KR100923048B1 - Nucleic Acid Chip for Obtaining Bind Profile of Single Strand Nucleic Acid and Unknown Biomolecule, Manufacturing Method Thereof, and Analysis Method of Unknown Biomolecule Using Nucleic Acid Chip - Google Patents

Abstract

The present invention relates to a nucleic acid chip for producing a binding profile of an unknown biomolecule and a single-stranded nucleic acid, a method for preparing a nucleic acid chip, and a method for analyzing an unknown biomolecule using the nucleic acid chip. Analyzing the biological meaning of unknown biomolecules included in The nucleic acid chip of the present invention comprises the steps of reacting a biological sample containing unknown biomolecules with a random single-stranded nucleic acid having a random sequence to determine biomolecule binding single-stranded nucleic acids that bind to the unknown biomolecules, and Synthesizing a capturing single-stranded nucleic acid consisting of the determined biomolecule-binding single-stranded nucleic acids and / or single-stranded nucleic acids having a nucleotide sequence complementary to the biomolecule-binding single-stranded nucleic acids to fix the capturing single-stranded nucleic acid to a substrate; It is prepared by a method comprising the steps.

Description

Nucleic acid chip for obtaining a binding profile of an unknown biomolecule and single-stranded nucleic acid, a method for preparing a nucleic acid chip, and an analysis method for an unknown biomolecule using the nucleic acid chip {Nucleic Acid Chip for Obtaining Bind Profile of Single Strand Nucleic Acid and Unknown Biomolecule, Manufacturing Method Thereof, and Analysis Method of Unknown Biomolecule Using Nucleic Acid Chip}

1 is a schematic view showing a process of determining the biomolecule binding single-stranded nucleic acids related to the method for producing a nucleic acid chip of the present invention,

Figure 2 is a schematic diagram showing a process for generating a binding profile of unknown biomolecules and single-stranded nucleic acids using a nucleic acid chip according to the present invention,

Figure 3 is a profile of a healthy human (A) and stable angina cardiovascular patient (B) serum generated by applying the nucleic acid chip according to the present invention,

Figure 4 is a schematic diagram showing the sequence of the process of building a database for each disease group the profile produced from the serum sample of the patient using the nucleic acid chip according to the present invention,

5 is a diagram showing a process of diagnosing a disease by a program using a database of a human serum protein profile generated by a nucleic acid chip and an artificial neural network algorithm according to the present invention;

6 is a diagram showing a result of diagnosing cardiovascular disease by a program using a database of a human serum protein profile generated using a nucleic acid chip according to the present invention and an artificial neural network algorithm;

7 is a diagram showing a result of diagnosing liver cancer by a program using a database of a human serum protein profile generated using a nucleic acid chip according to the present invention and an artificial neural network algorithm;

8 is a program using a database of human serum protein profiles generated using a nucleic acid chip according to the present invention and an artificial neural network algorithm, showing results of diagnosing metastasis of liver cancer,

9 is a view showing a procedure of determining the amino acid sequence of a protein specifically present in the serum of myocardial infarction patients in the database of human serum protein profiles generated using the nucleic acid chip according to the present invention;

10 is a view of determining the amino acid sequence of a protein specifically present in the serum of myocardial infarction patients in the database of human serum protein profiles generated using the nucleic acid chip according to the present invention,

11 is a view showing the result of binding the single-stranded nucleic acid obtained by producing and analyzing the surface biomolecule profile of the lung cancer cell line NCI-H1299 produced using the nucleic acid chip according to the present invention,

12 is a view showing the specificity of the biomolecule-bound single-stranded nucleic acid obtained by producing and analyzing the surface biomolecular profile of E. coli KCTC12006 and Salmonella typhimurium ATCC13311 using the nucleic acid chip according to the present invention;

Figure 13 shows the results of measuring the degree of contamination in foods contaminated with E. coli using biomolecule binding single-stranded nucleic acid and nano gold particles that specifically bind to E. coli, selected using a nucleic acid chip according to the present invention. .

(Technology)

The present invention relates to a nucleic acid chip for producing a binding profile of an unknown biomolecule and single-stranded nucleic acid, a method for producing a nucleic acid chip, and an unknown biomolecule analysis method using the nucleic acid chip.

(Background)

The technology for producing profiles of numerous biomolecules (proteins and carbohydrates), including the unknown biomolecules that make up biological samples, has been widely developed due to the development of physics, biochemistry, and bioinformatics. The need for efficient new methods and instruments is very high due to problems such as accuracy, sensitivity, test time and process automation.

In biosamples containing unknown biomolecules, information that synthesizes the quantitative state of these biomolecules, or profiles of biomolecules, is not an ultimate goal but a means to achieve that goal. It can be usefully used in microorganisms, cells, tissues, etc., and is widely applied to medicine, veterinary medicine, environmental engineering, food engineering, and agriculture.

Nucleic acids are linear multimers in which nucleotides are covalently linked, and nucleotides are small organic compounds that are phosphoric acid, sugars and purines (adenine or guanine) or pyrimidines (cytosine, thymidine, uracil). Nucleic acids exist in single- or double-stranded, single-stranded nucleic acids bind by hydrogen bonds and interactions between nucleotides under specific physical conditions to form unique conformations, which are formed by single-stranded nucleotide sequences. Is determined.

In general, nucleic acids such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are stores of information for expressing proteins with cell structure and enzyme activity, but in 1982, RNA forms a specific structure. Since the publication of its activity, there have been many reports on the structural properties of a nucleic acid and its specific function.

Nucleic acid is composed of four base repeats to maintain a high diversity to form a large number of three-dimensional structure, these three-dimensional structure is stabilized by interacting with a specific material to form a complex.

Nucleic acid can act as a ligand to a molecule containing a protein, which is characterized by high binding ability and specificity through a constant screening process and sequencing from a library of single stranded nucleic acids arranged in various nucleotide sequences. Nucleic acids that bind to substances are being selected.

The method of screening nucleic acids for binding to a specific substance is called SELEX (Systematic Evolution of Ligand by Exponential enrichment) and the selected nucleic acid is called aptamer (Tuerk C. and Gold L .; Science , 249). , pp 505-510, 1990).

Through such SELEX, nucleic acids (aptamers) that can bind with various biomolecules with very high affinity, including proteins that can bind nucleic acids in nature or proteins that do not bind nucleic acids, are selected.

However, the existing nucleic acid selection method through SELEX prior to the selection of nucleic acid that specifically binds to a specific substance (e.g. protein), first to produce and purify the protein (specific substance) in large quantities, and then to produce As a method of selecting a nucleic acid (aptamer) having a high binding capacity by reacting a single-stranded nucleic acid library with repeated proteins and repeating selection and amplification, it was necessary to first acquire a specific substance to select nucleic acids. Therefore, the conventional method for screening nucleic acids through SELEX has not recognized any technical idea of selecting and using nucleic acids as populations having meanings for a large number of unknown biomolecule populations included in biological samples.

The profiles of biomolecules, including micromolecules that constitute tissues, cell masses, cells, and microorganisms, which are biological samples, are made by various methods using physical and chemical properties, and in general, molecular weights or pI values of biomolecules. Electrophoresis is used to confirm the biomolecule profile, which is a quantitative state of the biomolecule in a biological sample.

In addition, after analyzing the profile to determine useful biomolecules and isolate them, a method of identifying their components by using Matrix Assisted Laser Desorption / Ionization-Time Of Flight (MALDI-TOF). Recently, many studies have been conducted on protein profiles by Surface-enhanced laser desorption / ionization time of flight mass spectrometry (SELDI-TOF-MS) (Adam et al ., Cancer Research, 62, 3609-3614. 2002; Li et al ., Clinical Chemistry, 48, 1296-1304. 2002; and Petricoin et al ., The Lancet, 359,572-577. 2002).

In recent years, high-throughput screening techniques for proteins include protein chips or aptamer chips (Smith et al ., Mol Cell Protomics, 11-18. 2003; and McCauley et al . , Anal Biochem, 319 (2), 244-250. 2003).

Since the protein chip knows the arrangement of the antibodies, it is possible to search and analyze the classification and quantification of specific substances. Protein chip manufacturing method is a method of fixing by spotting (spotting) the antibody using a microarrayer (Microarrayer). Protein chip detection technology needs to be able to detect very weak signals that occur when protein chips are packed with high density of antibodies in a small area to provide as much information as possible on a single chip. In addition, as the bioinformation on proteins increases, the degree of integration is increasing. Accordingly, a new method for detecting quantitatively and quickly and accurately is required.

Until now, the detection method is mainly used laser induced fluorescence (laser induced fluorescence) and the electrochemical detection method has been developed. As described above, methods for producing and analyzing profiles of specific proteins in biological samples using protein chips have been developed, but there are problems such as using expensive instruments and reagents and performing complicated processes. There is a limit that can be produced only for the molecules that can be produced.

The aptamer chip is different from using an aptamer (nucleic acid) instead of an antibody in a protein chip, and the other elements are very similar.

As described above, methods for producing a quantitative state of a biomolecule, that is, a profile, in a biological sample using a protein chip and an aptamer chip have been developed, but there are problems such as using expensive instruments and reagents and performing a complicated process. . In particular, until now, the protein chip or aptamer chip has a limit that can be produced only limited to the known protein that can produce antibodies or aptamers.

Biosamples are known to be composed of millions of proteins, but the number of known proteins is currently only tens of thousands, so technology for producing quantitative states, or profiles, of unknown biomolecules such as unknown proteins in biosamples. The need is very high.

The study of analyzing biomolecules in biosamples collectively includes biomolecules that can diagnose diseases, biomolecules that can be used to diagnose diseases, biomolecules that can analyze therapeutic effects, disease development and progression. It may be used to identify biomolecules that play an important role, susceptibility-related biomolecules, and target molecules for drug development.

SUMMARY OF THE INVENTION An object of the present invention is to provide a nucleic acid chip capable of generating a binding profile of an unknown biomolecule and single-stranded nucleic acids contained in a biological sample, whereby the unknown biomolecule is associated from the binding profile generated using the nucleic acid chip. It is to be able to analyze various biological meanings including disease information.

According to the present invention, there is provided a nucleic acid chip used to generate a binding profile between single-stranded nucleic acids and unknown biomolecules, a method for producing the same, and a method for analyzing an unknown biomolecule using the nucleic acid chip, the nucleic acid chip according to the present invention. Is used to analyze the biological meaning of the unknown biomolecules included in the biological sample.

The method for preparing a nucleic acid chip according to the present invention determines a biomolecule-binding single-stranded nucleic acid that binds the unknown biomolecules by reacting a biological sample containing unknown biomolecules with a random single-stranded nucleic acid having a random nucleotide sequence. The first step is to synthesize a single-stranded nucleic acid consisting of a single-stranded nucleic acid having a base sequence complementary to the determined biomolecule-binding single-stranded nucleic acids and / or the biomolecule-bound single-stranded nucleic acids to adhere to the substrate A second step is included.

The nucleic acid chip according to the present invention, biomolecule binding single-stranded nucleic acids that bind to unknown biomolecules contained in a biological sample and / or single-stranded nucleic acids having a base sequence complementary to the biomolecule-bound single-stranded nucleic acids Capture single-stranded nucleic acids consisting of two groups are fixed to the substrate.

Unknown biomolecule analysis method using the nucleic acid chip according to the present invention, preparing a nucleic acid chip according to the present invention; Reacting the single-stranded nucleic acids having the same base sequence as the capture single-stranded nucleic acids of the nucleic acid chip and the unknown biomolecules of the biological sample to form a biomolecule-target single-stranded nucleic acid complexes and the biomolecule-target single strand Separating nucleic acid complexes; Separating, amplifying and labeling the target single stranded nucleic acids from the separated biomolecule-target single stranded nucleic acid complexes; Reacting the labeled single stranded nucleic acids with the capture single stranded nucleic acids of the nucleic acid chip to obtain a binding profile via the label; And analyzing the biological meaning of the unknown biomolecules by comparing the obtained profile with profile data already secured. It includes.

According to the present invention, a basic principle of a nucleic acid chip and an unknown method for analyzing biomolecules using the same is that nucleic acid chips which contain single-stranded nucleic acids (captured single-stranded nucleic acids) complementary to the single-stranded nucleic acids that bind to unknown biomolecules. Adhere to and react the unknown biomolecules under test with the single-stranded nucleic acids bound thereto to form biomolecule-target single-stranded nucleic acid complexes, and then separate the target single-stranded nucleic acids and the nucleic acid chip from the complex. By acquiring and characterizing the complementary binding profile of the capturing single-stranded nucleic acids, the result is to analyze the binding profile characteristics of the unknown biomolecules to the single-stranded nucleic acid. You can fix single-stranded nucleic acids that complementarily bind to single-stranded nucleic acids that bind to molecules, but unknown biomolecules In the analysis, single-stranded nucleic acids complementary to target single-stranded nucleic acids that bind to unknown biomolecules in the process of amplifying the target single-stranded nucleic acids isolated from the biomolecule-target single-stranded nucleic acid complexes are also used. Since the information is generated in a state similar to that of the information, the same purpose can be achieved by using biomolecule-binding single-stranded nucleic acids that bind to unknown biomolecules as the capturing single-stranded nucleic acids of the nucleic acid chip according to the present invention. Furthermore, the same purpose can be achieved by simultaneously using biomolecule-linked single-stranded nucleic acids and single-stranded nucleic acids having base sequences complementary to biomolecule-linked single-stranded nucleic acids.

When the unknown biomolecule is analyzed using the nucleic acid chip according to the present invention, relevant profile data are accumulated, and specific single-stranded nucleic acids that contribute to the analysis of the biological meaning of the unknown biomolecule are naturally revealed. This allows the discovery of single-stranded nucleic acids that have meaning for analyzing unknown biomolecules.

The biological sample to which the nucleic acid chip according to the present invention can be applied includes bacteria, fungi, viruses, cell lines, tissues, and the like. The biomolecules whose biological meaning can be analyzed by the nucleic acid chip according to the present invention include proteins, At least one biomolecule selected from the group consisting of carbohydrates, lipids, polysaccharides, glycoproteins, hormones, receptors, antigens, antibodies and enzymes.

The first step of the method for producing a nucleic acid chip according to the present invention comprises a biological sample containing unknown biomolecules and single-stranded nucleic acids having a random sequence (hereinafter, referred to as 'random single-stranded nucleic acids'). Reacting to determine biomolecule binding single-stranded nucleic acids (hereinafter referred to as 'biomolecule binding single-stranded nucleic acids') that bind to unknown biomolecules.

Preferably, the determining of the biomolecule binding single-stranded nucleic acids comprises the steps of: reacting the random single-stranded nucleic acids with the unknown biomolecules of the biological sample to prepare biomolecule-single-nucleic acid complexes; Washing the biomolecule-single-nucleic acid complexes and selecting the biomolecule-single-nucleic acid complexes with a certain binding force or more based on the magnitude of the binding force between the biomolecules and the single-stranded nucleic acids; Separating and amplifying the single-stranded nucleic acids from the selected complexes; And determining the biomolecule binding single-stranded nucleic acids by inserting the amplified single-stranded nucleic acids into a cloning vector to obtain a single clone to determine the nucleotide sequence of the single-stranded nucleic acids. It includes.

The selection and amplification of the biomolecule-single-nucleic acid complexes may be repeatedly performed a plurality of times, but the biological sample including the unknown biomolecule is composed of numerous biomolecules and their quantitative differences are very diverse. It may be more preferable to manufacture a linear method that performs one-time selection and amplification and enhances the washing process, rather than a cyclic method of repeatedly selecting and amplifying single-stranded nucleic acids that bind to a molecule.

Random single-stranded nucleic acids having the random nucleotide sequence, using a single-stranded DNA oligonucleotide having a random sequence as follows to prepare a double-stranded DNA, RNA random single through in vitro transcription ( in vitro transcription) It can be prepared with stranded nucleic acid.

5'- GGGAGAGCGGAAGCGTGCTGGGCC N ₄₀ CATAACCCAGAGGTCGATGGATCCCCCC -3 '(where the underlined base sequence is a fixed site of the nucleic acid library, N ₄₀ means that there are equal concentrations of A, G, T, C, etc. at each position)

FW primer (5'-GGGGGA ATTCTAATACGACTCACTATAGGGAGAGCGGAAGCGTGCTGGG-3 ': SEQ ID NO: 1) used for PCR (Polymerase Chain Reaction) is capable of base binding with the 5' end of the underlined bases of the above nucleotide sequence and the RNA polymer of bacteriophage T7. It contains a promoter sequence for an aze.

The RE primer of PCR (5'-GGGGGGATCCATCGACCTCTGGGTTATG-3 ': SEQ ID NO: 2) can base bond with the 3' end of the underlined bases of the above base sequence.

Preferably, in the nucleic acid chip manufacturing method of the present invention, the biomolecule binding single-stranded nucleic acids are RNA single-stranded nucleic acids including 2'-F-substituted pyrimidine and are prepared by synthesis and purification by in vitro transcription.

The synthesized random single-stranded nucleic acids can be reacted with the biomolecule for 30 minutes by treating the biological sample at a concentration of 10 ¹⁵ nucleotide sequences / 1 ml, for example.

The biomolecule binding single-stranded nucleic acids can be inserted into the cloning vector product obtained by RT-PCR (Reverse Transcription-PCR) to secure E. coli clones and determine the base sequence.

At this time, the reaction temperature is ideally carried out at a temperature lower than the SELEX operating temperature, preferably, the reaction is carried out at a temperature of 20 to 37 ℃.

In general, excessive amounts of proteins and single-stranded nucleic acids are treated to prevent nonspecific binding of single-stranded nucleic acids that bind to biomolecules, preferably yeast tRNA, salmon sperm DNA or human placental DNA. (human placental DNA) can be used.

The second step of the method for producing a nucleic acid chip according to the present invention, the single-stranded nucleic acids having a base sequence complementary to the biomolecule-bound single-stranded nucleic acids and / or the biomolecule-bound single-stranded nucleic acids determined in the first step Synthesizing the single stranded nucleic acid consisting of the step of preparing a nucleic acid chip of the present invention by fixing the synthesized capturing single-stranded nucleic acids on a substrate.

Since capture single-stranded nucleic acid is a key factor that has a great influence on the degree of hybridization, the determination of its nucleotide sequence is very important. Each capture single-stranded nucleic acid fixed to the nucleic acid chip of the present invention is composed of a characteristic base, and the combination of the capture single-stranded nucleic acids and the target single-stranded nucleic acids must maintain an appropriate Tm value. Accordingly, the degree of hybridization of the conjugate should be able to maintain its signal value uncontaminated by the target single-stranded nucleic acids labeled with fluorescence.

Thus, the base sequence of the capture single stranded nucleic acids is determined based on the base sequence of the biomolecule binding single stranded nucleic acids selected from random single stranded nucleic acids in the first step. Preferably the capture single stranded nucleic acids are single stranded nucleic acids of an oligonucleotide having a nucleotide sequence of from 60 bp.

In addition, the substrate in the method for producing a nucleic acid chip of the present invention may be an inorganic material such as glass or silicon, or a polymer material such as acrylic or PET (polyethylene terephtalate), polycarbonate, polystyrene, polypropylene, or the like. It may be used to be made of, preferably a slide glass made of glass. In this case, the substrate may be one coated with an amine group or an aldehyde group. For example, a nucleic acid chip is prepared by arranging the capturing single-stranded nucleic acids on a regular basis using UltraGAPS ™ Coated Slide (Corning), a glass slide coated with Gamma Amino Propyl Silane (GAPS).

In the preparation of the nucleic acid chip according to the present invention, a microarrayer system can be used, and each capture single-stranded nucleic acid is dissolved in a buffer to adjust the concentration, and the humidity in the arrayer is maintained at 70 to 80%. To perform spotting. The spotted slides are left in a humidified chamber and then baked in a UV crosslinker.

As described above, the nucleic acid chip according to the present invention is fixed in a glass slide by capturing single-stranded nucleic acids by a method well known in the art, and then dried by directly centrifuging the slide, and then stored in a light-blocked state until use. do.

Capture single-stranded nucleic acids can be regularly produced nucleic acid chips by a variety of known methods (M. schena; DNA microarray; a practical approach, Oxford, 1999).

In the nucleic acid chip according to the present invention, as long as the biological meaning of the unknown biomolecule can be analyzed with the same degree of precision, reducing the number of capturing single-stranded nucleic acids that are adhered to the nucleic acid chip reduces the manufacturing cost and efficiency of the nucleic acid chip. It is preferable in terms of.

For this reason, the contribution of each capture single-stranded nucleic acid to the biological meaning analysis of the unknown biomolecules, and within the scope of analyzing the biological meaning of the unknown biomolecule, based on the analyzed contributions By selecting them, the method may further include reducing the number of capture single-stranded nucleic acids adhering to the nucleic acid chip of the present invention.

Hereinafter, with reference to the accompanying drawings and examples will be described in detail a nucleic acid chip, a method for producing a nucleic acid chip, and an unknown biomolecule analysis method using the nucleic acid chip. The following embodiments are merely illustrative of the present invention and are not intended to limit the scope of the present invention.

Example 1 Preparation of Biomolecule Binding Single-stranded Nucleic Acid Binding to Human Serum Protein

As shown in Figure 1, using a single-stranded DNA oligonucleotide having a random nucleotide sequence as follows to prepare a double-stranded DNA through PCR (Polymerase Chain Reaction), the single-stranded through in vitro transcription RNA libraries (random single stranded nucleic acids) were prepared.

5'- GGGAGAGCGGAAGCGTGCTGGGCC N ₄₀ CATAACCCAGAGGTCGATGGATCCCCCC -3 '(where the underlined base sequence is a fixed region of the nucleic acid library and N ₄₀ means that there are equal concentrations of A, G, T, C, etc. at each position)

The FW primer of SEQ ID NO: 1 used for PCR can base bond with the 5 'end of the underlined bases of the base sequence and includes a promoter base sequence for RNA polymerase of bacteriophage T7.

The RE primer of SEQ ID NO: 2 used for PCR can base bond with the 3 'end of the underlined bases of the above base sequence. FW and RE primers contain restriction enzyme cleavage sequences such as Eco RI and Bam HI, respectively, for subsequent cloning.

Random single-stranded nucleic acids to be reacted with a biological sample is an RNA library containing 2'-F-substituted pyrimidine, DNA nucleic acid library transcript and PCR primers were designed and prepared as described above prepared by PCR and in vitro transcription method.

PCR was performed using a 1000 pmoles single-stranded nucleic acid transcript, primer pair (5P7) of 2,500 pmoles PCR with 50 mM KCl, 10 mM Tris-Cl (pH 8.3), 3 mM MgCl ₂ , 0.5 mM dNTP (dATP, dCTP, dGTP, and dTTP), 0.1 U Taq DNA Polymerase (Perkin-Elmer, Foster City Calif.) and then purified by a QIAquick-spin PCR purification column (QIAGEN Inc., Chatsworth Calif.).

Random single-stranded nucleic acids comprising 2′-F-substituted pyrimidines were prepared by synthesis and purification by in vitro transcription. 200 pmoles double stranded DNA transcript, 40 mM Tris-Cl (pH 8.0), 12 mM MgCl 2, 5 mM DTT, 1 mM spermidine, 0.002% Triton X-100, 4% PEG 8000, 5 U T7 RNA Polymerase and 1 mM After ATP, GTP and 3 mM 2'F-CTP, 2'F-UTP was reacted for 6 to 12 hours at 37 ℃, and purified by Bio-Spin 6 chromatography column (Bio-Rad Laboratories, Hercules Calif.) UV spectrometer was used to detect the amount of purified nucleic acid and its purity.

The concentration solution of 10 ¹⁵ nucleotide sequences / 1 ml of the random single-stranded nucleic acids synthesized above was selected at a concentration of 200 pmol / 200 μl (50 mM TrisCl (pH 7.4), 5 mM KCl, 100 mM NaCl, 1). mM MgCl ₂ , 0.1% NaN ₃ ) was heated at 80 ° C. for 10 minutes, and then left on ice for 10 minutes. A reaction solution was prepared by adding 5 times yeast tRNA (yeast tRNA, Life Technologies) and 0.2% BSA (bovine serum albumin, Merck) of the used single-stranded nucleic acid.

10 μl of the serum sample was added to 90 μl of PBS solution and the reaction was shaken for 30 minutes with a nitrocellulose membrane disc. The RNA single-stranded nucleic acids prepared above were treated with a serum sample attached disk and reacted for 30 minutes.

The selection of biomolecule-bound single-stranded nucleic acid binding to human serum samples (biomolecules) is primarily aimed at single-stranded nucleic acids that show binding to human serum samples, and the reaction is repeated only once with various washing buffers. Human serum protein (biomolecule) -single-stranded nucleic acid complexes were obtained by the selection process.

As the washing buffer of the biomolecule-single-nucleic acid complexes, 0 to 1 × Serex buffer or 0 to 500 mM EDTA solution was used. RT-PCR was performed on the isolated complex to amplify a DNA pool indicative of RNA (biomolecule binding single-stranded nucleic acid) that binds to serum proteins. In this case, by repeating the selection and amplification process a number of times, biomolecule binding single-stranded nucleic acids may be prepared.

Cloning the secured RT-PCR product DNA into a plasmid to obtain a monoclonal, the production of biomolecule binding-single-stranded nucleic acids was completed. The base sequence of single-stranded nucleic acids binding to these biomolecules was performed by separating the plasmids by standard methods.

The base sequence of the capture single-stranded nucleic acids to be used in the nucleic acid chip according to the present invention for generating a profile of the biomolecule is the base sequence and / or biomolecule binding of the biomolecule binding single-stranded nucleic acids binding to human serum proteins (biomolecules) Since the nucleotide sequences of the single stranded nucleic acids complementarily bind to the single stranded nucleic acids, the secondary structure and structure free energy are identified using the MFOLD program that models the secondary structure of the nucleic acid. Biomolecule binding single stranded nucleic acid was selected.

Example 2. Manufacture of Nucleic Acid Chips

Organic synthesis of single-stranded nucleic acids (oligonucleotides) having a base sequence complementary to about 3,000 biomolecule-bound single-stranded nucleic acids having a nucleotide sequence selected in Example 1 as a capturing single-stranded nucleic acid to be fixed to the glass slide surface (Bionia) was prepared.

Using a GAPS (Gamma Amino Propyl Silane) coated glass slide, UltraGAPS ™ Coated Slide (Corning, Inc.), a nucleic acid chip was prepared in which a single-stranded nucleic acid was fixed on a regular basis. Nucleic acid chip was manufactured using a pin-type microarrayer system (GenPak), and the spot spacing was about 370 μm between centers of the spots (center-to-center). Each capture single stranded nucleic acid was dissolved in standard solution to adjust the concentration. At this time, the humidity in the arrayer was maintained at 70% to perform spotting. The spotted slides were left in a humidified chamber for 24 to 48 hours and then baked in a UV crosslinker. After capturing single-stranded nucleic acids in a glass slide by a widely known method, the slide was directly centrifuged and dried, and then stored in a light-blocked state.

Example 3. Preparation of Human Serum (Biomolecule) -Target Single-stranded Nucleic Acid Complex and Preparation of Target Single-stranded Nucleic Acid

In order to prepare a transcript of a single-stranded nucleic acid pool that binds to biomolecules containing unknown biomolecules by mixing the same amount of the plasmids inserted with the biomolecule-binding single-stranded nucleic acids selected in Example 1 and used for preparing nucleic acid chips. A plasmid pool was prepared. The single-stranded nucleic acid pool that binds to human serum proteins was designed and prepared by the above plasmid pool and PCR primers, and prepared by PCR and in vitro transcription methods.

Standard PCR method in PCR reaction solution, 100 pM 5'-primer, 100 pM 3'-primer, dNTP mixture (5 mM dATP, 5 mM CTP, 5 mM dGTP, 5 mM dTTP) using 1 pg plasmid as transcript in the prepared plasmid pool By repeating 30 cycles at 94 ℃ 30 seconds, 52 ℃ 30 seconds, 72 ℃ 20 seconds conditions to synthesize a double-stranded nucleic acid was purified by a QIAquick-spin PCR purification column (QIAGEN Inc., Chatsworth Calif.).

Target single-stranded nucleic acids of RNA molecules containing 2′-F-substituted pyrimidines were prepared by synthesis and purification by in vitro transcription.

200 pmoles double stranded DNA transcript, 40 mM Tris-Cl (pH 8.0), 12 mM MgCl 2, 5 mM DTT, 1 mM spermidine, 0.002% Triton X-100, 4% PEG 8000, 5 U T7 RNA Polymerase and 1 mM After ATP, GTP and 3 mM 2'F-CTP, 2'F-UTP was reacted for 6 to 12 hours at 37 ℃, it was purified by Bio-Spin 6 chromatography column (Bio-Rad Laboratories, Hercules Calif.).

Human serum used in the analysis was serum of healthy and stable angina patients with cardiovascular disease. The reaction was performed by shaking 10 minutes with 10 µl of serum sample added with 90 µl of PBS solution and a Nitrocellulose membrane disc. To prepare a sample. 100-400 ng of the target single-stranded nucleic acids prepared above were added and reacted for 30 minutes to form a biomolecule-target single-stranded nucleic acid complex.

The prepared single-stranded nucleic acids were treated with a serum sample attached disk and reacted for 30 minutes. Washed three times with a selection buffer or 50 mM EDTA and the reaction product was separated and harvested.

Cy-5-labeled primer (5'-Cy5-CGGAAGCGTGCTGGGCC-3 ': SEQ ID NO: 3) was subjected to RT-PCR by treating a disk with serum protein (biomolecule) -target single-stranded nucleic acid in RT-PCR solution. Was prepared. The target single-stranded nucleic acids prepared in the plasmid pool prepared above were prepared by RT-PCR in the same manner as described above to prepare a Cy-3-labeled primer (5'-Cy3-CGGAAGCGTGCTGGGCC-3 '). The two solutions were mixed in equal amounts to produce target single stranded nucleic acids.

Example 4. Reaction of Nucleic Acid Chip and Target Single-stranded Nucleic Acids

As shown in FIG. 2, the target single-stranded nucleic acids prepared in Example 3 were treated with capture single-stranded nucleic acids of the nucleic acid chip of the present invention, hybridized at 60 ° C. for 4 to 12 hours, and washed with a 0.1 × SSC solution at 42 ° C. It was. The hybridization solution then comprises 1 M sodium chloride, 0.3 M sodium citrate, 0.5% SDS or 100 μg / ml salmon pump DNA, 0.2% bovine serum albumin or single stranded nucleic acid.

After the hybridization was completed, the glass slide was treated with the solution prepared in Example 3, hybridization was performed at 42 ° C. for 12 hours, and the nucleic acid chip was washed with a washing solution. At this time, the composition of the washing solution is, for example, 1X SSC + 0.2% SDS, 1X SSC + 0.2% SDS, 0.5X SSC + 0.2% SDS, 0.01X SSC + 0.2% SDS in the order of 30 ℃ at each step 30 It was performed for a minute.

Example 5. Spot detection and analysis of nucleic acid chip

After the washing of Example 4 was finished, the glass slide was dried by centrifugation, and then a laser scanner having a laser (Cy5, 635 nm) of a suitable wavelength for excitation of the used fluorescent dye (laser scanner, GenePix4000, Search using Axon). The fluorescence images were saved in a multi-image-tagged image file (TIFF) format and then analyzed with appropriate image analysis software (GenePix Pro 3.0, Axon).

The signal intensity per spot (quanta) is used by subtracting the base signal of the surrounding background, where the background signal is a local background consisting of the surrounding signals of four spots around a particular spot. ). If more than 90% of the pixels in the spot exhibit a signal strength that exceeds the background signal + 2 standard deviation (SD), then include it in the data analysis. It is common to classify as a bad spot and not include it in the analysis.

Variation according to labeling efficiency is normalized (eg, Normalized Intensity = Probe Intensity / IS intensity) using signals of internal standard (IS), and in case of monolabeling Record the results in the signal intensity of the Cy5 channel and use the average if the spotting is more than doubled. The signal intensity (S) of the target single-stranded nucleic acid is obtained by calculating the respective signal intensities for the pixels of the spot and then using the median value of pixel-by-pixel. ). Signal strength (S) is averaged to the variation in labeling efficiency using the internal standard (IS).

S '(normalized value) = S (Cy5-reference) ㅧ (Cy5-IS).

In this way, the relationship between the analysis result of the pixel density and the actual sample amount can be identified to confirm the correlation. Imaging nucleic acid chip fluorescence data and providing a method for identifying biomolecule profiles in biological samples with patterns of all spots, and methods of hierarchical clustering and artificial neural network It can be analyzed and used.

The fluorescence intensity of the spots varies with the properties of the double strand formed by the capture single stranded nucleic acid and the target single stranded nucleic acid. The extent and amount of binding of the human serum protein- (target) single-stranded nucleic acid complex is determined according to the specificity and binding capacity between them.

The base sequence of the target single-stranded nucleic acid and the capture single-stranded nucleic acid attached to the nucleic acid chip originating from the human serum protein-target single-stranded nucleic acid complex is the double-strand stability of the target single-stranded nucleic acid-trapping single-stranded nucleic acid and the target on the nucleic acid chip. The amount of single stranded nucleic acid affects the degree of fluorescence.

In other words, the degree of fluorescence represents the amount of target single-stranded nucleic acid, and the amount of target single-stranded nucleic acid expresses the amount of human serum protein-target single-stranded nucleic acid complex. The amount of the complex also represents the amount of biomolecule in the biological sample. Therefore, the amount of specific biomolecules can be identified in a biological sample including an unknown biomolecule corresponding to the spot from the fluorescence degree of the spot. Eventually, by analyzing the fluorescence level of the formed spots to confirm the pattern of all spots of the nucleic acid chip it is possible to confirm the profile of the serum protein in human serum.

That is, the spots formed show a blue-yellow-red color spectrum because the ratio of the target single-stranded nucleic acid labeled Cy-3 and the target single-stranded nucleic acid labeled Cy-5 differs from the capture single-stranded nucleic acid. The color spectrum of a specific spot represents the amount of a specific biomolecule (protein) present in a specific serum sample that constitutes human serum, so that an image showing the color spectrum of all spots on a nucleic acid chip is used for a specific biological sample. Corresponds to the molecular profile.

In other words, in the biomolecule analysis method of the present invention, a target single-stranded nucleic acid that binds to a single-stranded nucleic acid at a specific spot to form a double strand is a target single-stranded nucleic acid labeled with Cy-3 and a target single-stranded Cy-5 labeled with Cy-3 It is composed of nucleic acids, the former in constant amounts, but the latter in proportion to the corresponding biomolecule in human serum. This results in certain spots becoming blue if the latter is present in relatively small amounts, yellow if similar, and red if present in excess.

Analysis of the spot on the nucleic acid chip, the degree of fluorescence differs depending on the number of target single-stranded nucleic acids in the double-stranded, which correlates with the number of biomolecules. Therefore, the image reflecting the color spectrum of all the spots constituting the nucleic acid chip of the present invention is a biomolecular profile of a biological sample containing unknown biomolecules.

The test results are as shown in FIG. Forms a color spectrum of blue-yellow-red.

From the results of Figure 3, using a nucleic acid chip based on the target single-stranded nucleic acid binding to human serum proteins, the profile of the serum protein in human serum can be confirmed and also in the serum of healthy human (A) and stable angina cardiovascular disease (B). It can be seen that the biomolecule profiles are different.

Figure 4 is a flow chart showing the procedure for the process of the database consisting of disease groups from the blood sample of the patient produced using the nucleic acid chip of the present invention. Figure 5 is a flow chart for diagnosing a disease by producing a biomolecular profile of a specific human serum by a program using a database and artificial neural network configured by the disease group.

As shown in FIG. 4, useful information can be obtained by analyzing a database constructed of profiles produced in many biological samples by bioinformatics techniques.

Serum samples of Lee 2-1 (99) were examined using the serum profile database of cardiovascular patients such as healthy, stable angina, unstable angina and myocardial infarction, as shown in FIG. 6 and 72.5% 10 fold cross validation. As a healthy person you can predict.

The clinical data of the serum samples used to construct the cardiovascular disease diagnosis database are shown in Table 1 below. A total of 127 patients including 37 healthy, 36 stable angina, 27 unstable angina and 27 myocardial infarction patients.

Clinical Information of Cardiovascular Patients healthy person Stability angina Unstable angina Myocardial infarction gender male 35 35 27 27 female 2 One One 0 age 40-49 One 0 One 0 50-59 13 17 15 17 60-69 22 18 11 10 70-79 One One One 0 Sum 37 36 28 27

The results of testing serum samples of KIM using a serum profile database of healthy people and liver cancer are shown in FIG. 7 and can be predicted as liver cancer patients with 93.0% 10 fold cross validation.

In addition, the results of testing serum samples of KIM using a serum protein profile database of healthy people, non-transparent liver cancer and metastatic liver cancer are shown in FIG. 8 to test for metastasis. Can be predicted by the patient.

The clinical data of the serum samples used to establish the liver cancer diagnosis database are shown in Table 2. There are 19 healthy patients, 72 non-transmitted liver cancer patients, 11 metastatic liver cancer patients, 83 liver cancer patients, and 102 samples.

Clinical Information of Liver Cancer healthy person Vision liver cancer Metastatic liver cancer gender male 17 67 10 female 2 5 0 age 40-49 14 60 7 50-59 5 7 3 60-69 0 5 One Sum 19 72 11

After comparing the seroprofiles of healthy and myocardial infarction patients to determine the specific spots in myocardial infarction patients, attaching biotin to the corresponding single-stranded nucleic acid and reacting with streptavidin, 9 is a flowchart illustrating a procedure of identifying biomolecules by separating a complex formed by reacting with a serum sample and then separating a band formed by electrophoresis. Figure 10 is a view of determining the amino acid sequence of the protein by separating the protein binding to the selected single-stranded nucleic acid MALDI-TOF-TOF instrument.

Using the nucleic acid chip of the present invention to which a single-stranded nucleic acid based on a single-stranded nucleic acid that binds to a biomolecule constituting the biological sample was attached, the biomolecule profile was searched and analyzed in a specific biological sample.

In addition, it is a program produced by producing biomolecules of medically useful biological samples, and then producing a serum profile of a specific person and using artificial neural network algorithms, the presence and types of cardiovascular diseases, the presence and metastasis of liver cancer invention The degree was checked.

Databases organized by disease groups were analyzed to determine useful spots and to prepare corresponding single-stranded nucleic acids to identify and identify corresponding proteins.

Example 6 Profile Generation and Application of Surface Biomolecules of Cell Lines

6-1. Nucleic acid chip production

The nucleic acid chip of the present invention was produced by producing the profile of the surface biomolecules of the lung cancer cell line NCI-H1299 which is a biological sample by the method of Examples 1 and 2. After reacting the prepared random single-stranded nucleic acids with lung cancer cell lines, wash the cell line (biomolecule) -single-stranded nucleic acid complex using a washing buffer to dissociate the single-stranded nucleic acid according to the degree of binding and unbound single-stranded nucleic acid, and then to 5,000xg. After repeating the process of centrifugation, single-stranded nucleic acid complexes were separated by centrifugation to prepare single-stranded nucleic acids that bind to the surface biomolecules of lung cancer cell lines.

A clone was selected from the prepared single-stranded nucleic acids to determine and analyze the nucleotide sequence to select about 1,000 biomolecule-bound single-stranded nucleic acids. The nucleic acid chip of the present invention was prepared by synthesizing an oligonucleotide (captured single-stranded nucleic acid) consisting of complementary nucleotide sequences of about 1,000 biomolecule-binding single-stranded nucleic acids selected by the method of Example 2 and attaching it onto a solid substrate.

6-2. Generation of Surface Biomolecular Profiles in Cell Lines

Using the nucleic acid chip produced by the method of Example 6-1, the surface molecule profile of the lung cancer cell line NCI-H1299 was produced. After reacting the lung cancer cell line with the single-stranded nucleic acid pool, the biomolecule-single-nucleic acid complex of the cell line (biosample) was washed and separated. Single-stranded nucleic acid bound to the complex was amplified and labeled by the method of Example 3. Capture single-stranded nucleic acid and labeled target single-stranded nucleic acid were reacted by the method of Example 4. The measurement of the substance labeled on the target single-stranded nucleic acid was carried out by the method of Example 5 and confirmed the profile of the surface biomolecules of the lung cancer cell line.

The single-stranded nucleic acid, which is expected to bind strongly to the lung cancer cell line, was selected as the produced profile, and the single-stranded nucleic acid attached to the FITC was synthesized and reacted with the lung cancer cell line.

As described above, it was confirmed that the selected single-stranded nucleic acid binds to the lung cancer cell line by analyzing the lung cancer cell line profile produced using the nucleic acid chip of the present invention.

Example 7 Profile Generation and Application of Surface Biomolecules of Escherichia Coli

7-1. Nucleic acid chip production

The nucleic acid chip of the present invention was produced by the E. coli KCTC12006 as a biological sample and the method of Examples 1 and 2.

After reacting the prepared single-stranded nucleic acids with E. coli, wash the E. coli (biomolecule) -single-nucleic acid complex using a washing buffer to dissociate the single-stranded nucleic acid according to the degree of binding and unbound single-stranded nucleic acid, and then centrifuged at 5,000xg. After repeated treatment, the E. coli-single-nucleic acid complex was separated by centrifugal separation to prepare single-stranded nucleic acids that bind to the surface biomolecules of E. coli.

A clone was selected from the prepared single-stranded nucleic acids to determine and analyze the nucleotide sequence to select about 1,000 biomolecule-bound single-stranded nucleic acids. Oligonucleotides (captured single-stranded nucleic acids) were synthesized using complementary nucleotide sequences of selected 1,000 biomolecule binding single-stranded nucleic acids and attached onto a solid substrate to prepare a nucleic acid chip according to the present invention.

7-2. Generation of Surface Biomolecular Profiles of Escherichia Coli

The surface molecule profile of Escherichia coli KCTC12006 was produced using the nucleic acid chip prepared by the method of Example 7-1. E. coli and the single-stranded nucleic acid pool were reacted, and then the E. coli-target single-stranded nucleic acid complex was washed and separated. Target single-stranded nucleic acid bound to the complex was amplified and labeled by the method of Example 3. Capture single-stranded nucleic acid and labeled target single-stranded nucleic acid were reacted by the method of Example 4. The measurement of the substance labeled on the target single-stranded nucleic acid was performed by the method of Example 5, and confirmed the profile of the surface biomolecules of E. coli.

In the same way to produce the surface biomolecular profile of Escherichia coli KCTC12006, a surface biomolecular profile of Salmonella typhimurium ATCC13311 was produced to construct a database, and then a single-stranded nucleic acid that specifically binds to Escherichia coli based on the hierarchical clustering method. Selected. As a result of measuring the specificity of the single-stranded nucleic acid by SPR equipment (BIAcore) was as shown in Figure 12, it was confirmed that the selected single-stranded nucleic acid specifically binds to E. coli compared with Salmonella.

The presence or absence of E. coli in the solution using the single-stranded nucleic acid selected above as a method for measuring E. coli using single-stranded nucleic acid and nano-gold particles bound to E. coli (see, for example, Korean Patent Application No. 10-2006-0072480) As a result of measuring the degree of contamination of E. coli in the food was as shown in FIG. The single-stranded nucleic acid is reacted with the washed Selex buffer, nanoparticles are added, NaCl solution is added, and the E. coli-free solution is clear and colorless blue, and the E. coli-contaminated solution turns red. It was confirmed that it is proportional to the coliform count.

According to the nucleic acid chip according to the present invention described above and an unknown method for analyzing biomolecules using the same, a very simple, inexpensive and efficient method using high throughput screening, including a microorganism, a cell, and a protein As it is possible to produce profiles for unknown biomolecules contained in samples, it is expected to be applied as a tool for analyzing the biological meaning of unknown biomolecules in a wide range of fields such as medicine, veterinary medicine, environmental engineering, food engineering, and agriculture. .

In addition, according to the nucleic acid chip and the biomolecule analysis method using the same according to the present invention, in the process of analyzing the biological meaning of the unknown biomolecule, it is possible to determine the biological action of the unknown biomolecule and determine and rescue the structure thereof. In addition, it is possible to select specific single-stranded nucleic acids that specifically bind to the biomolecules, and can provide an environment that can be used as a tool for understanding the action of more sophisticated biomolecules using the selected single-stranded nucleic acids.

In addition, according to the biomolecule analysis method using the nucleic acid chip according to the present invention, by analyzing the profile of the biomolecules related to medical conditions, biomolecules capable of diagnosing the disease, biomolecules capable of analyzing the therapeutic results, disease Biomolecules that play an important role in the development and progression, biomolecules related to disease susceptibility, and target molecules for drug development can be identified efficiently and in a very inexpensive manner.

<110> GENOPROT CO., LTD.          KIM, Sung-chun <120> Nucleic Acid Chip for Obtaining Bind Profile of Single Strand          Nucleic Acid and Unknown Biomolecule, Manufacturing Method          Thereof, and Analysis Method of Unknown Biomolecule Using Nucleic          Acid Chip <160> 3 <170> KopatentIn 1.71 <210> 1 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 1 gggggaattc taatacgact cactataggg agagcggaag cgtgctggg 49 <210> 2 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 2 ggggggatcc atcgacctct gggttatg 28 <210> 3 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 3 cggaagcgtg ctgggcc 17  

Claims (8)

Reacting a biological sample containing unknown biomolecules with random single-stranded nucleic acids having random sequences to determine biomolecule binding single-stranded nucleic acids binding to the unknown biomolecules; And Synthesizing a single-stranded nucleic acid comprising at least one single-stranded nucleic acid selected from the determined biomolecule-linked single-stranded nucleic acids and the single-stranded nucleic acids having a nucleotide sequence complementary to the biomolecule-bound single-stranded nucleic acids Adhering the capture single stranded nucleic acid to a substrate; It is prepared by a method comprising a; A method for producing a nucleic acid chip, characterized in that it is used to generate a binding profile of single-stranded nucleic acids and unknown biomolecules for analyzing the biological meaning of unknown biomolecules contained in a biological sample. The method of claim 1, wherein the determining of the biomolecule binding single-stranded nucleic acids, Reacting the random single-stranded nucleic acids with the unknown biomolecules of the biosample to produce biomolecule-single-stranded nucleic acid complexes; Washing the biomolecule-single-nucleic acid complexes and selecting the biomolecule-single-nucleic acid complexes with a certain binding force or more based on the magnitude of the binding force between the biomolecules and the single-stranded nucleic acids; Separating and amplifying the single-stranded nucleic acids from the selected complexes; And Determining the biomolecule-bound single-stranded nucleic acids by inserting the amplified single-stranded nucleic acids into a cloning vector to obtain a single clone to determine nucleotide sequences of the single-stranded nucleic acids; Method for producing a nucleic acid chip, characterized in that it comprises a. The method of claim 2, wherein the biomolecule-single strand nucleic acid complexes are repeatedly selected and amplified a plurality of times. The method according to any one of claims 1 to 3, wherein the biological meaning of the unknown biomolecule can be analyzed based on the contribution of the capturing single-stranded nucleic acids to the biological meaning analysis of the unknown biomolecule. And selecting the capturing single-stranded nucleic acids, thereby reducing the number of capturing single-stranded nucleic acids attached to the nucleic acid chip. The method according to any one of claims 1 to 3, The biological sample is selected from the group consisting of bacteria, fungi, viruses, cell lines, and tissues; The biomolecule is at least one or more selected from the group consisting of proteins, carbohydrates, lipids, polysaccharides, glycoproteins, hormones, receptors, antigens, antibodies and enzymes. At least one single-stranded nucleic acid selected from among biomolecule-bound single-stranded nucleic acids that bind to unknown biomolecules included in the biological sample and single-stranded nucleic acids having a base sequence complementary to the biomolecule-bound single-stranded nucleic acids; Capture single-stranded nucleic acids containing the structure is fixed to the substrate, A nucleic acid chip, characterized in that it is used to generate a binding profile of biomolecules and single-stranded nucleic acids for analyzing the biological meaning of unknown biomolecules contained in a biological sample. At least one single-stranded nucleic acid selected from among biomolecule-bound single-stranded nucleic acids that bind to unknown biomolecules included in the biological sample and single-stranded nucleic acids having a base sequence complementary to the biomolecule-bound single-stranded nucleic acids; Preparing a nucleic acid chip to which the capturing single-stranded nucleic acids comprising the substrate are fixed; The biomolecule-target single-stranded nucleic acid complexes are formed by reacting single-stranded nucleic acids having the same nucleotide sequence as the capturing single-stranded nucleic acids of the nucleic acid chip with the unknown biomolecules of the biological sample, and forming the biomolecule-target. Separating the single stranded nucleic acid complexes; Separating, amplifying and labeling the target single stranded nucleic acids from the separated biomolecule-target single stranded nucleic acid complexes; Reacting the labeled single stranded nucleic acids with the capture single stranded nucleic acids of the nucleic acid chip to obtain a binding profile via the label; And Analyzing the biological meanings of the unknown biomolecules by comparing the obtained profile data with the profile data already secured; An unknown biomolecule analysis method using a nucleic acid chip, characterized in that it comprises a. delete

Images