분석 결과를 히트맵으로 도식화한 결과를 보여준다.
도 8a 및 8b는 애기장대 원형질체에 HEI10-HA, PTD-HA, MSH5-HA 단백질을 발현시켰을 때 hcr3와 j3-1 유전자형에서 단백질 수준이 더 높은 것을 웨스턴블롯 실험으로 확인한 결과이다. 도 8c 및 8d는 감수분열모세포를 포함하는 꽃봉오리에서 HEI10-Myc, PTD-Myc, MSH5-Myc 단백질이 J3 우성 음성 돌연변이를 같이 발현시켰을 때 J3 야생형에 비해 더 많이 검출됨을 웨스턴블롯 실험으로 확인한 결과이다. 도 8e 및 8f는 감수분열모세포를 포함하는 꽃봉오리에서 HEI10 단백질이 hcr3, j3-1, J3:J3G155R 유전자형에서 야생형보다 더 많이 존재하는 것을 웨스턴블롯을 통해 확인한 결과이다.
본 발명의 목적을 달성하기 위하여, 본 발명은 J3 샤페론 단백질의 기능을 저해하는 단계를 포함하는, 식물 세포의 감수분열 동안에 상동 염색체의 교차(crossover) 재조합 수를 증가시키는 방법을 제공한다.
상동 염색체(homologous chromosome)는 감수분열(meiosis) 과정에서 세포 내에서 서로 짝을 이루는 부모로부터 각각 하나씩 물려 받은 크기와 모양이 거의 같은 염색체를 의미한다. 이러한 상동 염색체는 감수분열 제I분열의 전기 단계에서 상동 염색체의 분체끼리 일부가 교환되는(재조합되는) 교차(crossover)가 발생하고, 이러한 상동 염색체의 교차는 유전적 다양성 형성에 기여하게 된다.
본 발명에 따른 교차 재조합 수를 증가시키는 방법에 있어서, 상기 J3 샤페론 단백질의 기능 저해는 J3 샤페론 단백질 코딩 유전자의 발현을 저해하거나, J3 샤페론 단백질 코딩 유전자에 T-DNA를 삽입하여 기능상실 돌연변이체를 유도하거나, J3 샤페론 우성 음성 돌연변이 단백질 코딩 유전자의 발현을 증가시켜 이루어지는 것일 수 있으나, 이에 제한되지 않는다.
본 발명의 J3 단백질 코딩 유전자의 발현 저해는 상기 J3 단백질 코딩 유전자를 발현 저해 벡터인 VIGS (virus-induced gene silencing) 벡터나 RNAi 벡터에 삽입하여 수행할 수 있고, 보다 바람직하게는 감수분열 단계에서 특이적으로 J3 단백질 코딩 유전자의 침묵을 매개하는 재조합 벡터를 식물세포에 형질전환하여 이루어질 수 있으나, 이에 제한되지 않는다.
본 발명에 따른 교차 재조합 수를 증가시키는 방법에 있어서, 상기 J3 샤페론 단백질은 서열번호 3의 아미노산 서열로 이루어진 것일 수 있으며, 상기 J3 샤페론 우성 음성 돌연변이 단백질은 서열번호 3의 아미노산 서열에서 155번째 아미노산이 글리신(glycine)에서 아르기닌(arginine)으로 치환된 것일 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어 "우성 음성 돌연변이(dominant-negative mutation)"란 길항작용(antagonism)을 통해 야생형 대립유전자 산물의 정상기능을 저해함으로써 돌연변이 형질을 나타내는 것을 말한다. 이런 돌연변이는 보통 분자기능에 변화가 생긴 유전자 산물을 생성하며, 야생형 대립유전자에 상대적으로 우성 또는 반우성의 표현형을 나타낸다. 야생형 대립유전자가 있음에도 불구하고 돌연변이 형질의 발현을 주도하여 우성 효과의 특징을 보이며, 기능상실 표현형을 나타내는 점에서는 음성의 특성을 보이는 것이 특징이다.
본 발명에 따른 교차 재조합 수를 증가시키는 방법에 있어서, 상기 J3 샤페론 우성 음성 돌연변이 단백질 코딩 유전자의 발현은 구성적 프로모터 또는 감수분열 특이적 프로모터에 의해 발현 조절되는 것일 수 있으나, 이에 제한되지 않는다. 상기 감수분열 특이적 프로모터는 이에 한정되지 않으나, SPO11-1 (SPORULATION 11-1) 프로모터 또는 DMC1 (DNA meiotic recombinase 1) 프로모터일 수 있다.
본 발명에서 상기 J3 샤페론 단백질의 범위는 서열번호 3으로 표시되는 아미노산 서열을 갖는 단백질 및 상기 단백질의 기능적 동등물을 포함한다. "기능적 동등물"이란 아미노산의 부가, 치환 또는 결실의 결과, 상기 서열번호 3으로 표시되는 아미노산 서열과 적어도 70% 이상, 바람직하게는 80% 이상, 더욱 바람직하게는 90% 이상, 더 더욱 바람직하게는 95% 이상의 서열 상동성을 갖는 것으로, 서열번호 3으로 표시되는 단백질과 실질적으로 동질의 생리활성을 나타내는 단백질을 말한다. "실질적으로 동질의 생리활성"이란 J3 단백질의 기능 저해를 통해 야생형 즉, 비형질전환체에 비해 식물 세포의 감수분열 동안에 상동 염색체의 교차 재조합 수를 증가시키는 활성을 의미한다.
또한, 본 발명은 상기 J3 단백질을 암호화하는 유전자를 제공한다. 본 발명의 J3 단백질을 암호화하는 유전자는 서열번호 1 또는 서열번호 2로 표시되는 염기서열을 포함할 수 있다. 또한, 상기 염기서열의 상동체가 본 발명의 범위 내에 포함된다. 구체적으로, 상기 유전자는 서열번호 1 또는 서열번호 2의 염기서열과 각각 70% 이상, 더욱 바람직하게는 80% 이상, 더 더욱 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 상동성을 가지는 염기 서열을 포함할 수 있다. 폴리뉴클레오티드에 대한 "서열 상동성의 %"는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오티드 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다.
또한, 본 발명에 따른 교차 재조합 수를 증가시키는 방법은, 상기 J3 샤페론 단백질의 기능 저해와 동시에, 하나 이상의 교차 억제 단백질의 발현 또는 기능을 추가로 저해할 수 있으나, 이에 제한되지 않는다. 상기 교차 억제 단백질은 FANCM (Fanconi anemia group M protein), RECQ4A (ATP-dependent DNA helicase Q-like 4A), RECQ4B, FIGL1 (AAA-ATPase FIDGETIN-LIKE 1), HCR1 (HIGH CROSSOVER RATE 1/PROTEIN PHOSPHATASE X1) 또는 HCR2 (HIGH CROSSOVER RATE 2/HEAT SHOCK FACTOR BINDING PROTEIN)일 수 있으나, 이에 제한되지 않는다.
상기 교차 억제 단백질의 발현 또는 기능을 추가로 저해할 경우, 식물 세포에서 감수분열 동안 상동 염색체의 교차 재조합 수를 보다 더 증가시킬 수 있다.
본 발명은 또한, 식물 세포에서 J3 샤페론 단백질 코딩 유전자의 발현을 저해하거나, J3 샤페론 단백질 코딩 유전자에 T-DNA를 삽입하여 기능상실 돌연변이체를 유도하거나, J3 샤페론 우성 음성 돌연변이 단백질 코딩 유전자의 발현을 증가시키는 단계를 포함하는, 야생형에 비해 상동 염색체의 교차 재조합 수가 증가된 형질전환 식물체의 제조방법을 제공한다.
본 발명의 제조방법에 있어서, 상기 J3 샤페론 단백질은 서열번호 3의 아미노산 서열로 이루어진 것이며, J3 샤페론 우성 음성 돌연변이 단백질은 서열번호 3의 아미노산 서열에서 155번째 아미노산이 글리신(glycine)에서 아르기닌(arginine)으로 치환된 것일 수 있다.
본 발명의 제조방법에 있어서, 상기 J3 샤페론 단백질 코딩 유전자의 발현 저해 또는 J3 샤페론 우성 음성 돌연변이 단백질 코딩 유전자의 발현 증가는, 이로 한정되는 것은 아니나, 바람직하게는 감수분열 단계에서 특이적으로 발현이 조절되는 것일 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어 "재조합"은 세포가 이종의 핵산을 복제하거나, 상기 핵산을 발현하거나 또는 펩티드, 이종의 펩티드 또는 이종의 핵산에 의해 암호된 단백질을 발현하는 세포를 지칭하는 것이다. 재조합 세포는 상기 세포의 천연 형태에서는 발견되지 않는 유전자 또는 유전자 절편을, 센스 또는 안티센스 형태 중 하나로 발현할 수 있다. 또한 재조합 세포는 천연 상태의 세포에서 발견되는 유전자를 발현할 수 있으며, 그러나 상기 유전자는 변형된 것으로서 인위적인 수단에 의해 세포 내 재도입된 것이다.
또한, 용어 "재조합 발현 벡터"는 세균 플라스미드, 파아지, 효모 플라스미드, 식물 세포 바이러스, 포유동물 세포 바이러스, 또는 다른 벡터를 의미한다. 대체로, 임의의 플라스미드 및 벡터는 숙주 내에서 복제 및 안정화할 수 있다면 사용될 수 있다. 상기 발현 벡터의 중요한 특성은 복제 원점, 프로모터, 마커 유전자 및 번역 조절 요소(translation control element)를 가지는 것이다.
적당한 전사/번역 조절 신호를 포함하는 발현 벡터는 당업자에 주지된 방법에 의해 구축될 수 있다. 상기 방법은 시험관 내 재조합 DNA 기술, DNA 합성 기술 및 생체 내 재조합 기술 등을 포함한다. 상기 DNA 서열은 mRNA 합성을 이끌기 위해 발현 벡터 내의 적당한 프로모터에 효과적으로 연결될 수 있다. 또한 발현 벡터는 번역 개시 부위로서 리보좀 결합 부위 및 전사 터미네이터를 포함할 수 있다.
본 발명의 재조합 벡터의 바람직한 예는 VIGS 벡터 또는 RNAi 벡터이다. VIGS (Virus-induced gene silencing)는 바이러스 벡터에 식물유전자를 도입한 후 식물체를 감염시키면, 그 도입된 유전자의 내인성 식물유전자가 발현이 억제되는 현상을 말한다. 이는 PTGS (Post-transcriptional gene silencing)의 일종으로서, 전사-후(post-transcriptional), RNA 턴오버(RNA turnover) 및 뉴클레오티드 서열 특이적(nucleotide sequence specific) 이라는 특징들을 가진다. 상기 VIGS 벡터는 외래 유전자를 도입한 식물체 내에서 일시적으로 발현시킬 수 있는 일시적(transient) 발현 벡터 및 외래 유전자가 도입된 식물체에서 영구적으로 발현시킬 수 있는 식물 발현 벡터로 사용할 수 있다. 식물 발현 벡터의 바람직한 예는 아그로박테리움 튜메파시엔스(Agrobacterium tumefaciens)와 같은 적당한 숙주에 존재할 때 그 자체의 일부, 소위 T-영역을 식물 세포로 전이시킬 수 있는 Ti-플라스미드 벡터이다. 다른 유형의 Ti-플라스미드 벡터(EP 0 116 718 B1호 참조)는 현재 식물 세포, 또는 잡종 DNA를 식물의 게놈 내에 적당하게 삽입시키는 새로운 식물이 생산될 수 있는 원형질체로 잡종 DNA 서열을 전이시키는데 이용되고 있다. Ti-플라스미드 벡터의 특히 바람직한 형태는 EP 0 120 516 B1호 및 미국특허 제4,940,838호에 청구된 바와 같은 소위 바이너리(binary) 벡터이다.
발현 벡터는 바람직하게는 하나 이상의 선택성 마커를 포함할 것이다. 상기 마커는 통상적으로 화학적인 방법으로 선택될 수 있는 특성을 갖는 핵산 서열로, 형질전환된 세포를 비형질전환 세포로부터 구별할 수 있는 모든 유전자가 이에 해당된다. 그 예로는 글리포세이트(glyphosate) 또는 포스피노트리신(phosphinothricin)과 같은 제초제 저항성 유전자, 카나마이신(kanamycin), G418, 블레오마이신(Bleomycin), 하이그로마이신(hygromycin), 클로람페니콜(chloramphenicol)과 같은 항생제 내성 유전자가 있으나, 이에 한정되는 것은 아니다.
본 발명의 재조합 벡터에서, 프로모터는 T7 프로모터, SP6 프로모터, CaMV 35S 프로모터, 액틴 프로모터, 유비퀴틴 프로모터, pEMU 프로모터, MAS 프로모터 또는 히스톤 프로모터 등 당업계에 공지된 식물 프로모터를 선택적으로 사용할 수 있으며, 표적 유전자를 세포의 감수분열 단계에서 특이적으로 발현 저해할 수 있는 감수분열 특이적 프로모터 예컨대, SPO11-1 (SPORULATION 11-1) 프로모터 또는 DMC1 (DNA meiotic recombinase 1) 프로모터 등을 사용할 수 있으나, 이에 제한되지 않는다. "프로모터"란 용어는 구조 유전자로부터의 DNA 업스트림의 영역을 의미하며 전사를 개시하기 위하여 RNA 폴리머라아제가 결합하는 DNA 분자를 말한다. "식물 프로모터"는 식물 세포에서 전사를 개시할 수 있는 프로모터이다.
본 발명의 재조합 벡터에서, 통상의 터미네이터를 사용할 수 있으며, 그 예로는 노팔린 신타아제(NOS), 벼 α아밀라아제 RAmy1 A 터미네이터, 파세올린(phaseolin) 터미네이터 등이 있으나, 이에 한정되는 것은 아니다. 터미네이터의 필요성에 관하여, 그러한 영역이 식물 세포에서의 전사의 확실성 및 효율을 증가시키는 것으로 일반적으로 알려져 있다. 그러므로, 터미네이터의 사용은 본 발명의 내용에서 매우 바람직하다.
식물의 형질전환은 DNA를 식물에 전이시키는 임의의 방법을 의미한다. 그러한 형질전환 방법은 반드시 재생 및(또는) 조직 배양기간을 가질 필요는 없다. 식물 종의 형질전환은 이제는 쌍자엽 식물뿐만 아니라 단자엽 식물 양자를 포함한 식물 종에 대해 일반적이다. 원칙적으로, 임의의 형질전환 방법은 본 발명에 따른 잡종 DNA를 적당한 선조 세포로 도입시키는데 이용될 수 있다. 방법은 원형질체에 대한 칼슘/폴리에틸렌 글리콜 방법(Krens, FA et al, 1982, Nature 296, 72-74; Negrutiu I et al, 1987, Plant Mol Biol 8, 363-373), 원형질체의 전기천공법(Shillito RD et al, 1985 Bio/Technol 3, 1099-1102), 식물 요소로의 현미주사법(Crossway A et al, 1986, Mol Gen Genet 202, 179-185), 각종 식물 요소의 (DNA 또는 RNA-코팅된) 입자 충격법(Klein TM et al, 1987, Nature 327, 70), 식물의 침윤 또는 성숙 화분 또는 소포자의 형질전환에 의한 아그로박테리움 투메파시엔스 매개된 유전자 전이에서 (비완전성) 바이러스에 의한 감염(EP 0 301 316호) 등으로부터 적당하게 선택될 수 있다. 본 발명에 따른 바람직한 방법은 아그로박테리움 매개된 DNA 전달을 포함한다.
또한, 본 발명의 제조방법은 상기 형질전환된 식물 세포로부터 형질전환 식물을 재분화하는 단계를 포함한다. 형질전환 식물 세포로부터 형질전환 식물을 재분화하는 방법은 당업계에 공지된 임의의 방법을 이용할 수 있다.
본 발명은 또한, 상기 방법으로 제조된 야생형에 비해 상동 염색체의 교차 재조합 수가 증가된 형질전환 식물체 및 이의 형질전환된 종자를 제공한다.
본 발명의 일 구현 예에 있어서, 상기 식물체는 애기장대, 감자, 가지, 담배, 고추, 토마토, 우엉, 쑥갓, 상추, 도라지, 시금치, 근대, 고구마, 당근, 미나리, 배추, 양배추, 갓무, 수박, 참외, 오이, 호박, 박, 딸기, 대두, 녹두, 강낭콩, 완두 등의 쌍자엽 식물 또는 벼, 보리, 밀, 호밀, 옥수수, 사탕수수, 귀리, 양파 등의 단자엽 식물일 수 있고, 바람직하게는 쌍자엽 식물일 수 있으며, 더욱 바람직하게는 애기장대일 수 있으나, 이에 제한되지 않는다.
본 발명은 또한, J3 샤페론 단백질의 기능을 저해하는 물질을 유효성분으로 포함하는, 식물 세포의 감수분열 동안에 상동 염색체 교차 재조합 수 증가용 조성물을 제공한다.
본 발명에 따른 조성물에 있어서, J3 샤페론 단백질의 기능 저해 물질은 J3 샤페론 단백질에 특이적으로 결합하는 화합물, 펩티드, 펩티드 모방체, 기질 유사체, 앱타머 및 항체로 이루어진 군에서 선택되는 하나 이상; 또는 J3 샤페론 단백질 코딩 유전자의 발현을 저해하는 안티센스올리고뉴클레오티드, siRNA (small interfering RNA), shRNA (small hairpin RNA), miRNA (microRNA) 및 리보자임(ribozyme)으로 이루어진 군에서 선택되는 하나 이상일 수 있으나, 이에 제한되지 않는다.
또한, 본 발명의 조성물은 FANCM (Fanconi anemia group M protein), RECQ4A (ATP-dependent DNA helicase Q-like 4A), RECQ4B, FIGL1 (AAA-ATPase FIDGETIN-LIKE 1), HCR1 (HIGH CROSSOVER RATE 1/PROTEIN PHOSPHATASE X1) 및 HCR2 (HIGH CROSSOVER RATE 2/HEAT SHOCK FACTOR BINDING PROTEIN)로 이루어진 군으로부터 선택되는 하나 이상의 교차 억제 단백질의 기능 저해 물질을 추가로 포함할 수 있으나, 이에 제한되지 않는다. 상기 FANCM, RECQ4A, RECQ4B, FIGL1, HCR1 및 HCR2 단백질의 기능 저해 물질은 각 단백질에 특이적인 항체 또는 압타머; 또는 각각의 단백질 코딩 유전자의 발현을 저해할 수 있는 miRNA, siRNA 또는 antisense RNA 등일 수 있다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
재료 및 방법
1. 식물 재료
애기장대 식물체는 22℃, 50~60% 습도 및 16/8시간 명/암 주기의 광조건 하에서 생장시켰다. 종자는 발아를 위해 암 조건의 4℃에서 3-4일 배양하였다. 종자에서 발현되는 FTL (Fluorescent tagged line)과 꽃가루에서 발현되는 FTL 라인들을 발명에 사용하였다(Wu, G., et al., (2015) Genetics 200:35-45; Melamed-Bessudo, C., et al., (2005) Plant J. 43:458-66). T-DNA 삽입 계통인 j3-1 (SALK_132923), zip4-2 (SALK_068052), mus81-2 (SALK_107515), hei10-2 (SALK_014624)와 EMS 돌연변이체 fancm-1는 NASC (Nottingham Arabidopsis Stock Centre)로부터 제공받았다. 야생형의 대립유전자는 j3-1_geno_F 및 j3-1_geno_R의 프라이머 세트를 사용하였고, T-DNA 대립유전자를 위해서는 j3-1_geno_F 및 LBb1.3 프라이머 세트를 사용하여 유전형을 확인하였다. hcr3의 유전형분석은 hcr3_dCAPS_BamHI_F 및 hcr3_dCAPS_R를 사용한 PCR 증폭 후, BamHI 제한효소 처리를 통해 분석하였다. zip4-2, mus81-2, 및 fancm-1의 유전형분석은 이전의 방법으로 수행되었다(Yelina, N. E. et al., (2015) Genes Dev. 29:2183-202; F. Hartung et al., (2006), Nucleic Acids Research, 34(16):4438-4448).
본 발명에 사용된 프라이머 정보
Primer Sequence (5'-3') (서열번호)
hcr3_dCAPS_BamHI_F CACATTTCAAGGAGGCTCCAGATTTGGATC (4)
hcr3_dCAPS_R GCTATATGTGTCCTAGGTTCAT (5)
LBb1.3 ATTTTGCCGATTTCGGAAC (6)
j3-1_geno_F TGTTGAATTTTGATCCGATCTG (7)
j3-1_geno_R CCCTTTCTCTTGAACTTTGGG (8)
pPZP211-gJ3_GA_F GCCTGCAGGTCGACTCTAGAGAAATCAGTGATGATCAAATTACTTAC (9)
pPZP211-gJ3_GA_R AGGCGCGCCCTCGAGTTGAACTCTTTTTAAAATACAACTGGTATG (10)
pJ3(2.2 kb)_Lv0_F(GGAG) CCGAAGACGGCTCAGGAGCCAACCTACTTGCATGTTAACAAGAAACTATTATTC (11)
pJ3_Lv0_R(CCAT) CCGAAGACGGCTCGATGGCTTTTCGCCGTTGTAACGAAAAC (12)
J3_Lv0_F(AATG) AAAGAAGACAACTCAAATGATGTTCGGTAGAGGACCCTC (13)
J3 Lv0_R(TTCG) AAAGAAGACAAACCTTTACTGCTGGGCACATTGC (14)
J3(G155R)_SDM_F ATTGCAGAAAGAGATCAAAATCTGGAGCC (15)
J3(G155R)_SDM_R GGCTCCAGATTTTGATCTCTTTCTGCAAT (16)
J3-Ter_Lv0_F(GCTT) CCGAAGACGGCTCAGCTTGTAACTCCTTAGAGAGACTTTGAC (17)
J3-Ter_Lv0_R(CGCT) CCGAAGACGGCTCGAGCGAACTCTTTTTAAAATACAACTGGTATG (18)
pDMC1(1.5kb)_Lv0_F(GGAG) CCGAAGACGGCTCAGGAGAAAGAAACCAAAGTTCCATGTCCAT (19)
pDMC1_Lv0_R(AATG) CCGAAGACGGCTCGCATTCCGATCACTGACACAAGCAAAAATAAA (20)
HEI10_Lv0_GA_F(AATG) CCCGAAGACGGCTCAAATGATGAGATGCAACGCGTGTTGGA (21)
HEI10_Lv0_GA_R(ggTTCG) CCGAAGACGGCTCGCGAACCTAGCGTGAACAGCTGAGGGCGGGAA (22)
MSH5_Lv0_GA_F(AATG) CCGAAGACGGCTCAAATGATGGAGGAAATGGAGGACACTG (23)
MSH5_Lv0_GA_R(ggTTCG) CCGAAGACGGCTCGCGAACCGGAAGTGAAGATATCTTGAAAG (24)
PTD_Lv0_GA_F(AATG) CCGAAGACGGCTCAAATGATGGCGACGGCGGGATCA (25)
PTD_Lv0_GA_R(ggTTCG) CCGAAGACGGCTCGCGAACCTCAGTTGAATTTGGGACTGAG (26)
pRPS5A_Lv0_F(GGAG) CCGAAGACGGCTCAGGAGCCATAATCGTGAGTAGATATATTACTCAAC (27)
pRPS5A_Lv0_R(AATG) CCGAAGACGGCTCGCATTGGCTGTGGTGAGAGAAACAGAGCGTGAGCTC (28)
pREC8_Lv0_F(GGAG) CCCGAAGACGGCTCAGGAGATGGAGGTAGCGGGATAATTGA (29)
pREC8_Lv0_R(AATG) CCCGAAGACGGCTCGCATTCCCGCGTGCAATGTAGCGGCCATCCTTAAGAAGAAGAAA (30)
pASY1(1.3kb)_Lv0_F(GGAG) CCCGAAGACGGCTCAGGAGTGGCAGGATATATTGTGGTG (31)
pASY1_Lv0_R(AATG) CCCGAAGACGGCTCGCATTCCTTTTGCAGAAGTGTGAAACGA (32)
pSPO11-1_Lv0_F(GGAG) CCCGAAGACGGCTCAGGAGGACCTCTCTGTTCTTAATTCC (33)
pSPO11-1_Lv0_R(AATG) CCCGAAGACGGCTCGCATTCCCTCTTTCGAGTTTCAAAACTGAAA (34)
pSDS_Lv0_F(GGAG) CCCGAAGACGGCTCAGGAGTGGCAGGATATATTGTGGTG (35)
pSDS_Lv0_R(AATG) CCCGAAGACGGCTCGCATTCCTTTTTCTCCGTACGAAAGCTTGAAA (36)
2. EMS (Ethyl methanesulfonate) 처리를 통한 돌연변이 유도
420 (GR/GR) 동형접합체와 야생형 애기장대(Col-0)의 교배로부터 획득된 420 GR/++ 반접합체(hemizygote) 식물체의 약 10,000개 종자를 100 mM의 인산 완충액(pH 7.5) 40 ㎖에 1시간 동안 담가둔 후 신선한 인산 완충액으로 세척하고, 0.3%(v/v) EMS를 처리하고 상온에서 12시간 동안 반응시켰다(도 1a). EMS 처리한 종자는 증류수로 10회 세척하고 즉시 토양에 심었다. 이들 종자로부터 약 7,000개의 M1 식물체가 발아되고 성장되었다. 12개의 독립적인 M1 식물체로부터 종자를 결합하여 약 600개의 M2 집단을 생성하였다. 각 M2 집단으로부터 약 150개 종자를 빨간색과 녹색의 형광에 근거하여 420 GR/++ 반접합체로 지정하고 생장시켜 자가 수정하였다. 이로부터 유래된 종자를 420 교차 빈도(crossover frequency) 분석에 사용하였다.
3. 형광 종자 및 형광 꽃가루를 이용한 교차 빈도 및 간섭의 측정
교차 빈도는 CellProfiler 이미지 분석 프로그램을 사용하여 FTL/++ 반접합체 식물체의 형광 및 비형광 종자를 계수하여 분석하였다. CellProfiler는 녹색 단독 형광 종자(NGreen), 빨간색 단독 형광 종자(NRed) 및 총 종자수(NTotal)를 정량화할 수 있고, 교차 빈도(cM)는 하기의 공식을 통해 계산되었다. 유전자형간의 교차 빈도 유의성 검증은 Welch's t-test를 사용하였다.
cM = 100 x (1-[1[2(NGreen+NRed)/NTotal]1/2)
꽃가루 FTLs은 qrt-1 돌연변이 배경에서 제조되었으며, 웅성 감수분열의 4개 꽃가루 생성물이 서로 붙어있다. FTLs은 LAT52 프로모터의 조절하에 eYFP (Y), dsRed (R) 또는 eCFP (C)를 발현한다. 꽃가루 사분자(pollen tetrad) FTL-기반 교차 빈도 및 간섭의 측정은 DeepTetrad를 사용하여 수행하였다(Berchowitz, L. E. & Copenhaver, G. P. (2008) Nat. Protoc. 3:41-50; Lim, E. C. et al., (2020) Plant J. 101:473-483). DeepTetrad는 딥러닝(deep-learning) 기반 이미지 분석 시스템으로, FTL intervals의 꽃가루 사분자 종류를 인식할 수 있다.
FTL interval (I1bc, I1fg, I2fg, I3bc 및 I5ab)은 12개의 사분자 종류를 생산한다: no recombination (A), single crossover interval 1 (B; SCO-i1), single crossover interval 2 (C; SCO-i2), two-strand double crossover (D; 2st DCO), three-strand double crossover a (E; 3st DCOa), three-strand double crossover b (F; 3st DCOb), four-strand double crossover (G; 4st DCO), non-parental ditype interval 1, non-crossover interval 2 (H; NPD-i1 NCO-i2), non-crossover interval 1, non-parental ditype interval 2 (I; NCO-i1 NPD-i2), non-parental ditype interval 1, single crossover interval 2 (J; NPD-i1 SCO-i2), single crossover interval 1, non-parental ditype interval 2 (K; SCO-i1 NPD-i2) 및 non-parental ditype interval 1, non-parental ditype interval 2 (L; NPD-i1 NPD-i2). 형광 종자 상태는 DeepTetrad를 사용하여 확인하였고, 교차 빈도 및 간섭은 Perkin's 방정식을 사용하여 계산하였다.
두 개의 연결된 interval에서 교차 간섭률(IFR=σ)은 인접한 교차 Xγ를 가진 유전자 지도 거리 대 인접한 교차 Xδ를 포함하지 않는 유전자 지도 거리의 비율로, 다음의 공식을 사용하여 DeepTetrad로 계산하였다.
Figure PCTKR2024012205-appb-img-000001
4. DNA 시퀀싱과 SHOREmap을 이용한 hcr3 돌연변이의 확인
야생형보다 높은 420 교차 빈도를 가지는 50개의 hcr3 BC1F2 개체를 확인하였고, 각 BC1F2 개체로부터 획득한 종자 5 ㎎을 모았다. 멸균된 종자를 1/2 MS 고체 배지에서 발아시키고 7일령의 유묘를 수집하였다. 모은 유묘 약 3 g을 액체 질소를 이용하여 분말화하였다. 상기 분말을 40 ㎖의 nuclear isolation 버퍼(25 mM Tris-HCl, pH 7.5, 0.44 M sucrose, 10 mM MgCl2, 0.5% Triton X-100, 10 mM β2 mM spermine, EDTA-free Protease Inhibitor Cocktail)를 사용하여 균질화하였다. 용해물은 교반하여 얼음에서 30분간 반응시킨 후 4℃, 3,000 g에서 25분간 원심분리하고 펠렛 부분을 CTAB (Cetyl trimethylammonium bromide)를 이용한 DNA 추출에 사용하였다. 추출 및 정제한 DNA는 Bioruptor sonicator를 사용하여 200-500 bp 크기로 잘랐다. 정제된 DNA를 Illumina Truseq Nano DNA LT library prep kit를 사용하여 라이브러리 구축에 사용하였고 hcr3 BC1F2 라이브러리는 Illumina Genome Analyser (100 bp paired) Hiseq 2000 장비를 사용하여 시퀀싱하였다.
Paired-end reads를 GenomeMapper 툴을 사용한 TAIR10 참조 게놈에 정렬하기 위해 SHOREmap (v.3.0)을 사용하였다. 원시 reads는 SHORE import 기능을 사용하여 +33 또는 +64의 Phred 점수 컷 오프를 가진 quality value에 따라 다듬고, SHORE consensus 기능을 사용하여 hcr3 BC1F2와 TAIR10 참조 어셈블리간 서열 변이를 검출하였다. 높은 마커 점수(>40)를 가진 SNP (Single nucleotide polymorphism)를 SHOREmap backcross 기능을 사용한 대립유전자 빈도 분석에 사용하였다. 돌연변이는 (i) 80% 이상의 대립유전자 빈도 및 (ⅱ) 예측된 유전자 내에서 비동의(non-synonymous) 변이, splice site 또는 조기종결코돈 변화를 가진 것들을 스크리닝하였다. 또한 후보 돌연변이는 감수분열, 핵 내 단백질 위치 및 TAIR 데이터베이스에 제공된 알려진 분자 기능과 관련하여 예측되거나 알려진 기능을 가진 유전자 내의 위치를 기반으로 검사되었다.
5. J3의 우성 음성 대립유전자(dominant negative allele) HCR3 의 확인
HCR3/J3의 2.2kb 프로모터와 유전자를 포함하는 4.1kb의 게노믹 DNA 단편을 pPZP211-gJ3_GA_F 및 pPZP211-gJ3_GA_R 프라이머 세트를 이용하여 증폭하였다. PCR 산물은 Gibson assembly 방법을 이용해 pPZP211 벡터로 클로닝하였다. 클로닝된 벡터를 전기천공법(electroporation)으로 아그로박테리움 GV3101-pSoup 균주로 도입하고, 상기 아그로박테리움 균주를 꽃대 침지법(floral dipping)으로 식물체에 형질전환하였다. T1 식물체는 카나마이신 저항성과 HCR3/J3 전이유전자의 특이적인 프라이머 세트를 사용한 유전형분석을 통해 선별하였다.
6. J3 계통도
J3 계통도를 구축하기 위해 neighbour-joining 방법을 사용하였다. 다중 서열 정렬에 사용된 아미노산 정보는 다음과 같다: AtJ3, AtJ2, OsDNAJ (XP 015630926.1), SlDNAJ-like (NP 001234241.2), GmDNAJ (NP 0001354212.1), PpDNAJ (XP024402168.1), XlDNAJA2 (NP 001080625.1), DrDNAJ (NP 998658.1), CeDNAJ (NP 493570.1), HsDNAJA1 (NP 001530.1), DmDnaJ-like-2 (NP 650283.1), ScYDJ1, SpMas5 (NP 595428.1), EcHSP40.
7. HCR3/J3 우성 음성 돌연변이 식물체 제조
HCR3 우성 음성 대립유전자 발현 식물체를 제조하기 위해서 J3, DMC1, RPS5A, REC8, ASY1, SPO11-1, 또는 SDS 유전자의 프로모터 및 5'-UTR을 포함하는 야생형 게노믹 DNA를 정방향 및 역방향 프라이머로 증폭한 후 Lv0 벡터(pICH41331)로 클로닝하였다. HCR3/J3 게노믹 DNA는 hcr3 돌연변이 식물의 게노믹 DNA로부터 정방향 및 역방향 프라이머로 증폭하여 Lv0 벡터(pICH41331)로 클로닝하였다. 각 프로모터 및 hcr3 Lv0 벡터를 Lv1 position 2 vector (pICH47742)로 조립하였다. 만들어진 Lv1 벡터는 링커(pICH41744) 및 항생제 내성 유전자 BAR (pICSL11017)와 함께 Lv2 바이너리 벡터(pAGM4723)에 조립되었다. Lv2 바이너리 벡터는 아그로박테리움 균주 GV3101-pSoup로 도입되었고, 꽃대 침지법을 통해 애기장대를 형질전환시켰다.
8. F2 식물체의 GBS 및 교차 확인
시퀀싱 라이브러리 준비를 위해 J3:J3G155R Col/Ler F2 96 개체로부터 CTAB를 사용하여 게노믹 DNA를 추출하였다. DNA 150 ng을 0.3 unit의 dsDNA Shearase (Zymo Research)를 사용하여 단편화시키고(최종 부피 15 ㎕), 잘린 DNA는 20℃에서 30분 동안 30 ㎕의 반응 용액(3 units of T4 DNA polymerase (New England Biolabs), 10 units of T4 polynucleotide kinase (Thermo Fisher Scientific), 1.25 units of Klenow fragment (New England Biolabs) 및 0.4 mM dNTPs)에서 말단-수선시켰다. DNA 단편은 AMPure XP magnetic SPRI bead (Beckman-Coulter, A63881)를 이용하여 정리하였다. DNA는 A-tail이고, 기존에 기술된 방법(Rowan, B. A., et al., (2015) G3 (Bethesda). 5:385-98)에 따라 20 ㎕의 반응 부피로 바코드된 Illumina 어댑터와 결합시켰다. 8개의 DNA 라이브러리를 30 ㎕ 용출 버퍼(10 mM Tris-HCl, pH 8.0)에 풀링, 세척 및 용출하였다. 16 ㎕의 AMPure XP magnetic SPRI bead를 포함하고 있는 튜브에 30 ㎕의 혼합물을 넣고, 상온에서 5분간 반응시킨 후, 시료를 magnetic rack에 2분간 놓아둔 후 상층액(42 ㎕)을 새로운 튜브로 옮기고 0.23배의 SPRI bead와 섞어주었다. 상온에서 5분간 반응시킨 후, magnetic rack에 2분간 놓아둔 후 상층액을 제거하고 bead를 80% 에탄올로 30초간 세척하는 과정을 2회 반복하였다. 그 후 bead를 10분간 공기로 말리고 20 ㎕의 10 mM Tris (pH 8.0)를 이용하여 DNA를 용출시켰다. 용출물 12 ㎕를 KAPA HiFi Hot-Start ReadyMix PCR kit (Kapabiosystems)와 알려진 DNA 올리고뉴클레오티드(Rowan, B. A., et al., (2015))를 사용하여 PCR 증폭시켰다. PCR 산물은 SPRI bead를 사용하여 정제하였고 Bioanalyzer를 통해 정량화하였다. 6개의 바코드 라이브러리는 Illumina HiSeqX 기기를 사용하여 페어링 엔드 150bp 시퀀싱에 따라 수행되었다.
9. 야생형 및 hcr3 의 감수분열모세포의 세포학적 분석
애기장대 감수분열모세포의 염색체 실험은 이전의 보고 (Chelysheva, L. et al. (2010) Cytogenet. Genome Res. 129:143-53)에서와 같이 고정된 꽃봉오리와 DAPI 염색을 통해 준비되었다. 세사기에서 태사기 기간의 세포는 ASY1과 J3에 대해 면역염색되었고, 후기 태사기 세포는 HEI10에 대해, 복사기에서 이동기의 세포는 MLH1에 대해 면역염색되었다. 세사기 단계 감수분열모세포는 신선한 꽃봉오리를 이용하여 ASY1과 RAD51에 대해 면역염색되었다. α-ASY1(rat, 1:200 또는 1:500 희석), α-ZYP1(rabbit, 1:200 희석), α-MLH1(rabbit, 1:200 희석), α-RAD51(rabbit, 1:300 희석) 등의 항체가 사용되었다. 현미경 검사는 CDD Coolsnap HQ2 카메라가 장착된 DeltaVision personal DV 현미경(Applied precision/GE Healthcare)을 사용해 수행되었다. 이미지 캡처는 SoftWoRx 소프트웨어 버전 5.5를 사용하여 수행되었다. 세사기 단계 핵의 ASY1과 RAD51 공동-면역염색에는 각각 0.2 μM의 광학구간 10개의 Z-stack으로 개별 세포 이미지를 획득하였고, ImageJ를 이용하여 각 셀에 대한 최대 강도 투영을 결정하였다. 감수분열 세포당 MLH1 foci 수, 세포당 RAD51 foci 수는 축 단백질 ASY1과 관련된 값을 수동으로 점수화하였다. Welch's test는 야생형과 hcr3에서 MLH1 및 RAD51 foci의 유의미한 차이를 평가하기 위해 사용되었다.
10. 원형질체 및 형질전환 식물체에서의 ZMM 단백질 정량 분석
원형질체 일시적 발현 벡터는 골든 게이트 클로닝을 사용하여 구축되었다. PCR로 증폭된 HCR3/J3, HEI10, PTD, MSH5 게노믹 DNA는 Lv0 유니버설 벡터(pICH41331)로 복제되었다. 에피토프 표지를 위해 정지 코돈이 결여된 코딩 지역을 가지는 Lv0 벡터를 35S 프로모터 벡터(pICH51266), N-말단 또는 C-말단 벡터(Myc tag/pICSL50010 및 HA tag/pICSL50009) 및 NOS 터미네이터 벡터(pICH41421)를 사용하여 Lv1 벡터(pICH4742)에 조립하였다.
에피토프 표지가 달린 단백질이 발현되는 형질전환 식물체를 만들기 위해 상기 방법으로 제작된 HCR3/J3 Lv1 백터와 각 HEI10, PTD, MSH5 Lv1 벡터는 링커(pICH41744) 및 항생제 내성 유전자 BAR (pICSL11017)와 함께 Lv2 바이너리 벡터 (pAGM4723)에 조립되었다. 완성된 Lv2 바이너리 벡터는 아그로박테리움 균주 GV3101-pSoup로 도입되었고, 꽃대 침지법을 통해 애기장대를 형질전환시켰다.
플라스미드 DNA와 엽육(mesophyll) 원형질체는 이전에 기술된 방법(Hwang, I. & Sheen, J. (2001) Nature 413:383-389)에 따라 준비되었다. 4x104개의 원형질체는 40 ㎍의 총 플라스미드 DNA로 형질주입(transfection)시키고, 상온에서 10시간 동안 배양되었다. 총 단백질은 추출 버퍼(50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 5 mM EDTA, 1 mM dithiothreitol, protease inhibitor cocktail (Roche) 및 1% Triton X-100)를 사용하여 추출하였고, 추출된 버퍼는 8% 폴리아크릴아미드 겔을 사용하여 SDS-PAGE로 전개시켰으며, 니트로셀룰로스 멤브레인으로 트랜스퍼 후 anti-HA-HRP (1:2,000 Roche 12013819001) 또는 anti-Myc-HRP (1:2,000 Santa Cruz sc-9E10) 항체를 사용하여 확인하였다.
생체 내 단백질 분석으로는 5-6주 사이의 감수분열모세포를 포함하는 어린 꽃봉오리를 0.1 g가량 수집하여 액체질소를 이용하여 분말화하였다. 총 단백질은 용해 완충액(25mM HEPES, 5mM, EDTA, 2% SDS)을 사용하여 추출하였고 이후 과정은 상기 방법과 동일하게 진행되었다.
실시예 1. HCR3/J3 돌연변이를 통한 교차 증가
이전의 연구들을 통해 식물에서의 교차 수 증가는 교차 억제 유전자들(FANCM, RECQ4A/B, FIGL1, HCR1/PPX1)의 돌연변이 또는 교차 촉진 유전자(HEI10)의 과발현을 통해 이룰 수 있음이 알려졌다. 본 발명에서는 새로운 교차 억제 유전자를 확보하기 위해 형광 종자 교차 측정 라인에 EMS를 처리하고 교차가 증가된 돌연변이를 스크리닝하였다(도 1).
그 결과로 교차가 증가한 hcr3 돌연변이체를 확보하였고, NGS (next-generation sequencing)를 통해 돌연변이체의 교차 증가 원인이 J3 샤페론을 암호화하는 At3g44110 유전자의 돌연변이 발생에 기인한 것임을 확인하였다(도 2). J3 유전자에 T-DNA 삽입으로 유도된 J3 기능상실 돌연변이체에서 교차 증가가 확인되었으며(도 2c), J3 우성 음성 돌연변이 대립유전자가 발현될 때 식물체에 내인하는 J3 상동유전자들의 기능을 억제함으로써 단일 유전자의 기능상실 돌연변이보다 추가적인 교차 증가를 일으키는 것을 확인하였다(도 2d). 교차 조절 유전자의 전사체 발현 변화를 통해 교차율을 조절하는 사례는 이전 연구들을 통해 보고되었으나, 감수분열동안 교차 조절 단백질의 수준을 조절하여 교차 증가의 표현형을 확인한 사례는 본 발명에서 최초로 보고되는 내용이다.
실시예 2. 감수분열 특이적 HCR3 유전자 발현을 통한 교차 증가
J3 샤페론은 식물체가 생장하는데 적합하지 않은 고온 등의 조건에서 단백질 안정화에 기여한다. J3의 기능상실 돌연변이체는 환경변화에 식물체의 대응능력이 떨어지게 되고 J3의 상동유전자인 J2와 이중 돌연변이가 되면 발달 초기에 식물이 치사된다. 따라서, J3의 우성 음성 돌연변이형을 감수분열 특이적으로 발현시키기 위해 감수분열 특이적인 프로모터를 사용해 교차율 증가 패턴을 확인하였다(도 2e). SPO11-1 프로모터를 사용하였을 때 내인 J3 프로모터보다 높은 교차율 증가를 보이는 식물체를 얻었고, 이러한 양상은 J3 우성 음성 돌연변이체의 발현양에 비례하여 교차율이 증가함을 확인하였다(도 2f). 또한, SPO11-1 프로모터를 사용해 J3 우성 음성 돌연변이를 잡종세대에서 발현시켰을 때에도 마찬가지로 내인 J3 프로모터를 사용했을 때보다 높은 교차율을 확인하였다(도 4k 및 4l). 이 결과를 통해 다양한 프로모터를 사용해서 J3 우성 음성 돌연변이의 발현 시점과 양을 조절함으로써, 교차율을 증가폭을 가감할 수 있음을 확인했다.
실시예 3. 교차 억제 유전자들과 hcr3 이중 돌연변이를 통한 추가적인 교차 수 증가
기존 연구에서 알려진 Class Ⅱ 교차 억제 유전자들(FANCM, RECQ4A/4B) 및 Class I 교차 억제 유전자들(HCR1, HCR2)과 hcr3를 이중 또는 삼중 돌연변이로 만들었을 때 교차 수가 단일 돌연변이에 비해 추가적으로 증가하는 것을 확인하였다(도 7e). 이는 기존에 확립된 교차율 증가 방법에서 추가적으로 교차 수를 증가시킬 수 있기 때문에 중요한 의미를 가진다.

Claims (13)

  1. J3 샤페론 단백질의 기능을 저해하는 단계를 포함하는, 식물 세포의 감수분열 동안에 상동 염색체의 교차(crossover) 재조합 수를 증가시키는 방법.
  2. 제1항에 있어서, 상기 J3 샤페론 단백질의 기능 저해는 J3 샤페론 단백질 코딩 유전자의 발현을 저해하거나, J3 샤페론 단백질 코딩 유전자에 T-DNA를 삽입하여 기능상실 돌연변이체를 유도하거나, J3 샤페론 우성 음성 돌연변이 단백질 코딩 유전자의 발현을 증가시켜 이루어지는 것을 특징으로 하는, 식물 세포의 감수분열 동안에 상동 염색체의 교차 재조합 수를 증가시키는 방법.
  3. 제2항에 있어서, 상기 J3 샤페론 단백질은 서열번호 3의 아미노산 서열로 이루어진 것이며, J3 샤페론 우성 음성 돌연변이 단백질은 서열번호 3의 아미노산 서열에서 155번째 아미노산이 글리신(glycine)에서 아르기닌(arginine)으로 치환된 것을 특징으로 하는, 식물 세포의 감수분열 동안에 상동 염색체의 교차 재조합 수를 증가시키는 방법.
  4. 제2항에 있어서, 상기 J3 샤페론 우성 음성 돌연변이 단백질 코딩 유전자의 발현은 구성적 프로모터 또는 감수분열 특이적 프로모터에 의해 조절되는 것을 특징으로 하는, 식물 세포의 감수분열 동안에 상동 염색체의 교차 재조합 수를 증가시키는 방법.
  5. 제1항에 있어서, 상기 J3 샤페론 단백질의 기능 저해와 동시에, 하나 이상의 교차 억제 단백질의 발현 또는 기능을 추가로 저해하는 것을 특징으로 하는, 식물 세포의 감수분열 동안에 상동 염색체의 교차 재조합 수를 증가시키는 방법.
  6. 제5항에 있어서, 상기 교차 억제 단백질은 FANCM (Fanconi anemia group M protein), RECQ4A (ATP-dependent DNA helicase Q-like 4A), RECQ4B, FIGL1 (AAA-ATPase FIDGETIN-LIKE 1), HCR1 (HIGH CROSSOVER RATE 1/PROTEIN PHOSPHATASE X1) 또는 HCR2 (HIGH CROSSOVER RATE 2/HEAT SHOCK FACTOR BINDING PROTEIN)인 것을 특징으로 하는, 식물 세포의 감수분열 동안에 상동 염색체의 교차 재조합 수를 증가시키는 방법.
  7. 식물 세포에서 J3 샤페론 단백질 코딩 유전자의 발현을 저해하거나, J3 샤페론 단백질 코딩 유전자에 T-DNA를 삽입하여 기능상실 돌연변이체를 유도하거나, J3 샤페론 우성 음성 돌연변이 단백질 코딩 유전자의 발현을 증가시키는 단계를 포함하는, 야생형에 비해 상동 염색체의 교차 재조합 수가 증가된 형질전환 식물체의 제조방법.
  8. 제7항에 있어서, 상기 J3 샤페론 단백질은 서열번호 3의 아미노산 서열로 이루어진 것이며, J3 샤페론 우성 음성 돌연변이 단백질은 서열번호 3의 아미노산 서열에서 155번째 아미노산이 글리신(glycine)에서 아르기닌(arginine)으로 치환된 것을 특징으로 하는, 야생형에 비해 상동 염색체의 교차 재조합 수가 증가된 형질전환 식물체의 제조방법.
  9. 제7항의 방법으로 제조된 야생형에 비해 상동 염색체의 교차 재조합 수가 증가된 형질전환 식물체.
  10. 제9항에 따른 식물체의 형질전환된 종자.
  11. J3 샤페론 단백질의 기능을 저해하는 물질을 유효성분으로 포함하는, 식물 세포의 감수분열 동안에 상동 염색체 교차 재조합 수 증가용 조성물.
  12. 제11항에 있어서, 상기 J3 샤페론 단백질의 기능 저해 물질은 J3 샤페론 단백질에 특이적으로 결합하는 화합물, 펩티드, 펩티드 모방체, 기질 유사체, 앱타머 및 항체로 이루어진 군에서 선택되는 하나 이상; 또는 J3 샤페론 단백질 코딩 유전자의 발현을 저해하는 안티센스올리고뉴클레오티드, siRNA (small interfering RNA), shRNA (small hairpin RNA), miRNA (microRNA) 및 리보자임(ribozyme)으로 이루어진 군에서 선택되는 하나 이상인 것을 특징으로 하는 조성물.
  13. 제11항에 있어서, 상기 조성물은 FANCM (Fanconi anemia group M protein), RECQ4A (ATP-dependent DNA helicase Q-like 4A), RECQ4B, FIGL1 (AAA-ATPase FIDGETIN-LIKE 1), HCR1 (HIGH CROSSOVER RATE 1/PROTEIN PHOSPHATASE X1) 및 HCR2 (HIGH CROSSOVER RATE 2/HEAT SHOCK FACTOR BINDING PROTEIN)로 이루어진 군으로부터 선택되는 하나 이상의 단백질의 기능 저해 물질을 추가로 포함하는 것을 특징으로 하는 조성물.
PCT/KR2024/012205 2023-11-21 2024-08-16 식물에서 감수분열의 염색체 교차 재조합을 증가시키는 j3 샤페론 및 이의 용도 Pending WO2025110412A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2023-0161858 2023-11-21
KR1020230161858A KR102887451B1 (ko) 2023-11-21 2023-11-21 식물에서 감수분열의 염색체 교차 재조합을 증가시키는 j3 샤페론 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2025110412A1 true WO2025110412A1 (ko) 2025-05-30

Family

ID=95826962

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2024/012205 Pending WO2025110412A1 (ko) 2023-11-21 2024-08-16 식물에서 감수분열의 염색체 교차 재조합을 증가시키는 j3 샤페론 및 이의 용도

Country Status (2)

Country Link
KR (1) KR102887451B1 (ko)
WO (1) WO2025110412A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090126039A1 (en) * 2004-12-24 2009-05-14 Cropdesign N.V. Plants Having Increased Yield And Method For Making The Same
KR20220022237A (ko) * 2020-08-18 2022-02-25 포항공과대학교 산학협력단 식물 세포에서 감수분열의 염색체 교차 재조합을 증가시키는 Protein phosphatase 4 복합체 및 이의 용도
KR20220086037A (ko) * 2020-12-16 2022-06-23 서울대학교산학협력단 식물체의 재분화 효율을 조절하는 애기장대 유래 hda6 유전자 및 이의 용도
KR20220086041A (ko) * 2020-12-16 2022-06-23 서울대학교산학협력단 식물체의 재분화 효율을 조절하는 애기장대 유래 arp6 유전자 및 이의 용도
KR20220161666A (ko) * 2021-05-31 2022-12-07 경상국립대학교산학협력단 식물병에 대한 저항성 또는 감수성을 조절하는 고추 유래의 rlp 유전자 및 이의 용도

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090126039A1 (en) * 2004-12-24 2009-05-14 Cropdesign N.V. Plants Having Increased Yield And Method For Making The Same
KR20220022237A (ko) * 2020-08-18 2022-02-25 포항공과대학교 산학협력단 식물 세포에서 감수분열의 염색체 교차 재조합을 증가시키는 Protein phosphatase 4 복합체 및 이의 용도
KR20220086037A (ko) * 2020-12-16 2022-06-23 서울대학교산학협력단 식물체의 재분화 효율을 조절하는 애기장대 유래 hda6 유전자 및 이의 용도
KR20220086041A (ko) * 2020-12-16 2022-06-23 서울대학교산학협력단 식물체의 재분화 효율을 조절하는 애기장대 유래 arp6 유전자 및 이의 용도
KR20220161666A (ko) * 2021-05-31 2022-12-07 경상국립대학교산학협력단 식물병에 대한 저항성 또는 감수성을 조절하는 고추 유래의 rlp 유전자 및 이의 용도

Also Published As

Publication number Publication date
KR20250075773A (ko) 2025-05-29
KR102887451B1 (ko) 2025-11-18

Similar Documents

Publication Publication Date Title
Liu et al. Wheat TaSPL8 modulates leaf angle through auxin and brassinosteroid signaling
Li et al. The heat shock factor 20-HSF4-cellulose synthase A2 module regulates heat stress tolerance in maize
Li et al. TAC4 controls tiller angle by regulating the endogenous auxin content and distribution in rice
Tucker et al. Molecular identification of the wheat male fertility gene Ms1 and its prospects for hybrid breeding
Sun et al. Genetic improvement of the shoot architecture and yield in soya bean plants via the manipulation of GmmiR156b
Liu et al. DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis
JP2019524147A (ja) 収穫可能収量を増加させるためのジベレリン代謝操作を介して低草高植物を得るための方法及び組成物
CN103290027B (zh) 一种调控叶绿体发育蛋白质及其基因和应用
EP2308986A1 (en) Artificial plant minichromosomes
Dou et al. CLA4 regulates leaf angle through multiple hormone signaling pathways in maize
Mao et al. Rice MutLγ, the MLH1–MLH3 heterodimer, participates in the formation of type I crossovers and regulation of embryo sac fertility
Zheng et al. Factor of DNA methylation 1 affects woodland strawberry plant stature and organ size via DNA methylation
WO2024174954A1 (zh) 小麦广谱抗白粉病基因wtk7-tm克隆、功能标记及其应用
Liu et al. The ESCRT‐I components VPS28A and VPS28B are essential for auxin‐mediated plant development
Ren et al. Os SHOC 1 and Os PTD 1 are essential for crossover formation during rice meiosis
Wang et al. GAMETOPHYTE DEFECTIVE 1, a putative subunit of RNases P/MRP, is essential for female gametogenesis and male competence in Arabidopsis
Ma et al. Arabidopsis exoribonuclease USB1 interacts with the PPR-domain protein SOAR1 to negatively regulate abscisic acid signaling
Fang et al. Natural variation of MS2 confers male fertility and drives hybrid breeding in soybean
Jiang et al. The Arabidopsis cohesin protein SYN3 localizes to the nucleolus and is essential for gametogenesis
Qian et al. Arabidopsis mitochondrial single‐stranded DNA‐binding proteins SSB1 and SSB2 are essential regulators of mtDNA replication and homologous recombination
Chen et al. A wheat CC-NBS-LRR protein Ym1 confers WYMV resistance by recognizing viral coat protein
Dupouy et al. Plastid ribosome protein L5 is essential for post-globular embryo development in Arabidopsis thaliana
He et al. A natural variation in the promoter of TaGDSL‐7D contributes to grain weight and yield in wheat
Wei et al. Florigen‐like protein OsFTL1 promotes flowering without essential florigens Hd3a and RFT1 in rice
KR102410996B1 (ko) 식물 세포에서 감수분열의 염색체 교차 재조합을 증가시키는 Protein phosphatase 4 복합체 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 24894309

Country of ref document: EP

Kind code of ref document: A1