WO2025014949A1

WO2025014949A1 - Aptamers and sensors for detecting igg polypeptides

Info

Publication number: WO2025014949A1
Application number: PCT/US2024/037205
Authority: WO
Inventors: Gregory Allen Penner; Ashish Jagtiani
Original assignee: Chronus Health, Inc.
Priority date: 2023-07-10
Filing date: 2024-07-09
Publication date: 2025-01-16

Abstract

Provided herein are aptamers for binding immunoglobulin G (IgG) and methods of detecting IgG in a sample. The aptamers may be used for detecting the levels of IgG in a biological sample. Also provided herein is a sensor attached an aptamer for the detection of IgG.

Description

APTAMERS AND SENSORS FOR DETECTING IGG POLYPEPTIDES

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to and the benefit of United States Provisional Patent Application No. 63/512,880, the contents of which are hereby incorporated herein by reference in its entirety.

REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (794642000740SEQLIST.xml; Size: 37,091 bytes; and Date of Creation: July 4, 2024) is herein incorporated by reference in its entirety.

FIELD

[0003] The present disclosure relates to aptamers that specifically bind to an immunoglobulin G (IgG) polypeptide, including aptamers that may be used to detect IgG in a biological sample. The disclosure also describes a sensor that includes an aptamer that specifically binds to an IgG polypeptide for determining an amount of the IgG polypeptide in a biological sample, as well as methods of using said sensor.

BACKGROUND

[0004] The detection and/or quantification of immunoglobulins and other proteins or analytes in the blood of subjects can help with the diagnoses of different types of health conditions, disorders, or diseases. Clinical blood tests, such as a complete metabolic panel (CMP), attempts to determine a blood concentration of certain analytes, which allow doctors to more accurately diagnose or treat certain diseases. The quantification of immunoglobulin G (IgG) polypeptide blood concentration, for example, is useful for the diagnosis of diseases, including IgG deficiency, infection, inflammatory diseases, liver or kidney disease, or autoimmune diseases.

[0005] Aptamers are short single-stranded oligonucleotides that can fold into a secondary and/or tertiary structure capable of detecting and binding various molecules with high affinity and specificity. The capacity of the aptamers to bind to a target is a function of the interaction of charges presented by the aptamer and the target. Given that each target is different, there is a need for aptamers that bind to each target to possess a structure that specifically enables said binding. Additionally, the sequence of an aptamer results in a particular structure of the aptamer. It is this particular structure that enables affinity and specificity in target binding. Aptamers of different sequences can result in aptamers of the same enabling structure. Specific sequences of aptamers that all exhibit the same function (z.e., binding to a specific protein) can be considered in terms of consensus structures.

[0006] Aptamers that specifically bind target molecules are being increasingly investigated as diagnostic and therapeutic tools. However, despite this intensive investigation, few aptamers have developed beyond early-stage clinical development, and none have been approved in an U.S. FDA approved diagnostic. Therefore, there continues to be a need to design aptamers with high binding affinity and sufficient specificity.

SUMMARY

[0007] Provided herein are aptamers produced to bind an IgG polypeptide with high affinity and specificity. A selection process was used to identify aptamers that specifically bind IgG polypeptides. Successful IgG-binding aptamers exhibited an unhybridized adenine or thymidine rich segment (i.e., an A/T rich motif) in an unhybridized region of the aptamer structure. As further discussed herein, truncated sequences for each of the identified aptamers that included the unhybridized A/T rich motif maintained binding capacity to IgG.

Additionally, as further described herein, a motif analysis of the identified aptamers was performed to identify significant motifs for IgG binding in certain aptamer sequences.

[0008] Described herein is a sensor that comprises: a first electrode and a second electrode; a fluid channel for a fluidic sample between the first electrode the second electrode; and a plurality of aptamers attached to the first electrode that bind immunoglobulin G (IgG) polypeptides, the aptamers in the plurality of aptamers comprising an unhybridized A/T rich region comprising at least four contiguous nucleotides. The sensor may further comprise a control circuit configured to operate the first electrode and the second electrode and to detect an electrical signal between the first electrode and the second electrode. The electrical signal may based on a binding of the IgG polypeptide to the aptamer. In some implementations, the electrical signal is an impedance, a voltage, or a current.

[0009] Also described herein is an aptamer that binds an immunoglobulin G (IgG) polypeptide comprising at least one sequence selected from the group consisting of: (a) AATACAAAC; (b) GAAAGCC; (c) AAGCAA; (d) TCAAATATA; (e) TATACAG; (f) TCGAAG (g) ATTAAT; (h) CTTCGATT; (i) ATTTCA; (j) AAACTT; (k) GGAAACGA (1) TTGCTA; (m) AGGCCACAT; (n) CCAATCAAG; (o) AATTAT; (p) ATAAAG; (q) GCAAAATT; (r) TTGCTA; (s) TTACGATC; (t) TCACTAG; (u) AATTCCA; (v) CATCAT; (w) AAGCCA; and (x) ATTCATTACTCGACAACAAT (SEQ ID NO: 29). [0010] In some implementations, the aptamer comprises at least one sequence selected from the group consisting of AATACAAAC, GAAAGCC, and AAGCAA. In some implementations, the aptamer comprises a first sequence according to AATACAAAC GAAAGCC (SEQ ID NO: 30) and a second sequence according to AAGCAA. In some implementations, the aptamer comprises a sequence according to SEQ ID NO: 5.

[0011] In some implementations, the aptamer comprises at least one sequence selected from the group consisting of TCAAATATA, TATACAG, and TCGAAG. In some implementations, the aptamer comprises a first sequence according to TCAAATATACAG (SEQ ID NO: 31) and a second sequence according to TCGAAG. In some implementations, the aptamer comprises a sequence according to SEQ ID NO: 6.

[0012] In some implementations, the aptamer comprises at least one sequence selected from the group consisting of ATTAAT, CTTCGATT, ATTTCA, AAACTT, and GGAAACGA. In some implementations, the aptamer comprises a first sequence according to ATTAAT, a second sequence according to CTTCGATTTCA (SEQ ID NO: 32), a third sequence according to AAACTT, and a fourth sequence according to GGAAACGA. In some implementations, the aptamer comprises the second sequence at the fourth sequence are hybridized to each other. In some implementations, the aptamer comprises the third sequence is part of a loop structure that links the second sequence to the fourth sequence. In some implementations, the aptamer comprises a sequence according to SEQ ID NO: 7.

[0013] In some implementations, the aptamer comprises at least one sequence selected from the group consisting of TTGCT, AGGCCACAT, CCAATCAAG, AATTAT, and ATAAAG. In some implementations, the aptamer comprises a first sequence according to TTGCTAGGCCACAT (SEQ ID NO: 33), a second sequence according to CCAATCAAG, and a third sequence according to AATTATAAAG (SEQ ID NO: 34). In some implementations, the aptamer comprises a sequence according to SEQ ID NO: 8.

[0014] In some implementations, the aptamer comprises at least one sequence selected from the group consisting of GCAAAATT, TTGCTA, TTACGATC, and TCACTAT. In some implementations, the aptamer comprises a first sequence according to GCAAAATTGCTA (SEQ ID NO: 35), a second sequence according to TTACGATC, and a third sequence according to TCACTAT. In some implementations, the aptamer comprises a sequence according to SEQ ID NO: 9.

[0015] In some implementations, the aptamer comprises at least one sequence selected from the group consisting of AATTCCA, CATCAT, AAGCCA, and ATTCATTACTCGACAACAAT (SEQ ID NO: 29). In some implementations, the aptamer comprises a first sequence according to AATTCCATCAT (SEQ ID NO: 36) and a second sequence according to AAGCC ATTCATTACTCGACAACAAT (SEQ ID NO: 37). In some implementations, the aptamer comprises a sequence according to SEQ ID NO: 10.

[0016] Also described herein is an aptamer comprising a sequence according to any one of SEQ ID NOS: 5-28.

[0017] In some implementations of any of the above, the aptamer is a DNA aptamer or an XNA aptamer.

[0018] Further described herein is a sensor comprising: a first electrode and a second electrode; a fluid channel for a fluidic sample between the first electrode the second electrode; and a plurality of aptamers attached to the first electrode, the aptamer of the plurality of aptamers being according to any of the aptamers described herein. In some implementations, the sensor further comprises a control circuit configured to operate the first electrode and the second electrode and to detect an electrical signal between the first electrode and the second electrode. In some implementations, the electrical signal is based on a binding of the IgG polypeptide to the aptamer. In some implementations, the electrical signal is an impedance, a voltage, or a current.

[0019] Also described herein is a method of binding an IgG polypeptide to an aptamer, comprising contacting the IgG polypeptide with an aptamer as described herein.

[0020] Further described is a method of measuring an amount of IgG polypeptide in a fluidic sample, comprising: flowing the fluidic sample through the fluid channel of the sensor as described herein; binding IgG polypeptides in the fluidic sample to the plurality of aptamers; operating the control circuit to pass an electrical current or voltage across the fluid channel; and measuring the electrical signal, wherein the electrical signal is indicative of an amount of IgG polypeptides bound to the plurality of aptamers.

BRIEF DESCRIPTION OF THE DRAWINGS

[0021] FIG. 1 depicts a schematic of an exemplary modified SELEX selection process.

[0022] FIG. 2 depicts a schematic of the oligonucleotides included in an exemplary library for modified SELEX selection.

[0023] FIG. 3A depicts aptamer library enrichment being tracked by the proportion of library recovered after each selection round for HSA, IgG, and ALPL. FIG. 3B depicts relative proportions of the top twenty sequences in terms of relative frequency after SR10. FIG. 3C depicts the specificity of the top IgG aptamer sequences. [0024] FIGS. 4A-4C shows binding of candidate aptamers by SPR to pooled IgG (FIG. 4A), HSA (FIG. 4B), or IgG3 (FIG. 4C). FIG. 4D depicts a competition binding assay using pairs of IgG aptamers.

[0025] FIG. 5 depicts the full-length sequence structures of six exemplary IgG aptamers.

[0026] FIGS. 6A-6F depict significant sequence motifs to structure for exemplary aptamers cIgG-2 (FIG. 6A), cIgG-6 (FIG. 6B), cIgG-7 (FIG. 6C), cIgG-8 (FIG. 6D), cIgG-9 (FIG. 6E), and cIgG-13 (FIG. 6F).

[0027] FIG. 7 depicts exemplary truncated sequence structures of the six IgG aptamers.

[0028] FIG. 8 depicts the location of certain sequence motifs of the exemplary truncated aptamers.

[0029] FIG. 9 depicts an example (CIgG-8.2) of a further truncated sequence structure. [0030] FIGS. 10A-10F depict the binding of six exemplary truncated clgG aptamers to pooled IgG (FIG. 10A); to IgGl (FIG. 10B); to IgG2 (FIG. 10C); to IgG3 (FIG. 10D); to IgG4 (FIG. 10E); and HSA (FIG. 10F).

[0031] FIG. 11 illustrates an exemplary impedance sensor pair configured to measure the concentration of an analyte concentration.

[0032] FIG. 12A illustrates an exemplary impedance sensor that can be used for indirect detection or quantification of an analyte. The impedance sensor includes a MOSCap sensor. [0033] FIG. 12B shows a side view of the MOSCap sensor illustrated as part of the impedance sensor in FIG. 12A, along with an electrical model for the impedance sensor. [0034] FIG. 13 illustrates direct and indirect analyte measurements using the sensor illustrated in FIG. 12A and FIG. 12B.

DETAILED DESCRIPTION

[0035] Provided herein are aptamers produced to bind an IgG polypeptide with high affinity and specificity. The aptamers are synthetically derived, single-stranded oligonucleotides (e.g., DNA, RNA, or XNA oligonucleotides). A selection process was used to identify aptamers that specifically bind IgG polypeptides. Successful IgG-binding aptamers exhibited an unhybridized adenine or thymidine rich segment (i.e., an A/T rich motif) in an unhybridized region of the aptamer structure. As further discussed herein, truncated sequences for each of the identified aptamers that included the unhybridized A/T rich motif maintained binding capacity to IgG. Additionally, as further described herein, a motif analysis of the identified aptamers was performed to identify significant motifs for IgG binding in certain aptamer sequences. [0036] Accordingly, described herein are aptamers that bind to an IgG polypeptide. In some embodiments, the aptamer includes an unhybridized A/T rich region comprising at least four contiguous nucleotides. The A/T rich region includes adenine bases, thymidine bases, or both, but are not interspersed with other base types.

[0037] Significant motifs of the IgG polypeptide binding aptamers include: (a) AATACAAAC; (b) GAAAGCC; (c) AAGCAA; (d) TCAAATATA; (e) TATACAG; (f) TCGAAG (g) ATTAAT; (h) CTTCGATT; (i) ATTTCA; (j) AAACTT (k) GGAAACGA (1) TTGCTA; (m) AGGCCACAT; (n) CCAATCAAG; (o) AATTAT; (p) ATAAAG; (q) GCAAAATT; (r) TTGCTA; (s) TTACGATC; (t) TCACTAG; (u) AATTCCA; (v) CATCAT; (w) AAGCCA; and (x) ATTCATTACTCGACAACAAT (SEQ ID NO: 29). Accordingly, in some implementations, the IgG-binding aptamer includes one or more of these motifs (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 of the above motifs).

[0038] Further described herein is a sensor configured to detect IgG polypeptide in a sample. The sensor can include a first electrode and a second electrode, with a fluid channel for a fluidic sample (e.g., a blood or plasma sample, or a sample derived therefrom) to flow between the first and second electrodes. A plurality of the IgG-binding aptamers, for example as described herein, are attached to the first electrode. As the sample flows through the fluid channel of the sensor, IgG polypeptides in the fluidic sample can bind to the aptamers. An electrical signal change upon binding of the IgG polypeptides to the aptamers can be detected. For example, the sensor may further include a control circuit configured to operate the first electrode and the second electrode and to detect an electrical signal (e.g., an impedance, a voltage, or a current) between the first electrode and the second electrode. The electrical signal is thus based on the binding of the IgG polypeptide to the aptamer.

[0039] The current state of the art for the testing of immunoglobulin in a patient is to determine total protein measurement and an albumin measurement. The globulin fraction is determined by subtracting the albumin concentration from the total protein concentration. This represents an improvement for two reasons since total globulin is comprised of IgG and other globulins. The IgG fraction of this is the one that underlies the diagnosis of a potential medical condition. Here, amount of IgG directly, and it is not assumed that everything left in the protein after subtracting albumin is globulin. So, there is improvement in terms of accuracy with the measurement. This improved accuracy will improve diagnosis of medical conditions and prescription of appropriate treatment. As disclosed herein, the anti-IgG aptamers provide a more accurate way to detect and determine the IgG levels in a patient by determining the amount of IgG directly in the patient and is not determined indirectly by the measurement of total protein.

[0040] Also described herein is a method of detecting an IgG polypeptide level (e.g., concentration) in a biological sample. The method includes transporting the biological sample through a sensor as described herein. For example, the method may include flowing the fluidic sample through the fluid channel of the sensor; binding IgG polypeptides in the fluidic sample to the plurality of aptamers; operating the control circuit to pass an electrical current or voltage across the fluid channel; and measuring the electrical signal, wherein the electrical signal is indicative of an amount of IgG polypeptides bound to the plurality of aptamers.

[0041] All publications, including patent documents, scientific articles and databases, referred to in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference. If a definition set forth herein is contrary to or otherwise inconsistent with a definition set forth in the patents, applications, published applications and other publications that are herein incorporated by reference, the definition set forth herein prevails over the definition that is incorporated herein by reference.

[0042] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

I. IGG-BINDING APTAMERS

[0043] Provided herein are aptamers that specifically bind to IgG. IgG encompasses any isoforms or allelic variants of IgG, as well as fragments of IgG such as Fc region, any glycosylated forms, non-glycosylated forms, or post-translational modified forms of IgG. In some embodiments, the anti-IgG aptamers bind to at least one human subclass of IgG (z.e., IgGl, IgG2, IgG3, or IgG4). In some embodiments, the anti-IgG aptamers bind to more than one subclass of IgG. In some embodiments, the anti-IgG aptamers bind to the Fc domain of IgG. In some embodiments, the anti-IgG aptamers bind to the Fab region. In some embodiments, the anti-IgG aptamers bind to the VH region and/or the VL region.

[0044] In some embodiments, the IgG refers to a protein having the amino acid sequence of a human wild-type IgG, a fully-human IgG or a variant thereof, including chimeric IgG and humanized IgG. In some embodiments, the anti-IgG aptamer may bind to human plasma IgG, a recombinant or transgenic human IgG, as well as a chimeric or a humanized IgG. In some embodiments, the anti-IgG aptamer is able to bind a human IgG, regardless of its glycosylation. In some embodiments, the anti-IgG aptamer may be able to specifically bind to human plasma IgG and a recombinant IgG comprising a Fc domain of a human IgG, for instance a recombinant human IgG, a chimeric IgG or a humanized IgG produced in a recombinant host cell or in a transgenic multicellular organism.

[0045] In some embodiments, the aptamers disclosed herein are between 20 to 150 nucleotides in length. In some embodiments, the aptamers are between 50 to 100 nucleotides in length. In some embodiments, the aptamers are between 70 and 90 nucleotides in length. In certain embodiments, the aptamers are between 75 and 85 nucleotides in length. The aptamers disclosed herein may be 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89 or 90 nucleotides in length. In some embodiments, the nucleotides may be hybridized or unhybridized. In some embodiments, the aptamers comprise both hybridized and unhybridized regions.

[0046] In some embodiments, the aptamer includes an unhybridized A/T rich region comprising at least four contiguous nucleotides. The A/T rich region includes adenine bases, thymidine bases, or both, but are not interspersed with other base types.

[0047] In some embodiments, the IgG-binding aptamer includes one or more of (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 of) the following motifs(a) AATACAAAC; (b) GAAAGCC; (c) AAGCAA; (d) TCAAATATA; (e) TAT AC AG; (f) TCGAAG (g) ATTAAT; (h) CTTCGATT; (i) ATTTCA; (j) AAACTT (k) GGAAACGA (1) TTGCTA; (m) AGGCCACAT; (n) CCAATCAAG; (o) AATTAT; (p) ATAAAG; (q) GCAAAATT; (r) TTGCTA; (s) TTACGATC; (t) TCACTAG; (u) AATTCCA; (v) CATCAT; (w) AAGCCA; and (x) ATTCATTACTCGACAACAAT (SEQ ID NO: 29).

[0048] In some embodiments, the aptamer includes an unhybridized A/T rich region comprising at least four contiguous nucleotides and one or more of (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 of) the following motifs(a) AATACAAAC; (b) GAAAGCC; (c) AAGCAA; (d) TCAAATATA; (e) TATACAG; (f) TCGAAG (g) ATTAAT; (h) CTTCGATT; (i) ATTTCA; (j) AAACTT (k) GGAAACGA (1) TTGCTA; (m) AGGCCACAT; (n) CCAATCAAG; (o) AATTAT; (p) ATAAAG; (q) GCAAAATT; (r) TTGCTA; (s) TTACGATC; (t) TCACTAG; (u) AATTCCA; (v) CATCAT; (w) AAGCCA; and (x) ATTCATTACTCGACAACAAT (SEQ ID NO: 29).

[0049] In some embodiments, the aptamer comprises at least one sequence selected from the group consisting of AATACAAAC, GAAAGCC, and AAGCAA. In some embodiments, the aptamer comprises a first sequence of according to AATACAAACGAAAGCC (SEQ ID NO: 30) and a second sequence according to AAGCAA. In some embodiments, the aptamer comprises a sequence according to SEQ ID NO: 5. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the sequence set forth in SEQ ID NO: 5.

[0050] In some embodiments, the aptamer comprises at least one sequence selected from the group consisting of TCAAATATA, TATACAG, and TCGAAG. In some embodiments, the aptamer comprises a first sequence of according to TCAAATATACAG (SEQ ID NO: 31) and a second sequence according to TCGAAG. In some embodiments, the aptamer comprises a sequence according to SEQ ID NO: 6. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the sequence set forth in SEQ ID NO: 6.

[0051] In some embodiments, the aptamer comprises at least one sequence selected from the group consisting of ATTAAT, CTTCGATT, ATTTCA, AAACTT, and GGAAACGA. In some embodiments, the aptamer comprises a first sequence of according to ATTAAT, a second sequence according to CTTCGATTTCA (SEQ ID NO: 32), a third sequence according to AAACTT, and a fourth sequence according to GGAAACGA. In some embodiments, the aptamer comprises a sequence according to SEQ ID NO: 7. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the sequence set forth in SEQ ID NO: 7.

[0052] In some embodiments, the aptamer comprises at least one sequence selected from the group consisting of TTGCT, AGGCCACAT, CCAATCAAG, AATTAT, and ATAAAG. In some embodiments, the aptamer comprises a first sequence of according to TTGCTAGGCCACAT (SEQ ID NO: 33), a second sequence according to CCAATCAAG, and a third sequence according to AATTATAAAG (SEQ ID NO: 34). In some embodiments, the aptamer comprises a sequence according to SEQ ID NO: 8. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the sequence set forth in SEQ ID NO: 8.

[0053] In some embodiments, the aptamer comprises at least one sequence selected from the group consisting of GCAAAATT, TTGCTA, TTACGATC, and TCACTAT. In some embodiments, the aptamer comprises a first sequence of according to GCAAAATTGCTA (SEQ ID NO: 35), a second sequence according to TTACGATC, and a third sequence according to TCACTAT. In some embodiments, the aptamer comprises a sequence according to SEQ ID NO: 9. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the sequence set forth in SEQ ID NO: 9.

[0054] In some embodiments, the aptamer comprises at least one sequence selected from the group consisting of AATTCCA, CATC AT, AAGCCA, and ATTCATTACTCGACAACAAT (SEQ ID NO: 29). In some embodiments, the aptamer comprises a first sequence of according to AATTCCATCAT (SEQ ID NO: 36) and a second sequence according to AAGCC ATTCATTACTCGACAACAAT (SEQ ID NO: 37). In some embodiments, the aptamer comprises a sequence according to SEQ ID NO: 10. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the sequence set forth in SEQ ID NO: 10.

[0055] In some embodiments, the aptamers comprise a region rich in adenine or thymidine. In some embodiments, the aptamers comprise a region rich in both adenine and thymidine. In some embodiments, the region rich in adenine or thymidine comprises 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides. In some embodiments, the region rich in adenine and thymidine comprises 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides. In some embodiments, the region rich in A/T is comprised of at least 4 contiguous nucleotides. In some embodiments, the region rich in A/T may be a hybridized or unhybridized region. In a specific embodiment, the region rich in A/T is unhybridized. In a specific embodiment, the aptamers comprise an unhybridized A/T rich region comprising at least four contiguous nucleotides.

[0056] In some embodiments, the aptamers share a consensus (common) structural motif. The consensus structural motif of the aptamers may comprise hairpin loops, stem regions, dangling ends, internal loops, multiloops; and stem termini regions. In some embodiments, the common structural motif comprises two or more, three or more, four or more, or five or more of these regions. The presence of the consensus structural motif is a result of a specific sequence of each aptamer. In some embodiments, the sequence resulting in a consensus structural motif may comprises any one of sequences according to SEQ ID NOs: 23-28. [0057] In some embodiments, the aptamer comprises a sequence according to SEQ ID NO:

23. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the sequence set forth in SEQ ID NO: 23.

[0058] In some embodiments, the aptamer comprises a sequence according to SEQ ID NO:

24. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the sequence set forth in SEQ ID NO: 24.

[0059] In some embodiments, the aptamer comprises a sequence according to SEQ ID NO:

25. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the sequence set forth in SEQ ID NO: 25.

[0060] In some embodiments, the aptamer comprises a sequence according to SEQ ID NO:

26. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the sequence set forth in SEQ ID NO: 26.

[0061] In some embodiments, the aptamer comprises a sequence according to SEQ ID NO:

27. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the sequence set forth in SEQ ID NO: 27.

[0062] In some embodiments, the aptamer comprises a sequence according to SEQ ID NO:

28. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the sequence set forth in SEQ ID NO: 28. II. METHODS OF APTAMER SELECTION

A. MODIFIED SELEX METHOD

[0063] A modified SELEX method of selection was used to select the aptamers disclosed herein from a library containing random sequences. Systematic Evolution of Ligands by Exponential Enrichment (SELEX) has been broadly studied and improved for the selection of aptamers against small molecules and proteins (WO 91/19813). The modified SELEX processes for the selection of target-specific aptamers are characterized by repetition of five main steps: (1) binding of oligonucleotides to the target, (2) partition or removal of oligonucleotides with low binding affinity, (3) elution of oligonucleotides with high binding affinity, (4) amplification or replication of oligonucleotides with high binding affinity, and (5) conditioning or preparation of the oligonucleotides for the next cycle. This selection process is designed to identify the oligonucleotides with the greatest affinity and specificity for the target material.

[0064] SELEX cycles are usually repeated several times until oligonucleotides with high binding affinity are identified. The number of cycles depends on multiple variables, including target features and concentration, design of the starting random oligonucleotide library, selection conditions, ratio of target binding sites to oligonucleotides, and the efficiency of the partitioning step. In certain embodiments, the selection process comprises 5 cycles, 6 cycles, 7 cycles, 8 cycles, 9 cycles, 10 cycles, 11 cycles, 12 cycles, 13 cycles, 14 cycles, or 15 cycles. In a certain embodiment, the selection process comprises 10 cycles.

[0065] In some embodiments, the selection method comprises negative selection or counterselection steps. These steps can minimize the enrichment of oligonucleotides that bind to undesired targets or undesired epitopes within a target. In some embodiments, the method of selecting an aptamer composition as disclosed herein may further comprise the step of contacting: a) a mixture of oligonucleotides, b) a selection buffer, and c) one or more undesired targets. Methods for negative selection or counter- sei ection of aptamers against unbound targets have been published in WO201735666.

[0066] There are multiple factors that can influence the success of SELEX, including, but not limited to, molecule type, immobilization matrix, physicochemical properties of the target molecule, sequence diversity, chemical modifications, constant domains and primers, PCR bias, ssDNA regeneration, sequencing, selection stringency, countersei ection, and quality control. One skilled in the art can alter these variables to optimize the process for the selection of the anti-IgG aptamers disclosed herein. [0067] Aptamers can be ribonucleotides (RNA), deoxynucleotides (DNA), or their derivatives (XNA). When aptamers are ribonucleotides, the first SELEX step may consist in transcribing the initial mixture of chemically synthesized DNA oligonucleotides via the primer recognition sequence at the 5' end. After selection, the candidates are converted back into DNA by reverse transcription before being amplified. RNA and DNA aptamers having comparable characteristics have been selected against the same target and reported in the art. Additionally, both types of aptamers can be competitive inhibitors of one another, suggesting potential overlapping of interaction sites. Derivatives of ribonucleotides or said derivatives of deoxyribonucleotides may be selected from the group comprising locked oligonucleotides, peptide oligonucleotides, glycol oligonucleotides, threose oligonucleotides, hexitol oligonucleotides, altritol oligonucleotides, butyl oligonucleotides, L-ribonucleotides, arabino oligonucleotides, 2 '-fluoroarabino oligonucleotides, cyclohexene oligonucleotides, phosphorodiamidate morpholino oligonucleotides, and mixtures thereof.

B. Truncations and Post-Selection Modification

[0068] After the selection process, the aptamers may be modified in order to enhance stability, improve affinity, and/or improve specificity. Such modifications include, but are not limited to, chemical modifications, enzymatic modifications, random incorporation of modified nucleotides, chemical labeling, sequence truncations, and the linking of combinations of aptamers. In some embodiments, the truncations may remove regions that are not essential for binding or for folding into the structure. A full-length aptamer is in constant flux among many different structures. In some embodiments, by removing parts of the aptamer that are driving this flux among shapes, the proportion of molecules of a given sequence that are in the appropriate structure for binding at any given moment is increased. [0069] In some embodiments, the aptamers disclosed herein may undergo sequence truncation. In some embodiments, the aptamer comprises a truncated sequence according to any of SEQ ID NOs: 11-22. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the truncated sequence set forth in any of SEQ ID NOs: 11-22. In some embodiments, the truncated forms of the aptamers exhibited equal or better binding to IgG than the full-length sequence.

[0070] In some embodiments, the aptamer comprises a truncated sequence according to SEQ ID NO: 11. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the truncated sequence set forth in SEQ ID NO: 11.

[0071] In some embodiments, the aptamer comprises a truncated sequence according to SEQ ID NO: 12. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the truncated sequence set forth in SEQ ID NO: 12.

[0072] In some embodiments, the aptamer comprises a truncated sequence according to SEQ ID NO: 13. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the truncated sequence set forth in SEQ ID NO: 13.

[0073] In some embodiments, the aptamer comprises a truncated sequence according to SEQ ID NO: 14. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the truncated sequence set forth in SEQ ID NO: 14.

[0074] In some embodiments, the aptamer comprises a truncated sequence according to SEQ ID NO: 15. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the truncated sequence set forth in SEQ ID NO: 15.

[0075] In some embodiments, the aptamer comprises a truncated sequence according to SEQ ID NO: 16. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the truncated sequence set forth in SEQ ID NO: 16.

[0076] In some embodiments, the aptamer comprises a truncated sequence according to SEQ ID NO: 17. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the truncated sequence set forth in SEQ ID NO: 17. [0077] In some embodiments, the aptamer comprises a truncated sequence according to SEQ ID NO: 18. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the truncated sequence set forth in SEQ ID NO: 18.

[0078] In some embodiments, the aptamer comprises a truncated sequence according to SEQ ID NO: 19. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the truncated sequence set forth in SEQ ID NO: 19.

[0079] In some embodiments, the aptamer comprises a truncated sequence according to SEQ ID NO: 20. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the truncated sequence set forth in SEQ ID NO: 20.

[0080] In some embodiments, the aptamer comprises a truncated sequence according to SEQ ID NO: 21. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the truncated sequence set forth in SEQ ID NO: 21.

[0081] In some embodiments, the aptamer comprises a truncated sequence according to SEQ ID NO: 22. In some embodiments, the aptamer comprises a sequence that has at least at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98%, or at or about 99% sequence identity to the truncated sequence set forth in SEQ ID NO: 22.

[0082] In some embodiments, the truncated aptamer is biochemically identical to the full- length aptamer.

[0083] In some embodiments, the aptamers comprising a truncated sequence comprise a region rich in adenine or thymidine. In some embodiments, the aptamers comprising a truncated sequence comprise a region rich in both adenine and thymidine. In some embodiments, the region rich in adenine or thymidine comprises 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides. In some embodiments, the region rich in adenine and thymidine comprises 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides. In some embodiments, the region rich in A/T is comprised of at least 4 contiguous nucleotides. In some embodiments, the region rich in A/T may be a hybridized or unhybridized region. In a specific embodiment, the region rich in A/T is unhybridized. In a specific embodiment, the aptamers comprising a truncated sequence comprise an unhybridized A/T rich region comprising at least four contiguous nucleotides.

III. USES AND METHODS

[0084] Also provided are methods and uses of anti-IgG aptamers. The aptamers or pharmaceutical compositions and formulations comprising the aptamers may be used for a wide-range of applications including, but not limited to, specific detection, inhibition, and characterization of various targets such as small organic and inorganic molecules, proteins, and whole cells, cell imaging, targeted drug delivery, imaging RNA, analytical reagents, diagnosis of disease, treatment of certain medical conditions, biomarker discovery, Western blot analysis, and aptamer affinity chromatography.

[0085] In some embodiments, the aptamer may be used by itself or in combination with 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 other aptamers. The aptamers in a combination may be directed to the same target molecule or different target molecules. In some embodiments, the combination of aptamers may compete with each other for binding. In some embodiments, the combination of aptamers may work in concert with one another. In some embodiments, the combination of aptamers may work well as a capture-detection pair for detection of a target molecule.

[0086] Also provided are methods of using and uses of the anti-IgG aptamers, and pharmaceutical compositions and formulations thereof, in the detection and diagnosis of diseases, conditions, and disorders in which abnormal IgG levels may be present in a subject. Abnormal IgG levels comprise levels that are lower than IgG levels in a normal, healthy subject or higher than IgG levels in a normal, healthy patient. Also provided are methods of combination therapy comprising the use of the anti-IgG aptamer to diagnose the disease followed by the administration of the appropriate therapeutic to the subject to treat the disease.

[0087] The disease, condition, or disorder that is detected and diagnosed by the anti-IgG aptamers disclosed herein can be any in which expression of an antigen is associated with and/or involved in the etiology of a disease condition or disorder, e.g. causes, exacerbates or otherwise is involved in such disease, condition, or disorder. Exemplary diseases and conditions can include diseases or conditions associated with malignancy or transformation of cells (e.g., cancer), autoimmune or inflammatory disease, or an infectious disease, e.g., caused by a bacterial, viral or other pathogen. [0088] In some embodiments, the disease, disorder or condition to be treated is a tumor (including solid tumors, hematologic malignancies, and melanomas, and including localized and metastatic tumors), cancer, malignancy, neoplasm, or other proliferative disease or disorder.

[0089] In some embodiments, the disease, disorder, or condition is an autoimmune disease or disorder. In some embodiments, the autoimmune disease or disorder is systemic lupus erythematosus (SLE), lupus nephritis, inflammatory bowel disease, rheumatoid arthritis, ANCA associated vasculitis, idiopathic thrombocytopenia purpura (ITP), thrombotic thrombocytopenia purpura (TTP), autoimmune thrombocytopenia, Chagas’ disease, Grave’s disease, Wegener’s granulomatosis, poly-arteritis nodosa, Sjogren’s syndrome, pemphigus vulgaris, scleroderma, Crohn’s disease, asthma, multiple sclerosis, psoriasis, IgA nephropathy, IgM polyneuropathies, vasculitis, diabetes mellitus, Reynaud’s syndrome, antiphospholipid syndrome, Goodpasture’s disease, Kawasaki disease, autoimmune hemolytic anemia, myasthenia gravis, progressive glomerulonephritis, and/or a disease or condition associated with transplant.

[0090] In some embodiments, the disease, disorder, or condition is an infectious disease such as infection with a virus or other pathogen, e.g., HIV, HCV, HBV, CMV, HPV, and parasitic disease.

[0091] In some embodiments, the disease, disorder, or condition is kidney or liver disease. [0092] In some embodiments, the anti-IgG aptamers may be used to detect or diagnose autoimmune disease, infections, or malignancy or transformation of cells (e.g., cancer) which may be indicated by abnormally high levels of IgG in a subject. In some embodiments, the anti-IgG aptamers may be used to detect or diagnose kidney and liver disease which may be indicated by abnormally low IgG levels in a subject.

[0093] In some embodiments, subsequent to detection and determination of IgG levels by the anti-IgG aptamers, subjects diagnosed with a disease, disorder, or condition may be administered the appropriate therapeutic to treat the disease, disorder, or condition.

IV. SENSORS

[0094] In some embodiments, the aptamer disclosed herein can be included in a sensor, which may include one or more electrodes (e.g., a first electrode and a second electrode). One of the electrodes, for example, may be functionalized (e.g., bound by) an aptamer as described herein. In some embodiments, the sensor can be used to analyze a biological sample, e.g., one obtained from or derived from a subject. The biological sample can be a sample obtained directly from a biological source or a sample that is processed. Biological samples include, but are not limited to, body fluids, such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine and sweat, tissue and organ samples, including processed samples derived therefrom. Exemplary samples include whole blood, peripheral blood mononuclear cells (PBMCs), leukocytes, bone marrow, thymus, tissue biopsy, tumor, leukemia, lymphoma, lymph node, gut associated lymphoid tissue, mucosa associated lymphoid tissue, spleen, other lymphoid tissues, liver, lung, stomach, intestine, colon, kidney, pancreas, breast, bone, prostate, cervix, testes, ovaries, tonsil, or other organ, and/or cells derived therefrom.

[0095] In some embodiments, the sensors can transmit data to a device, which is electrically connected to the one or more sensors through a device interface. The sensor or sensors may vary depending on the desired biological sample analysis. Exemplary sensors include channel sensors and impedance-based sensors, for example as described in WO2019236682A1. Although the sensor described below is discussed in the context of measuring an impedance as an electrical signal, the detected electrical signal may alternatively be a voltage or a current. For example, the sensor may be configured to apply a current and a voltage signal is measured. In another example, the sensor is configured to apply a voltage and a current signal is measured.

[0096] In some embodiments, the sensor is an impedance sensor, which is configured to detect an IgG polypeptide or measure an amount of the IgG polypeptide in the sample. The impedance sensor can include an electrode pair, wherein at least one of the two electrodes is functionalized with an aptamer that specifically binds to the IgG polypeptide, for example as described herein. In some implementations, the electrodes may be coated with an insulating layer (i.e., a dielectric layer), and the aptamer may be functionalized on the insulating layer or an optional hydrophobic layer coating the insulating layer. The insulating layer preferably incudes a high-K material (i.e., has a dielectric constant of about 3.9 or higher). In some embodiments, the insulating layer comprises silicon dioxide, silicon nitride, or silicon-oxy- nitride or a combination thereof (e.g., mixed together or in a plurality of separate layers). Characteristics (e.g., thickness, dielectric constant and/or hydrophobicity) of the insulating layer and/or hydrophobic layer may be the same or similar to the characteristics of the insulating layer and the hydrophobic layer described herein.

[0097] In some embodiments, the biological sample is statically positioned in the impedance sensor during an impedance measurement, and in some embodiments the biological sample continuously flows through the sensor during the impedance measurement. The amount of impedance change between the two electrodes resulting from binding of the target molecule to the affinity molecule is correlated with the concentration of the analyte in the biological sample. In some embodiments, the cartridge includes a reference sensor, which includes an electrode pair including at least one functionalized electrode configured in a manner similar to the sensor used to analyze the biological sample. A control fluid, such as a reagent without the biological sample, can be used to detect a baseline impendence, which can be transmitted to the device and used to calibrate the sensor used to analyze the biological sample.

[0098] In some embodiments, impedance (or electrical signal such as voltage or current response) is measured at a sampling rate of about 10 Hz or more (such as about 20 Hz or more, about 50 Hz or more, about 100 Hz or more, about 200 Hz or more, about 300 Hz or more, about 400 Hz or more, about 500 Hz or more, about 1 kHz or more, about 5 kHz or more, about 10 kHz or more, about 25 kHz or more, about 50 kHz or more, about 75 kHz or more, about 100 kHz or more, about 125 kHz or more, or about 150 kHz or more). In some embodiments, impedance (or electrical signal such as voltage or current response) is measured at a sampling rate of about 10 kHz or more (such as about 20 kHz or more, about 50 kHz or more, about 100 kHz or more, about 200 kHz or more, about 300 kHz or more, about 400 kHz or more, about 500 kHz or more, about 1 MHz or more, about 5 MHz or more, about 10 MHz or more, about 25 MHz or more, about 50 MHz or more, about 75 MHz or more, about 100 MHz or more, about 125 MHz or more, or about 150 MHz or more). In some embodiments, impedance (or electrical signal such as voltage or current response) is measured at a sampling rate of about 10 kHz to about 200 MHz (such as about 10 kHz to about 20 kHz, about 20 kHz to about 50 kHz, about 50 kHz to about 100 kHz, about 100 kHz to about 200 kHz, about 200 kHz to about 300 kHz, about 300 kHz to about 400 kHz, about 400 kHz to about 500 kHz, about 500 kHz to about 1 MHz, about 1 MHz to about 2 MHz, about 2 MHz to about 3 MHz, about 3 MHz to about 4 MHz, about 4 MHz to about 5 MHz, about 5 MHz to about 10 MHz, about 10 MHz to about 25 MHz, about 25 MHz to about 50 MHz, about 50 MHz to about 75 MHz, about 75 MHz to about 100 MHz, about 100 MHz to about 125 MHz, about 125 MHz to about 150 MHz, or about 150 MHz to about 200 MHz). In some embodiments, impedance is measured at a sampling rate of about 100 kHz to about 5 MHz. In some embodiments, impedance (or electrical signal such as voltage or current response) is measured at a sampling rate of about 125 MHz or more.

[0099] In some embodiments, resistance (or electrical signal such as voltage or current response) is measured at an 0Hz or direct current. In some embodiments, impedance (or electrical signal such as voltage or current response) is measured at an excitation frequency of about 1 Hz or more(such as 10Hz) or 100Hz or more or 1kHz or more, 10 kHz or more (such as about 20 kHz or more, about 50 kHz or more, about 100 kHz or more, about 200 kHz or more, about 300 kHz or more, about 400 kHz or more, about 500 kHz or more, about 1 MHz or more, about 5 MHz or more, about 10 MHz or more, about 25 MHz or more, about 50 MHz or more, about 75 MHz or more, about 100 MHz or more, about 125 MHz or more, or about 150 MHz or more). In some embodiments, impedance is measured at an excitation frequency of about 1Hz to about 100Hz or of about 100Hz to about 1kHz or of about 1kHz to about 10kHz or of about 10 kHz to about 200 MHz (such as about 10 kHz to about 20 kHz, about 20 kHz to about 50 kHz, about 50 kHz to about 100 kHz, about 100 kHz to about 200 kHz, about 200 kHz to about 300 kHz, about 300 kHz to about 400 kHz, about 400 kHz to about 500 kHz, about 500 kHz to about 1 MHz, about 1 MHz to about 2 MHz, about 2 MHz to about 3 MHz, about 3 MHz to about 4 MHz, about 4 MHz to about 5 MHz, about 5 MHz to about 10 MHz, about 10 MHz to about 25 MHz, about 25 MHz to about 50 MHz, about 50 MHz to about 75 MHz, about 75 MHz to about 100 MHz, about 100 MHz to about 125 MHz, about 125 MHz to about 150 MHz, or about 150 MHz to about 200 MHz). In some embodiments, impedance is measured at an applied excitation frequency of about 100 Hz to about 125 kHz. In some embodiments, impedance (or electrical signal such as voltage or current response) is measured at a sampling rate of about 125 kHz or more.

[0100] FIG. 11 illustrates an exemplary sensor pair configured to measure the concentration of an IgG polypeptide concentration. The sensor pair includes a test sensor and a control sensor that can be configured to measure voltage or current response, which can be used to use resistance or impedance response to quantify an IgG polypeptide concentration. The biological sample is transported to the test sensor, and a control buffer is transported to the control sensor. Impedance is measured at the test sensor and the control sensor, and the impedance due to the analyte is the difference between the impedance measured at the test sensor and the control sensor. Both sensors include a first sensing electrode 302 on a bottom substrate 304, and a second sensing electrode 306 on a top substrate 308 opposite the first sensing electrode 302. The first sensing electrode 302 is coated with a first insulating layer 310, and the second sensing electrode 306 is coated with a second insulating layer 312. The first dielectric layer 310 is coated with a first hydrophobic layer 314, and the second dielectric layer 312 is coated with a second hydrophobic layer 316. The first hydrophobic layer 314 is functionalized with an aptamer 318 that specifically binds to an IgG polypeptide 320 in the biological sample in the test sensor. The first hydrophobic layer 314 of the reference sensor is also functionalized with an affinity moiety 318, but does not bind the IgG polypeptide, as no biological sample is transported to the reference sensor. The second hydrophobic layer 316 in the illustrated sensors are not functionalized with the aptamer, although in other embodiments the second hydrophobic layer 316 may be functionalized. In some embodiments, the aptamer 318 may be coated directly on the sensing electrode 302 and the second sensing electrode 306. In some embodiments, the aptamer 318 is only coated on the first sensing electrode 302. In some embodiments, the first sensing electrode 302 and second sensing electrode 306 are coplanar and are on the same bottom substrate 304 or top substrate 308. In some embodiments, there are three or more sensing electrodes. The biological sample is transported to the test sensor between the first sensing electrode 302 and the second sensing electrode 306, and the analyte impedance (Z2) can be measured. A control buffer is transported to the reference sensor, and the reference impedance (Zl) is measured. The difference between the analyte impedance (Z2) and the reference impedance (Zl) correlates with the concentration of the protein in the biological sample. The sensor is in electrical communication with the device interface of the cartridge. When the device interface of the cartridge is engaged with the cartridge interface on the device, the device can operate the impedance sensor to detect the change in impedance upon binding of the analyte to the affinity molecule or the reference impedance. The device can then determine the analyte concentration based on the detected impedances (or change in current or voltage signal). [0101] The sensor for IgG detection or quantification may additionally or alternatively rely on an indirect analyte detection or quantification method. For an indirect measurement, the IgG polypeptide is bound to aptamer of the electrode, washed with a wash buffer, and bound to a second affinity moiety (e.g., an aptamer, antibody, etc.) that can produce ions or protons (e.g., by catalyzing a compound to produce hydrogen peroxide, which can form protons), or other signaling moiety. The ions or protons can be detected by an ion-sensitive or pH sensitive film, and the concentration of the ion or proton is proportional to the concentration of the analyte. Exemplary pH sensitive layers can include hafnium oxide, aluminum oxide, iridium oxide, or a chromium -tantalum oxide (CrO2/Ta2O3). In some embodiments, the ions or protons are detected using a metal oxide semiconductor capacitor (MOSCap) sensor, which includes a pH-sensitive or ion-sensitive layer. Other signaling moieties or entities (e.g., light) may be used instead of ions or protons. In some embodiments, the secondary affinity moiety produces electrons near the electrode surface (e.g., by applying a voltage to catalyze hydrogen peroxide in presence of oxygen). The electrons are detected by measuring the current, and the concentration of the analyte is proportional to the current change. [0102] An exemplary impedance sensor that can be used for indirect detection or quantification of an analyte is shown in FIG. 12A. The impedance sensor illustrated in FIG. 12A includes a functionalized electrode adjacent to a MOSCap sensor. The analyte is captured on the functionalized electrode using affinity moieties (e.g., an aptamer as described herein), and a secondary affinity moiety (e.g., an aptamer as described herein) is bound to the analyte to produce ions or protons that flow to the MOSCap sensor for detection. The electrode includes a first electrode 502 on a bottom substrate 504, and an optional second (ground) electrode 506 on a top substrate 508 opposite the first electrode 502. The first electrode 502 is coated with a first insulating layer 510, and the second electrode 506 is coated with a second insulating layer 512. Optionally, the first insulating layer 510 is coated with a first hydrophobic layer 514 above the first electrode 502, and the second insulating layer 512 is optionally coated with a second hydrophobic layer 516 below the second electrode 506. However, the first hydrophobic layer 514 and the second hydrophobic layer 516 do not extend into the MOSCap sensor. The first hydrophobic layer 514 (or the dielectric layer 510 in an embodiment that omits the first hydrophobic layer) is functionalized with an affinity moiety 518. In some embodiments, the functionalized electrodes are configured to directly detect or quantify analyte based on impedance (or voltage or current) change upon the analyte binding to the affinity moiety.

[0103] The MOSCap sensor includes a first MOSCap electrode 520 on the first substrate 504, and a second MOSCap electrode 522 on the second substrate 508 opposite the first MOSCap electrode 520. The first MOSCap electrode 520 is coated with a first semiconductor layer 524 (for example, silicon, germanium, or gallium compounds, such as gallium arsenide or gallium nitride), and the second MOSCap electrode 522 is coated with a second semiconductor layer 526. In this embodiment, 504 and 508 can be a different insulating or semiconducting material from 524 and 526, or the same insulating or semiconducting material. The first insulating layer 510 extends over the first semiconductor layer 524, and the second insulating layer 512 extends over the second semiconductor layer 526, although it is conceived that the insulating layers coating the semiconductor layers may be different than the insulating layers coating the electrowetting electrodes. A first detection layer 528 (e.g., a pH-sensitive layer or an ion-sensitive layer or uncoated that can detect electrons i.e., current change) coats the first insulating layer 510 within the MOSCap sensor, and a second detection layer 530 (e.g., a pH-sensitive layer or ion sensitive layer or uncoated that can detect electrons i.e., current change) coats the second insulating layer 512 within the MOSCap sensor. [0104] FIG. 12B shows a side view of the MOSCap sensor, along with an electrical model. The MOSCap sensor includes a reference electrode 532 (which may be, for example, a silver or silver chloride electrode, or may be of any other suitable material), and a counter electrode 534 (which may be, for example, gold or any other suitable material). In some embodiments, the reference electrode 532 and the counter electrode 534 are positioned in line with the liquid flow (e.g., the reference electrode 532 or the counter electrode 534 can be positioned between the first MOSCap electrode 520 and the first electrode 502). In some embodiments, the reference electrode 532 and the counter electrode 534 are positioned adjacent to the liquid flow.

[0105] FIG. 13 illustrates direct and indirect analyte measurements using the sensor illustrated in FIG. 12A and FIG. 12B. At step 602, the biological sample is transported to the functionalized electrodes, and the IgG polypeptide in the sample binds to the affinity moiety attached to the hydrophobic layer (or the insulating layer, if no hydrophobic layer is present or the functionalized electrode layer if the hydrophibic layer and insulating layers are not present). Optionally the biological sample is washed once the analyte is bound. Once the analyte is bound to the affinity moieties, the impedance (or voltage or current) can be measured to directly measure the analyte concentration, as described above. At step 604, a secondary affinity moiety, which is conjugated to a signaling enzyme or signaling secondary aptamer or reagent is configured to produce protons (in some cases ions or electrons), is transported to the functionalized electrodes and binds the analyte bound to the primary affinity moiety attached to the electrodes (via the insulating layer and/or hydrophobic layer). At step 606, a reagent is transported to the electrodes, which can be catalyzed by the signaling enzyme to produce hydrogen peroxide, which degrades to produce protons. The protons flow to the MOSCap sensor at step 608, and the change in pH-sensitive layer modulates impedance in response to the protons. The modulated impedance is detected using the MOSCap sensor and is proportional to the concentration of the analyte in the biological sample.

[0106] In some embodiments, the impedance (or voltage or current) sensor is a MOSCap sensor wherein one of the insulating layers (or hydrophobic layer coating the insulating layer, if present) is functionalized with an affinity moiety. The opposite insulating layer is coated with a pH-sensitive or ion-sensitive layer. This configuration of the MOSCap sensor allows for direct analyte detection or concentration measurement (through the functionalized surface) and indirect analyte detection (through the pH-sensitive or ion-sensitive layer) in the same MOSCap sensor. V. DEFINITIONS

[0107] Unless defined otherwise, all terms of art, notations and other technical and scientific terms or terminology used herein are intended to have the same meaning as is commonly understood by one of ordinary skill in the art to which the claimed subject matter pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and/or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art. [0108] As used herein, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. For example, “a” or “an” means “at least one” or “one or more.” It is understood that aspects, embodiments, and variations described herein include “comprising,” “consisting,” and/or “consisting essentially of’ aspects, embodiments and variations.

[0109] Throughout this disclosure, various aspects of the claimed subject matter are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the claimed subject matter. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, where a range of values is provided, it is understood that each intervening value, between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the claimed subject matter. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the claimed subject matter, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the claimed subject matter. This applies regardless of the breadth of the range. [0110] The term “about” as used herein refers to the usual error range for the respective value readily known to the skilled person in this technical field. Reference to “about” a value or parameter herein includes (and describes) embodiments that are directed to that value or parameter per se. For example, description referring to “about X” includes description of “X”.

[0111] As used herein, the term “aptamer” refers to a single stranded oligonucleotide or a peptide that has a binding affinity for a specific target.

[0112] As used herein, the term “nucleic acid” refers to a polymer or oligomer of nucleotides. Nucleic acids are also referred as “ribonucleic acids” when the sugar moiety of the nucleotides is D-ribose and as “deoxyribonucleic acids” when the sugar moiety is 2-deoxy-D- ribose.

[0113] As used herein, the term “nucleotide” usually refers to a compound consisting of a nucleoside esterified to a monophosphate, polyphosphate, or phosphate-derivative group via the hydroxyl group of the 5-carbon of the sugar moiety. Nucleotides are also referred as “ribonucleotides” when the sugar moiety is D-ribose and as “deoxyribonucleotides” when the sugar moiety is 2-deoxy-D-ribose.

[0114] As used herein, the term “nucleoside” refers to a glycosylamine consisting of a nucleobase, such as a purine or pyrimidine, usually linked to a 5-carbon sugar (e.g. D-ribose or 2-deoxy-D-ribose) via a P-glycosidic linkage. Nucleosides are also referred as “ribonucleosides” when the sugar moiety is D-ribose and as “deoxyribonucleosides” when the sugar moiety is 2-deoxy-D-ribose.

[0115] As used herein, the term “nucleobase”, refers to a compound containing a nitrogen atom that has the chemical properties of a base. Non-limiting examples of nucleobases are compounds comprising pyridine, purine, or pyrimidine moieties, including, but not limited to adenine, guanine, hypoxanthine, thymine, cytosine, and uracil.

[0116] As used herein, the term “oligonucleotide” refers to an oligomer composed of nucleotides.

[0117] As used herein, the term “motif’ refers to the sequence of contiguous, or series of contiguous, nucleotides occurring in a library of aptamers with binding affinity towards a specific target and that exhibits a statistically significant higher probability of occurrence than would be expected compared to a library of random oligonucleotides. The motif sequence is frequently the result or driver of the aptamer selection process.

[0118] As used herein, the term “antibody” includes, but is not limited to, a monoclonal antibody, polyclonal, a chimeric antibody, a CDR-grafted antibody, a humanized antibody, a Fab, a Fab', a F(ab')2, a Fv, a disulfide linked Fv, a scFv, a single domain antibody (dAb), a diabody, a multispecific antibody, a dual specific antibody, an anti -idiotypic antibody, a bispecific antibody, a functionally active epitope-binding fragment thereof, bifunctional hybrid antibodies, a single chain antibody, and a Fc-containing polypeptide, such as an immunoadhesion. In some embodiments, the antibody may be of any heavy chain isotype (e.g., IgG, IgA, IgM, IgE, or IgD). In some embodiments, the antibody may be of any light chain isotype (e.g., kappa or gamma). The antibody may be non-human (e.g., from mouse, goat, or any other animal), fully human, humanized, or chimeric. In some embodiments, the antibody is a derivatized antibody. [0119] As used herein, the term “IgG” encompasses the four human subclasses of IgG (IgGl, IgG2, IgG3, IgG4) and any protein having the amino acid sequence of a wild-type IgG and variants thereof, regardless the glycosylation state. The term “IgG” encompasses any isoforms or allelic variants of IgG, as well as fragments of IgG such as Fc region, any glycosylated forms, non-glycosylated forms or post-translational modified forms of IgG.

[0120] As used herein, “Fc”, “Fc Fragment” or “Fc region” of IgG refers to the polypeptide comprising the constant region of an antibody excluding the first constant region immunoglobulin domain. Thus, Fc refers to the last two constant region immunoglobulin domains of IgG and the flexible hinge N-terminal to these domains.

VI. EXEMPLARY EMBODIMENTS

[0121] The following embodiments are exemplary and not intended to limit the scope of the invention described herein.

[0122] Embodiment 1. A sensor comprising: a first electrode and a second electrode; a fluid channel for a fluidic sample between the first electrode the second electrode; and a plurality of aptamers attached to the first electrode that bind immunoglobulin G (IgG) polypeptides, the aptamers in the plurality of aptamers comprising an unhybridized A/T rich region comprising at least four contiguous nucleotides.

[0123] Embodiment 2. The sensor of embodiment 1, further comprising a control circuit configured to operate the first electrode and the second electrode and to detect an electrical signal between the first electrode and the second electrode.

[0124] Embodiment 3. The sensor of embodiment 2, wherein the electrical signal is based on a binding of the IgG polypeptide to the aptamer.

[0125] Embodiment 4. The sensor of embodiment 2 or 3, wherein the electrical signal is an impedance, a voltage, or a current.

[0126] Embodiment 5. An aptamer that binds an immunoglobulin G (IgG) polypeptide comprising at least one sequence selected from the group consisting of:

(a) AATACAAAC;

(b) GAAAGCC;

(c) AAGCAA;

(d) TCAAATATA;

(e) TATACAG; (f) TCGAAG;

(g) ATTAAT;

(h) CTTCGATT;

(i) ATTTCA;

(j) AAACTT;

(k) GGAAACGA;

(l) TTGCTA;

(m) AGGCCACAT;

(n) CCAATCAAG;

(o) AATTAT;

(p) ATAAAG;

(q) GCAAAATT;

(r) TTGCTA;

(s) TTACGATC;

(t) TCACTAG;

(u) AATTCCA;

(v) CATCAT;

(w) AAGCCA; and

(x) ATTCATTACTCGACAACAAT (SEQ ID NO: 29).

[0127] Embodiment 6. The aptamer of embodiment 5, comprising at least one sequence selected from the group consisting of AATACAAAC, GAAAGCC, and AAGCAA.

[0128] Embodiment 7. The aptamer of embodiment 5, comprising a first sequence according to AATACAAACGAAAGCC (SEQ ID NO: 30) and a second sequence according to AAGCAA.

[0129] Embodiment 8. The aptamer of embodiment 7, comprising a sequence according to SEQ ID NO: 5.

[0130] Embodiment 9. The aptamer of embodiment 5, comprising at least one sequence selected from the group consisting of TCAAATATA, TATACAG, and TCGAAG.

[0131] Embodiment 10. The aptamer of embodiment 9, comprising a first sequence according to TCAAATATACAG (SEQ ID NO: 31) and a second sequence according to TCGAAG.

[0132] Embodiment 11. The aptamer of embodiment 10, comprising a sequence according to SEQ ID NO: 6. [0133] Embodiment 12. The aptamer of embodiment 5, comprising at least one sequence selected from the group consisting of ATTAAT, CTTCGATT, ATTTCA, AAACTT, and GGAAACGA.

[0134] Embodiment 13. The aptamer of embodiment 12, comprising a first sequence according to ATTAAT, a second sequence according to CTTCGATTTCA (SEQ ID NO: 32), a third sequence according to AAACTT, and a fourth sequence according to GGAAACGA. [0135] Embodiment 14. The aptamer of embodiment 13, wherein the second sequence at the fourth sequence are hybridized to each other.

[0136] Embodiment 15. The aptamer of embodiment 14, wherein the third sequence is part of a loop structure that links the second sequence to the fourth sequence.

[0137] Embodiment 16. The aptamer of embodiment 15, comprising a sequence according to SEQ ID NO: 7.

[0138] Embodiment 17. The aptamer of embodiment 16, comprising at least one sequence selected from the group consisting of TTGCT, AGGCCACAT, CCAATCAAG, AATTAT, and AT A A AG.

[0139] Embodiment 18. The aptamer of embodiment 17, comprising a first sequence according to TTGCT AGGCCACAT (SEQ ID NO: 33), a second sequence according to CCAATCAAG, and a third sequence according to AATTATAAAG (SEQ ID NO: 34).

[0140] Embodiment 19. The aptamer of embodiment 18, comprising a sequence according to SEQ ID NO: 8.

[0141] Embodiment 20. The aptamer of embodiment 5, comprising at least one sequence selected from the group consisting of GCAAAATT, TTGCTA, TTACGATC, and TCACTAT.

[0142] Embodiment 21. The aptamer of embodiment 20, comprising a first sequence according to GCAAAATTGCTA (SEQ ID NO: 35), a second sequence according to TTACGATC, and a third sequence according to TCACTAT.

[0143] Embodiment 22. The aptamer of embodiment 21, comprising a sequence according to SEQ ID NO: 9.

[0144] Embodiment 23. The aptamer of embodiment 5, comprising at least one sequence selected from the group consisting of AATTCCA, CATCAT, AAGCCA, and ATTCATTACTCGACAACAAT (SEQ ID NO: 29).

[0145] Embodiment 24. The aptamer of embodiment 23, comprising a first sequence according to AATTCCATCAT (SEQ ID NO: 36) and a second sequence according to AAGCCATTCATTACTCGACAACAAT (SEQ ID NO: 37). [0146] Embodiment 25. The aptamer of embodiment 24, comprising a sequence according to SEQ ID NO: 10.

[0147] Embodiment 26. An aptamer comprising a sequence according to any one of SEQ ID NOS: 5-28.

[0148] Embodiment 27. The aptamer of any one of embodiments 5-25, wherein the aptamer is a DNA aptamer or an XNA aptamer.

[0149] Embodiment 28. A sensor comprising: a first electrode and a second electrode; a fluid channel for a fluidic sample between the first electrode the second electrode; and a plurality of aptamers attached to the first electrode, the aptamer of the plurality of aptamers being according to any one of embodiments 5-27.

[0150] Embodiment 29. The sensor of embodiment 28, further comprising a control circuit configured to operate the first electrode and the second electrode and to detect an electrical signal between the first electrode and the second electrode.

[0151] Embodiment 30. The sensor of embodiment 29, wherein the electrical signal is based on a binding of the IgG polypeptide to the aptamer.

[0152] Embodiment 31. The sensor of embodiment 29 or 30, wherein the electrical signal is an impedance, a voltage, or a current.

[0153] Embodiment 32. A method of binding an IgG polypeptide to an aptamer, comprising contacting the IgG polypeptide with an aptamer according to any one of embodiments 5-27. [0154] Embodiment 33. A method of measuring an amount of IgG polypeptide in a fluidic sample, comprising: flowing the fluid sample through the fluid channel of the sensor according to any one of embodiments 2-4 or 29-31; binding IgG polypeptides in the fluidic sample to the plurality of aptamers; operating the control circuit to pass an electrical current or voltage across the fluid channel; and measuring the electrical signal, wherein the electrical signal is indicative of an amount of IgG polypeptides bound to the plurality of aptamers.

VII. EXAMPLES

[0155] The following examples are included for illustrative purposes only and are not intended to limit the scope of the invention. Example 1: Selection of Aptamers that Bind IgG

[0156] The aptamers with affinity for IgG are selected from a large oligonucleotide through the use of a modified SELEX (Sequential Evolution of Ligands by Exponential Enrichment) process. Briefly, non-binding aptamers are discarded and aptamers binding to the proposed target are expanded. Initial positive selection rounds are sometimes followed by negative selection. This improves the selectivity of the resulting aptamer candidates. Multiple rounds of the modified SELEX process are performed with increasing stringency to enhance enrichment of the oligonucleotide pool.

[0157] The selection of aptamers for human serum albumin (SA), immunoglobulin, and alkaline phosphatase (ALP) was performed using three tagged randomized-ssDNA libraries will select for the aptamers. A full description of the processes used in each selection round is provided in Table 1. An overall schematic of the selection process is provided in Figure 1.

Table 1: Processes used in each selection round

A. Library Preparation

[0158] A series of DNA libraries were synthesized. The oligonucleotides were composed of a random region of 40 nucleotides flanked by two conserved regions, i.e. a 5' forward primer recognition sequence and a 3' reverse primer recognition sequence. The oligonucleotides are identical in design except for a different two nucleotide tag. See Table 2 below: Table 2: Library sequences

[0159] The two letter tag is underlined in the library sequences listed above. The symbol N40 denotes a contiguous string of 40 random nucleotides. Each individual oligonucleotide in Library 1 had the sequence 5'-AATGTGGAAAGCAAGGAGGTCAATG(N₄O)GAGTGACCTTGCTTCCC-3' (SEQ ID NO: 38); each individual oligonucleotide in Library 2 had the sequence

5 '-AATGTGGAAAGC AAGGAGGTC AAAC(N₄o)GAGTGACCTTGCTTCCC-3 '(SEQ ID NO: 39); and each individual oligonucleotide in Library 3 had the sequence

5'- AATGTGGAAAGC AAGGAGGTC AACT(N₄o)GAGTGACCTTGCTTCCC-3' (SEQ ID NO: 40); wherein N is any deoxynucleotide (A, C, G, or T). A schematic of the oligonucleotides in the library is illustrated in FIG. 2.

[0160] Library 1 was used for the selection of aptamers for SA, Library 2 for IgG, and Library 3 for ALP. A total of IxlO¹⁵ sequences were aliquoted for each library and exposed to the respective protein immobilized on UltraLink Biosupport (Thermo Scientific). Each library contained a random region of 40 nucleotides (nt) in length resulting in 4⁴⁰ possible sequences. It is highly improbable that any sequences were duplicated in any of the initial libraries and the average copy number of each unique sequence is equal to one.

[0161] The immobilized protein was loaded into a column (1 mL syringe barrels) and the DNA library was allowed to flow through. Aptamers that did not bind to the immobilized proteins were discarded in the flow through. Human whole blood depleted of >95% of the HSA and IgG was added into the selection matrix for competitive binding to remove nontarget sequences. Some of the blood was lysed following the depletion to release hemoglobin into the matrix. B. Selection Rounds

[0162] In the first round of selection (SRI), naive libraries of the randomized sequences were incubated against immobilized pooled IgG (containing all IgG subclasses), HSA, or ALP. The initial pool consisted of 40 pg (1.66 nmoles) or about lei 5 unique random sequences. [0163] Following a selection round, the remaining bound aptamers were eluted from the resin and PCR amplified. This PCR amplification process was designed such that a T7 RNA polymerase promoter was created on the 3’ end of the amplicon. This promoter was used to transcribe an antisense RNA version of the library, with RNA polymerase. The antisense RNA was then subsequently reverse transcribed back into single stranded DNA oligonucleotides by using reverse transcriptase and the remaining RNA library was removed with an RNase treatment, recovering the library for next selection round.

[0164] Selection stringency was increased through subsequent selection rounds by decreasing the amount of library used, introducing counter targets, and increasing washes. In selection round 2 (SR2) the input library was decreased to 10 pg and counter selection against empty UltraLink was introduced. In SR3, the library was reduced to 5 pg and depleted whole blood was included in the selection matrix as a counter target for aptamer binding. Before being used for selection, albumin and IgG were removed from the whole blood to prevent loss of desired sequences.

[0165] In SR4, 1 pg of each of the selected libraries out of SR3 was pooled together. The pooled library was incubated with the depleted blood as described in the previous rounds and was passed through an empty resin column for counter selection. The prepared resins with each of the immobilized targets (ALP, HSA, and IgG) were pooled together for positive selection. A single pooled library that bound to the combined targets was eluted and amplified for the next selection round. For SR5, the selection process was completed in the similar matter as SR4 with 1 pg of the amplified pooled library. The depleted whole blood was lysed to free the hemoglobulin and introduced to the selection matrix as a counter-target for aptamer binding. For SR6, selection stringency was increased by adding a second positive selection. The library was first incubated with lysed blood as a counter target followed by positive selection against the pooled resin. The bound library was eluted and incubated with the depleted whole blood as a counter target before being selected against another pool of protein targets.

[0166] For SR7, the selection stringency was increased by decreasing the library input to 0.25 pg. The pooled library was mixed with lysed blood and flowed over and empty resin column to remove non-specific sequences before incubating with the pooled targets. The library was cleaned up and mixed with whole blood before incubating with a second pool of targets. In round 8, selection was split into four separate channels. Each channel was specific to separate targets which include HSA, IgG, ALP and depleted whole blood. An equal amount of the pooled library out of SR7 was incubated with each of the targets. To ensure recovery of library against each of the targets was maintained during the pooled rounds of selection, counter selection was dropped in this round. For SR9, after confirmation of library recovery against each target, counter selection was reintroduced. IgG was used as a counter target for the HSA channel and HSA as the counter target for IgG. Sequences that did not bind to the counter target were incubated with the target for that channel. Lysed blood and depleted blood were added to the selection matrix as competitive binders for the ALP channel. The library input was also increased to ensure sufficient recovery of sequences. For SR10, selection stringency was increased with the addition of a second counter selection.

C. Library Enrichment

[0167] The aptamer library enrichment is tracked by the proportion of library recovered after each selection round (FIG. 3 A). The recovered library is estimated by the number of PCR cycles necessary to achieve sufficient amplification of the library to observe a clean visible band on a polyacrylamide gel. This is divided by the amount of library used at the start of the selection round. Lower cycle numbers indicate greater amounts of library recovered from a selection round. Large increases in PCR cycles suggest selection stringency was pushed too much and indicate a loss of potential sequences. Consistently low cycles may be an indication that the stringency is not enough to drive selection against the specific target.

[0168] As shown in Figure 3 A, a decrease in library enrichment during SR2 (for ALPL) and SR3 (for HSA and IgG) was seen. The decrease in library enrichment is potentially due to the increasing selection pressures caused by decreasing amounts of input library, counter selection, and increasing the number of washes to remove weak or aspecific sequences. For the ALPL target, the amount of DNA recovered increased in SR3 indicating a greater enrichment of aptamers that bind to the target. Following a decrease in cycles in selection round 5, selection stringency was increased in selection round 6 with double counter and positive selections. After SR8, library recovery from the IgG and HSA channels was much less than the ALPL channel. The selection protocol from round 9 was modified slightly to ensure selection was specific to the identified targets. Library recovery increased in round 9 and selection continued into the final round. Example 2: Sequencing of Aptamers

[0169] Samples of selected libraries from rounds 7-10 were prepared for next generation sequencing (NGS). Unique primers were used to amplify each library to add a specific ID tag required for sequence extraction and analysis. The libraries were purified through acrylamide electrophoresis and balanced for relative quantity. These libraries were then pooled and submitted for NGS sequencing using an Illumina HiSeq instrument (Hospital for Sick Children, Toronto, CA).

[0170] The sequencing data was tabulated and analyzed. These top sequences are listed in Table 3. The relative proportions of the top twenty sequences in terms of relative frequency in SR10 for IgG is shown in FIG. 3B. Sequences are named in order of their copy number in SR10, thus a sequence named CIgG-1 was the top copy number sequence in SR10 against IgG. FIG. 3B shows that more of the IgG sequences were enriched in SR10 versus previous selection rounds except for CIgG-1, CIgG-3 and CIgG-11. FIG. 3C shows the specificity of the top IgG sequences. The lower the bar, the less sequences are present. If the bar is absent, then no sequences were observed. High copy number sequences that exhibited high levels of specificity were selected as candidate sequences: CIgG-2, CIgG-6, CIgG-7, CIgG-8, CIgG-9 and CIgG-13. The candidate sequences were used in further binding studies (Example 3).

Table 3: Aptamer Sequences

Example 3: Candidate Aptamers Binding to IgG

[0171] The binding of the six candidate aptamers to IgG (Fitzgerald Industries IntT) was examined by surface plasmon resonance imaging (SPRI). Briefly, 200 pl of a 250 nm concentration of human IgG pool (all subtypes) in a Roche buffer were flowed over the immobilized aptamers at a flow rate of 50 pl/min. The pooled IgG was flowed over the aptamers for the first 240 seconds (association phase), followed by the flowing of only buffer over the aptamers (disassociation phase). The koir value was calculated using the disassociation phase response and the k_on value was calculated using the k_Off value and the association phase response.

[0172] FIG. 4A shows the binding of pooled IgG to candidate aptamers CIgG-2, CIgG-6, CIgG 7, CIgG-8, and CIgG-9. Aptamer CIgG-13 did not exhibit any binding. The bonding coefficients for the candidates that exhibited binding are listed below in Table 4.

Table 4: Binding Coefficients

[0173] To determine the specificity of the aptamers, HSA was flowed over the bound aptamers and binding was assessed. As shown in FIG. 4B, only aptamer CIgG-8 exhibited some binding (Kd=0.01474816; Ka=192326.8; KD=7.67E-08).

[0174] The binding of the aptamers to specific IgG subclasses was determined. No significant binding of the aptamers to IgG subclasses 1 or 4 was observed. As shown in FIG. 4C, the aptamers bound to IgG3, but the overall resonance due to binding was lower.

A. Competition Analysis

[0175] A competition analysis was performed to identify pairs of aptamers against IgG that would not inhibit the binding of each other and would thus work well as capture-detection pairs. This analysis was performed with surface plasmon resonance imaging (SPRI) with candidate aptamers for a target immobilized on a surface and the protein alone, or the protein pre-incubated with a specific aptamer flowed over the aptamers. Due to variability in response in SPRi from injection to injection, the focus of the analysis is the relative difference in response. In addition, the association rate (kon) of an aptamer for its target was the focus as this is what is affected by competition for the binding site. The koir is not affected. The amount of protein bound will be decreased in the presence of an aptamer bound to the protein that inhibits by binding of an immobilized aptamer to the same protein. However, once this protein is bound, the rate that it disassociates will not be affect by the presence of a competing aptamer.

[0176] Figure 4D provides the estimate for maximum value for the SPRi binding curve as the overall resonance in the presence of the aptamer (groupings on the x-axis) versus different immobilized aptamers (legend). Figure 4D shows that the following pairs of aptamers that would work well for capture and detection. CIgG-2 appears to work well as a capture aptamer with CIgG-6 and CIgG-7 as detection aptamers. CIgG-6 works well with itself and with CIgG-7. CIgG-7 works well with CIgG-6. CIgG-8 as a capture aptamer worked best with CIgG-2 and CIgG-6 as detection aptamers. CIgG-9 worked well as a capture aptamer with CIgG-6 as a detection aptamer. CIgG-13 worked well as a capture aptamer with CIgG-2 as a detection aptamer.

Example 4: Structure Characterization of Aptamers

[0177] The capacity of an aptamer to bind to a target protein is a function of the structure of the aptamer in three-dimensional space. Structure predictions of single stranded oligonucleotides has a relatively long history in terms of two-dimensional space predictions with the first publicly available website for prediction dating back to 2003. For the purpose of these examples, the prediction of the structure in two dimensions is sufficient for characterization given the inherent flexibility of single stranded DNA.

[0178] Structure predictions in these examples were produced using RNAfold software available through a public web-server. The concept of annotating structure has been developed as a software package called bpRNA. This general concept is utilized in this example.

[0179] The secondary structure of the aptamers was predicted. The following code is used to annotate each of the possible structural states at each position. E= dangling end; L = Internal loop; M = Multiloop; H = Hairpin loop; S = Stem; T = Stem terminus. The full-length sequence structures of the six candidate aptamers are shown in Figure 5.

[0180] By using these definitions, a structure annotation can be aligned with the sequence as seen in Table 5. By using this process, it is possible to reduce the structure prediction of each aptamer disclosed as a string of structure characters. This process enables meta-analysis of the structures including searches for similarities and differences. The XSTREME program was used to search for consensus motifs in the sequence and structures. The XSTREME program enables the definition of those motifs that are conserved across these sequences at a statistically significant level. Table 5: Sequence and Structure Annotations

[0181] The following structural motif was identified as significant (E = 0.00108) in the selected IgG sequences: HHHHHHHTSSTTSTT. The unusual feature of this motif is the TT repeats. It is not unusual to have a stem region immediately following a hairpin region (H = hairpin, T and S = stem). Note that T denotes the start or end position of a stem region. Thus this motif indicates a stem where the complementary sequence has bulges that are not hybridized. The presence of this consensus structural motif in these sequences was caused by the following sequences in each aptamer: IgG-6: CAAATATACAGGAC (SEQ ID NO: 23); IgG-7: ACTTGAGGAAACGA (SEQ ID NO: 24); IgG-8: TGACCTTGCTTC (SEQ ID NO: 25); IgG-9: GGGTTACGAT (SEQ ID NO: 26) and ATCCAGAGTGACC (SEQ ID NO: 27);

IgG-13: ACTAATTCCATCA (SEQ ID NO: 28).

Example 5: Motif Analysis of Aptamers

[0182] The frequency of motifs of the six nucleotides from the random regions of the top aptamers within all the sequences of selection round 10 library was determined. The random sequence within the library used to select the IgG sequences was 40 nucleotides (nt) in length. This means that this region contains 35 overlapping motifs of six nucleotides each. The average motif frequency in the top 10,000 sequences selected in selection round 10 based on copy number was determined. The frequency of each of the 35 overlapping motifs from the aptamers that were demonstrated to exhibit binding to IgG were then characterized. The frequency of each of the observed motifs was then compared to the average and standard deviation of this average and a Z score (xi-xbar)/standard deviation was calculated.

[0183] A presentation of these analyses is shown in FIG. 6A-6F. Analysis for the aptamer cIgG-2 is provided in FIG. 6A with significant sequence motifs (Z scores) mapped to structural locations in the aptamer. FIG. 6A illustrates that a large hairpin loop in the cIgG-2 structure was clearly significant for the binding potential of this aptamer. The same presentation for the cIgG-6 aptamer is seen in FIG. 6B, cIgG-7 aptamer in FIG. 6C, cIgG-8 aptamer in FIG. 6D, cIgG-9 aptamer in FIG. 6E, and cIgG-13 aptamer in FIG. 6F.

[0184] Of note, all of the selected six IgG aptamers exhibited an adenine or thymidine rich segment in an unhybridized region of the aptamer structure. The following sequence motifs were significantly selected for across all successful aptamers; IgG-2: AATA; IgG-6: AAATAT; IgG-7: ATTAAT; IgG-8: AATTAT; IgG-9: AAAT; and IgG-13: AATT. In all cases, this A/T rich motif was not only significantly selected for, it was also unhybridized. Thus, it is likely this region is necessary for the functioning of the aptamer.

Example 6: Truncation of Aptamers

[0185] After selection, in addition to chemical modifications, sequence truncations can be performed to remove regions that are not essential for binding or for folding into the structure. Moreover, aptamers can be linked together to provide different features or better affinity. Thus, any truncations or combinations of the aptamers described herein are incorporated as part of the current invention. Starting from the predicted secondary structure of the selected aptamers, smaller oligonucleotides comprising some of the secondary structure elements or segments of the sequence were designed. Mutations were included as necessary to preserve the secondary structures of the parent aptamer.

A. Structure Characterization of Truncated Aptamers

[0186] As described in Example 3, structure predictions of the truncated aptamers were produced using RNAfold software available through a public web-server. The truncates sequence structures of the IgG aptamers is shown in Figure 7. The truncated sequences and the annotated structure of the truncated form of the aptamer is listed Table 6 below.

[0187] Similar structures to the structural motif described in Example 4 (HHHHHHHTSSTTSTT) for each of the aptamers that exhibited significant binding to IgG are bolded in the annotated structure of the truncated form of the aptamer in Table 6. Of note, all of the truncated forms of the aptamers exhibited equal or better binding to IgG than the full length sequence, indicating that the truncated structure was the driver for the binding reaction.

Table 6: Truncated Sequence and Structure Annotations

Table 7: Further Truncated Sequences

[0188] Figure 8 shows the structure of the truncated aptamers where the significantly selected for sequence motifs are boxed. Of note, the unhybridized, significantly selected A/T rich sequences seen in the non-truncated structures (Example 5) were maintained in successful aptamer truncations (IgG-2.1 : AATA; IgG-6.1 : AAATAT; IgG-7.1 : ATTAAT; IgG-8: AATTAT; IgG-9.1 : AAAT; and IgG-13.1 : AATT). This suggests that these regions are necessary for the functioning of the aptamer. An example of a further truncated sequence structure is shown in Figure 9 (CIgG-8.2).

B. Binding Assays of Truncated IgG Aptamers

[0189] Binding assays were performed with the six candidate aptamers for IgG using surface plasmon resonance imaging. The aptamers were immobilized on a gold surface in triplicate at a concentration of 5 pM in 10 nL suspended above a prism, and proteins were flowed over the chip at a specified concentration. 200 pL of protein solution was injected and the standard flow rate was 50 pL/min. In addition, the binding assays are competed in lx HEPEs buffer and lx Roche buffer, lx selection contains lOmM HEPEs, 120mM NaCl, 5mM KC1 and 5mM MgC12 with a pH of 7.4. lx Roche buffer contains 400mM EACA, 2mM TETA and lOOmM NaCl with a pH of 5.7. Injections of negative controls were also included. [0190] FIG. 10A shows binding of the six truncated aptamers to pooled Human IgG (250 nM concentration) at a flow rate of 50 pL/min. The graph is plotted after the negative aptamer subtraction. The binding coefficients (KD) are listed below in Table 8.

Table 8: Binding coefficients of truncated aptamers to pooled IgG

[0191] All six truncated CIgG aptamers were then tested for binding against individual IgG subunits (FIG. 10B-10E). The binding coefficients of the truncated aptamers to IgGl, IgG3, and IgG4 subunits are shown below in Tables E9-E11. No meaningful binding to IgG2 was observed. None of the aptamers exhibited any meaningful cross-reactivity to HSA (FIG. 10F).

Table 9: Binding coefficients of truncated aptamers to IgGl

Table 10: Binding coefficients of truncated aptamers to IgG3

Table 11: Binding coefficients of truncated aptamers to IgG4

Table 12: SEQUENCE TABLE

Claims

CLAIMS What is claimed is:

1. A sensor comprising: a first electrode and a second electrode; a fluid channel for a fluidic sample between the first electrode the second electrode; and a plurality of aptamers attached to the first electrode that bind immunoglobulin G (IgG) polypeptides, the aptamers in the plurality of aptamers comprising an unhybridized A/T rich region comprising at least four contiguous nucleotides.

2. The sensor of claim 1, further comprising a control circuit configured to operate the first electrode and the second electrode and to detect an electrical signal between the first electrode and the second electrode.

3. The sensor of claim 2, wherein the electrical signal is based on a binding of the IgG polypeptide to the aptamer.

4. The sensor of claim 2 or 3, wherein the electrical signal is an impedance, a voltage, or a current.

5. An aptamer that binds an immunoglobulin G (IgG) polypeptide comprising at least one sequence selected from the group consisting of:

(a) AATACAAAC;

(b) GAAAGCC;

(c) AAGCAA;

(d) TCAAATATA;

(e) TATACAG;

(f) TCGAAG;

(g) ATTAAT;

(h) CTTCGATT;

(i) ATTTCA;

(j) AAACTT (k) GGAAACGA

(l) TTGCTA;

(m) AGGCCACAT;

(n) CCAATCAAG;

(o) AATTAT;

(p) ATAAAG;

(q) GCAAAATT;

(r) TTGCTA;

(s) TTACGATC;

(t) TCACTAG;

(u) AATTCCA;

(v) CATCAT;

(w) AAGCCA; and

(x) ATTCATTACTCGACAACAAT (SEQ ID NO: 29).

6. The aptamer of claim 5, comprising at least one sequence selected from the group consisting of AATACAAAC, GAAAGCC, and AAGCAA.

7. The aptamer of claim 5, comprising a first sequence according to AATACAAAC GAAAGCC (SEQ ID NO: 30) and a second sequence according to AAGCAA.

8. The aptamer of claim 7, comprising a sequence according to SEQ ID NO: 5.

9. The aptamer of claim 5, comprising at least one sequence selected from the group consisting of TCAAATATA, TATACAG, and TCGAAG.

10. The aptamer of claim 9, comprising a first sequence according to TCAAATATACAG (SEQ ID NO: 31) and a second sequence according to TCGAAG.

11. The aptamer of claim 10, comprising a sequence according to SEQ ID NO: 6.

12. The aptamer of claim 5, comprising at least one sequence selected from the group consisting of ATTAAT, CTTCGATT, ATTTCA, AAACTT, and GGAAACGA.

13. The aptamer of claim 12, comprising a first sequence according to ATTAAT, a second sequence according to CTTCGATTTCA (SEQ ID NO: 32), a third sequence according to AAACTT, and a fourth sequence according to GGAAACGA.

14. The aptamer of claim 13, wherein the second sequence at the fourth sequence are hybridized to each other.

15. The aptamer of claim 14, wherein the third sequence is part of a loop structure that links the second sequence to the fourth sequence.

16. The aptamer of claim 15, comprising a sequence according to SEQ ID NO: 7.

17. The aptamer of claim 16, comprising at least one sequence selected from the group consisting of TTGCT, AGGCCACAT, CCAATCAAG, AATTAT, and ATAAAG.

18. The aptamer of claim 17, comprising a first sequence according to TTGCTAGGCCACAT (SEQ ID NO: 33), a second sequence according to CCAATCAAG, and a third sequence according to AATTATAAAG (SEQ ID NO: 34).

19. The aptamer of claim 18, comprising a sequence according to SEQ ID NO: 8.

20. The aptamer of claim 5, comprising at least one sequence selected from the group consisting of GCAAAATT, TTGCTA, TTACGATC, and TCACTAT.

21. The aptamer of claim 20, comprising a first sequence according to GCAAAATTGCTA (SEQ ID NO: 35), a second sequence according to TTACGATC, and a third sequence according to TCACTAT.

22. The aptamer of claim 21, comprising a sequence according to SEQ ID NO: 9.

23. The aptamer of claim 5, comprising at least one sequence selected from the group consisting of AATTCCA, CATCAT, AAGCCA, and ATTCATTACTCGACAACAAT (SEQ ID NO: 29).

24. The aptamer of claim 23, comprising a first sequence according to AATTCCATCAT (SEQ ID NO: 36) and a second sequence according to AAGCCATTCATTACTCGACAACAAT (SEQ ID NO: 37).

25. The aptamer of claim 24, comprising a sequence according to SEQ ID NO: 10.

26. An aptamer comprising a sequence according to any one of SEQ ID NOS: 5-28.

27. The aptamer of any one of claims 5-26, wherein the aptamer is a DNA aptamer or an XNA aptamer.

28. A sensor comprising: a first electrode and a second electrode; a fluid channel for a fluidic sample between the first electrode the second electrode; and a plurality of aptamers attached to the first electrode, the aptamer of the plurality of aptamers being according to any one of claims 5-27.

29. The sensor of claim 28, further comprising a control circuit configured to operate the first electrode and the second electrode and to detect an electrical signal between the first electrode and the second electrode.

30. The sensor of claim 29, wherein the electrical signal is based on a binding of the IgG polypeptide to the aptamer.

31. The sensor of claim 29 or 30, wherein the electrical signal is an impedance, a voltage, or a current.

32. A method of binding an IgG polypeptide to an aptamer, comprising contacting the IgG polypeptide with an aptamer according to any one of claims 5-27.

33. A method of measuring an amount of IgG polypeptide in a fluidic sample, comprising: flowing the fluidic sample through the fluid channel of the sensor according to any one of claims 2-4 or 28-31; binding IgG polypeptides in the fluidic sample to the plurality of aptamers; operating the control circuit to pass an electrical current or voltage across the fluid channel; and measuring the electrical signal, wherein the electrical signal is indicative of an amount of IgG polypeptides bound to the plurality of aptamers.