WO2025014239A1 - Sort1 유전자 프로모터의 메틸화 변화를 이용한 간암 진단용 조성물 및 이의 용도 - Google Patents
Sort1 유전자 프로모터의 메틸화 변화를 이용한 간암 진단용 조성물 및 이의 용도 Download PDFInfo
- Publication number
- WO2025014239A1 WO2025014239A1 PCT/KR2024/009723 KR2024009723W WO2025014239A1 WO 2025014239 A1 WO2025014239 A1 WO 2025014239A1 KR 2024009723 W KR2024009723 W KR 2024009723W WO 2025014239 A1 WO2025014239 A1 WO 2025014239A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- liver cancer
- cpg island
- island region
- methylation
- sort1 gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Definitions
- the present invention relates to a composition for diagnosing liver cancer using methylation changes in the SORT1 (Sortilin 1) gene promoter and its use.
- Liver cancer is the fifth most common cancer worldwide, and according to statistics released by the National Cancer Center, it has the sixth highest incidence rate and an extremely low survival rate of 37%, making it a fatal disease.
- liver cancer in particular is one of the major causes of death, and is characterized by high incidence, low early diagnosis rate, and low survival rate.
- the reason for the high mortality rate of liver cancer patients is that there is no biomarker for early diagnosis, and liver cancer is often diagnosed at an advanced stage where it is impossible to cure.
- Tumor development involves complex molecular mechanisms, and proliferation, metastasis, and angiogenesis occur through interactions with various cell types in the tumor microenvironment. Based on this, the development of safe and effective technologies for early diagnosis and treatment of tumors is urgent. Accordingly, the discovery of liver cancer biomarkers for early diagnosis, prognosis, and treatment response prediction is also urgently needed in liver cancer.
- the purpose of the present invention is to provide a biomarker composition for diagnosing liver cancer or predicting the prognosis of liver cancer metastasis, which comprises a methylated CpG island region of the SORT1 gene promoter.
- another object of the present invention is to provide a composition for diagnosing liver cancer, which comprises as an active ingredient an agent capable of measuring the methylation level of a CpG island region of the SORT1 gene promoter, and a kit for diagnosing liver cancer comprising the same.
- another object of the present invention is to provide a composition for predicting the prognosis of liver cancer metastasis, comprising as an active ingredient an agent capable of measuring the methylation level of the CpG island region of the SORT1 gene promoter, and a kit for predicting the prognosis of liver cancer metastasis comprising the same.
- another object of the present invention is to provide a method for providing information necessary for diagnosing liver cancer or predicting the prognosis of liver cancer metastasis, comprising a step of measuring the methylation level of a CpG island region of the SORT1 gene promoter.
- the present invention provides a biomarker composition for diagnosing liver cancer comprising a methylated CpG island region of the SORT1 gene promoter.
- the present invention provides a biomarker composition for predicting the prognosis of liver cancer metastasis, which comprises a methylated CpG island region of the SORT1 gene promoter.
- the present invention provides a composition for diagnosing liver cancer, comprising as an active ingredient an agent capable of measuring the methylation level of a CpG island region of the SORT1 gene promoter.
- the present invention provides a kit for diagnosing liver cancer comprising the composition.
- the present invention provides a composition for predicting the prognosis of liver cancer, comprising as an active ingredient an agent capable of measuring the methylation level of a CpG island region of the SORT1 gene promoter.
- the present invention provides a kit for predicting liver cancer prognosis comprising the composition.
- the present invention provides a method for providing information necessary for diagnosing liver cancer, comprising the steps of: (1) obtaining genomic DNA from a sample isolated from a patient; (2) measuring the methylation level of a CpG island region of a SORT1 gene promoter in the obtained genomic DNA; (3) comparing the measured methylation level of the CpG island region of the SORT1 gene promoter with a control sample; and (4) determining that the sample is liver cancer if the measured methylation level of the CpG island region of the SORT1 gene promoter is decreased compared to the control sample.
- the present invention provides a method for providing information necessary for predicting the prognosis of liver cancer metastasis, comprising the steps of: (1) obtaining genomic DNA from a sample isolated from a patient; (2) measuring the methylation level of a CpG island region of a SORT1 gene promoter in the obtained genomic DNA; (3) comparing the measured methylation level of the CpG island region of the SORT1 gene promoter with a control sample; and (4) predicting and determining that the possibility of liver cancer metastasis is high if the measured methylation level of the CpG island region of the SORT1 gene promoter is decreased compared to the control sample.
- the present invention relates to a composition for diagnosing liver cancer using methylation changes in the SORT1 gene promoter and a use thereof, and establishes systematic research methods and techniques for elucidating growth and proliferation, cell death and metastasis inhibition of liver cancer and signal transduction pathways, and confirms whether the target gene SORT1 shows clinical significance based on basic experiments, and can predict or diagnose liver cancer with high accuracy by measuring the methylation level of the SORT1 gene, specifically, cg16988986 in the promoter region of the SORT1 gene. Therefore, the methylation change in the SORT1 gene promoter is highly likely to be utilized as a target for diagnosing liver cancer.
- Figure 1 shows the association between SORT1 expression and copy number in the TCGA_LIHC dataset.
- Figure 2 shows the results of correlation analysis between SORT1 activation and methylation in the TCGA_LIHC data set.
- Figure 3 shows the results of identifying a specific probe region that regulates the activation of SORT1.
- Figure 4 shows the beta-value analysis results of the four selected probe regions.
- Figure 5 shows the results of overall survival, disease-free survival, and disease-specific survival curves according to cg16988986 methylation level.
- Figure 6 shows the results of measuring methylation levels in liver cancer patient tissues using qMSP analysis.
- Figure 7 shows the results of evaluating the diagnostic ability of liver cancer using the methylation level of SORT1.
- Figure 8 shows the results of confirming the clinical correlation between the methylation level of SORT1 and liver cancer.
- Figure 9 shows the results of confirming the correlation between the expression of SORT1 and the methylation level in qRT-PCR and qMSP data.
- the present invention provides a biomarker composition for diagnosing liver cancer comprising a methylated CpG island region of the SORT1 gene promoter.
- the present invention provides a biomarker composition for predicting the prognosis of liver cancer metastasis, which comprises a methylated CpG island region of the SORT1 gene promoter.
- diagnosis includes determining the susceptibility of a subject to a particular disease or condition, determining whether a subject currently has a particular disease or condition, determining the prognosis of a subject having a particular disease or condition, or therametrics (e.g., monitoring the condition of a subject to provide information about the efficacy of a treatment).
- prognosis prediction means the process of predicting the treatment outcome of a pathological condition by collecting data on the progress of the pathological condition and the treatment process.
- the prognosis prediction may be interpreted as determining the possibility of metastasis after liver cancer treatment or the possibility of death due to it, but is not limited thereto.
- methylation in the present invention refers to a phenomenon that occurs at a cytosine in a CpG island in the promoter region of a specific gene, thereby blocking the binding of a transcription factor and thereby blocking the expression of the specific gene.
- methylation refers to methylation in a CpG island in the promoter region of the SORT1 gene.
- CpG island refers to a genomic region where CpGs are gathered at an exceptionally high frequency, and refers to a region of 0.2 to 3 kb in length where the C+G content is 50% or more and the CpG ratio is 3.75% or more.
- C represents cytosine
- G represents guanine
- p represents a phosphodiester bond between cytosine and guanine.
- CpG islands There are about 45,000 CpG islands in the human genome, and most of them are found in promoter regions that regulate gene expression. In fact, the CpG islands are found in the promoters of housekeeping genes, which account for about 50% of human genes (Cross, S. and Bird, A., Curr. Opin.
- 5-methylcytosine which has a methyl group attached to the fifth carbon of the cytosine ring (5-mC).
- 5-mC is attached only to the C of the CG dinucleotide (5'-mCG-3'), called CpG.
- the C of CpG is mostly methylated by contact with the methyl group.
- Methylation of CpG suppresses the expression of transposons and repetitive sequences in the genome.
- CpG is the site where most epigenetic changes frequently occur in mammalian cells. This is because the 5-mC of CpG is easily deaminated naturally to become thymine (T).
- the present invention provides a composition for diagnosing liver cancer, comprising as an active ingredient an agent capable of measuring the methylation level of a CpG island region of the SORT1 gene promoter.
- the present invention provides a composition for predicting the prognosis of liver cancer metastasis, comprising as an active ingredient an agent capable of measuring the methylation level of a CpG island region of the SORT1 gene promoter.
- the agent capable of measuring the methylation level of the CpG island region of the SORT1 gene promoter may be at least one selected from the group consisting of a primer pair capable of amplifying a fragment within the methylated CpG island region of the SORT1 gene, a probe capable of hybridizing with the methylated CpG island region of the SORT1 gene, a methylation-specific binding protein capable of binding to the methylated CpG island region of the SORT1 gene, a methylation-specific binding antibody or aptamer of the SORT1 gene; and a methylation-sensitive restriction enzyme, but is not limited thereto.
- the CpG island region of the SORT1 gene promoter may be cg16988986, but is not limited thereto.
- primer refers to a short nucleic acid sequence having a short free 3' hydroxyl group, which can form base pairs with a complementary template and serves as a starting point for copying the template strand.
- the primer can initiate DNA synthesis in the presence of a reagent for polymerization reaction (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature.
- a reagent for polymerization reaction i.e., DNA polymerase or reverse transcriptase
- the lengths of the sense and antisense primers can be appropriately selected according to techniques known in the art.
- the primers of the present invention can be preferably designed according to the sequence of the CpG island to be analyzed for methylation, and can be a primer pair that can specifically amplify a cytosine that is methylated and not modified by bisulfite, and a primer pair that can specifically amplify a cytosine that is not methylated and modified by bisulfite.
- probe in this specification refers to a nucleic acid fragment such as RNA or DNA, which is short, a few bases or long, several hundred bases, and can specifically bind to mRNA, and is labeled so that the presence or absence of a specific mRNA and the expression level can be confirmed.
- the probe can be produced in the form of an oligonucleotide probe, a single strand DNA probe, a double strand DNA probe, an RNA probe, etc.
- the selection of an appropriate probe and hybridization conditions can be appropriately selected according to techniques known in the art.
- antibody as used herein is a term known in the art, and refers to a specific immunoglobulin directed against an antigenic site.
- the antibody in the present invention refers to an antibody that specifically binds to the PMVK of the present invention, and the antibody can be prepared according to a conventional method in the art.
- the form of the antibody includes a polyclonal antibody or a monoclonal antibody, and includes all immunoglobulin antibodies.
- the antibody refers to a complete form having two full-length light chains and two full-length heavy chains.
- the antibody also includes special antibodies such as humanized antibodies.
- aptamer refers to a type of polynucleotide composed of a special type of single-stranded nucleic acid (DNA, RNA or modified nucleic acid) that has a stable tertiary structure in itself and has the characteristics of being able to bind to a target molecule with high affinity and specificity.
- DNA DNA, RNA or modified nucleic acid
- an aptamer is composed of a polynucleotide that can specifically bind to an antigenic substance in the same way as an antibody, but is more stable than a protein, has a simple structure, and is easy to synthesize, and therefore can be used as a substitute for an antibody.
- methylation-sensitive restriction enzyme refers to a restriction enzyme that can specifically detect methylation of a CpG island and contains CG as a recognition site of the restriction enzyme. Examples thereof include, but are not limited to, SmaI, SacII, EagI, HpaII, MspI, BssHII, BstUI, NotI, etc. Depending on methylation or unmethylation at C of the restriction enzyme recognition site, whether or not the restriction enzyme cuts is different and this can be detected through PCR or Southern Blot analysis. Other methylation-sensitive restriction enzymes other than the above restriction enzymes are well known in the art.
- the present invention provides a kit for diagnosing liver cancer comprising the composition.
- the present invention provides a composition for predicting the prognosis of liver cancer metastasis comprising the composition.
- the kit may be any one selected from the group consisting of an RT-PCR kit, a microarray chip kit, a DNA kit, and a protein chip kit, but is not limited thereto.
- the present invention provides a method for providing information necessary for diagnosing liver cancer, comprising the steps of: (1) obtaining genomic DNA from a sample isolated from a patient; (2) measuring the methylation level of a CpG island region of a SORT1 gene promoter in the obtained genomic DNA; (3) comparing the measured methylation level of the CpG island region of the SORT1 gene promoter with a control sample; and (4) determining that the sample is liver cancer if the measured methylation level of the CpG island region of the SORT1 gene promoter is decreased compared to the control sample.
- the present invention provides a method for providing information necessary for predicting the prognosis of liver cancer metastasis, comprising the steps of: (1) obtaining genomic DNA from a sample isolated from a patient; (2) measuring the methylation level of a CpG island region of a SORT1 gene promoter in the obtained genomic DNA; (3) comparing the measured methylation level of the CpG island region of the SORT1 gene promoter with a control sample; and (4) predicting and determining that the possibility of liver cancer metastasis is high if the measured methylation level of the CpG island region of the SORT1 gene promoter is decreased compared to the control sample.
- the measurement of the methylation level of the CpG island region of the SORT1 gene promoter can be performed by a method selected from the group consisting of, but not limited to, PCR, methylation specific PCR, real time methylation specific PCR, PCR using a methylated DNA-specific binding protein, ChIP analysis using a methylated DNA-specific binding antibody or aptamer, DNA chip, pyrosequencing, and bisulfite sequencing.
- the CpG island region of the SORT1 gene promoter may be cg16988986, but is not limited thereto.
- the step (4) is performed by a cut-off value, and the cut-off value may be 0.0885 when the relative methylation level of the SORT1 gene promoter is log10 substituted, but is not limited thereto.
- the isolated sample may be, but is not limited to, isolated cells, tissues, blood, saliva or urine.
- liver cancer tissue samples were used for methylation analysis, including non-tumor (NT) and liver cancer tissue (Tumor, T) surrounding non-liver cancer tissues from 58 patients who underwent hepatectomy.
- NT non-tumor
- T liver cancer tissue
- TCGA LIHC data were used to validate methylation, expression, and survival analyses.
- Genomic DNA of the tissue was extracted using the DNeasy Blood & Tissue kit (Qiagen, #69504) according to the kit's manual.
- Tissues measuring approximately 8 mm 3 in size were frozen in liquid nitrogen, ground with a sterilized mortar and pestle, and 180 ul of Buffer ATL and 20 ul of proteinase K were added, vortexed, and reacted in a shaking incubator at 56°C for more than 12 hours.
- DNA adsorbed to the column was separated using elution buffer, and the amount and purity of the separated genomic DNA were measured using a NanoPhotometer (Implen).
- DNA bisulfite conversion was performed by combining 1 ug DNA and DW to make 20 ul, adding 130 ul of CT conversion reagent, and making a total of 150 ul.
- the sample and 600 ⁇ l of binding buffer were added to the Zymo-Spin IC column, and centrifuged at 12,000 g for 30 seconds to allow DNA to be adsorbed to the column.
- the bisulfite-converted genomic DNA was separated from the column using M-elution buffer.
- the information of the probe derived from the methylation analysis of the gene is as follows.
- target probes were identified in the UCSC genome brower (https:/genome.ucsc.edu/index.html), and primers for qMSP were designed using MethPrimer (https:/www.urogene.org/cgi-bin/methprimer/methprimer.cgi) for the chr1:109,397,301-109,399,000 (1700 bp) sequence containing the target probes and CpG islands.
- qMSP was performed using a total of 10 ul of reaction mixture containing 2X qPCR master mix (Gendepot, Q5602), 10 uM primer, and bisulfite-modified DNA under the conditions below.
- cDNA was synthesized from 500 ng of RNA in a total volume of 10 ⁇ l using 5X PrimeScriptTMRT Master Mix (Takara) and AmfiSure qGreen Q-PCR Master Mix (GenDEPOT) was used at 95°C for 2 min, followed by 40 cycles of 95°C for 15 sec, 60°C for 34 sec, and 72°C for 30 sec, followed by a dissociation stage of 95°C for 10 sec, 65°C for 5 sec, and 95°C for 5 sec.
- Real-time monitoring was confirmed using a CFX Connect Real-Time PCR Detection System (Bio-Rad).
- the primer NM number of SORT1 is NM_001205228.1, the product size is 198 bp, and the sequence is as follows.
- Gene copy number variation is one of the genetic structural variations existing in the human genome and is closely related to gene expression. It affects the final activity of the gene, the increase or decrease of the transcript, which is the gene product, and the expression of protein.
- the beta value was checked in the liver cancer and non-liver cancer tissues of the same 50 liver cancer patients, the beta value was concentrated at 0 in the liver cancer tissues compared to the non-liver cancer tissues, confirming that the methylation of SORT1 was relatively low (Fig. 2).
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
본 발명은 SORT1 유전자 프로모터의 메틸화 변화를 이용한 간암 진단용 조성물 및 이의 용도에 관한 것으로, 간암의 성장과 증식, 세포 사멸과 전이 억제 관련 및 신호 전달 경로 규명에 대해 체계적인 연구 방법과 기술을 확립하고, 기초 실험을 기반으로 타겟 유전자인 SORT1이 임상적 유의성을 보이는지 확인하였으며, SORT1 유전자, 구체적으로는 SORT1 유전자 상의 프로모터 부위 내의 cg16988986의 메틸화 수준을 측정하여 간암을 높은 정확도로 예측 또는 진단할 수 있었다. 이에, SORT1 유전자 프로모터의 메틸화 변화는 간암 진단용 타겟으로 활용될 가능성이 매우 높다.
Description
본 발명은 SORT1(Sortilin 1) 유전자 프로모터의 메틸화 변화를 이용한 간암 진단용 조성물 및 이의 용도에 대한 것이다.
간암은 세계적으로 5번째로 가장 흔한 암이며, 국립암센터가 발표한 통계에 따르면 발생률이 6번째로 높으며 생존율은 37%로 극히 낮은 치명적인 질환이라고 할 수 있다.
산업화와 현대화의 지속적인 발전으로 암 발병률은 지속적으로 증가하는 추세이며 특히, 간암은 주요 사망 원인 중 하나이고, 높은 발병률과 낮은 조기 진단율, 낮은 생존율이 특징이다. 간암 환자의 사망률이 높은 이유는 조기 진단을 위한 바이오마커가 없고 근치적 치료가 불가능할 정도로 간암이 진행된 상태에서 진단되는 경우가 많기 때문이다.
최근에는 DNA 메틸화 측정을 통하여 암을 진단하는 방법들이 제시되고 있으며 특정 유전자의 과메틸화 및 저메틸화는, 그 유전자의 발현을 차단(gene silencing) 또는 활성화(gene activation) 하는 것으로 알려져 있다. 이는 생체 내에서 유전자의 기능이 소실되거나 활성화되는 주요 기전 중 하나로, 인체 암에서 다수의 종양 억제유전자(tumor suppressor genes)의 기능소실 및 발암유전자(oncognene)의 기능 활성화의 원인으로 해석할 수 있으며 암과 관련된 유전자의 메틸화를 분석하는 것은 암 연구에 큰 기여를 하고 있다.
종양의 발생은 복잡한 분자학적 기전을 포함하고, 종양미세환경에서 여러 세포 유형과 상호작용을 함으로써 증식, 전이, 혈관 신생이 진행되며 이를 기초하여 종양의 조기 진단 및 치료를 위한 안전하고 효과적인 기술의 개발이 시급한 실정이다. 이에, 간암에서도 조기 진단 및 예후, 치료 반응 예측을 위한 간암 바이오마커 발굴이 절실한 상황이다.
본 발명의 목적은 SORT1 유전자 프로모터의 메틸화된 CpG 섬(CpG island) 영역을 포함하는 간암 진단 또는 간암 전이 예후 예측용 바이오마커 조성물을 제공하는데 있다.
또한, 본 발명의 다른 목적은 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 측정할 수 있는 제제를 유효성분으로 포함하는 간암 진단용 조성물 및 이를 포함하는 간암 진단용 키트를 제공하는데 있다.
또한, 본 발명의 또 다른 목적은 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 측정할 수 있는 제제를 유효성분으로 포함하는 간암 전이 예후 예측용 조성물 및 이를 포함하는 간암 전이 예후 예측용 키트를 제공하는데 있다.
또한, 본 발명의 또 다른 목적은 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 측정하는 단계를 포함하는 간암 진단 또는 간암 전이 예후 예측에 필요한 정보를 제공하는 방법을 제공하는데 있다.
상기 목적을 달성하기 위하여, 본 발명은 SORT1 유전자 프로모터의 메틸화된 CpG 섬(CpG island) 영역을 포함하는 간암 진단용 바이오마커 조성물을 제공한다.
또한, 본 발명은 SORT1 유전자 프로모터의 메틸화된 CpG 섬(CpG island) 영역을 포함하는 간암 전이 예후 예측용 바이오마커 조성물을 제공한다.
또한, 본 발명은 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 측정할 수 있는 제제를 유효성분으로 포함하는 간암 진단용 조성물을 제공한다.
또한, 본 발명은 상기 조성물을 포함하는 간암 진단용 키트를 제공한다.
또한, 본 발명은 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 측정할 수 있는 제제를 유효성분으로 포함하는 간암 예후 예측용 조성물을 제공한다.
또한, 본 발명은 상기 조성물을 포함하는 간암 예후 예측용 키트를 제공한다.
또한, 본 발명은 (1) 환자로부터 분리된 시료로부터 게놈 DNA를 수득하는 단계; (2) 상기 수득된 게놈 DNA에서 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 측정하는 단계; (3) 상기 측정된 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 대조군 시료와 비교하는 단계; 및 (4) 상기 측정된 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준이 대조군 시료에 비해 감소된 경우, 간암으로 판단하는 단계를 포함하는 간암 진단에 필요한 정보를 제공하는 방법을 제공한다.
또한, 본 발명은 (1) 환자로부터 분리된 시료로부터 게놈 DNA를 수득하는 단계; (2) 상기 수득된 게놈 DNA에서 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 측정하는 단계; (3) 상기 측정된 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 대조군 시료와 비교하는 단계; 및 (4) 상기 측정된 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준이 대조군 시료에 비해 감소된 경우, 간암 전이 가능성이 높은 것으로 예측 판단하는 단계를 포함하는 간암 전이 예후 예측에 필요한 정보를 제공하는 방법을 제공한다.
본 발명은 SORT1 유전자 프로모터의 메틸화 변화를 이용한 간암 진단용 조성물 및 이의 용도에 관한 것으로, 간암의 성장과 증식, 세포 사멸과 전이 억제 관련 및 신호 전달 경로 규명에 대해 체계적인 연구 방법과 기술을 확립하고, 기초 실험을 기반으로 타겟 유전자인 SORT1이 임상적 유의성을 보이는지 확인하였으며, SORT1 유전자, 구체적으로는 SORT1 유전자 상의 프로모터 부위 내의 cg16988986의 메틸화 수준을 측정하여 간암을 높은 정확도로 예측 또는 진단할 수 있었다. 이에, SORT1 유전자 프로모터의 메틸화 변화는 간암 진단용 타겟으로 활용될 가능성이 매우 높다.
도 1은 TCGA_LIHC 데이터 세트에서 SORT1의 발현과 copy number와의 연관성을 나타낸다.
도 2는 TCGA_LIHC 데이터 세트에서 SORT1 활성화와 메틸화 간의 상관관계 분석 결과를 나타낸다.
도 3은 SORT1의 활성화를 조절하는 특정 probe region 확인 결과를 나타낸다.
도 4는 선별된 네 개의 probe region의 beta-value 분석 결과를 나타낸다.
도 5는 cg16988986 메틸화 수준에 따른 전체 생존, 무병 생존 및 질병 특이적 생존 곡선 결과를 나타낸다.
도 6은 qMSP 분석을 통한 간암 환자 조직에서의 메틸화 수준 측정 결과를 나타낸다.
도 7은 SORT1의 메틸화수준을 이용한 간암 진단력 평가 결과를 나타낸다.
도 8은 SORT1의 메틸화수준과 간암 임상적 연관성 확인 결과를 나타낸다.
도 9는 qRT-PCR과 qMSP 데이터에서의 SORT1의 발현과 메틸화 수준의 상관관계 확인 결과를 나타낸다.
본 발명은 SORT1 유전자 프로모터의 메틸화된 CpG 섬(CpG island) 영역을 포함하는 간암 진단용 바이오마커 조성물을 제공한다.
또한, 본 발명은 SORT1 유전자 프로모터의 메틸화된 CpG 섬(CpG island) 영역을 포함하는 간암 전이 예후 예측용 바이오마커 조성물을 제공한다.
본 명세서에서 용어 “진단”은 특정 질병 또는 질환에 대한 한 객체의 감수성(susceptibility)을 판정하는 것, 한 객체가 특정 질병 또는 질환을 현재 가지고 있는지 여부를 판정하는 것, 특정 질병 또는 질환에 걸린 한 객체의 예후(prognosis)를 판정하는 것, 또는 테라메트릭스(therametrics)(예컨대, 치료 효능에 대한 정보를 제공하기 위하여 객체의 상태를 모니터링하는 것)을 포함한다.
본 명세서에서 용어 "예후 예측"이란, 병리 상태의 진행 상황 및 치료 과정의 데이터를 취합하여, 병리 상태의 치료 결과를 예측하는 과정을 의미한다. 본 발명의 목적상 상기 예후 예측은 간암 치료 후 전이 가능성을 판단하거나, 이로 인한 사망 가능성을 판단하는 것으로 해석될 수 있으나, 이에 한정되는 것은 아니다.
본 발명에서 용어, "메틸화"는 특정 유전자의 프로모터 부위의 CpG 섬(CpG island)의 사이토신에서 일어나고, 그로 인하여 전사인자의 결합이 방해를 받게 되어 특정 유전자의 발현이 차단되는 것으로서, 본 발명의 목적상, 메틸화 여부는 SORT1 유전자 프로모터 부위의 CpG 섬에서의 메틸화를 의미한다.
본 발명에서 용어, "CpG 섬(CpG island)"은 CpG가 예외적으로 높은 빈도로 모여 있는 게놈 영역을 의미하며, C+G 함유량이 50% 이상이고, CpG 비율이 3.75%이상인 0.2~3kb 길이의 부위를 말한다. 상기 CpG에서, C는 사이토신을, G는 구아닌을 나타내며 p는 사이토신과 구아닌과의 사이에 있는 포스포디에스테르 결합을 의미한다. 인간 게놈에는 약 45,000개의 CpG 섬이 있으며, 이들 대부분이 유전자의 발현을 조절하는 프로모터 부위에서 발견된다. 실제로, 상기 CpG 섬은 인간 유전자의 약 50%에 달하는 하우스키핑(housekeeping) 유전자의 프로모터에서 발견된다(Cross, S. and Bird, A., Curr. Opin. Gene Develop., 5:309, 1995). 정상인의 체세포에서, 상기 하우스키핑 유전자 프로모터 부위의 CpG 섬은 비메틸화되어 있으며, 임프린티드(imprinted) 유전자 및 비활성화 상태의 X 염색체 상의 유전자와 같이 발달과정 동안 발현되지 않는 유전자들은 메틸화되어 있다.
포유동물 세포의 게놈 DNA에서는 A, C, G 및 T에 더하여, 사이토신 링(5-mC)의 다섯번째 탄소에 메틸 그룹이 부착된 5-메틸시토신(5-methylcytosine)이라는 5번째 염기가 존재한다. 5-mC는 CpG라고 불리는, CG 디뉴클레오티드(5'-mCG-3')의 C에만 부착된다. CpG의 C는 메틸 그룹의 접촉에 의하여 대부분 메틸화된다. CpG의 메틸화는 트랜스포존과 게놈의 반복서열이 발현되는 것을 억제한다. 또한, 상기 CpG는 포유동물 세포에서 대부분의 후생유전학적 변화가 자주 일어나는 부위이다. 상기 CpG의 5-mC가 자연적으로 탈아미노화하여 티민(T)이 되기 쉽기 때문이다.
또한, 본 발명은 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 측정할 수 있는 제제를 유효성분으로 포함하는 간암 진단용 조성물을 제공한다.
또한, 본 발명은 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 측정할 수 있는 제제를 유효성분으로 포함하는 간암 전이 예후 예측용 조성물을 제공한다.
바람직하게는, 상기 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 측정할 수 있는 제제는 상기 SORT1 유전자의 메틸화된 CpG 섬 영역 내의 단편을 증폭할 수 있는 프라이머쌍, 상기 SORT1 유전자의 메틸화된 CpG 섬 영역과 혼성화할 수 있는 프로브, 상기 SORT1 유전자의 메틸화된 CpG 섬 영역과 결합할 수 있는 메틸화 특이적 결합 단백질, 상기 SORT1 유전자의 메틸화 특이적 결합 항체 또는 압타머; 및 메틸화 민감성 제한효소로 이루어진 군에서 선택된 어느 하나 이상일 수 있으나, 이에 한정되는 것은 아니다.
바람직하게는, 상기 SORT1 유전자 프로모터의 CpG 섬 영역은 cg16988986일 수 있으나, 이에 한정되는 것은 아니다.
본 명세서에서 용어 "프라이머"는 짧은 자유 3-말단 수산화기(free 3' hydroxyl group)를 가지는 핵산 서열로 상보적인 템플레이트(template)와 염기쌍을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로서 작용하는 짧은 핵산 서열을 말한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응을 위한 시약(즉, DNA 폴리머라제 또는 역전사효소) 및 상이한 4 가지의 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성을 개시할 수 있다. PCR 조건, 센스 및 안티센스 프라이머의 길이는 당업계에 공지된 기술에 따라 적절히 선택될 수 있다.
본 발명의 프라이머는 메틸화 여부를 분석하는 대상이 되는 CpG 섬의 서열에 따라 바람직하게 디자인될 수 있으며, 각각 메틸화되어 바이설파이트에 의해 변형되지 않았던 사이토신을 특이적으로 증폭할 수 있는 프라이머쌍 및 메틸화되지 않아 바이설파이트에 의해 변형된 사이토신을 특이적으로 증폭할 수 있는 프라이머쌍일 수 있다.
본 명세서에서 용어 "프로브"는 mRNA외 특이적으로 결합을 이룰 수 있는 짧게는 수 염기 내지 길게는 수백 염기에 해당하는 RNA 또는 DNA 등의 핵산 단편을 의미하며 라벨링되어 있어서 특정 mRNA의 존재 유무, 발현양을 확인할 수 있다. 프로브는 올리고뉴클레오타이드(oligonucleotide) 프로브, 단쇄 DNA(single strand DNA) 프로브, 이중쇄DNA(double strand DNA)프로브, RNA 프로브 등의 형태로 제작될 수 있다. 적절한 프로브의 선택 및 혼성화 조건은 당해 기술 분야에 공지된 기술에 따라 적절히 선택할 수 있다.
본 명세서에서 용어 "항체"는 당해 기술분야에 공지된 용어로서 항원성 부위에 대하여 지시되는 특이적인 면역 글로불린을 의미한다. 본 발명에서의 항체는 본 발명의 PMVK에 대해 특이적으로 결합하는 항체를 의미하며, 당해 기술분야의 통상적인 방법에 따라 항체를 제조할 수 있다. 상기 항체의 형태는 폴리클로날 항체 또는 모노클로날 항체를 포함하며, 모든 면역글로불린 항체가 포함된다. 상기 항체는 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 갖는 완전한 형태를 의미한다. 또한, 상기 항체는 인간화 항체 등의 특수 항체도 포함된다.
본 명세서에서 용어 "앱타머(aptamer)"란, 그 자체로 안정된 삼차 구조를 가지면서 표적 분자에 높은 친화성과 특이성으로 결합할 수 있는 특징을 가진 특별한 종류의 단일가닥 핵산(DNA, RNA 또는 변형핵산)으로 구성된 폴리뉴클레오티드의 일종을 의미한다. 상술한 바와 같이, 앱타머는 항체와 동일하게 항원성 물질에 특이적으로 결합할 수 있으면서도, 단백질보다 안정성이 높고, 구조가 간단하며, 합성이 용이한 폴리뉴클레오티드로 구성되어 있으므로, 항체를 대체하여 사용될 수 있다.
본 명세서에서 용어 "메틸화 민감성 제한효소"는 CpG 섬의 메틸화를 특이적으로 검출할 수 있는 제한효소로서 제한효소의 인식부위로 CG를 함유하는 제한효소일 수 있다. 예를 들면, SmaI, SacII, EagI, HpaII, MspI, BssHII, BstUI, NotI 등이 있으며 이에 제한되지 않는다. 상기 제한효소 인식부위의 C에서의 메틸화 또는 비메틸화에 따라 제한효소에 의한 절단 여부가 달라지고 이를 PCR 또는 서던블롯(Southern Blot) 분석을 통해 검출할 수 있게 된다. 상기 제한효소 이외의 다른 메틸화 민감성 제한효소는 당업계에 잘 알려져 있다.
또한, 본 발명은 상기 조성물을 포함하는 간암 진단용 키트를 제공한다.
또한, 본 발명은 상기 조성물을 포함하는 간암 전이 예후 예측용를 제공한다.
본 발명에서 상기 키트는 RT-PCR 키트, 마이크로어레이 칩 키트, DNA 키트, 및 단백질 칩 키트로 이루어진 군으로부터 선택되는 어느 하나일 수 있으나, 이에 제한되는 것은 아니다.
또한, 본 발명은 (1) 환자로부터 분리된 시료로부터 게놈 DNA를 수득하는 단계; (2) 상기 수득된 게놈 DNA에서 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 측정하는 단계; (3) 상기 측정된 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 대조군 시료와 비교하는 단계; 및 (4) 상기 측정된 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준이 대조군 시료에 비해 감소된 경우, 간암으로 판단하는 단계를 포함하는 간암 진단에 필요한 정보를 제공하는 방법을 제공한다.
또한, 본 발명은 (1) 환자로부터 분리된 시료로부터 게놈 DNA를 수득하는 단계; (2) 상기 수득된 게놈 DNA에서 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 측정하는 단계; (3) 상기 측정된 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 대조군 시료와 비교하는 단계; 및 (4) 상기 측정된 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준이 대조군 시료에 비해 감소된 경우, 간암 전이 가능성이 높은 것으로 예측 판단하는 단계를 포함하는 간암 전이 예후 예측에 필요한 정보를 제공하는 방법을 제공한다.
바람직하게는, 상기 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준 측정은 PCR, 메틸화 특이 PCR(methylation specific PCR), 실시간 메틸화 특이 PCR(real time methylation specific PCR), 메틸화 DNA 특이적 결합 단백질을 이용한 PCR, 메틸화 DNA 특이적 결합 항체 또는 압타머를 이용한 ChIP 분석, DNA 칩, 파이로시퀀싱 및 바이설파이트 시퀀싱으로 이루어진 군에서 선택된 방법에 의해 수행될 수 있으나, 이에 한정되는 것은 아니다.
바람직하게는, 상기 SORT1 유전자 프로모터의 CpG 섬 영역은 cg16988986일 수 있으나, 이에 한정되는 것은 아니다.
바람직하게는, 상기 (4) 단계는 컷오프(cut-off) 값에 의하여 수행되는 것으로, 상기 컷오프(cut-off) 값은 상기 SORT1 유전자 프로모터의 상대적 메틸화 수준이 log10 치환시 0.0885일 수 있으나, 이에 한정되는 것은 아니다.
바람직하게는, 상기 분리된 시료는 분리된 세포, 조직, 혈액, 타액 또는 뇨일 수 있으나, 이에 한정되는 것은 아니다.
이하에서는, 본 발명을 한정하지 않는 실시예에 따라 본 발명을 상세히 설명한다. 본 발명의 하기 실시예는 본 발명을 구체화하기 위한 것일 뿐 본 발명의 권리범위를 제한하거나 한정하는 것이 아님은 물론이다. 따라서, 본 발명의 상세한 설명 및 실시예로부터 본 발명이 속하는 기술분야의 전문가가 용이하게 유추할 수 있는 것은 본 발명의 권리범위에 속하는 것으로 해석된다.
<실험예>
하기의 실험예들은 본 발명에 따른 각각의 실시예에 공통적으로 적용되는 실험예를 제공하기 위한 것이다.
1. 간암 시료 준비
메틸화 분석에 사용된 간암 조직 시료는 총 116개로 간절제술을 시행한 환자 58명의 비간암 주변조직 (Non-tumor, NT)와 간암조직 (Tumor, T)을 사용하였다.
2. 공개 오믹스 데이터 분석
메틸화, 발현 및 생존 분석을 검증하기 위해 TCGA LIHC 데이터를 사용하였다.
3. 조직샘플에서 DNA 추출
조직의 genomic DNA는 DNeasy Blood & Tissue kit (Qiagen, #69504)를 이용하여 상기 kit의 매뉴얼에 따라 실험을 진행하였다.
대략 8mm3 크기의 조직을 액체질소로 얼린 후 멸균된 막자사발로 갈아준 다음, Buffer ATL 180ul와 proteinase K 20ul를 넣고 vortex 해준 후, 56℃의 교반 배양기(shaking incubator)에서 12시간 이상 반응시켰다.
앞의 반응액을 짧게 vortex 한 후, Buffer AL 200ul와 EtOH 200ul를 넣고 vortex로 잘 혼합시켰다. DNA spin column과 collection tube를 준비하여 반응액 전량을 column에 옮겨준 후 상온에서 12,000rpm, 1분간 원심분리한 다음, column만 새로운 collection tube에 끼워주었다.
column에 washing buffer 500ul를 넣어주고 상온에서 12,000rpm, 1분간 원심분리 및 collection tube 교체 후 반복작업 후 14,000rpm, 3분간 원심분리를 진행하여 column의 membrane을 건조시켰다.
column에 흡착된 DNA를 elution buffer를 이용하여 분리하고, 분리된 genomic DNA의 양 및 순도는 NanoPhotometer (Implen)을 이용해 측정하였다.
4. DNA의
바이설파이트
변경(
Bisulfite
modification)
EZ DNA Methylation-Gold™ kit (Zymo research, D5005)를 사용하여 1ug의 genomic DNA에 대하여 바이설파이트를 처리하였다.
1ug DNA와 DW를 합하여 20ul에 맞추고 CT conversion reagent를 130ul 넣어서 총 150ul로 DNA 바이설파이트 변경을 진행하였다.
위의 샘플을 98℃ 10분, 64℃ 2시간 30분, 4℃ 보관 순서로 처리한 후, Zymo-Spin IC column에 샘플과 binding buffer 600ul를 함께 넣어준 다음 12,000 g, 30초간 원심분리하여 column에 DNA가 흡착되도록 하였다.
M-wash buffer로 column을 한차례 wash한 다음, M-desulphonation buffer 200ul를 넣고 상온에서 20분이내로 놔둔 후 다시 12,000 g, 30초간 원심분리하였다.
M-wash buffer로 2차례 wash한 후 M-elution buffer를 이용하여 바이설파이트로 전환된 genomic DNA를 column에서 분리하였다.
5. Quantitative
methylation
-specific polymerase chain reaction (
qMSP
)
유전자의 메틸화 분석에서 도출된 프로브의 정보는 다음과 같다.
| 후보 ID | 프로브 위치 | 염기서열 | 사이즈 |
| cg16988986 | chr1:109,398,437-109,398,556 | CCCGCTCACTGGAGCGCCCATTGTCTGCTAAGCAGCTGCCTTGCTGCAAGAAGGTGAATG[CG]AACTGATGTGGGCCACATCCTACGGAGACAGACATCAGGACATCCGTGACTCCTGCAAGC | 122 bp |
UCSC genome brower (https:/genome.ucsc.edu/index.html)에서 타겟 프로브의 위치를 확인하고 타겟 프로브 및 CpG islands를 포함하는 chr1:109,397,301-109,399,000 (1700bp) 의 서열에 대해서 MethPrimer (https:/www.urogene.org/cgi-bin/methprimer/methprimer.cgi)을 이용하여 qMSP를 위한 프라이머를 디자인하였다.
AmfiSure qGreen Q-PCR Master Mix (GenDEPOT)를 사용하여 실시간 모니터링 하였다. 프라이머 시퀀스는 다음과 같다.
| Forward sequence | Reverse sequence | |
| SORT1_Methyl | 5'-GTTTTGTTGTAAGAAGGTGAATGC-3' | 5'-AAAAAAATAAAAAAAACCAAACGTA-3' |
| SORT1_Unmethyl | 5'-GTTTTGTTGTAAGAAGGTGAATGTG-3' | 5'-AAAAAAATAAAAAAAACCAAACATA-3' |
2X qPCR master mix (Gendepot, Q5602)와 10uM primer, 바이설파이트-변형된 DNA를 포함한 반응 혼합물 총 10ul를 아래의 조건으로 qMSP를 진행하였다.
A. Stage 1 : 95℃, 2분
B. Stage 2 : 95℃, 15초
C. : 58℃, 34초
D. : 72℃, 30초
E. Stage 2를 40 cycle 반복
6. Quantitative real-time polymerase chain reaction (
qRT
-
PCR
)
5X PrimeScript™RT Master Mix (Takara)를 사용하여 총 부피 10 μl에서 RNA 500 ng으로 cDNA를 합성하였고, AmfiSure qGreen Q-PCR Master Mix (GenDEPOT)를 사용하여 95℃에서 2분 후에 95℃에서 15초, 60℃에서 34초, 72℃에서 30초를 40 cycles로 하였고, 이어서 dissociation stage에서는 95℃에서 10초, 65℃에서 5초, 95℃에서 5초 진행하였다. 실시간 모니터링은 CFX Connect Real-Time PCR Detection System (Bio-Rad)을 통해 확인하였다. SORT1의 프라이머 NM number는 NM_001205228.1이며 product 사이즈는 198 bp이고, 시퀀스는 다음과 같다.
Forward: 5'-AGTTTCAGTGACCCACGTCAG-3'
Reverse: 5'-AGTAGGTCAGGTAACAAAGTCCAGT-3'
<실시예>
간암에서 비특이적으로 과발현이 되어있는 SORT1이 어떠한 조절 메커니즘에 의해 발현이 활성화가 되는지 확인하기 위해, 첫 번째로 유전자 복제 수 변이에 변화가 있는지 TCGA_LIHC 데이터세트를 통해 분석하고자 하였다. 유전자 복제 수 변이는 인간 유전체에 존재하는 유전적 구조 변이 중 하나로 유전자의 발현과 밀접한 관련이 있으며 유전자의 최종 활성도, 유전자 산물인 전사체, 즉 단백질 발현의 증가와 감소에 영향을 미친다. 따라서, 염색체의 일부가 유전자 재조합 과정에서 손실이 생겨 일어나는 돌연변이 deletion, 두배수체 집합인 diploid, 정상 배수체에서 비이상적으로 복제된 gain, 유전자 사본 수가 증가한 amplification이 SORT1에서는 어느 정도의 비율로 일어났는지 확인하였고, SORT1의 발현과 copy number의 상관관계에서 연관성이 없는 것을 확인하였다(도 1).
다음으로, 후성유전학의 핵심 프로세스로 알려져 있는 메틸화에 의해 SORT1의 발현이 조절이 되는지 확인하기 위해, 메틸화 비율 측정 지표로 알려진 beta-value를 분석하고자 하였고, beta-value가 0과 1의 수치에서 1에 밀집될수록 메틸화 강도가 높은 것이며 TCGA_LIHC 데이터세트에서 간암환자 371명에 대한 SORT1의 발현과 beta-value의 상관관계를 분석하였을 때, SORT1의 발현이 높을수록 beta-value의 수치는 0에 가까운 것으로 나타났으며 강한 음의 상관관계가 있음을 확인하였다(도 2, Pearson r=-0.626).
추가적으로, 동일한 간암 환자 50명의 간암 및 비간암조직에서 beta-value를 확인하였을 때, 비간암조직에 비해 간암조직에서 beta-value의 수치가 0에 밀집되어 있는 것으로 SORT1의 메틸화가 상대적으로 낮은 것을 확인하였다(도 2).
SORT1의 발현 활성화가 메틸화와 밀접한 관련이 있다는 선행 분석을 기반으로, SORT1 5' 프로모터 영역의 CpG island에서 간암환자에서 유의한 차이가 있는지 확인하기 위해, 각각의 SORT1의 CpG probe region의 메틸화와 SORT1 발현 사이의 상관관계를 MEXPRESS를 이용하여 분석하였고, SORT1의 프로모터의 CpG 부위에 존재하는 총 4개의 probe region이 비간암과 간암샘플의 메틸화 사이에 유의한 상관관계를 보이는 것을 확인하였다(도 3).
TCGA_LIHC 데이터세트를 이용하여 선별된 네 개의 probe region 중에서 50명의 간암 환자의 비종양 그룹과 종양 그룹에서의 beta-value를 분석하였을 때, cg16988986만이 유의하게 비종양 그룹에 비해 종양 그룹에서 beta-value 수치가 떨어지는 저메틸화 현상을 확인하였다(도 4).
특정 probe region인 cg16988986의 메틸화 정도와 환자의 예후와의 연관성을 확인하기 위해 TCGA데이터를 이용하여 전체생존기간 (OS, Overall Survival)과 무병생존기간 (DFS, Disease Free Survival), 질병특이생존기간(DSS, Disease Specific Survival)을 분석하였고, cg16988986의 메틸화 수준이 낮을수록 예후가 좋지 않은 것을 확인하였다(도 5).
아주대학교 병원에서 간절제술을 받은 간암환자로부터 확보한 조직에서 qMSP 이용하여 SORT1 프로모터의 CpG cg16988986의 메틸화 수준을 분석하고자 하였다. 테스트 코호트 (n = 20) 및 검증 코호트 (n = 38)에서 유의하게 저메틸화가 관찰된 환자는 각각 65% 및 57.9%로 (도 6), 종양 조직이 비종양 조직과 비교하여 메틸화의 비율이 높게 평가되었으며, 총 58개의 조직쌍으로 메틸화 수준을 분석하였을 때, 비종양 그룹에 비해 종양 그룹에서 메틸화의 비율이 떨어져 있는 것을 확인하였다. 구체적으로는 qMSP의 메틸화수준을 log10으로 전환하여 나타내었을 때 비종양조직의 평균값은 0.1874이고, 간암조직의 평균값은 -0.1729로 나타났다.
또한 SORT1의 메틸화 수준으로 간암 진단력을 평가 시, SORT1의 상대적 메틸화수준이 log10 치환시 0.0885일 때 AUC 값 0.80 (95% CI=0.716 to 0.86)으로 높은 정확도를 보였다(도 7).
SORT1의 메틸화와 임상적 연관성을 평가하기 위해 여러 임상변수와 비교 분석하였다. 간암의 전이에서 전이가 있는 경우 메틸화수준이 더 낮았으며, mUICC 병기가 진행될수록 메틸화수준이 감소하는 것으로 나타나고, 분화도 정도를 나타내는 Edmondson grad에서도 상대적으로 분화 정도가 불량한 G3/G4에서 메틸화 수준이 낮은 것으로 나타났다(도 8). 종합적으로 SORT1의 메틸화의 수준이 낮을수록 임상적으로 좋지 않은 결과를 보였다.
마지막으로, SORT1의 발현과 메틸화 수준을 아주대병원 코호트로 재분석한 결과, 발현이 높을수록 메틸화가 낮게 일어나는 것을 확인하였고, 이는 처음 TCGA 데이터 분석과 일치하는 것을 확인하였다(도 9).
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시예일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
Claims (16)
- SORT1 유전자 프로모터의 메틸화된 CpG 섬(CpG island) 영역을 포함하는 간암 진단용 바이오마커 조성물.
- SORT1 유전자 프로모터의 메틸화된 CpG 섬(CpG island) 영역을 포함하는 간암 전이 예후 예측용 바이오마커 조성물.
- SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 측정할 수 있는 제제를 유효성분으로 포함하는 간암 진단용 조성물.
- 제3항에 있어서, 상기 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 측정할 수 있는 제제는 상기 SORT1 유전자의 메틸화된 CpG 섬 영역 내의 단편을 증폭할 수 있는 프라이머쌍, 상기 SORT1 유전자의 메틸화된 CpG 섬 영역과 혼성화할 수 있는 프로브, 상기 SORT1 유전자의 메틸화된 CpG 섬 영역과 결합할 수 있는 메틸화 특이적 결합 단백질, 상기 SORT1 유전자의 메틸화 특이적 결합 항체 또는 압타머; 및 메틸화 민감성 제한효소로 이루어진 군에서 선택된 어느 하나 이상인 것을 특징으로 하는 간암 진단용 조성물.
- 제4항에 있어서, 상기 SORT1 유전자 프로모터의 CpG 섬 영역은 cg16988986인 것을 특징으로 하는 간암 진단용 조성물.
- 제3항 내지 제5항 중 어느 한 항의 조성물을 포함하는 간암 진단용 키트.
- SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 측정할 수 있는 제제를 유효성분으로 포함하는 간암 전이 예후 예측용 조성물.
- 제7항에 있어서, 상기 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 측정할 수 있는 제제는 상기 SORT1 유전자의 메틸화된 CpG 섬 영역 내의 단편을 증폭할 수 있는 프라이머쌍, 상기 SORT1 유전자의 메틸화된 CpG 섬 영역과 혼성화할 수 있는 프로브, 상기 SORT1 유전자의 메틸화된 CpG 섬 영역과 결합할 수 있는 메틸화 특이적 결합 단백질, 상기 SORT1 유전자의 메틸화 특이적 결합 항체 또는 압타머; 및 메틸화 민감성 제한효소로 이루어진 군에서 선택된 어느 하나 이상인 것을 특징으로 하는 간암 전이 예후 예측용 조성물.
- 제8항에 있어서, 상기 SORT1 유전자 프로모터의 CpG 섬 영역은 cg16988986인 것을 특징으로 하는 간암 전이 예후 예측용 조성물.
- 제7항 내지 제9항 중 어느 한 항의 조성물을 포함하는 간암 전이 예후 예측용 키트.
- (1) 환자로부터 분리된 시료로부터 게놈 DNA를 수득하는 단계;(2) 상기 수득된 게놈 DNA에서 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 측정하는 단계;(3) 상기 측정된 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 대조군 시료와 비교하는 단계; 및(4) 상기 측정된 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준이 대조군 시료에 비해 감소된 경우, 간암으로 판단하는 단계를 포함하는 간암 진단에 필요한 정보를 제공하는 방법.
- (1) 환자로부터 분리된 시료로부터 게놈 DNA를 수득하는 단계;(2) 상기 수득된 게놈 DNA에서 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 측정하는 단계;(3) 상기 측정된 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준을 대조군 시료와 비교하는 단계; 및(4) 상기 측정된 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준이 대조군 시료에 비해 감소된 경우, 간암 전이 가능성이 높은 것으로 예측 판단하는 단계를 포함하는 간암 전이 예후 예측에 필요한 정보를 제공하는 방법.
- 제11항 또는 제12항에 있어서, 상기 SORT1 유전자 프로모터의 CpG 섬 영역의 메틸화 수준 측정은 PCR, 메틸화 특이 PCR(methylation specific PCR), 실시간 메틸화 특이 PCR(real time methylation specific PCR), 메틸화 DNA 특이적 결합 단백질을 이용한 PCR, 메틸화 DNA 특이적 결합 항체 또는 압타머를 이용한 ChIP 분석, DNA 칩, 파이로시퀀싱 및 바이설파이트 시퀀싱으로 이루어진 군에서 선택된 방법에 의해 수행되는 것을 특징으로 하는 방법.
- 제11항 또는 제12항에 있어서, 상기 SORT1 유전자 프로모터의 CpG 섬 영역은 cg16988986인 것을 특징으로 하는 방법.
- 제11항 또는 제12항에 있어서, 상기 (4) 단계는 컷오프(cut-off) 값에 의하여 수행되는 것으로, 상기 컷오프(cut-off) 값은 상기 SORT1 유전자 프로모터의 상대적 메틸화 수준이 log10 치환시 0.0885인 것을 특징으로 하는 방법.
- 제11항 또는 제12항에 있어서, 상기 분리된 시료는 분리된 세포, 조직, 혈액, 타액 및 뇨로 이루어진 군에서 선택된 것을 특징으로 하는 방법.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020230090455A KR20250010344A (ko) | 2023-07-12 | 2023-07-12 | Sort1 유전자 프로모터의 메틸화 변화를 이용한 간암 진단용 조성물 및 이의 용도 |
| KR10-2023-0090455 | 2023-07-12 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2025014239A1 true WO2025014239A1 (ko) | 2025-01-16 |
Family
ID=94215669
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2024/009723 Pending WO2025014239A1 (ko) | 2023-07-12 | 2024-07-09 | Sort1 유전자 프로모터의 메틸화 변화를 이용한 간암 진단용 조성물 및 이의 용도 |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR20250010344A (ko) |
| WO (1) | WO2025014239A1 (ko) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101596359B1 (ko) | 2014-12-01 | 2016-02-22 | 이화여자대학교 산학협력단 | SORT1 유전자 프로모터의 CpG 메틸화 변화를 이용한 모야모야병 진단용 조성물 및 이의 이용 |
-
2023
- 2023-07-12 KR KR1020230090455A patent/KR20250010344A/ko active Pending
-
2024
- 2024-07-09 WO PCT/KR2024/009723 patent/WO2025014239A1/ko active Pending
Non-Patent Citations (5)
| Title |
|---|
| AHN H R, SON J A, WEON J H, BAEK G O, YOON M G, HAN J E, KIM S S, CHEONG J Y, KWON M, EUN J W, CHO H J: "SORT1 with oncogenic potential associated hypomethylation and promotes tumor progression in hepatocellular carcinoma", CANCER GENOMICS 258 (PB038), 1 May 2023 (2023-05-01), pages S94, XP093260212 * |
| GAO YAN, LI YAN, SONG ZIYAN, JIN ZHENXING, LI XIAO, YUAN CHUNLUAN: "Sortilin 1 Promotes Hepatocellular Carcinoma Cell Proliferation and Migration by Regulating Immune Cell Infiltration", JOURNAL OF ONCOLOGY, HINDAWI PUBLISHING CORPORATION, US, vol. 2022, 8 July 2022 (2022-07-08), US , pages 1 - 13, XP093260252, ISSN: 1687-8450, DOI: 10.1155/2022/6509028 * |
| HYE RI AHN, JI HYANG WEON, SU JIN KIM, MIN JI KANG, JI YI CHOI, GEUM OK BAEK, MOON GYEONG YOON, JI EUN HAN, SOON SUN KIM, JAE YOUN: "Poster D-44: Hypomethylation-mediated upregulation of the SORT1 promotes tumor progression in hepatocellular carcinoma.", KSBMB INTERNATIONAL CONFERENCE 2023, MAY 10-13, 2023, BEXCO, BUSAN, KOREA, KOREA SOCIETY OF BIOCHEMISTRY AND MOLECULAR BIOLOGY, KOREA, 1 May 2023 (2023-05-01) - 2023-05-13, Korea, pages 133, XP009560102 * |
| LIN MINJIE, ZHU MENGYING, GE TINGQIU, LU NAIYING, FU XILING, CHANG JIABAO: "and its co‐expressed genes in hepatocellular carcinoma based on integrative analysis of multiple database", PRECISION MEDICAL SCIENCES, vol. 11, no. 4, 1 December 2022 (2022-12-01), pages 161 - 173, XP093260248, ISSN: 2642-2514, DOI: 10.1002/prm2.12084 * |
| LIN XIA-HUI, LI DONG-PING, LIU ZHI-YONG, ZHANG SI, TANG WEN-QING, CHEN RONG-XIN, WENG SHU-QIANG, TSENG YU-JEN, XUE RU-YI, DONG LIN: "Six immune-related promising biomarkers may promote hepatocellular carcinoma prognosis: a bioinformatics analysis and experimental validation", CANCER CELL INTERNATIONAL, BIOMED CENTRAL, LONDON, GB, vol. 23, no. 1, GB , XP093260243, ISSN: 1475-2867, DOI: 10.1186/s12935-023-02888-9 * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20250010344A (ko) | 2025-01-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7612216B2 (ja) | Dna試料のメチル化変化を検出するための方法およびシステム | |
| US20220213559A1 (en) | Diagnostic gene marker panel for colorectal cancer | |
| US20200172963A1 (en) | Dna methylation in colorectal and breast cancer diagnostic methods | |
| EP2885427B1 (en) | Colorectal cancer methylation marker | |
| CN102311953B (zh) | 尿液诊断膀胱癌的方法和试剂盒 | |
| WO2018066910A1 (ko) | 메틸화 dna 다중 검출방법 | |
| WO2019045533A1 (ko) | Line-1 조절 영역에서 cpg 부위의 메틸화 수준을 이용한 유방암 진단용 조성물, 키트, 및 이를 이용한 방법 | |
| WO2021091277A1 (ko) | 혈액 기반 대장암 진단용 dna 메틸화 바이오마커 패널 | |
| JP2022522979A (ja) | スクリーニング方法 | |
| EP1525327A2 (en) | Method for identifying cancer risk | |
| WO2021091239A1 (ko) | 대장암 검출 방법 | |
| WO2025014239A1 (ko) | Sort1 유전자 프로모터의 메틸화 변화를 이용한 간암 진단용 조성물 및 이의 용도 | |
| WO2025071141A1 (ko) | 대사증후군 예측용 후성유전 메틸화 마커, 및 이를 이용한 키트 | |
| WO2024029988A1 (ko) | 세포유리 dna를 이용한 관상동맥 측부순환 예측용 바이오마커 조성물, 키트 및 정보제공방법 | |
| WO2023132626A1 (ko) | 특정 유전자의 cpg 메틸화 변화를 이용한 전립선암 진단용 조성물 및 이의 용도 | |
| CN116426624A (zh) | 一种标准化的dna甲基化检测标准品及其制备方法、定值方法及应用 | |
| WO2020256293A1 (ko) | Sdc2 유전자의 메틸화 검출방법 | |
| WO2024144235A1 (ko) | 폐암 특이적 메틸화 마커 유전자를 이용한 폐암 검출 방법 | |
| WO2023229393A1 (ko) | 폐암 검출 방법 | |
| WO2024106651A1 (ko) | 저선량 방사선 특이적 dna 메틸화 바이오마커 조성물 및 이의 용도 | |
| WO2025058140A1 (ko) | 에드워드 증후군 진단을 위한 질환 특이적인 후성학적 바이오마커 및 그의 용도 | |
| WO2024144237A1 (ko) | 폐암 특이적 메틸화 마커 유전자를 이용한 폐암 검출 방법 | |
| WO2020111809A1 (ko) | 조혈모세포 이식 후 혈액암 예후 예측을 위한 정보 제공 방법 | |
| WO2025234700A1 (ko) | 대장암 진단용 dna 메틸화 마커 및 이의 용도 | |
| WO2026059423A1 (ko) | 폐암 특이적 바이오마커 및 이를 이용한 폐암 진단 또는 예후 예측용 조성물 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 24840050 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |