WO2025006573A2

WO2025006573A2 - Codon optimized pmcv sequences

Info

Publication number: WO2025006573A2
Application number: PCT/US2024/035572
Authority: WO
Inventors: Jared PATCH; Shrinivasrao P. MANE
Original assignee: Intervet International BV; Elanco US Inc
Current assignee: Intervet International BV; Elanco US Inc
Priority date: 2023-06-27
Filing date: 2024-06-26
Publication date: 2025-01-02
Anticipated expiration: 2025-12-27
Also published as: WO2025006573A3; NO20251666A1; DK202570141A1; EP4735031A2

Abstract

The present disclosure provides exemplary codon optimized nucleic acid sequences encoding Piscine Myocarditis Virus (PMCV). Expression vectors comprising one or more of the described codon optimized nucleic acids sequences are also provided.

Description

CODON OPTIMIZED PMCV SEQUENCES

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application Serial No. 63/523,476, filed on June 27, 2023, the entire disclosure of which is incorporated herein by reference.

TECHNICAL FIELD

The disclosure relates to sequences of Piscine Myocarditis Virus (PMCV) sequences that have been modified to comprise codons optimized for expression in cells.

BACKGROUND AND SUMMARY OF THE INVENTION

Cardiomyopathy syndrome (CMS) is an emerging disease of economic importance in salmon. In particular, the Piscine Myocarditis Virus (PMCV) has been identified as a causative link for CMS. PMCV is of large economic concern in the salmonid industry because it causes morbidity and mortality in adult fish that are nearly full grown and almost ready for harvest.

PMCV encodes at least three major proteins: a capsid (ORF1), an RNA- dependent RNA polymerase (ORF2), and a structural protein of unknown function (ORF3) that may be involved in virus assembly or egress. However, attempts to propagate PMCV using in vitro cell culture systems have failed. As a result, traditional live, attenuated, and inactivated vaccine approaches have not yet materialized. Thus, there exists a need for a PMCV vaccine that utilizes DNA, RNA, or recombinant approaches for design, in particular those utilizing nucleic acid sequences that have been modified to comprise codons optimized for improved expression.

Accordingly, the present disclosure, in one aspect, provides nucleic acid molecules (e.g., described in one aspect as sequences) encoding Piscine Myocarditis Virus (PMCV) protein(s). In one example, the nucleic acid sequences of the present disclosure have been modified to comprise codons optimized for improved expression in cells.

DETAILED DESCRIPTION

Various embodiments are described herein as follows.

Illustrative aspects of the present disclosure include SEQ ID NO: 1. As described herein, SEQ ID NO: 1 corresponds to a codon optimized sequence for ORF_1 of PMCV. In an embodiment, a codon optimized nucleic acid sequence comprising SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting essentially of SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting of SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO: 1 is provided.

Illustrative aspects of the present disclosure include SEQ ID NO: 2. As described herein, SEQ ID NO: 2 corresponds to a codon optimized sequence for ORF_3 of PMCV. In an embodiment, a codon optimized nucleic acid sequence comprising SEQ ID NO:

2 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting essentially of SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting of SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO: 2 is provided.

Illustrative aspects of the present disclosure include SEQ ID NO: 3. As described herein, SEQ ID NO: 3 corresponds to a codon optimized sequence for ORF_3 FR13 of PMCV. In an embodiment, a codon optimized nucleic acid sequence comprising SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting essentially of SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting of SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO: 3 is provided.

Illustrative aspects of the present disclosure include SEQ ID NO: 4. As described herein, SEQ ID NO: 4 corresponds to a second codon optimized sequence for ORF_1 of PMCV. In an embodiment, a codon optimized nucleic acid sequence comprising SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting essentially of SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting of SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO: 4 is provided.

Illustrative aspects of the present disclosure include SEQ ID NO: 5. As described herein, SEQ ID NO: 5 corresponds to a second codon optimized sequence for ORF_3 of PMCV. In an embodiment, a codon optimized nucleic acid sequence comprising SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting essentially of SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting of SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO: 5 is provided.

Illustrative aspects of the present disclosure include SEQ ID NO: 6. As described herein, SEQ ID NO: 6 corresponds to second codon optimized sequence for ORF_3 FR13 of PMCV. In an embodiment, a codon optimized nucleic acid sequence comprising SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting essentially of SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting of SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO: 6 is provided.

In illustrative aspects, an expression vector is provided. The expression vector comprises one or more codon optimized nucleic acids sequences, wherein the one or more codon optimized nucleic acids sequences can comprise any of the codon optimized nucleic acid sequences described herein.

The following numbered embodiments are contemplated and are non-limiting.

1. A codon optimized nucleic acid sequence comprising SEQ ID NO:1.

2. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:1.

3. A codon optimized nucleic acid sequence consisting of SEQ ID NO:1.

4. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO: 1.

5. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:1.

6. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO: 1.

7. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:1.

8. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO: 1.

9. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ 1D NO:1.

10. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO: 1.

11. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO: 1.

12. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:1.

13. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO: 1. 14. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO: 1.

15. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:1.

16. A codon optimized nucleic acid sequence comprising SEQ ID NO:2.

17. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:2.

18. A codon optimized nucleic acid sequence consisting of SEQ ID NO:2.

19. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:2.

20. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:2.

21. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:2.

22. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:2.

23. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:2.

24. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:2.

25. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:2.

26. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:2.

27. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:2.

28. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:2.

29. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:2.

30. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:2.

31. A codon optimized nucleic acid sequence comprising SEQ ID NO:3.

32. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:3.

33. A codon optimized nucleic acid sequence consisting of SEQ ID NO:3. 34. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:3.

35. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:3.

36. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:3.

37. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:3.

38. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:3.

39. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:3.

40. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:3.

41. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:3.

42. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:3.

43. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:3.

44. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:3.

45. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:3.

46. A codon optimized nucleic acid sequence comprising SEQ ID NO:4.

47. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:4.

48. A codon optimized nucleic acid sequence consisting of SEQ ID NO:4.

49. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:4.

50. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:4.

51. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:4. 52. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:4.

53. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:4.

54. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:4.

55. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:4.

56. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:4.

57. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:4.

58. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:4.

59. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:4.

60. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:4.

61. A codon optimized nucleic acid sequence comprising SEQ ID NO:5.

62. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:5.

63. A codon optimized nucleic acid sequence consisting of SEQ ID NO:5.

64. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:5.

65. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:5.

66. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:5.

67. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:5.

68. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:5.

69. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:5. 70. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:5.

71. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:5.

72. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:5.

73. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:5.

74. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:5.

75. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:5.

76. A codon optimized nucleic acid sequence comprising SEQ ID NO:6.

77. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:6.

78. A codon optimized nucleic acid sequence consisting of SEQ ID NO:6.

79. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:6.

80. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:6.

81. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:6.

82. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:6.

83. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:6.

84. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:6.

85. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:6.

86. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:6.

87. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:6. 88. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:6.

89. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:6.

90. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:6.

91. An expression vector comprising one or more codon optimized nucleic acids sequences, wherein the one or more codon optimized nucleic acids sequences are selected from any one of clauses 1 to 90 and any combination thereof.

EXAMPLE 1

Exemplary Codon Optimized Nucleic Acid Sequences

Exemplary codon optimized nucleic acid sequence were constructed. The nucleic acid sequences as shown in Table 1 can be utilized according to the present disclosure.

Table 1.

The sequences include the following:

ATGGAGCCCAATACCAGCGTGATCGCTACCGAACAACAACAAGCTGCTATGAGAG

AAGTCGAAGCTGAAGCTGCTGCTAGAGATGAGGTCGTCGAAAAAATTGCCTTTGCC

GAGGGAGCCATGATGGTGCAAACCAGAAGACTGCCCAGCGGAAAATCCAGCGTGG

GCGGATTCCTGGGAGAGCTCGCTCAAAATATCAGGGCTATGAACAGATCCCTGCAT

ACCGACACAAATATGCTCACAGAGGGAGCTATGGTCGATAGGGCTAGAGCCAAGG

TGCATAAGATTATCAGAGAGGGAAACCTGGATTCCAGAGTGTTCAGCAATACCGGC

TCCAATACCATGCTGAGCCTCTGGGTGCCTGCTGTGCCAGGCCCTCCCGCTGTGCCC

GAACACTGGGATGTGGCTCCAAGCTGGTTTGTGTGTAGGCCAGGCAAGAAAGGCG GAATCAAAATTACCCAGTCCGCTAGCATGGCTGCTCTGAATCCCCTGTTCAGGGGA

GCCGATGTCGGACCTATTGGAACCGCTGTGAGAGCCGACGTGAATGCCTTCTCCAT

GAACGCTGTGCTCGGAGCTCTGAGGGCTGGCGGATTCAATACAGAGCACAGCCTCG

TCAGCTTTGTGGAGCCCCTGATCAGGATTCTGCTGATGGGAGTGCAGACCCAGGAT

AGAGGAACAAGCCCTTGGGACTGGGTGGGCGGAATGTCCAGCAGGATCGTGAACC

CTCTGGTGTTTACCACCTCCGGAAATTTTTTTCCCGGCGGACCTAACCTGAGAGTCT

GGGGCGCTAATGACACCGTCGCTAGAATCGTGAATGTGGAAGATTATATGAGGGA

AGCTGCTGGAGAAGGAAGATTTGATGCTGGATGGGGACCAGAGTTTTGGGGCGGA

ACCGGAGATGATGCTGTCGCTGTCGTGCCAATCAGAGCTGTGGAGGCTGGACTGGG

AGAGGTGAATGCTGGATGGACCCTGGCTCATATGGAGTATCCCGTGAAAGTGAGG

CTGCTGGATGTGGATGATAGAACCATCGGACCCGGCGGAAGCCTCCCACTGAATGC

TAATAGGGAGTATACCGCTGCTGGAGCTACCCACGTGCCAGGACCTTACGCTAGAG

TGCTCTATGTGGTGGTCGATCAGAATGCCGATAGATGTGTCGGAGTCAGAGTCCAA

GGACAAGGAGCTGTGATCGATGTCGACCCCGCCCTGAACTATGTCATCGGCGGAGC

CGACCTGGGAATGCTGCCCCTGATCCAATGGAGCGTGGGACTCGGAGCTGAAGAT

ATGGCTCAAGGATCCATCGCCCAAACCCAAAGATGGGTCAGAATGTACGGCAATG

AAGATGACTGGGAGTCCGCTTGGCACCTGGTCTCCAGCGCCTATACCGTCTATAGC

CCAGCTTTTAGAAGATCCGGAGTGGCTGTCGAAGGCGGATTTTGGGCTCAGCCTGC

TGCTGGAGCTGCTCCCTTCCCCCTGGGCGGACTGGCCGGCTGGGTCAGATATGATA

ACCAAGCTAGAGCTGCTCAAGTGGCTCTGTGTAGGGAAAGAGCTGACATGGCTGA

ATGTCCATGGGGCGGATATAGAGAAAGAGGAGTCAGACCCGGAAGCGTCGCTAAT

TGGCAATATGTGAGATTTGACCCAACCGTCGCTGTGGGAGTGGCTGCCCATTTTTG

GTCCGTGGTCAAAGTCATGGTCGCTCCAGTGCCTGATAGGGCTGCTGCCCTCGCCG

ATATGGCCTGGGGCAAAGGAAAAGTCCAGGCTATGGGAGAAGACGTCATTAATGG

CCAAATGGGACAGCCCGAAAGCATGATGAGGGGAGTCGCTCTCAATGAAAATCAA

GGACTGGCTGCTGCTACCGTGAGAAGAGTCGTGGGCCTCGAAAATGAAAGCATGC

AGACCACCCATTGGTCCACCACCGAAGTGGCCATGAATGGCTATTATGGAAGAGCT

GGAGCTACCGCTCATCATGCTGCTTTCCCCCTGAGCGAAGGCGGAACCATGAGGAA

GAGAATCCCCGCCATCGAAATGAGAGAAAATGGAGTCGAAGGCGATCTCATGAAT

GACGACCTGTACTCCATCGGAACCGCCGCCGGCTATCTCGCTGTGGAAGGAATGGC

TGGAGCTCAAGGCGGAATTTGGGATGTCGTGCAATATCAACTCCCAGGACCAGATG

ACGAAGCTAGAGGAGTCATGAATACCGTCGGAGCTATGGGCGGATGGACCAGAGC

TGTCACCCCTGTGGATAACGTCGCTACAATGAGAGATAATGGAGTGGAAGGCGAG

CCCTGCGGAATCGTCATGAGCCTGCCTACCTCCGGAACAGCTGTCGTCGACAGACT GGCCAACTTTGGACTGCCTCCCGCTAGAGCTGAGCTGAGAGAGGTGCCTTTCGGAG

GATATCAGAGGTCCGTGACCAATACAAATCATAGAGTGAAAGTCTCCGTCAGCGGC

GGAAGGGCTGTGGTGCAGAAGGGAAATAAGGCTGAAATGAACCCCGTGTTCGTGA

ACAGAACCCCTGGACAGACCACACTGGGACAGCCTACCACCGATACCACCGGAAT

GACCACCGCTGACTTCCTGGACATCTGA (SEQ ID NO: 1)

ATGTCCAATAAAATGAAAAGCTTCCTGCTCGTCCTGCTGTGCCTGTGTGTGGGCGA

GGGAATCGTGCCCATGTTTAGAAGAGAGTGGTGCCTGTGTACCGCTGGAAACGCTA

GGGTGCCACTGGTCGGAGAAGGAAGAGCTGAAAAAATTGAACTGTTTAACCAATC

CGCTACCTGCGGCAAAAAGGAACTGATCATCACCTGGAAAGGAAAAAGATGGTGT

TATGACATCGAATCCAAAAGGGGCAAGATCCTGGTGAAAACCCTCAGCGGCGGAG

GCCACCTCGAGAGAGAAGGCAAAGGATATAAACTCGTGAGAAATGGATTTCACCT

GGCCAGCTTTGGCGGCAAGAAAGAAGAGATCCAAGACTCCAGCCATATCGAAAAG

GTGAATGGCAAGGATGCCATCGTGAAAAAGGGACAGCATGTGGAGCACCTGCCCG

GAGGCAATGACCTGATCGTGACCGAAGGAGGCAATCTCTGCGGCAATGTCGGATTT

TTTGACAACACCCAATGTACCTATAATTCCGTGATCAACATCGGAGGCGGATCCGT

GGATAACAGCCAGGAAGCTAAAAATGACAAGAGCAATACCATCGATAACCTGATC

GACATGCTGCCCCTGGTGGTGGGAATCGCTGGCGGATGCCTGATCGTCATCGTGGT

GCTGTATCTGACCATCAAGTATTGCAAGTGTAAAAAAAAAAGAACAAATCCTGAG

CCCGCTGAGCCAGAAGAGCATGAAATGAGAGACCTGAGAAGAAGACTGGAACCTA

GGCCTCCCTATCAGAGGCAAATGGGCGTGGAATTCGAGATCAACGAGGCCCTGGA

GTTTATGGGAGTGGAGGGATCCGAGAGCCCTGATTCCGGATGTCAAAGCGACGAG

GAAGGCTTTAGGGTGGGAGTGTGA (SEQ ID NO: 2)

ATGTCCAATAAAATGAAAAGCTTCCTGCTCGTCCTGCTGTGCCTGTGTGTGGGCGA

GGGAATCGTGCCCATGTTTAGAAGAGAGTGGTGCCTGTGTACCGCTGGAAACGCTA

GGGTGCCACTGGTCGGAGAAGGAAGAGCTGAAAAAATTGAACTGTTTAACCAATC

CGCTACCTGCCGGAAAAAGGAACTGATCATCACCTGGAAAGGAAAAAGATGGTGT

TATGACATCGGATCCAAAAGGGGCAAGGTGCTGGTGCAGACCCTCAGCGGCGGAG

GCCACCTCGAGCAGGAAGGCAAAGGATATAAACTCGTGAGAAATGGATTTCACCT

GGCCAGCTTTGGCGGCAAGAAAGAAGAGATCCAAGACTCCAGCCATATCGAAAAG

GTGAATGGCAAGGATGCCATCGTGAAAAAGGGACAGCATGTGGAGCACCTGCCCG

GAGGCAATGACCTGATCGTGACCGAAGGAGGCAATCTCTGCGGCAATGTCGGATTT TTTGACAACACCCAATGTACCTATAATTCCGTGATCAACATCGGAGGCGGATCCGT

GGATAACAGCCAGGAAGCTAAAAATGACAAGAGCAATACCATCGATAACCTGATC

GACATGCTGCCCCTGGTGGTGGGAATCGCTGGCGGATGCCTGATCGTCATCGTGAT

CCTGTATCTGACCATCAAGTATTGCAAGTGTAAAAAAAAAAGAACAAATCCTGAGC

CCGTGGAGCCAGAAGAGCATGAAATGAGAGACCTGAGAAGAAGACTGGAACCTAG

GCCTCCCTATCAGAGGCAAATGGGCGTGGAATTCGAGATCAACGAGGCCCTGGAG

TTTATGGGAGTGGAGGGATCCGAGAGCCCTGATTCCGGATGTCAAAGCGACGAGG

AAGGCTTTAGGGTGGGAGTGTGA (SEQ ID NO: 3)

ATGGAGCCTAATACTAGCGTTATAGCTACAGAACAACAACAAGCAGCTATGCGCG

AAGTCGAAGCTGAAGCTGCTGCTCGCGATGAGGTCGTCGAAAAAATTGCTTTTGCA

GAGGGGGCTATGATGGTCCAAACAAGAAGACTCCCTAGCGGGAAAAGCAGCGTCG

GGGGATTCTTGGGAGAGCTCGCTCAAAATATTAGAGCTATGAACAGAAGCCTCCAT

ACTGACACAAATATGCTCACAGAGGGAGCTATGGTCGATCGCGCTAGAGCTAAGG

TCCATAAGATTATAAGAGAGGGAAACCTCGATAGCAGAGTCTTCAGCAATACAGG

ATCTAATACAATGCTCAGCCTCTGGGTCCCTGCTGTCCCTGGGCCTCCTGCTGTCCC

TGAACACTGGGATGTCGCTCCTAGCTGGTTTGTCTGTCGCCCTGGAAAGAAAGGAG

GAATTAAAATTACTCAGTCTGCTAGCATGGCTGCTCTCAATCCTCTCTTCCGCGGAG

CTGATGTCGGACCTATTGGAACTGCTGTTAGAGCTGACGTCAATGCTTTCAGCATG

AACGCTGTCCTCGGGGCTCTCCGCGCTGGAGGGTTCAATACAGAGCACAGCCTCGT

CAGCTTTGTCGAGCCTCTCATAAGAATTCTCCTCATGGGAGTCCAGACTCAGGATA

GAGGAACATCTCCTTGGGACTGGGTCGGGGGAATGAGCAGCAGAATTGTTAACCCT

CTCGTCTTTACTACTTCTGGAAATTTTTTTCCTGGAGGGCCTAACCTCAGAGTCTGG

GGGGCTAATGACACTGTCGCTAGAATTGTCAATGTCGAAGATTATATGAGAGAAGC

TGCTGGAGAAGGAAGATTTGATGCAGGGTGGGGGCCTGAGTTTTGGGGAGGAACT

GGAGATGATGCTGTCGCTGTCGTCCCTATTAGAGCTGTCGAGGCTGGACTCGGGGA

GGTCAATGCTGGATGGACTCTCGCTCATATGGAGTATCCTGTTAAAGTCCGCCTCCT

CGATGTTGATGATAGAACTATAGGGCCTGGAGGATCTCTCCCTCTCAATGCTAATC

GCGAGTATACAGCTGCTGGGGCAACACACGTCCCTGGACCTTACGCTAGAGTCCTC

TATGTTGTTGTCGATCAGAATGCTGATAGATGCGTCGGAGTCCGCGTCCAAGGGCA

AGGAGCAGTCATAGATGTCGACCCTGCTCTCAACTATGTCATTGGAGGGGCTGACC

TCGGAATGCTCCCTCTCATTCAATGGAGCGTCGGACTCGGAGCTGAAGATATGGCT

CAAGGGAGCATAGCTCAAACACAAAGATGGGTCAGAATGTACGGGAATGAAGATG

ACTGGGAGAGCGCTTGGCACCTCGTCAGCTCTGCTTATACTGTCTATTCTCCTGCTT TTAGACGCAGCGGAGTTGCTGTCGAAGGGGGGTTTTGGGCTCAGCCTGCAGCTGGA

GCTGCTCCTTTCCCTCTCGGGGGGCTCGCTGGATGGGTCAGATATGATAACCAAGC

TAGAGCTGCTCAAGTCGCTCTCTGTCGCGAAAGAGCTGACATGGCTGAATGCCCAT

GGGGAGGATATAGAGAACGCGGAGTCCGCCCTGGAAGCGTCGCTAATTGGCAATA

TGTCAGATTTGACCCTACTGTCGCAGTCGGGGTCGCAGCACATTTTTGGAGCGTCGT

CAAAGTCATGGTCGCACCTGTTCCTGATCGCGCTGCAGCACTCGCTGATATGGCTT

GGGGAAAAGGAAAAGTCCAGGCTATGGGAGAAGACGTCATTAATGGACAAATGGG

GCAGCCAGAAAGCATGATGCGCGGAGTCGCTCTCAATGAAAATCAAGGGCTCGCT

GCTGCAACTGTTAGAAGAGTCGTCGGACTCGAAAATGAAAGCATGCAGACTACAC

ATTGGAGCACTACAGAAGTCGCTATGAATGGATATTATGGACGCGCTGGGGCTACT

GCTCATCATGCAGCTTTCCCTCTCAGCGAAGGAGGAACTATGAGAAAGAGAATTCC

TGCAATTGAAATGAGAGAAAATGGAGTCGAAGGAGATCTCATGAATGACGACTTG

TACAGCATAGGGACAGCTGCTGGATATCTCGCTGTCGAAGGAATGGCTGGAGCTCA

AGGAGGAATTTGGGATGTCGTTCAATATCAACTCCCAGGACCAGATGACGAAGCTA

GAGGAGTCATGAATACAGTCGGAGCTATGGGAGGGTGGACAAGAGCTGTCACTCC

TGTCGATAACGTCGCTACAATGAGAGATAATGGAGTCGAAGGAGAGCCATGCGGG

ATTGTCATGAGCCTCCCTACTAGCGGAACAGCAGTCGTCGACAGACTCGCAAACTT

TGGGCTCCCTCCTGCTAGAGCTGAGCTCCGCGAGGTCCCTTTCGGAGGATATCAGC

GCAGCGTTACTAATACAAATCATCGCGTTAAAGTCAGCGTCAGCGGAGGAAGAGC

TGTCGTCCAGAAGGGAAATAAGGCTGAAATGAACCCTGTTTTCGTTAACAGAACTC

CTGGGCAGACAACACTCGGACAGCCTACTACTGATACAACTGGAATGACTACAGCT

GACTTCCTCGACATTTAA (SEQ ID NO: 4)

ATGTCCAATAAAATGAAAAGCTTCCTGCTCGTCCTGCTGTGCCTGTGTGTGGGCGA

GGGAATCGTGCCCATGTTTAGAAGAGAGTGGTGCCTGTGTACCGCTGGAAACGCTA

GGGTGCCACTGGTCGGGGAAGGGAGAGCAGAAAAAATTGAACTGTTTAACCAATC

CGCTACCTGCGGCAAAAAGGAACTGATCATCACCTGGAAAGGGAAAAGATGGTGT

TATGACATCGAATCCAAAAGGGGCAAGATCCTGGTGAAAACCCTCTCTGGCGGAG

GCCACCTCGAGAGAGAAGGCAAAGGATATAAACTCGTGAGAAATGGATTTCACCT

GGCCAGCTTTGGCGGCAAGAAAGAAGAGATCCAAGACTCCAGCCATATCGAAAAG

GTGAATGGCAAGGATGCCATCGTGAAAAAGGGACAGCATGTGGAGCACCTGCCCG

GAGGCAATGACCTGATCGTGACCGAAGGAGGCAATCTCTGCGGCAATGTCGGATTT

TTTGACAACACCCAATGTACCTATAATTCCGTGATCAACATCGGGGGCGGGTCCGT

GGATAACAGCCAGGAAGCTAAAAATGACAAGAGCAATACCATCGATAACCTGATC GACATGCTGCCCCTGGTGGTGGGGATCGCTGGCGGATGCCTGATCGTCATCGTGGT GCTGTATCTGACCATCAAGTATTGCAAGTGTAAAAAAAAAAGAACAAATCCTGAG CCCGCTGAGCCAGAAGAGCATGAAATGAGAGACCTGAGACGCAGACTGGAACCTA GGCCACCCTATCAGAGGCAAATGGGCGTGGAATTCGAGATCAACGAGGCCCTGGA GTTTATGGGAGTGGAGGGATCCGAGTCTCCTGATTCCGGGTGTCAAAGCGACGAGG AAGGCTTTAGGGTGGGGGTGTGA (SEQ ID NO: 5)

ATGTCCAATAAAATGAAAAGCTTCCTGCTCGTCCTGCTGTGCCTGTGTGTGGGCGA GGGAATCGTGCCCATGTTTAGAAGAGAGTGGTGCCTGTGTACCGCTGGAAACGCTA GGGTGCCACTGGTCGGGGAAGGGAGAGCAGAAAAAATTGAACTGTTTAACCAATC CGCTACCTGCCGCAAAAAGGAACTGATCATCACCTGGAAAGGGAAAAGATGGTGT TATGACATCGGATCCAAAAGGGGCAAGGTCCTGGTGCAAACCCTCTCTGGCGGAG GCCACCTCGAGCAAGAAGGCAAAGGATATAAACTCGTGAGAAATGGATTTCACCT GGCCAGCTTTGGCGGCAAGAAAGAAGAGATCCAAGACTCCAGCCATATCGAAAAG GTGAATGGCAAGGATGCCATCGTGAAAAAGGGACAGCATGTGGAGCACCTGCCCG GAGGCAATGACCTGATCGTGACCGAAGGAGGCAATCTCTGCGGCAATGTCGGATTT TTTGACAACACCCAATGTACCTATAATTCCGTGATCAACATCGGGGGCGGGTCCGT GGATAACAGCCAGGAAGCTAAAAATGACAAGAGCAATACCATCGATAACCTGATC GACATGCTGCCCCTGGTGGTGGGGATCGCTGGCGGATGCCTGATCGTCATCGTGAT ACTGTATCTGACCATCAAGTATTGCAAGTGTAAAAAAAAAAGAACAAATCCTGAG CCCGTTGAGCCAGAAGAGCATGAAATGAGAGACCTGAGACGCAGACTGGAACCTA GGCCACCCTATCAGAGGCAAATGGGCGTGGAATTCGAGATCAACGAGGCCCTGGA GTTTATGGGAGTGGAGGGATCCGAGTCTCCTGATTCCGGGTGTCAAAGCGACGAGG AAGGCTTTAGGGTGGGGGTGTGA (SEQ ID NO: 6)

EXAMPLE 2

Exemplary Vectors

Exemplary vectors can be constructed using fusion technology to create various plasmids. For instance, starting with an existing plasmid, a variant plasmid can be designed to include one or more codon optimized nucleic acid sequences of the present disclosure.

Claims

WHAT IS CLAIMED IS:

1. A codon optimized nucleic acid sequence comprising SEQ ID NO: 1.

3. A codon optimized nucleic acid sequence consisting of SEQ ID NO:1.

4. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:1.

6. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:1.

8. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:1.

9. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:1.

10. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:1.

11. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:1 .

13. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:1.

14. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:1.

16. A codon optimized nucleic acid sequence comprising SEQ ID NO:2.

18. A codon optimized nucleic acid sequence consisting of SEQ ID NO:2.

31. A codon optimized nucleic acid sequence comprising SEQ ID NO:3.

33. A codon optimized nucleic acid sequence consisting of SEQ ID NO:3.

34. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:3.

46. A codon optimized nucleic acid sequence comprising SEQ ID NO:4.

48. A codon optimized nucleic acid sequence consisting of SEQ ID NO:4.

51. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:4.

52. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:4.

61. A codon optimized nucleic acid sequence comprising SEQ ID NO:5.

63. A codon optimized nucleic acid sequence consisting of SEQ ID NO:5.

69. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:5.

70. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:5.

76. A codon optimized nucleic acid sequence comprising SEQ ID NO:6.

78. A codon optimized nucleic acid sequence consisting of SEQ ID NO:6.

87. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:6.

88. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:6.

91. An expression vector comprising one or more codon optimized nucleic acids sequences, wherein the one or more codon optimized nucleic acids sequences are selected from any one of claims 1 to 90 and any combination thereof.

92. An immunogenic composition comprising the expression vector of claim 91.

93. A plurality of expression vectors, wherein at least one expression vector comprises the one or more codon optimized nucleic acids sequences are selected from any one of claims 1 to 90.

94. An immunogenic composition comprising the plurality of expression vectors of claim 93.

95. A method of immunizing a non-human animal with the immunogenic composition of claim 94.

96. The method of claim 95, wherein the non-human animal is a fish.