WO2024258052A1 - 샘플 내의 bk 바이러스 및 사이토메갈로바이러스의 동시 정량 방법 - Google Patents

샘플 내의 bk 바이러스 및 사이토메갈로바이러스의 동시 정량 방법 Download PDF

Info

Publication number
WO2024258052A1
WO2024258052A1 PCT/KR2024/005857 KR2024005857W WO2024258052A1 WO 2024258052 A1 WO2024258052 A1 WO 2024258052A1 KR 2024005857 W KR2024005857 W KR 2024005857W WO 2024258052 A1 WO2024258052 A1 WO 2024258052A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
nucleic acid
nucleotide
seq
cmv
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2024/005857
Other languages
English (en)
French (fr)
Inventor
임소정
이정우
전지현
박태영
김민선
강초은
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Seegene Inc
Original Assignee
Seegene Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Seegene Inc filed Critical Seegene Inc
Priority to KR1020257030948A priority Critical patent/KR20250169531A/ko
Publication of WO2024258052A1 publication Critical patent/WO2024258052A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/6818—Hybridisation assays characterised by the detection means involving interaction of two or more labels, e.g. resonant energy transfer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2561/00—Nucleic acid detection characterised by assay method
    • C12Q2561/113—Real time assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/107—Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2565/00—Nucleic acid analysis characterised by mode or means of detection
    • C12Q2565/10—Detection mode being characterised by the assay principle
    • C12Q2565/101—Interaction between at least two labels
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention relates to a method for simultaneous quantification of BK virus (BKV) and cytomegalovirus (CMV) in a sample.
  • BKV BK virus
  • CMV cytomegalovirus
  • Human polyomavirus type BK virus is a non-enveloped virus with a circular, double-stranded DNA genome of approximately 5,300 bp.
  • the genome encodes three capsid structural proteins, namely viral capsid protein 1 (VP1), VP2, and VP3, as well as the large T and small T antigens.
  • BK virus was first isolated in 1971 from urine from a patient with ureteric stenosis who had undergone renal transplantation, with the initials "B.K.” Although BK virus infection is widespread, infected individuals are usually asymptomatic or present only with mild symptoms (e.g., respiratory infection or fever). After initial infection, BK virus typically remains latent in the uroepithelium and renal tubular epithelial cells. It is thought that more than 80% of the population contains this latent form of the virus.
  • BK virus infection in immunosuppressed and/or immunocompromised individuals are quite severe, for example in the setting of organ transplantation.
  • clinical manifestations may include renal dysfunction and the presence of renal tubular cells and inflammatory cells in the urine.
  • BK virus reactivates and replicates, triggering a series of events beginning with tubular cell lysis and viruria.
  • BK virus then amplifies in the interstitium and crosses the peritubular capillaries, causing viremia and eventually invading the allograft, resulting in a variety of tubulointerstitial lesions and BK virus nephrophathy (BKVN).
  • BK virus significantly increases the likelihood of graft loss.
  • BK virus is an opportunistic viral infection posttransplantation, affecting approximately 15% of renal transplant recipients in the first year after transplantation. If left untreated, BKVN will progress to allograft failure.
  • BK virus infection Although immunosuppression and/or immunocompromise are the major risk factors for BK virus infection, other risk factors include male sex, older age, previous rejection episodes, degree of human leukocyte antigen mismatch, prolonged cold ischemia time, BK serostatus, and ureteral stent placement. Treatment options for patients with symptomatic BK virus infection are limited, and effective prophylaxis is not available. The cornerstone of treatment is to reduce immunosuppression, which increases the risk of allograft rejection. Antiviral drugs are used, but the results are inconsistent. BK virus is now recognized as a major cause of interstitial nephritis and allograft failure in renal transplant recipients.
  • BK virus infection is diagnosed by a BK virus blood test or a urine test for decoy cells.
  • the presence of decoy cells is a sensitive measure, but has a low positive predictive value for the diagnosis of BKVN (see Mbianda, et al. Journal of Clinical Virology 71:59-62 (2015)).
  • Quantification of viral load in plasma and urine using DNA or mRNA has been used to diagnose BKVN.
  • transplant renal biopsy remains the gold standard for diagnosing BKVN.
  • transplant renal biopsy is a time-consuming, invasive, and cumbersome procedure.
  • Cytomegalovirus is a ubiquitous herpes-like virus with a linear, double-stranded DNA genome of approximately 236,000 kb. CMV infects 40-80% of humans before puberty. CMV is latent after primary infection and is often asymptomatic. Even reinfection is often asymptomatic or causes only mild disease in immunocompetent hosts. However, in immunocompromised patients, such as congenitally infected infants and allogeneic transplant recipients or patients with autoimmune deficiency syndrome (AIDS), CMV can cause serious and sometimes life-threatening diseases, such as retinitis, gastrointestinal disorders, and encephalitis. Half of allogeneic stem cell recipients develop CMV infection within 100 days of transplantation. CMV end-organ disease is a serious and frequent complication of allogeneic stem cell transplantation.
  • CMV end-organ disease is a serious and frequent complication of allogeneic stem cell transplantation.
  • antiviral drugs e.g., ganciclovir and foscarnet
  • ganciclovir and foscarnet can have a significant beneficial effect on the patient's prognosis.
  • Anti-CMV antibodies especially IgM antibodies, can be used as markers for CMV infection.
  • detection of anti-CMV antibodies is limited in distinguishing between latent and active infections.
  • virus culture such as virus culture from blood cells, is a more direct diagnostic parameter for CMV viremia, but this method is technically difficult and time-consuming. Furthermore, virus culture does not necessarily correspond to CMV disease. Isolation of virus from peripheral leukocytes may not predict clinical symptoms in some immunosuppressed patients.
  • the present inventors have endeavored to develop a novel method capable of simultaneously quantifying BKV and CMV in a sample with improved sensitivity and specificity. As a result, the present inventors have confirmed that BKV and CMV in a sample can be effectively and simultaneously quantified in a single reaction by a method using a first oligonucleotide set capable of hybridizing to the VP2 gene of BKV and a second oligonucleotide set capable of hybridizing to the UL55 gene of CMV.
  • an object of the present invention is to provide a method for simultaneous quantification of BK virus (BKV) and cytomegalovirus (CMV) in a sample.
  • BKV BK virus
  • CMV cytomegalovirus
  • Another object of the present invention is to provide a composition for a method for simultaneous quantification of BK virus (BKV) and cytomegalovirus (CMV) in a sample.
  • BKV BK virus
  • CMV cytomegalovirus
  • a method for simultaneous quantification of BK virus (BKV) and cytomegalovirus (CMV) in a sample comprising the following steps:
  • nucleic acid amplification reaction comprising contacting a sample in a single reaction vessel with a first set of oligonucleotides hybridizable to the VP2 gene of BKV and a second set of oligonucleotides hybridizable to the UL55 gene of CMV, wherein the nucleic acid amplification reaction generates a first amplification curve representing amplification of the VP2 gene of BKV in the sample and a second amplification curve representing amplification of the UL55 gene of CMV in the sample;
  • the first oligonucleotide set comprises a plurality of oligonucleotides hybridizable to the nucleotide sequence of SEQ ID NO: 1 or a complement thereof.
  • At least one of the plurality of oligonucleotides has 1-3 deoxyinosines; one or two of the deoxyinosines are located in a core region ranging from the 3rd nucleotide at the 3'-terminus to the 6th nucleotide at the 3'-terminus of the oligonucleotide, and the remainder are located in a region ranging from the 4th nucleotide at the 5'-terminus to the 7th nucleotide at the 3'-terminus of the oligonucleotide.
  • the first oligonucleotide set does not comprise an oligonucleotide hybridizable to the genomic sequence of JC virus or simian virus 40.
  • the first oligonucleotide set comprises a primer having the nucleotide sequence of SEQ ID NO: 2 and a primer having the nucleotide sequence of SEQ ID NO: 3.
  • the first oligonucleotide set comprises a probe having the nucleotide sequence of SEQ ID NO: 4.
  • the probe comprises a detectable fluorescent label and a quenching moiety capable of quenching a signal from the fluorescent label.
  • the second oligonucleotide set comprises a plurality of oligonucleotides hybridizable to the nucleotide sequence of SEQ ID NO: 5 or the complement thereof.
  • At least one of the plurality of oligonucleotides has 1-3 deoxyinosines; one or two of the deoxyinosines are located in a core region ranging from the 3rd nucleotide at the 3'-terminus to the 6th nucleotide at the 3'-terminus of the oligonucleotide, and the remainder are located in a region ranging from the 4th nucleotide at the 5'-terminus to the 7th nucleotide at the 3'-terminus of the oligonucleotide.
  • the second oligonucleotide set does not comprise an oligonucleotide hybridizable to the genomic sequence of herpes simplex virus 1, human herpesvirus 2, human herpesvirus 4, human herpesvirus 6B, human herpesvirus 6, or human herpesvirus 7 virus.
  • the second oligonucleotide set comprises a primer having the nucleotide sequence of SEQ ID NO: 6 and a primer having the nucleotide sequence of SEQ ID NO: 7.
  • the second oligonucleotide set comprises a probe having the nucleotide sequence of SEQ ID NO: 8.
  • the probe comprises a detectable fluorescent label and a quenching moiety capable of quenching a signal from the fluorescent label.
  • the nucleic acid amplification reaction is a real-time PCR or an isothermal amplification reaction.
  • the reference samples containing the known amount of VP2 gene are three or more, each comprising an amount selected from 10 1 copies/uL to 10 10 copies/uL.
  • the other reference samples containing the known amount of the UL55 gene are three or more, each comprising an amount selected from 10 1 copies/uL to 10 10 copies/uL.
  • the sample is whole blood, plasma or serum collected from a subject who has received a kidney transplant.
  • the subject is less than 1 year post-renal transplant.
  • the sample has a volume of 5 to 15 ul and the total volume of the nucleic acid amplification reaction is 20 to 30 ul.
  • the present invention provides a composition for simultaneous quantification of BK virus (BKV) and cytomegalovirus (CMV) in a sample, comprising:
  • a reagent for nucleic acid amplification comprising a polymerase, dNTPs, and a buffer.
  • the composition further comprises a reference sample containing a known amount of the VP2 gene and another reference sample containing a known amount of the UL55 gene.
  • the first oligonucleotide set comprises a primer having the nucleotide sequence of SEQ ID NO: 2 and a primer having the nucleotide sequence of SEQ ID NO: 3.
  • the first oligonucleotide set comprises a probe having the nucleotide sequence of SEQ ID NO: 4.
  • the second oligonucleotide set comprises a primer having the nucleotide sequence of SEQ ID NO: 6 and a primer having the nucleotide sequence of SEQ ID NO: 7.
  • the second oligonucleotide set comprises a probe having the nucleotide sequence of SEQ ID NO: 8.
  • the method of the present invention can simultaneously quantify BKV and CMV in a sample with one reaction, and thus exhibits the effects of reducing the cost of testing, such as reducing the amount of sample, shortening the testing time, and shortening the testing equipment and administration personnel.
  • the oligonucleotide set used in the method of the present invention enables more accurate diagnosis of BKV and CMV with high sensitivity and specificity.
  • the method of the present invention can increase the diagnosis rate of opportunistic infections in renal transplant patients and contribute to improving the survival rate of transplanted organs and patients in the long term.
  • the present invention provides a method for simultaneous quantification of BK virus (BKV) and cytomegalovirus (CMV) in a sample, comprising the following steps:
  • nucleic acid amplification reaction comprising contacting a sample in a single reaction vessel with a first set of oligonucleotides hybridizable to the VP2 gene of BKV and a second set of oligonucleotides hybridizable to the UL55 gene of CMV, wherein the nucleic acid amplification reaction generates a first amplification curve representing amplification of the VP2 gene of BKV in the sample and a second amplification curve representing amplification of the UL55 gene of CMV in the sample;
  • step (a) of the present disclosure a nucleic acid amplification reaction for target nucleic acids of BKV and CMV is performed.
  • a nucleic acid amplification reaction comprising contacting a sample in a single reaction vessel with a first set of oligonucleotides hybridizable to the VP2 gene of BKV and a second set of oligonucleotides hybridizable to the UL55 gene of CMV.
  • the process for amplifying the target nucleic acid of BKV and the process for amplifying the target nucleic acid of CMV occur simultaneously in one reaction vessel through one reaction, and the results thereof are also provided together. Therefore, the method of the present invention is also referred to by terms such as “multiplex analysis”, “multiplex reaction”, and “multiplex amplification”.
  • vessel refers to a physical compartment or space that houses the components used in the nucleic acid amplification reaction for BKV and CMV.
  • Non-limiting examples of the above containers include tubes, plates, etc.
  • the containers can be sealed, for example, by a cap or by a film via a suitable sealing machine.
  • a “single reaction vessel” is a single well in a well plate, such as a 48-well plate, a 96-well plate, a 192-well plate, or a 384-well plate.
  • sample can mean any analyte that contains or is suspected of containing a nucleic acid to be detected.
  • the sample includes biological samples (e.g., cells, tissues, and body fluids) and non-biological samples (e.g., food, water, and soil), and the biological sample can be, but is not limited to, viruses, bacteria, tissues, cells, blood (including whole blood, plasma, and serum), lymph, bone marrow fluid, saliva, sputum, swabs, aspirations, milk, urine, feces, eye fluid, semen, brain extracts, spinal fluid, joint fluid, thymus fluid, bronchial washings, ascites, or amniotic fluid.
  • biological samples e.g., cells, tissues, and body fluids
  • non-biological samples e.g., food, water, and soil
  • the biological sample can be, but is not limited to, viruses, bacteria, tissues, cells, blood (including whole blood, plasma, and serum), lymph, bone marrow fluid, saliva,
  • the sample can be obtained from a subject, particularly a mammal, more particularly a human, and can be, for example, but not limited to, a swab, saliva, sputum, aspiration, bronchoalveolar lavage (BAL), gargle or blood.
  • a subject particularly a mammal, more particularly a human
  • BAL bronchoalveolar lavage
  • the sample is whole blood, plasma or serum.
  • the above sample can be derived from a subject.
  • subject as used herein means a subject suspected of being infected with BKV and/or CMV, or a subject requiring testing or diagnosis of the pathogen, from which the target nucleic acid to be analyzed using the methods of the present disclosure is derived.
  • the subject include, but are not limited to, mammals such as dogs, cats, rodents, primates, and humans, and particularly humans.
  • the subject is a subject who has received a kidney transplant. In more certain embodiments, the subject is a subject who has received a kidney transplant less than 1 year ago.
  • the sample may be whole blood, plasma or serum collected from a subject who has received a kidney transplant, or whole blood, plasma or serum collected from a subject who has received a kidney transplant less than 1 year ago.
  • the sample may be subjected to a nucleic acid extraction and/or purification process known in the art for efficient amplification reaction (see, e.g., Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)).
  • the nucleic acid extraction and/or purification process may vary depending on the type of sample.
  • nucleic acid means a deoxyribonucleotide or ribonucleotide polymer in single-stranded or double-stranded form, which nucleotides may include derivatives of natural nucleotides, non-natural nucleotides or modified nucleotides that can function in the same manner as naturally occurring nucleotides.
  • target nucleic acid refers to a nucleic acid sequence to be detected.
  • the target nucleic acid includes not only one newly generated in the reaction, but also one initially present in the sample.
  • the target nucleic acid herein includes a target nucleic acid from BKV and a target nucleic acid from CMV, both of which are double-stranded DNA.
  • double-stranded target nucleic acids can be separated into single-stranded or partially single-stranded forms for application to the methods of the present invention.
  • Known methods for separating the strands include, but are not limited to, heating, alkali, formamide, urea and glycoxal treatment, enzymatic methods (e.g., helicase action), and binding proteins.
  • strand separation can be achieved by heating at a temperature in the range of 80°C-105°C.
  • a general method for achieving such treatment is provided by Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001).
  • BKV BK virus
  • CMV cytomegalovirus
  • the target nucleic acids are two, one of which is the VP2 gene of BKV or a portion thereof, and the other is the UL55 gene of CMV or a portion thereof.
  • the target nucleic acids are two, one of which has a sequence from nucleotide 624 to nucleotide 1679 of the BKV whole genome under Genbank Accession No. NC_001538, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, and the other of which has a sequence from nucleotide 624 to nucleotide 1679 of the BKV whole genome under Genbank Accession No.
  • NC_001538 or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more.
  • a sequence having at least 90% identity such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, to the sequence from nucleotide 82066 to nucleotide 84789 of the CMV whole genome under NC_006273.
  • the target nucleic acids are two, one of which has a sequence from nucleotide 948 to nucleotide 1108 of the BKV whole genome under Genbank Accession No. NC_001538, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, and the other of which has a sequence from nucleotide 948 to nucleotide 1108 of the BKV whole genome under Genbank Accession No.
  • NC_001538 or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more.
  • a sequence having at least 90% identity such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, to the sequence from nucleotide 82871 to nucleotide 83019 of the CMV whole genome under NC_006273.
  • target nucleic acids there are two target nucleic acids, one of which has a sequence having at least 90% identity, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, to the sequence from the 325th nucleotide to the 485th nucleotide in the VP2 gene of the BKV whole genome under Genbank Accession No. NC_001538, and the other one has a sequence having at least 90% identity, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, to the sequence.
  • a sequence having at least 90% identity such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, to the sequence from the 806th nucleotide to the 954th nucleotide in the UL55 gene of the CMV whole genome under NC_006273.
  • the target nucleic acids are two, one of which has a sequence from nucleotide 948 to nucleotide 1108 of the BKV whole genome under Genbank Accession No. NC_001538, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, and the other of which has a sequence from nucleotide 948 to nucleotide 1108 of the BKV whole genome under Genbank Accession No.
  • NC_001538 or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more.
  • a sequence having at least 90% identity such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, to the sequence from nucleotide 82871 to nucleotide 83019 of the CMV whole genome under NC_006273.
  • the target nucleic acids are two, one of which has a sequence comprising any one nucleotide selected from the group consisting of the 748th nucleotide to the 948th nucleotide to the group consisting of the 1108th nucleotide to the 1308th nucleotide in the BKV whole genome under Genbank Accession No.
  • NC_001538 or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, and the other of which has a sequence comprising any one nucleotide selected from the group consisting of the 748th nucleotide to the 948th nucleotide to the 1108th nucleotide to the 1308th nucleotide in the BKV whole genome under Genbank Accession No. NC_001538, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more.
  • a sequence comprising any one nucleotide selected from the group consisting of the 82671st nucleotide to the 82871st nucleotide in the CMV whole genome under NC_006273 to any one nucleotide selected from the group consisting of the 83019th nucleotide to the 83219th nucleotide, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more.
  • the target nucleic acids are two, one of which has a sequence comprising any one nucleotide selected from the group consisting of the 848th nucleotide to the 948th nucleotide to the group consisting of the 1108th nucleotide to the 1208th nucleotide in the BKV whole genome under Genbank Accession No.
  • NC_001538 or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, and the other of which has a sequence comprising any one nucleotide selected from the group consisting of the 848th nucleotide to the 948th nucleotide to the group consisting of the 1108th nucleotide to the 1208th nucleotide in the BKV whole genome under Genbank Accession No. NC_001538, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more.
  • a sequence comprising any one nucleotide selected from the group consisting of the 82771st nucleotide to the 82871st nucleotide in the CMV whole genome under NC_006273 to any one nucleotide selected from the group consisting of the 83019th nucleotide to the 83119th nucleotide, or a sequence having at least 90% identity thereto, for example, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more.
  • the target nucleic acids are two, one of which has a sequence comprising any one nucleotide selected from the group consisting of the 898th to the 948th nucleotide in the BKV whole genome under Genbank Accession No.
  • NC_001538 to any one nucleotide selected from the group consisting of the 1108th to the 1158th nucleotide, or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, and the other of which has a sequence comprising any one nucleotide selected from the group consisting of the 898th to the 948th nucleotide in the BKV whole genome under Genbank Accession No.
  • NC_001538 to the 1108th to the 1158th nucleotide or a sequence having at least 90% identity thereto, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more.
  • a sequence comprising any one nucleotide selected from the group consisting of the 82821st nucleotide to the 82871st nucleotide in the CMV whole genome under NC_006273 to any one nucleotide selected from the group consisting of the 83019th nucleotide to the 83069th nucleotide, or a sequence having at least 90% identity thereto, for example, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more.
  • the target nucleic acids are two, one of which has the nucleotide sequence of SEQ ID NO: 1, or a sequence having at least 90%, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identity thereto, and the other of which has the nucleotide sequence of SEQ ID NO: 5, or a sequence having at least 90%, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identity thereto.
  • there are two target nucleic acids one of which has the nucleotide sequence of SEQ ID NO: 1 and the other of which has the nucleotide sequence of SEQ ID NO: 5.
  • the present inventors confirmed that among various genes of BKV, targeting the VP2 gene, particularly the nucleotide sequence of SEQ ID NO: 1, can quantify BKV with the highest specificity and sensitivity.
  • the present inventors confirmed that among various genes of CMV, targeting the UL55 gene, particularly the nucleotide sequence of SEQ ID NO: 5, can quantify CMV with the highest specificity and sensitivity (data not shown).
  • a composition for detecting a target nucleic acid of BKV and a composition for detecting a target nucleic acid of CMV are used for simultaneous quantification of target nucleic acids from BKV and CMV.
  • composition for detecting the target nucleic acid of the above BKV is specific for the target nucleic acid of BKV, i.e., the VP2 gene
  • composition for detecting the target nucleic acid of the above CMV is specific for the target nucleic acid of CMV, i.e., UL55.
  • the composition for detecting a target nucleic acid is specific for a target nucleic acid
  • the composition for detecting a target nucleic acid is involved in detecting the target nucleic acid, but is not involved in detecting other nucleic acids.
  • the phrase means that the composition for detecting a target nucleic acid interacts with the target nucleic acid, but does not interact with other nucleic acids.
  • the composition for detecting the target nucleic acid of BKV is specific for the target nucleic acid of BKV but non-specific for the target nucleic acid of CMV
  • the composition for detecting the target nucleic acid of CMV is specific for the target nucleic acid of CMV but non-specific for the target nucleic acid of BKV.
  • composition for detecting target nucleic acids of BKV and the composition for detecting target nucleic acids of CMV used in the present invention are used together in one reaction, and therefore exist together in one reaction solution or reaction vessel.
  • composition for detecting target nucleic acid means a composition containing components used for detecting a target nucleic acid.
  • compositions for detecting the target nucleic acid examples include, but are not limited to, an oligonucleotide set used to amplify or detect the target nucleic acid, a label, a nucleic acid polymerase, a buffer, a polymerase cofactor, and dNTPs.
  • the composition for detecting the target nucleic acid may include various additional components, such as a substance for promoting a reaction, a molecule for inhibiting nucleic acid polymerase activity, a molecule for preventing contamination, and the like.
  • the composition for detecting the target nucleic acid may include oligonucleotides or reagents necessary for performing a positive control, a negative control, or an internal control reaction.
  • the composition for detecting the target nucleic acid may include a reference sample containing a known amount of a standard target nucleic acid for absolute quantification.
  • composition for detecting the target nucleic acid may be stored together in one container or divided into multiple containers prior to the reaction.
  • a composition for detecting a target nucleic acid of BKV comprises a first oligonucleotide set capable of hybridizing to the VP2 gene of BKV.
  • the first oligonucleotide set comprises a plurality of oligonucleotides hybridizable to a nucleotide sequence of SEQ ID NO: 1 or a complement thereof: 5'-GTTTCCACTGTAGGCCTCTATCAGCAATCAGGCATGGCTTTGGAATTGTTTAACCCAGATGAGTACTATGATATTCTGTTTCCTGGTGTAAATACTTTTGTTAATAATATTCAATACCTTGATCCTAGGCATTGGGGTCCTTCTTTGTTTGCTACTATTTC-3' (SEQ ID NO: 1).
  • the nucleotide sequence of SEQ ID NO: 1 is a representative example of a conserved region in the VP2 gene of BKV.
  • At least one of the plurality of oligonucleotides included in the first oligonucleotide set has 1-3 deoxyinosines; one or two of the deoxyinosines are located in a core region ranging from the 3rd nucleotide at the 3'-end to the 6th nucleotide at the 3'-end of the oligonucleotide, and the remainder are located in a region ranging from the 4th nucleotide at the 5'-end to the 7th nucleotide at the 3'-end of the oligonucleotide.
  • the method of the present invention enables more effective detection of target nucleic acids by incorporating deoxyinosine into the oligonucleotides so that some or all of the oligonucleotides in the first oligonucleotide set satisfy the above-described requirements.
  • the composition for detecting a target nucleic acid of CMV comprises a second oligonucleotide set capable of hybridizing to the UL55 gene of CMV.
  • the second oligonucleotide set comprises a plurality of oligonucleotides hybridizable to a nucleotide sequence of SEQ ID NO: 5 or a complement thereof: 5'-CAGTACGGTCAACTGGGCGAGGACAACGAAATCCTGTTGGGCAACCACCGCACTGAGGAATGTCAGCTTCCCAGCCTCAAGATCTTCATCGCCGGGAACTCGGCCTACGAGTACGTGGACTACCTCTTCAAACGCATGATTGACCTCAG-3' (SEQ ID NO: 5).
  • the nucleotide sequence of SEQ ID NO: 5 is a representative example of a conserved region in the UL55 gene of CMV.
  • At least one of the plurality of oligonucleotides included in the second oligonucleotide set has 1-3 deoxyinosines; one or two of the deoxyinosines are located in a core region ranging from the 3rd nucleotide at the 3'-terminus to the 6th nucleotide at the 3'-terminus of the oligonucleotide, and the remainder are located in a region ranging from the 4th nucleotide at the 5'-terminus to the 7th nucleotide at the 3'-terminus of the oligonucleotide.
  • each of the first oligonucleotide set and the second oligonucleotide set comprises a primer pair and a probe.
  • primer refers to an oligonucleotide that can act as an initiation point of synthesis under conditions that induce synthesis of a primer extension product complementary to a target nucleic acid (template), i.e., the presence of nucleotides and a polymerization agent such as DNA polymerase, and conditions of suitable temperature and pH.
  • template i.e., the presence of nucleotides and a polymerization agent such as DNA polymerase, and conditions of suitable temperature and pH.
  • the primer must be sufficiently long to prime the synthesis of an extension product in the presence of the polymerization agent.
  • the appropriate length of the primer is determined by a number of factors, such as temperature, application, and the source of the primer.
  • probe refers to a single-stranded nucleic acid molecule comprising a portion or portions that are substantially complementary to a target nucleic acid.
  • the 3'-end of the probe is "blocked" to prevent its extension.
  • Blocking can be accomplished by any conventional method. For example, blocking can be accomplished by adding a chemical moiety, such as biotin, a label, a phosphate group, an alkyl group, a non-nucleotide linker, a phosphorothioate, or an alkane-diol moiety, to the 3'-hydroxyl group of the last nucleotide.
  • blocking can be accomplished by removing the 3'-hydroxyl group of the last nucleotide or by using a nucleotide that lacks a 3'-hydroxyl group, such as a dideoxynucleotide.
  • “Complementary” means sufficiently complementary to allow a primer or probe to selectively hybridize to a target nucleic acid sequence under given annealing conditions or hybridization conditions, and includes both “substantially complementary” and “perfectly complementary,” preferably perfectly complementary.
  • substantially complementary means that the oligonucleotide is sufficiently complementary so that it can selectively hybridize to a template nucleic acid sequence under designated annealing or hybridization conditions such that the annealed oligonucleotide can be extended by a polymerase to form a complementary copy of the template.
  • this term has a different meaning than “fully complementary” or related terms.
  • non-complementary means sufficiently non-complementary such that a primer or probe does not selectively hybridize to a target nucleic acid sequence under specified annealing conditions or hybridization conditions, and is intended to encompass both the terms “substantially non-complementary” and “perfectly noncomplementary”, preferably completely non-complementary.
  • the primer or probe may be single-stranded.
  • the primer or probe comprises a deoxyribonucleotide, a ribonucleotide or a combination thereof.
  • the primer or probe used in the present invention may comprise a naturally occurring dNMP (i.e., dAMP, dGMP, dCMP and dTMP), a modified nucleotide or a non-natural nucleotide.
  • annealing or “priming” refers to the apposition of an oligonucleotide or nucleic acid to a template nucleic acid, which causes a polymerase to polymerize the nucleotides to form a nucleic acid molecule complementary to the template nucleic acid or a portion thereof.
  • hybridization refers to the formation of a double-stranded structure by two single-stranded polynucleotides through non-covalent bonding between complementary nucleotide sequences under certain hybridization conditions.
  • the first oligonucleotide set according to the present invention does not comprise an oligonucleotide hybridizable to the genomic sequence of JC virus or simian virus 40.
  • JC virus and simian virus 40 are known to have high genetic homology with BKV. Therefore, an oligonucleotide designed only considering the target sequence of BKV without considering the sequence having high genetic homology with BKV is likely to hybridize to the genome sequence from JC virus or simian virus 40, and may cause false positive results, for example, for a sample in which BKV is not present but JC virus or simian virus 40 is present.
  • the first oligonucleotide set according to the present invention is designed taking into account the genome sequences of both JC virus and simian virus 40 so that it does not hybridize to the genome sequences of JC virus or simian virus 40.
  • the first oligonucleotide set comprises a primer having a nucleotide sequence of SEQ ID NO: 2 or a sequence at least 90% homologous thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous thereto, and a primer having a nucleotide sequence of SEQ ID NO: 3 or a sequence at least 90% homologous thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous thereto.”
  • the two primers can have deoxyinosine (indicated by 'I') incorporated at specific positions.
  • the deoxyinosine is considered to match the naturally occurring base opposite it in the alignment.
  • the first oligonucleotide set comprises a primer having the nucleotide sequence of SEQ ID NO: 2 and a primer having the nucleotide sequence of SEQ ID NO: 3.
  • the first oligonucleotide set comprises a probe having a nucleotide sequence of SEQ ID NO: 4 or a sequence having at least 90% homology thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology thereto:
  • the probe does not contain deoxyinosine.
  • the first oligonucleotide set comprises a probe having the nucleotide sequence of SEQ ID NO: 4.
  • the first oligonucleotide set according to the present invention exhibits 100% target coverage for the VP2 gene sequences of 541 different subtypes and variants of BKV.
  • the first oligonucleotide set according to the present invention does not detect the genome sequences of 47 strains listed in Table 3 herein.
  • the first oligonucleotide set according to the present invention detects the target nucleic acid of BKV with high specificity.
  • the second oligonucleotide set according to the present invention does not comprise an oligonucleotide hybridizable to the genomic sequence of herpes simplex virus 1, human herpesvirus 2, human herpesvirus 4, human herpesvirus 6B, human herpesvirus 6, or human herpesvirus 7 virus.
  • the above herpes simplex virus 1, human herpesvirus 2, human herpesvirus 4, human herpesvirus 6B, human herpesvirus 6, and human herpesvirus 7 viruses are known to have high genetic homology with CMV. Therefore, an oligonucleotide designed only considering the target sequence of CMV without considering the sequence having high genetic homology with CMV is likely to hybridize to the genome sequence from the above herpesviruses, and may cause a false positive result, for example, for a sample in which CMV is not present but the above herpesviruses are present.
  • the first oligonucleotide set according to the present invention is designed in consideration of the genome sequences of all of the aforementioned herpesviruses so that it does not hybridize to the genome sequences of herpes simplex virus 1, human herpesvirus 2, human herpesvirus 4, human herpesvirus 6B, human herpesvirus 6, or human herpesvirus 7 viruses.
  • the second oligonucleotide set comprises a primer having a nucleotide sequence of SEQ ID NO: 6 or a sequence at least 90% homologous thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous thereto and a primer having a nucleotide sequence of SEQ ID NO: 7 or a sequence at least 90% homologous thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous thereto:
  • the two primers have deoxyinosine (indicated by 'I') incorporated at specific positions.
  • the deoxyinosine is considered to match the naturally occurring base opposite it in the alignment.
  • the second oligonucleotide set comprises a primer having the nucleotide sequence of SEQ ID NO: 6 and a primer having the nucleotide sequence of SEQ ID NO: 7.
  • the second oligonucleotide set comprises a probe having a nucleotide sequence of SEQ ID NO: 8 or a sequence having at least 90% homology thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology thereto:
  • the probe does not contain deoxyinosine.
  • the second oligonucleotide set comprises a probe having the nucleotide sequence of SEQ ID NO: 8.
  • the second oligonucleotide set according to the present invention exhibits substantially 100% target coverage for the UL55 gene sequences of 523 different subtypes and variants of CMV. Furthermore, the second oligonucleotide set according to the present invention does not detect the genomic sequences of the 47 strains listed in Table 4 herein. Thus, the second oligonucleotide set according to the present invention detects the target nucleic acid of CMV with high specificity.
  • the composition for detecting a target nucleic acid of BKV according to the present invention particularly the first oligonucleotide set, generates a signal from the fluorescent label in a manner dependent on the cleavage of an oligonucleotide that specifically hybridizes to the VP2 gene of BKV.
  • the composition for detecting a target nucleic acid of CMV according to the present invention particularly the second oligonucleotide set, generates a signal from the fluorescent label in a manner dependent on the cleavage of an oligonucleotide that specifically hybridizes to the UL55 gene of CMV.
  • generation of a signal by the first oligonucleotide set and the second oligonucleotide set can be achieved by hybridization of an oligonucleotide, e.g., a probe, to a target nucleic acid, followed by cleavage thereof.
  • an oligonucleotide e.g., a probe
  • Examples of such signal generation include, but are not limited to, TaqMan probe methods (U.S. Patent No. 5,210,015 and U.S. Patent No. 5,538,848).
  • a composition for detecting a target nucleic acid comprises a set of oligonucleotides including a primer pair and a probe, as well as a nucleic acid polymerase having 5'-nuclease activity.
  • the probe hybridized to the target nucleic acid is cleaved during amplification of the target nucleic acid to generate a signal indicating the presence of the target nucleic acid.
  • a specific example of generating a signal by the TaqMan probe method comprises the steps of: (a) hybridizing the target nucleic acid with a probe having a primer pair and an appropriate label (e.g., an interactive dual label); (b) amplifying the target nucleic acid using the product of step (a) and a nucleic acid polymerase having 5' nuclease activity; wherein the probe is cleaved to release the label; and (c) detecting signal generation from the released label.
  • an appropriate label e.g., an interactive dual label
  • Signal generation by the first oligonucleotide set and the second oligonucleotide set can be achieved by various methods known to those skilled in the art in addition to the above-described methods.
  • each of the probes included in the first oligonucleotide set and the probes included in the second oligonucleotide set comprises a detectable fluorescent label and a quenching moiety capable of quenching a signal from the fluorescent label.
  • the fluorescent label and the quenching moiety herein may be referred to as an interactive dual label, the fluorescent label may be referred to as a fluorescent reporter molecule, and the quenching moiety may be referred to as a quencher molecule.
  • a representative example of an interaction label system including the above-mentioned interactive dual labels includes a fluorescence resonance energy transfer (FRET) label system including a fluorescent reporter molecule (donor molecule) and a quencher molecule (acceptor molecule).
  • FRET fluorescence resonance energy transfer
  • the energy donor is fluorescent, but the energy acceptor can be fluorescent or non-fluorescent.
  • the interaction label system can include a dual label based on "contact-mediated quenching" (Salvatore et al., Nucleic Acids Research, 2002 (30) no.21 e122 and Johansson et al., J. AM. CHEM. SOC 2002 (124) pp 6950-6956).
  • the above-mentioned interactive label system can include any label system that induces a signal change by the interaction between at least two molecules (e.g., dyes).
  • Reporter molecules and quencher molecules useful in the present invention may include any molecules known in the art. Examples include: Cy2TM (506), YO-PROTM-1 (509), YOYOTM-1 (509), Calcein (517), FITC (518), FluorXTM (519), AlexaTM (520), Rhodamine 110 (520), Oregon GreenTM 500 (522), Oregon GreenTM 488 (524), RiboGreenTM (525), Rhodamine GreenTM (527), Rhodamine 123 (529), Magnesium GreenTM (531), Calcium GreenTM (533), TO-PROTM-1 (533), TOTO1 (533), JOE (548), BODIPY530/550 (550), Dil (565), BODIPY TMR (568), BODIPY558/568 (568), BODIPY564/570 (570), Cy3TM (570), AlexaTM 546 (570), TRITC (572), Magnesium OrangeTM (575), Phycoerythrin R&B (575), Rhodamine Phalloid
  • Suitable fluorescent molecules and suitable reporter-quencher pairs are described in various references, including: Pesce et al., editors, Fluorescence Spectroscopy (Marcel Dekker, New York, 1971); White et al., Fluorescence Analysis: A Practical Approach (Marcel Dekker, New York, 1970); Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd Edition (Academic Press, New York, 1971); Griffiths, Color AND Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, editor, Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992); Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); Haugland, R. P., Handbook of Fluorescent Probes and Research Chemicals, 6th Edition (Molecular Probes, Eugene, Oreg., 1996); U.S. Patent Nos. 3,99
  • non-fluorescent quencher molecules e.g., black quenchers or dark quenchers
  • black quenchers or dark quenchers capable of quenching fluorescence of a broad wavelength or a specific wavelength
  • the reporter comprises the donor of FRET and the quencher comprises the remaining partner (acceptor) of FRET.
  • a fluorescein dye can be used as a reporter and a rhodamine dye can be used as a quencher.
  • the interactive dual label is linked to a probe within the first oligonucleotide set.
  • the interactive dual label is linked to a probe within a second oligonucleotide set.
  • each probe in the first oligonucleotide set and the second oligonucleotide set exists in a single-stranded state of a hairpin or random coil structure, and in this case, the quencher molecule comes into proximity to the reporter molecule and quenches the signal from the reporter molecule, so that no signal is generated.
  • each of the probes hybridizes to the target nucleic acid under appropriate hybridization conditions to form a duplex, thereby dissociating the quencher molecule from the reporter molecule, thereby generating a signal by unquenching a signal from the reporter molecule, and further, as the probe is cleaved by the action of a nuclease, the separation between the quencher molecule and the reporter molecule is enhanced.
  • the fluorescent label linked to the probe included in the first oligonucleotide set is different from the fluorescent label linked to the probe included in the second oligonucleotide set. That the two fluorescent labels are different means that signals generated from the fluorescent labels can be easily distinguished using two detection channels due to substantially different signal characteristics (e.g., optical characteristics, emission wavelengths, etc.).
  • the fluorescent label linked to the probe included in the first oligonucleotide set is FAM or an equivalent thereof.
  • the fluorescent label linked to the probe included in the second oligonucleotide set is Cal Red 610 or an equivalent thereof.
  • a nucleic acid amplification reaction is performed for the VP2 gene of BKV and the UL55 gene of CMV.
  • the above nucleic acid amplification reaction is a multiplex reaction that simultaneously amplifies two target nucleic acids in one reaction vessel.
  • amplification of the target nucleic acid can be performed via polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • Polymerase chain reaction is widely used in the art to amplify target nucleic acids, and involves repeated cycles of denaturation of the target nucleic acid sequence, annealing (hybridization) between the target nucleic acid sequence and a primer, and primer extension (U.S. Patent Nos. 4,683,195, 4,683,202, and 4,800,159; Saiki et al., (1985) Science 230, 1350-1354).
  • Methods for separating the double-strands include, but are not limited to, heating, alkali, formamide, urea and glycoxal treatment, enzymatic methods (e.g., helicase action), and binding proteins.
  • separation of the strands can be accomplished by heating at a temperature in the range of 80° C. to 105° C.
  • a general method for accomplishing such treatments is provided by Joseph Sambrook, et. al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001).
  • Annealing of the primer and target nucleic acid can be carried out under suitable hybridization conditions, which are generally determined by optimization procedures. Conditions such as temperature, concentration of components, hybridization and washing times, buffer components, and their pH and ionic strength can vary depending on various factors including the length and GC content of the primer and target nucleic acid sequences. Detailed conditions for hybridization can be found in Joseph Sambrook et. al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001); and M.L.M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. N.Y. (1999).
  • the primer annealed to the target nucleic acid is extended by a template-dependent polymerase, which comprises the "Klenow" fragment of E. coli DNA polymerase I, a thermostable DNA polymerase and a bacteriophage T7 DNA polymerase.
  • a template-dependent polymerase which comprises the "Klenow" fragment of E. coli DNA polymerase I, a thermostable DNA polymerase and a bacteriophage T7 DNA polymerase.
  • the template-dependent polymerase is a thermostable DNA polymerase obtained from various bacterial species.
  • nucleic acid polymerase having nuclease activity e.g., 5’nuclease activity or 3’nuclease activity
  • nuclease activity e.g., 5’nuclease activity or 3’nuclease activity
  • Nucleic acid polymerases useful in the present invention include Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, Thermus antranikianii, Thermus caldophilus, Thermus chliarophilus, Thermus flavus, Thermus igniterrae, Thermus lacteus, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus, Thermus silvanus, Thermus species Z05, Thermus species sps 17, Thermus thermophilus, Thermotoga maritima, Thermotoga neapolitana, Thermosipho africanus, Thermococcus litoralis, Thermococcus barossi, Thermococcus gorgonarius, Thermotoga maritima, Thermotoga
  • the components required for the reaction may be provided in excess to the reaction vessel.
  • excess means an amount of each component such that the ability to achieve the desired extension is not substantially limited by the concentration of said components. It is desirable to provide the necessary cofactors such as Mg 2+ , dATP, dCTP, dGTP and dTTP to the reaction mixture in sufficient amounts to cause the desired reaction to occur.
  • an increased volume of sample can be used to increase the sensitivity of quantitation.
  • the volume of the sample used can be, but is not limited to, 5 to 15 ul, in particular 8 ul, 9 ul, 10 ul, 11 ul or 12 ul.
  • the method of the present invention may have an increased total reaction volume.
  • the total reaction volume in the nucleic acid amplification reaction according to the present invention may be, but is not limited to, 20 to 30 ul, particularly 25 ul, 26 ul, 27 ul, 28 ul, 29 ul, or 30 ul.
  • a reverse transcription step is essential prior to the annealing step, and the details thereof are disclosed in the literature [Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001); and Noonan, K. F. et al., Nucleic Acids Res. 16:10366 (1988)].
  • an oligonucleotide dT primer, a random primer or a target-specific primer capable of hybridizing to the poly A tail of mRNA can be used.
  • ligase chain reaction see Wiedmann M, et al., "Ligase chain reaction (LCR)- overview and applications.” PCR Methods and Applications 1994 Feb;3(4):S51-64
  • gap filling LCR GLCR, see WO 90/01069, European Patent No. 439182 and WO 93/00447
  • Q-beta replicase amplification see Cahill P, et al., Clin Chem., 37(9):1482-5(1991), U.S. Patent No.
  • amplification-mediated amplification e.g., European Patent No. 497272
  • NASBA nucleic acid sequence-based amplification
  • TMA transcription-mediated amplification
  • RPA recombinase polymerase amplification
  • LAMP loop-mediated isothermal amplification
  • the amplification method described above can amplify target nucleic acids through repetition of a series of reactions with or without changing the temperature.
  • the unit of amplification including repetition of the series of reactions is expressed as a "cycle.”
  • the unit of the cycle can be expressed as the number of repetitions or time depending on the amplification method.
  • detection of a signal can be performed at each cycle of amplification, at a selected subset of cycles, or at the end-point of the reaction.
  • amplification of the target nucleic acid is achieved by asymmetric PCR.
  • the ratio of the primers can be selected taking into account cleavage or hybridization of the downstream oligonucleotide.
  • the composition for detecting a target nucleic acid according to the present invention further comprises an oligonucleotide set for an internal control reaction.
  • the internal control reaction can be performed simultaneously with the nucleic acid amplification reaction of the VP2 gene of BKV and the UL55 gene of CMV according to the present invention.
  • the term "internal control" herein refers to a substance for confirming the suitability of a reaction, which confirms the presence of a target nucleic acid, the loss of a target nucleic acid during nucleic acid extraction, the presence of an inhibitory substance in an amplification reaction, etc.
  • the internal control is human hemoglobin subunit beta (HBB).
  • HBB human hemoglobin subunit beta
  • the set of oligonucleotides required for the internal control reaction comprises a primer pair and a probe that are hybridizable with the internal control.
  • the probe used in the internal control reaction comprises a detectable fluorescent label and a quenching moiety capable of quenching a signal from the fluorescent label.
  • the fluorescent label linked to the probe used in the internal control reaction is Quasar 670 or an equivalent thereof.
  • the composition for detecting a target nucleic acid according to the present invention further comprises a positive control for a positive control reaction.
  • the positive control reaction can be performed simultaneously with, before, or after the nucleic acid amplification reaction of the VP2 gene of BKV and the UL55 gene of CMV according to the present invention.
  • the positive control can be the VP2 gene of BKV described above or the UL55 gene of CMV described above.
  • the positive control can be amplified and/or detected by the first oligonucleotide set or the second oligonucleotide set according to the present invention.
  • the composition for detecting a target nucleic acid according to the present invention further comprises a negative control for a negative control reaction.
  • the negative control reaction may be performed simultaneously with, before, or after the nucleic acid amplification reaction of the VP2 gene of BKV and the UL55 gene of CMV according to the present invention.
  • the negative control may be sterile water containing no target nucleic acid, particularly ultrapure PCR grade water.
  • the composition for detecting a target nucleic acid according to the present invention further comprises UDG (Uracil DNA Glycosylase).
  • UDG can prevent carry-over contamination in which the result of a previous reaction (e.g., cDNA or an amplification product) contaminates a newly performed reaction through various routes.
  • dUTP is used instead of dTTP among dNTPs to perform a reverse transcription reaction or an amplification reaction.
  • the result (i.e., cDNA or an amplification product) thereof contains dUTP, and by treating with UDG before performing a new reaction to hydrolyze the previous result containing dUTP, carry-over contamination can be prevented.
  • heat labile UDG heat labile Uracil DNA Glycosylase
  • the heat labile UDG can include, but is not limited to, UDG derived from a cold-loving organism, such as UDG derived from psychrophilic bacteria or Atlantic cod. These enzymes have the characteristic of being rapidly and irreversibly inactivated when exposed to a temperature of 50°C or 55°C, respectively. Therefore, the heat labile UDG is inactivated before the reverse transcription reaction starts, and only removes carry-over contaminants without affecting the process of cDNA production by the reverse transcription reaction at all.
  • composition for detecting a target nucleic acid generates a signal in the presence of its corresponding target nucleic acid, and enables quantification of the target nucleic acid by detecting the generated signal.
  • a nucleic acid amplification reaction is performed under conditions in which target amplification is possible together with signal generation by a composition for detecting target nucleic acids.
  • the generation of the signal includes “signal generation or disappearance” and “signal increase or decrease” from the label.
  • the generation of the signal herein means the generation of a significant signal, i.e., a signal indicating the presence of the target nucleic acid.
  • a significant signal i.e., a signal indicating the presence of the target nucleic acid
  • a significant signal i.e., a signal indicating the presence of the target nucleic acid
  • the generation of the signal is not considered as a signal or the generation of a signal in the methods of the present invention.
  • the nucleic acid amplification reaction generates a first amplification curve representing amplification of the VP2 gene of BKV when BKV is present in the sample, and a second amplification curve representing amplification of the UL55 gene of CMV when CMV is present in the sample.
  • an amplification curve refers to a curve obtained by plotting a data set for a target nucleic acid obtained from an amplification reaction.
  • the data set includes a plurality of data points including cycle numbers and signal values.
  • a cycle refers to a unit of change in a condition in a plurality of measurements involving a change in a certain condition.
  • the change in the certain condition refers to an increase or decrease in, for example, temperature, reaction time, number of reactions, concentration, pH, number of replications of a measurement target (e.g., nucleic acid), etc.
  • a cycle may be a time or process cycle, a unit operation cycle, and a reproductive cycle.
  • the substrate decomposition degree of the enzyme is measured several times by changing the substrate concentration, and the substrate decomposition ability of the enzyme is analyzed from this. At this time, a change in a certain condition is an increase in the substrate concentration, and the unit of substrate concentration increase used is set as one cycle.
  • reaction time is a change in condition
  • unit of reaction time is set as one cycle.
  • cycle means one unit of repetition, when a reaction of a certain process is repeated or a reaction is repeated at certain time intervals.
  • one cycle means a reaction including a denaturation step of nucleic acid, annealing step of primer, and extension step of primer.
  • a change in a certain condition is an increase in the number of repetitions of the reaction, and the unit of repetition of the reaction including the above series of steps is set as one cycle.
  • signal value means a value that is quantified according to a certain scale of the level of a signal (e.g., signal intensity) measured in a cycle of a nucleic acid amplification reaction, or a modified value thereof.
  • the modified value may include a mathematically processed signal value of the measured signal value. Examples of mathematically processed signal values of actually measured signal values (i.e., signal values of a raw data set) may include logarithmic values or derivatives.
  • data point means a coordinate value that includes a cycle and a signal value.
  • data means all information that constitutes a data set. For example, each of a cycle and a signal value of an amplification reaction is data.
  • Data points obtained by the amplification reaction can be expressed as coordinate values that can be expressed in a two-dimensional rectangular coordinate system.
  • the X-axis represents the corresponding cycle number
  • the Y-axis represents the signal value measured or processed in the corresponding cycle.
  • data set means a collection of said data points.
  • the data set may be a collection of data points obtained directly through an amplification reaction performed in the presence of a set of oligonucleotides specific for a target nucleic acid, or may be a modified data set thereof.
  • the data set may be a part or all of a plurality of data points obtained by the amplification reaction, or a modified data set thereof.
  • the amplification curve according to the present invention is obtained by subtracting the background signal according to a conventionally known method.
  • step (b) of the present disclosure the amount of BKV in the sample is determined using the first amplification curve generated above, and the amount of CMV in the sample is determined using the second amplification curve generated above.
  • the amount of BKV in the sample is determined by comparing the first amplification curve generated with a standard curve generated from a reference sample containing a known amount of the VP2 gene, and the amount of CMV in the sample is determined by comparing the second amplification curve generated with a standard curve generated from another reference sample containing a known amount of the UL55 gene.
  • the standard curve for the VP2 gene and the standard curve for UL55 are prepared prior to or simultaneously with step (b).
  • a standard curve generated from a reference sample containing the VP2 gene may be referred to as a “standard curve for VP2 gene” or a “standard curve for BKV,” and a standard curve generated from a reference sample containing the UL55 gene may be referred to as a “standard curve for UL55 gene” or a “standard curve for CMV.”
  • a standard curve for the VP2 gene is obtained from nucleic acid amplification reactions using reference samples containing various known amounts of the VP2 gene.
  • a standard curve for the UL55 gene is obtained from a nucleic acid amplification reaction using another reference sample containing various known amounts of the UL55 gene.
  • the nucleic acid amplification reaction for obtaining the above standard curve is performed separately from the nucleic acid amplification reaction in the above-described step (a), and may be called a standard nucleic acid amplification reaction or a reference nucleic acid amplification reaction.
  • the standard curve for the VP gene or the standard curve for the UL55 gene can be obtained by an absolute quantification method known in the art.
  • the standard curve for the VP gene or the standard curve for the UL55 gene is obtained from the following steps: (i) obtaining an amplification curve by a nucleic acid amplification reaction using a reference sample containing a known amount of the VP gene or the UL55 gene, (ii) determining a threshold cycle (Ct) from the amplification curve, and (iii) plotting the threshold cycle against the log value of the known amount of the VP gene or the UL gene.
  • the known amount of VP2 gene or the known amount of UL55 gene used in step (i) may be a commercially or non-commercially available standard material.
  • the amount of the base of said gene can be a dilution series of the amount of said gene.
  • the dilution series of the above gene refers to a reference sample containing a series of diluted amounts of the gene, which can be prepared taking into account the amount of target nucleic acid known to be commonly present in a sample, particularly a clinical sample.
  • the reference samples containing the VP2 gene of the known amount are three or more, each comprising an amount selected from 10 1 copies/uL to 10 10 copies/uL.
  • the reference samples containing the known amount of VP2 gene include a reference sample comprising 10 3 copies/uL of VP2 gene, a reference sample comprising 10 5 copies/uL of VP2 gene, and a reference sample comprising 10 7 copies/uL of VP2 gene.
  • the other reference samples containing the known amount of the UL55 gene are three or more, each comprising an amount selected from 10 1 copies/uL to 10 10 copies/uL.
  • the other reference samples containing the known amount of UL55 gene include a reference sample comprising 10 3 copies/uL of UL55 gene, a reference sample comprising 10 5 copies/uL of UL55 gene, and a reference sample comprising 10 7 copies/uL of UL55 gene.
  • the conditions of the nucleic acid amplification reaction for the reference sample are the same as the conditions of the nucleic acid amplification reaction for the sample according to the present invention.
  • the conditions e.g., temperature, time, etc.
  • the container or the type of container (e.g., plate, etc.)
  • the device or the type of device (e.g., thermocycler, etc.) of the nucleic acid amplification reaction using the reference sample are the same as the conditions, the container and the device used of the nucleic acid amplification reaction using the sample.
  • determination of the threshold cycle (Ct) in step (ii) can be performed by various methods known in the art.
  • the above threshold cycle shows a linear correlation with the amount of target nucleic acid present in the sample.
  • a high threshold cycle indicates a small amount of target nucleic acid present in the sample, while a low threshold cycle indicates a large amount of target nucleic acid present in the sample.
  • the threshold cycle from the nucleic acid amplification reactions for a reference sample containing 10 3 copies/uL of VP2 gene, a reference sample containing 10 5 copies/uL of VP2 gene and a reference sample containing 10 7 copies/uL of VP2 gene, the reference sample containing 10 3 copies/uL of VP2 gene will exhibit the highest threshold cycle and the reference sample containing 10 7 copies/uL of VP2 gene will exhibit the lowest threshold cycle.
  • the same will apply to the reference sample of UL55.
  • the threshold cycles obtained from them may be different from each other.
  • the threshold cycle can be determined as a point where the threshold is crossed by applying a predetermined threshold to the amplification curve, or as FDM (first derivative maximum), SDM (second derivative maximum), etc. disclosed in US 6,503,720, US 6,783,934, US 10,176,293, US 8,285,489, US 7,565,250, etc.
  • FDM first derivative maximum
  • SDM second derivative maximum
  • other parameters such as Cp (crossing point), Cq (quantification cycle), ⁇ Ct, ⁇ Cp or ⁇ Cq, can be used instead of the threshold cycle.
  • each standard curve is obtained by plotting the threshold cycle against the known positive log value of the VP gene or UL gene.
  • the standard curve has the threshold cycle on the y-axis and the amount of each gene (starting amount, log value) on the x-axis.
  • each standard curve generated from the reference sample is compared with a corresponding amplification curve among the first amplification curve and the second amplification curve. That is, the first amplification curve is compared with the standard curve for the VP2 gene, and the second amplification curve is compared with the standard curve for the UL55 gene.
  • a threshold cycle is obtained from a first amplification curve for a sample, and an amount of VP2 gene (e.g., a value on the x-axis) corresponding to the threshold cycle (e.g., a value on the y-axis) is obtained from a standard curve for the VP2 gene, and the obtained amount is determined as the amount of BKV in the sample.
  • an amount of VP2 gene e.g., a value on the x-axis
  • the threshold cycle e.g., a value on the x-axis
  • the obtained amount is determined as the amount of BKV in the sample.
  • a threshold cycle is obtained from the second amplification curve, and an amount of the UL55 gene (e.g., a value on the x-axis) corresponding to the threshold cycle (e.g., a value on the y-axis) from a standard curve for the UL55 gene is obtained, and the obtained amount is determined as the amount of CMV in the sample.
  • an amount of the UL55 gene e.g., a value on the x-axis
  • the threshold cycle e.g., a value on the y-axis
  • the method of the present invention enables simultaneous quantification of BK virus (BKV) and cytomegalovirus (CMV) in a sample by using a first oligonucleotide set capable of hybridizing to the VP2 gene of BKV and a second oligonucleotide set capable of hybridizing to the UL55 gene of CMV.
  • BKV BK virus
  • CMV cytomegalovirus
  • the quantitative results according to the method of the present invention can be applied to the qualitative analysis of BKV in a sample.
  • the sample if the amount of BKV or CMV determined according to the method of the present invention for a particular sample exceeds a predetermined level, the sample is determined to be positive, whereas if the amount of BKV or CMV is less than the predetermined level, the sample is determined to be negative.
  • the sample may be determined to be positive, whereas if it is below the level, the sample may be determined to be negative.
  • the sample may be determined to be positive, whereas if it is below the level, the sample may be determined to be negative.
  • the predetermined level can be easily determined by a person skilled in the art.
  • composition for simultaneous quantification of BK virus (BKV) and cytomegalovirus (CMV) in a sample, comprising:
  • a reagent for nucleic acid amplification comprising a polymerase, dNTPs, and a buffer.
  • the composition further comprises a reference sample containing a known amount of the VP2 gene and another reference sample containing a known amount of the UL55 gene.
  • the first oligonucleotide set comprises a primer having a nucleotide sequence of SEQ ID NO: 2 or a sequence at least 90% homologous thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous thereto, and a primer having a nucleotide sequence of SEQ ID NO: 3 or a sequence at least 90% homologous thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous thereto.
  • the first oligonucleotide set comprises a probe having the nucleotide sequence of SEQ ID NO: 4 or a sequence having at least 90% homology thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology thereto.
  • the second oligonucleotide set comprises a primer having a nucleotide sequence of SEQ ID NO: 6 or a sequence having at least 90% homology thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology thereto, and a primer having a nucleotide sequence of SEQ ID NO: 7.
  • the second oligonucleotide set comprises a probe having the nucleotide sequence of SEQ ID NO: 8 or a sequence having at least 90% homology thereto, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology thereto.
  • the VP2 gene of BKV was determined as a target nucleic acid for detecting BKV.
  • a conserved region with little sequence variation was selected within the VP2 gene of BKV, and a forward primer having a nucleotide sequence of SEQ ID NO: 2 that can hybridize to the conserved region, a reverse primer having a nucleotide sequence of SEQ ID NO: 3, and a probe having a nucleotide sequence of SEQ ID NO: 4 were designed.
  • a FAM fluorescent label is linked to one end and BHQ-2 is linked to the other end.
  • the designed primers and probe are collectively referred to as the first oligonucleotide set.
  • the target coverage of the first oligonucleotide set was analyzed as follows.
  • the genome sequence of BKV (taxonomy ID: 1891762) was collected from the NCBI database. As a result of the collection, a total of 541 target nucleic acid sequences were collected. Thereafter, the sequence of SEQ ID NO: 2, the sequence of SEQ ID NO: 3, and the sequence of SEQ ID NO: 4 in the first oligonucleotide set were compared with each of the collected target nucleic acid sequences to determine the number of mismatches.
  • the above table shows the number of target nucleic acids having 0, 1, 2, 3, 4, 5, 6, 7 and 8 mismatched nucleotides for the sequences of SEQ ID NOS: 2, 3 and 4, respectively.
  • each of the sequences of SEQ ID NOS: 2, 3 and 4 was found to have 0 mismatches with all 541 target nucleic acids, which proves that the primers and probes of SEQ ID NOS: 2, 3 and 4 according to the present invention have 100% match with the collected 541 genome sequences of BKV, thus exhibiting 100% target coverage.
  • the UL55 gene of CMV was determined as a target nucleic acid for detecting CMV.
  • a conserved region with little sequence variation within the UL55 gene of CMV was selected, and a forward primer having a nucleotide sequence of SEQ ID NO: 6 that can hybridize to the conserved region, a reverse primer having a nucleotide sequence of SEQ ID NO: 7, and a probe having a nucleotide sequence of SEQ ID NO: 8 were designed.
  • a Cal Red 610 fluorescent label is linked to one end and BHQ-2 is linked to the other end.
  • the designed primers and probe are collectively referred to as the second oligonucleotide set.
  • the target coverage of the second oligonucleotide set was analyzed as follows.
  • the genome sequence of CMV (taxonomy ID: 10359) was collected from the NCBI database. As a result of the collection, a total of 523 target nucleic acid sequences were collected. Thereafter, the sequence of SEQ ID NO: 6, the sequence of SEQ ID NO: 7, and the sequence of SEQ ID NO: 8 in the second oligonucleotide set were compared with each of the collected target nucleic acid sequences to determine the number of mismatches.
  • the above table shows the number of target nucleic acids having 0, 1, 2, 3, 4, 5, 6, 7 and 8 mismatched nucleotides for the sequences of SEQ ID NO: 6, 7 and 8, respectively.
  • the sequence of SEQ ID NO: 6 was found to have 0 mismatches for all 523 target nucleic acids, and therefore, the sequence exhibited 100% target coverage.
  • the sequences of SEQ ID NOs: 7 and 8 were found to have 0 mismatches for 521 of the 523 target nucleic acids, and 1 mismatch for 2 target nucleic acids. Since the sequences of SEQ ID NOs: 7 and 8 are expected to be capable of hybridizing even to a target nucleic acid having 1 mismatch, it was confirmed that the primers and probes of SEQ ID NOs: 6, 7, and 8 according to the present invention exhibited substantially 100% target coverage.
  • JC virus and simian virus 40 which belong to polyomavirus and have high genetic homology with BK virus, and other strains known to exist in humans but which should not be detected by the first oligonucleotide set according to the present invention.
  • a reaction mixture for real-time PCR was prepared by mixing 10 ⁇ l of genomic DNA of each of the 47 strains, 6.25 ⁇ l of the first oligonucleotide set designed in Example 1, 6.25 ⁇ l of 4X Master mix (final, 200 uM dNTPs, 2 mM MgCl 2 , 2 U of Taq DNA polymerase, 0.1 U of UDG), and 2.5 ⁇ l of distilled water.
  • the presence or absence of each target nucleic acid was determined by applying a predetermined threshold to the above amplification curve.
  • the first oligonucleotide set according to the present invention was found not to detect other clinically important strains, including JC virus and simian virus 40, which have high genetic homology with BKV, demonstrating the high target specificity of the first oligonucleotide set according to the present invention.
  • herpes simplex virus 1 (strain: MacIntyre), which belongs to the herpesvirus family and has high genetic homology with CMV virus, human herpesvirus 2, human herpesvirus 4 Epstein-Barr virus (EBV), human herpesvirus 6B, human herpesvirus 6, and human herpesvirus 7 virus (SB strain), and other strains known to exist in humans but which should not be detected by the second oligonucleotide set according to the present invention.
  • strain MacIntyre
  • EBV Epstein-Barr virus
  • SB strain human herpesvirus 7 virus
  • a reaction mixture for real-time PCR was prepared by mixing 10 ⁇ l of genomic DNA of each of the 47 strains, 6.25 ⁇ l of the second oligonucleotide set designed in Example 1, 6.25 ⁇ l of 4X Master mix (final, 200 uM dNTPs, 2 mM MgCl 2 , 2 U of Taq DNA polymerase, 0.1 U of UDG), and 2.5 ⁇ l of distilled water.
  • the presence or absence of each target nucleic acid was determined by applying a predetermined threshold to the above amplification curve.
  • the second oligonucleotide set according to the present invention was found not to detect other clinically important strains, including herpes simplex virus 1 (strain: MacIntyre), human herpesvirus 2, human herpesvirus 4 Epstein-Barr virus (EBV), human herpesvirus 6B, human herpesvirus 6 and human herpesvirus 7 virus (SB strain), which have high genetic homology with CMV, demonstrating the high target specificity of the second oligonucleotide set according to the present invention.
  • strain MacIntyre
  • human herpesvirus 2 human herpesvirus 4 Epstein-Barr virus
  • EBV Epstein-Barr virus
  • human herpesvirus 6B human herpesvirus 6
  • human herpesvirus 7 virus SB strain
  • Genomic DNA was extracted from the above plasma sample using the QIAsymphony DSP Virus/pathogen Midi Kit (Qiagen, Cat. No. 937055). The extracted genomic DNA was then subjected to real-time PCR as described in Example 1 to obtain a first amplification curve.
  • the Ct value was calculated by applying RFU 300 as a threshold to the first amplification curve.
  • the amount of BKV was calculated by substituting the Ct value from the first amplification curve into the standard curve for the VP2 gene of BKV prepared in advance.
  • the sample was determined to be positive, and if it was below the level, the sample was determined to be negative.
  • Genomic DNA was extracted from the plasma sample using the QIAsymphony DSP Virus/pathogen Midi Kit (Qiagen, Cat. No. 937055). The extracted genomic DNA was then subjected to real-time PCR as described in Example 1 to obtain a second amplification curve.
  • the Ct value was calculated by applying RFU 300 as a threshold to the second amplification curve.
  • the amount of CMV was calculated by substituting the Ct value from the second amplification curve into the standard curve for the UL55 gene of CMV prepared in advance.
  • the sample was determined to be positive, and if it was below the level, the sample was determined to be negative.
  • real-time PCR using the second oligonucleotide set according to the present invention determined all 33 positive samples for CMV as positive, 92 out of 97 negative samples for CMV were determined as negative, but 5 were determined as positive.
  • the method according to the present invention enables more accurate simultaneous diagnosis of BKV and CMV with high sensitivity and specificity.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 샘플 내의 BK 바이러스(BKV) 및 사이토메갈로바이러스(CMV)의 정량을 위한 멀티플렉싱 분석 방법에 관한 것이다. 본 발명은 하나의 반응으로 샘플 내의 BKV 및 CMV를 동시에 정량할 수 있으므로, 샘플 양의 감소, 검사 시간 단축, 검사 장비 및 투여 인력의 단축 등의 검사 비용 절감 효과를 나타낸다. 또한, 본 발명의 방법에 사용되는 올리고뉴클레오타이드 세트는 높은 민감도 및 특이도로 보다 정확한 BKV 및 CMV의 진단을 가능하게 한다. 나아가, 본 발명의 방법은 신장 이식 환자에서 기회 감염의 진단율을 높이고 장기적으로 이식 장기와 환자의 생존율 향상에 기여할 수 있다.

Description

샘플 내의 BK 바이러스 및 사이토메갈로바이러스의 동시 정량 방법
본 발명은 샘플 내의 BK 바이러스(BKV) 및 사이토메갈로바이러스(CMV)의 동시 정량 방법에 관한 것이다.
인간 폴리오마바이러스 유형 BK 바이러스는 약 5,300 bp의 원형, 이중 가닥의 DNA 게놈을 가진 비외피 바이러스이다. 상기 게놈은 3개의 캡시드 구조 단백질, 즉 바이러스 캡시드 단백질 1(VP1), VP2 및 VP3뿐만 아니라 큰 T 및 작은 t 항원을 코딩한다.
BK 바이러스는 1971년에 "B.K."라는 이니셜을 갖는 요관 협착증(ureteric stenosis) 환자에서 신장 이식 후 소변으로부터 처음으로 분리되었다. BK 바이러스 감염은 널리 퍼져 있지만, 감염된 개인은 일반적으로 무증상이거나 약한 증상(예컨대, 호흡기 감염 또는 열)만을 나타낸다. 초기 감염 후, BK 바이러스는 전형적으로 요상피(uroepithelium) 및 신장 관상 상피 세포에서 잠복한다. 인구의 80% 이상이 이러한 잠복기 형태의 바이러스를 함유하고 있다고 여겨진다.
그러나, 면역억제되고/거나 면역손상된 개인에 대한 BK 바이러스 감염의 증상은, 예를 들어, 장기 이식의 환경에서 상당히 심각하다. 장기 이식의 경우, 임상적 발현은 신장 기능장애와 소변 내에 신장 관형 세포 및 염증성 세포의 존재를 포함할 수 있다. 특히, 면역억제 및/또는 면역손상 환경에서, BK 바이러스는 재활성화하고 복제하여, 관형 세포 용해 및 바이러스뇨(viruria)로부터 시작하는 일련의 사건을 촉발한다. 이후, BK 바이러스는 간질(interstitium)에서 증폭하고 관주위 모세혈관을 가로질러, 바이러스혈증(viremia)을 유발하고 결국 동종이식편을 침범하여, 다양한 관 간질성 병변(tubulointerstitial lesion) 및 BK 바이러스 신병증(BK virus Nephrophathy, BKVN)을 야기한다. BK 바이러스는 이식편 손실 가능성을 크게 높인다. BK 바이러스는 이식후 기회감염적 바이러스 감염이며, 이식후 첫해에 신장 이식 환자의 약 15%에 영향을 미친다. 치료되지 않으면, BKVN이 동종이식 실패로 진행될 것이다.
면억억제 및/또는 면역손상이 BK 바이러스 감염의 주 위험 인자이지만, 남성 성별, 고령, 이전 거부 에피소드, 인간 백혈구 항원 미스매칭 정도, 장기간 냉 허혈(cold ischemia) 시간, BK 혈청상태, 및 요관 스텐트 배치와 같은 다른 위험 인자가 있다. 증상이 있는 BK 바이러스 감염 환자를 위한 치료 옵션은 제한적이며, 효과적인 예방은 없다. 치료의 초석은 면역억제를 감소시키는 것인데, 이는 동종이식편 거부 위험을 증가시킨다. 항바이러스 약물이 사용되지만, 결과가 일관성이 없다. BK 바이러스는 현재 신장이식 환자에서 간질 신염 및 동종이식 실패의 주 원인으로 인식된다.
BK 바이러스 감염은 BK 바이러스 혈액 검사나 데코이(decoy) 세포에 대한 소변 검사에 의해 진단된다. 데코이 세포의 존재는 민감한 척도이긴 하지만, BKVN의 진단에서 낮은 양성 예측값을 갖는다(Mbianda, et al. Journal of Clinical Virology 71:59-62 (2015) 참조). DNA나 mRNA를 이용하여 혈장 및 소변에서 바이러스 부하를 정량하는 방법이 BKVN을 진단하는 데 사용되어 왔다. 그러나, 이식 신장 생검이 여전히 BKVN을 진단하는 표준이다. 하지만, 이식 신장 생검은 시간 소모적이고, 침습적이며, 번거로운 절차이다.
사이토메갈로바이러스(CMV)는 약 236,000 kb의 선형, 이중 가닥 DNA 게놈을 갖는 유비쿼터스 헤르페스 유형 바이러스이다. CMV는 사춘기 전에 인간의 40-80%를 감염시킨다. CMV는 1차 감염 후에 잠복하며 종종 무증상이다. 심지어 재감염도 대부분의 경우 무증상이거나 면역능력이 있는 숙주에서 약한 질병만을 일으킨다. 그러나, 선천적으로 감염된 유아 및 동종 이식 환자나 자가면역 결핍 증후군(AIDS) 환자와 같은 면역손상된 환자에서, CMV는 심각하고 때로는 생명을 위협하는 질환, 예컨대 망막염, 위장 장애 및 뇌염을 유발할 수 있다. 동종 줄기 세포 수여자의 절반이 이식 후 100일 내에 CMV 감염에 걸린다. CMV 말단-기관 질환은 동종 줄기 세포 이식의 심각하고 빈번한 합병증이다.
항 바이러스 약물(예컨대, 간시클로비르 및 포스카넷)의 조기 투여가 환자의 예후에 상당히 유익한 영향을 미칠 수 있으므로, 조기 및 민감한 진단이 상당히 중요하다.
CMV를 분석하기 위해 다양한 방법이 사용되고 있다. CMV 감염을 위한 마커로서 항-CMV 항체, 특히 IgM 항체가 사용될 수 있다. 그러나, 항-CMV 항체의 검출은 잠복 및 활성 감염의 구별에서 제한적이다.
가장 최근에 이용된 바이러스 검출 방법은 감염이 증상을 보일지 여부를 명확하게 예측할 수 없다. 혈청학적 방법은 간접적이며 종종 민감도가 부족하다. 혈구로부터의 바이러스 배양과 같은 바이러스 배양은 CMV 바이러스혈증에 대한 보다 직접적인 진단 파라미터이지만, 상기 방법은 기술적으로 어렵고 시간이 오래 걸린다. 더욱이, 바이러스 배양이 반드시 CMV 질환에 상응하지는 않는다. 말초 백혈구로부터 바이러스를 분리하는 것은 일부 면역억제된 환자에서 임상적 증상을 예측하지 못할 수 있다.
전술한 바와 같이, 건강한 성인의 대부분은 낮은 수치의 BK 바이러스 및 CMV 바이러스를 갖는 반면, 신장 이식 환자에서 면역억제제의 사용시 상기 바이러스들은 활성화되거나 기회 감염되어 높은 수치를 나타낼 수 있다. 따라서, 생물학적 샘플에서 BK 바이러스와 CMV 바이러스를 동시에 정량하기 위한 신속하고, 신뢰성 있고, 민감한 방법이 당업계에 필요하다.
명세서 전체에 걸쳐 다수의 인용문헌 및 특허 문헌이 참조되고 그 인용이 표시되어 있다. 인용된 문헌 및 특허의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 발명자들은 보다 향상된 민감도 및 특이도로 샘플 내의 BKV와 CMV를 동시에 정량할 수 있는 신규한 방법을 개발하고자 노력하였다. 그 결과, 본 발명자들은 BKV의 VP2 유전자에 혼성화가능한 제1 올리고뉴클레오타이드 세트 및 CMV의 UL55 유전자에 혼성화가능한 제2 올리고뉴클레오타이드 세트를 사용한 방법에 의해 하나의 반응에서 샘플 내의 BKV 및 CMV를 효과적으로 동시에 정량할 수 있음을 확인하였다.
따라서, 본 발명의 목적은 샘플 내의 BK 바이러스(BKV) 및 사이토메갈로바이러스(CMV)의 동시 정량 방법을 제공하는 것이다.
본 발명의 다른 목적은 샘플 내의 BK 바이러스(BKV) 및 사이토메갈로바이러스(CMV)의 동시 정량 방법을 위한 조성물을 제공하는 것이다.
본 발명의 다른 목적 및 이점은 첨부한 청구범위와 함께 하기의 상세한 설명에 의해 보다 명확해질 것이다.
본 발명의 일 양태에서, 하기 단계를 포함하는, 샘플 내의 BK 바이러스(BKV) 및 사이토메갈로바이러스(CMV)의 동시 정량 방법이 제공된다:
(a) 단일 반응 용기에서 샘플을 BKV의 VP2 유전자에 혼성화가능한 제1 올리고뉴클레오타이드 세트 및 CMV의 UL55 유전자에 혼성화가능한 제2 올리고뉴클레오타이드 세트와 접촉시키는 것을 포함하는 핵산 증폭 반응을 수행하는 단계로서, 상기 핵산 증폭 반응은 샘플 내에 BKV의 존재시 BKV의 VP2 유전자의 증폭을 나타내는 제1 증폭 곡선을 생성하고, 샘플 내에 CMV의 존재시 CMV의 UL55 유전자의 증폭을 나타내는 제2 증폭 곡선을 생성하며; 및
(b) 상기 생성된 제1 증폭 곡선을 기지의 양의 VP2 유전자를 함유하는 참조 샘플로부터 생성된 표준 곡선과 비교하여 상기 샘플 내의 BKV의 양을 결정하고, 상기 생성된 제2 증폭 곡선을 기지의 양의 UL55 유전자를 함유하는 또 다른 참조 샘플로부터 생성된 표준 곡선과 비교하여 상기 샘플 내의 CMV의 양을 결정하는 단계.
특정 구현예에서, 상기 제1 올리고뉴클레오타이드 세트는 서열번호: 1의 뉴클레오타이드 서열 또는 이의 보체에 혼성화가능한 복수의 올리고뉴클레오타이드를 포함한다.
특정 구현예에서, 상기 복수의 올리고뉴클레오타이드 중 적어도 하나는 1-3개의 데옥시이노신을 갖고; 상기 데옥시이노신 중 1개 또는 2개는 올리고뉴클레오타이드의 3'-말단에 있는 3번째 뉴클레오타이드 내지 6번째 뉴클레오타이드 범위의 코어 영역에 위치하며, 나머지는 올리고뉴클레오타이드의 5'-말단에 있는 4번째 뉴클레오타이드 내지 3'-말단에 있는 7번째 뉴클레오타이드 범위의 영역에 위치한다.
특정 구현예에서, 상기 제1 올리고뉴클레오타이드 세트는 JC 바이러스 또는 시미안 바이러스 40의 게놈 서열에 혼성화가능한 올리고뉴클레오타이드를 포함하지 않는다.
특정 구현예에서, 상기 제1 올리고뉴클레오타이드 세트는 서열번호: 2의 뉴클레오타이드 서열을 갖는 프라이머 및 서열번호: 3의 뉴클레오타이드 서열을 갖는 프라이머를 포함한다.
특정 구현예에서, 상기 제1 올리고뉴클레오타이드 세트는 서열번호: 4의 뉴클레오타이드 서열을 갖는 프로브를 포함한다.
특정 구현예에서, 상기 프로브는 검출가능한 형광 표지 및 상기 형광 표지로부터의 시그널을 퀀칭할 수 있는 퀀칭 모이어티를 포함한다.
특정 구현예에서, 상기 제2 올리고뉴클레오타이드 세트는 서열번호: 5의 뉴클레오타이드 서열 또는 이의 보체에 혼성화가능한 복수의 올리고뉴클레오타이드를 포함한다.
특정 구현예에서, 상기 복수의 올리고뉴클레오타이드 중 적어도 하나는 1-3개의 데옥시이노신을 갖고; 상기 데옥시이노신 중 1개 또는 2개는 올리고뉴클레오타이드의 3'-말단에 있는 3번째 뉴클레오타이드 내지 6번째 뉴클레오타이드 범위의 코어 영역에 위치하며, 나머지는 올리고뉴클레오타이드의 5'-말단에 있는 4번째 뉴클레오타이드 내지 3'-말단에 있는 7번째 뉴클레오타이드 범위의 영역에 위치한다.
특정 구현예에서, 상기 제2 올리고뉴클레오타이드 세트는 헤르페스 심플렉스 바이러스 1, 인간 헤르페스바이러스 2, 인간 헤르페스바이러스 4, 인간 헤르페스바이러스 6B, 인간 헤르페스바이러스 6, 또는 인간 헤르페스 7 바이러스의 게놈 서열에 혼성화가능한 올리고뉴클레오타이드를 포함하지 않는다.
특정 구현예에서, 상기 제2 올리고뉴클레오타이드 세트는 서열번호: 6의 뉴클레오타이드 서열을 갖는 프라이머 및 서열번호: 7의 뉴클레오타이드 서열을 갖는 프라이머를 포함한다.
특정 구현예에서, 상기 제2 올리고뉴클레오타이드 세트는 서열번호: 8의 뉴클레오타이드 서열을 갖는 프로브를 포함한다.
특정 구현예에서, 상기 프로브는 검출가능한 형광 표지 및 상기 형광 표지로부터의 시그널을 퀀칭할 수 있는 퀀칭 모이어티를 포함한다.
특정 구현예에서, 상기 핵산 증폭 반응은 실시간 PCR 또는 등온 증폭 반응이다.
특정 구현예에서, 상기 기지의 양의 VP2 유전자를 함유하는 참조 샘플은 각각 101 copies/uL 내지 1010 copies/uL로부터 선택된 양을 포함하는 3개 이상이다.
특정 구현예에서, 상기 기지의 양의 UL55 유전자를 함유하는 또 다른 참조 샘플은 각각 101 copies/uL 내지 1010 copies/uL로부터 선택된 양을 포함하는 3개 이상이다.
특정 구현예에서, 상기 샘플은 신장 이식을 받은 대상체로부터 채취한 전혈, 혈장 또는 혈청이다.
특정 구현예에서, 상기 대상체는 신장 이식을 받은 후 1년 이하이다.
특정 구현예에서, 상기 샘플은 5 내지 15 ul의 부피를 가지며, 상기 핵산 증폭 반응의 총 부피는 20 내지 30 ul이다.
다른 양태에 따르면, 본 발명은 하기를 포함하는, 샘플 내의 BK 바이러스(BKV) 및 사이토메갈로바이러스(CMV)의 동시 정량을 위한 조성물을 제공한다:
(a) BKV의 VP2 유전자에 혼성화가능한 제1 올리고뉴클레오타이드 세트;
(b) CMV의 UL55 유전자에 혼성화가능한 제2 올리고뉴클레오타이드 세트; 및
(c) 중합효소, dNTPs, 및 버퍼를 포함하는 핵산 증폭용 시약.
특정 구현예에서, 상기 조성물은 기지의 양의 VP2 유전자를 함유하는 참조 샘플 및 기지의 양의 UL55 유전자를 함유하는 또 다른 참조 샘플을 추가로 포함한다.
특정 구현예에서, 상기 제1 올리고뉴클레오타이드 세트는 서열번호: 2의 뉴클레오타이드 서열을 갖는 프라이머 및 서열번호: 3의 뉴클레오타이드 서열을 갖는 프라이머를 포함한다.
특정 구현예에서, 상기 제1 올리고뉴클레오타이드 세트는 서열번호: 4의 뉴클레오타이드 서열을 갖는 프로브를 포함한다.
특정 구현예에서, 상기 제2 올리고뉴클레오타이드 세트는 서열번호: 6의 뉴클레오타이드 서열을 갖는 프라이머 및 서열번호: 7의 뉴클레오타이드 서열을 갖는 프라이머를 포함한다.
특정 구현예에서, 상기 제2 올리고뉴클레오타이드 세트는 서열번호: 8의 뉴클레오타이드 서열을 갖는 프로브를 포함한다.
본 발명의 방법은 하나의 반응으로 샘플 내의 BKV 및 CMV를 동시에 정량할 수 있으므로, 샘플 양의 감소, 검사 시간 단축, 검사 장비 및 투여 인력의 단축 등의 검사 비용 절감 효과를 나타낸다. 또한, 본 발명의 방법에 사용되는 올리고뉴클레오타이드 세트는 높은 민감도 및 특이도로 보다 정확한 BKV 및 CMV의 진단을 가능하게 한다. 나아가, 본 발명의 방법은 신장 이식 환자에서 기회 감염의 진단율을 높이고 장기적으로 이식 장기와 환자의 생존율 향상에 기여할 수 있다.
I. 동시 정량 방법
일 양태에 따르면, 본 발명은 하기 단계를 포함하는, 샘플 내의 BK 바이러스(BKV) 및 사이토메갈로바이러스(CMV)의 동시 정량 방법을 제공한다:
(a) 단일 반응 용기에서 샘플을 BKV의 VP2 유전자에 혼성화가능한 제1 올리고뉴클레오타이드 세트 및 CMV의 UL55 유전자에 혼성화가능한 제2 올리고뉴클레오타이드 세트와 접촉시키는 것을 포함하는 핵산 증폭 반응을 수행하는 단계로서, 상기 핵산 증폭 반응은 샘플 내에 BKV의 존재시 BKV의 VP2 유전자의 증폭을 나타내는 제1 증폭 곡선을 생성하고, 샘플 내에 CMV의 존재시 CMV의 UL55 유전자의 증폭을 나타내는 제2 증폭 곡선을 생성하며; 및
(b) 상기 생성된 제1 증폭 곡선을 기지의 양의 VP2 유전자를 함유하는 참조 샘플로부터 생성된 표준 곡선과 비교하여 상기 샘플 내의 BKV의 양을 결정하고, 상기 생성된 제2 증폭 곡선을 기지의 양의 UL55 유전자를 함유하는 또 다른 참조 샘플로부터 생성된 표준 곡선과 비교하여 상기 샘플 내의 CMV의 양을 결정하는 단계.
이하, 각 단계에 따라 본 개시의 내용을 보다 상세하게 설명한다:
단계 (a): 핵산 증폭 반응의 수행
본 개시의 단계 (a)에서는, BKV 및 CMV의 타겟 핵산에 대한 핵산 증폭 반응을 수행한다.
구체적으로, 단일 반응 용기에서 샘플을 BKV의 VP2 유전자에 혼성화가능한 제1 올리고뉴클레오타이드 세트 및 CMV의 UL55 유전자에 혼성화가능한 제2 올리고뉴클레오타이드 세트와 접촉시키는 것을 포함하는 핵산 증폭 반응이 수행된다.
본 발명의 방법에 따르면, BKV의 타겟 핵산을 증폭시키기 위한 과정과 CMV의 타겟 핵산을 증폭시키기 위한 과정이 하나의 반응 용기에서 하나의 반응에 의해 동시에 발생할 뿐만 아니라 이들의 결과물도 함께 제공된다. 따라서, 본 발명의 방법은 "멀티플렉스 분석", "멀티플렉스 반응", "멀티플렉스 증폭" 등의 용어로도 지칭된다.
본원에서 사용된 용어 "용기(vessel, container, carrier)" 또는 "반응 용기"는 상기 BKV 및 CMV에 대한 핵산 증폭 반응에 사용되는 구성요소들이 수용되는 물리적 구획 또는 공간을 지칭한다.
상기 용기의 비제한적인 예는 튜브, 플레이트 등을 포함한다. 상기 용기는, 예를 들어 캡에 의해 또는 적합한 실링 머신을 통한 필름에 의해 밀봉될 수 있다.
특정 구현예에서, "단일 반응 용기"는 웰 플레이트, 예컨대 48-웰 플레이트, 96-웰 플레이트, 192-웰 플레이트, 또는 384-웰 플레이트에서의 하나의 웰이다.
본원에서 사용되는 용어 "샘플"은 검출하고자 하는 핵산을 포함하거나 포함하고 있을 것으로 의심되는 임의의 분석 물질을 의미할 수 있다. 예컨대, 상기 샘플은 생물학적 샘플(예컨대, 세포, 조직 및 체액) 및 비생물학적 샘플(예컨대, 음식물, 물 및 토양)을 포함하며, 상기 생물학적 샘플은 예컨대, 바이러스, 세균, 조직, 세포, 혈액(전혈, 혈장 및 혈청 포함), 림프, 골수액, 타액, 객담(sputum), 도말물(swab), 흡인액(aspiration), 우유, 소변, 분변, 안구액, 정액, 뇌 추출물, 척수액, 관절액, 흉선액, 기관지 세척액, 복수 또는 양막액일 수 있으나, 이에 한정되는 것은 아니다.
일 구현예에 따르면, 상기 샘플은 대상체, 특히 포유동물, 보다 특히 인간으로부터 얻을 수 있으며, 예를 들어, 도말물(swab), 타액(saliva), 객담(sputum), 흡인액(aspiration), 기관지폐포세척(bronchoalveolar lavage; BAL), 가글(gargle) 또는 혈액일 수 있으나, 이에 한정되는 것은 아니다.
특정 구현예에 있어서, 상기 샘플은 전혈, 혈장 또는 혈청이다.
상기 샘플은 대상체로부터 유래될 수 있다. 본 명세서에서 사용되는 용어 "대상체(subject)"는 본 개시의 방법을 이용하여 분석하고자 하는 타겟 핵산이 유래된 병원체, 즉 BKV 및/또는 CMV에 감염되었을 것으로 의심되는 개체 또는 상기 병원체의 검사 또는 진단을 필요로 하는 개체를 의미한다. 상기 대상체의 예는 비제한적으로 개, 고양이, 설치류, 영장류, 인간 등의 포유동물을 들 수 있으며, 특히 인간이다.
특정 구현예에서, 대상체는 신장 이식을 받은 대상체이다. 보다 특정 구현예에서, 대상체는 신장 이식을 받은 후 1년 이하의 대상체이다.
상기 대상체의 맥락에서, 상기 샘플은 신장 이식을 받은 대상체로부터 채취한 전혈, 혈장 또는 혈청, 또는 신장 이식을 받은 후 1년 이하의 대상체로부터 채취한 전혈, 혈장 또는 혈청일 수 있다.
일 구현예에 따르면, 상기 샘플은 효율적인 증폭 반응을 위해 본 기술분야에서 공지된 핵산 추출(nucleic acid extraction) 및/또는 정제 과정을 거칠 수 있다(참조: Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press(2001)). 상기 핵산 추출 및/또는 정제 과정은 샘플의 종류에 따라 달라질 수 있다.
본 명세서에서 사용되는 용어 "핵산", "핵산 서열" 또는 "핵산 분자"는 단일-가닥 형태 또는 이중-가닥 형태의 디옥시리보뉴클레오타이드 또는 리보뉴클레오타이드 폴리머를 의미하며, 상기 뉴클레오타이드는 자연(naturally occurring) 뉴클레오타이드와 동일한 방식으로 기능(function)할 수 있는 자연 뉴클레오타이드의 유도체, 비-자연 뉴클레오타이드 또는 변형 뉴클레오타이드를 포함할 수 있다.
본 명세서에서 사용되는 용어 "타겟 핵산", "타겟 핵산 서열" 또는 "타겟 서열"은 검출하고자 하는 핵산 서열을 의미한다. 상기 타겟 핵산은 반응에서 새롭게 생성된 것뿐만 아니라 샘플 내에 초기에 존재하는 것을 포함한다.
본원에서 타겟 핵산은 BKV로부터의 타겟 핵산 및 CMV로부터의 타겟 핵산을 포함하며, 이들은 모두 이중 가닥의 DNA이다. 이러한 이중 가닥의 타겟 핵산은 본 발명의 방법에 적용하기 위해 단일-가닥 또는 부분적 단일-가닥 형태로 분리될 수 있다. 상기 가닥을 분리하기 위한 알려진 방법은 가열, 알칼리, 포름아미드, 우레아 및 글리콕살 처리, 효소적 방법(예, 헬리카아제 작용) 및 결합 단백질을 포함하나, 이에 한정되는 것은 아니다. 예를 들어, 가닥 분리는 80℃-105℃의 온도 범위에서 가열하여 달성될 수 있다. 이러한 처리를 달성하기 위한 일반적인 방법은 문헌[Joseph Sambrook, 등, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001)]에 의해 제공된다.
일 구현예에 따르면, 타겟 핵산은 2개이며, 그 중 하나는 BK 바이러스(BKV)로부터의 핵산이고, 다른 하나는 사이토메갈로바이러스(CMV)로부터의 핵산이다.
특정 구현예에서, 타겟 핵산은 2개이며, 그 중 하나는 BKV의 VP2 유전자 또는 이의 일부이고, 다른 하나는 CMV의 UL55 유전자 또는 이의 일부이다.
특정 구현예에서, 타겟 핵산은 2개이며, 그 중 하나는 Genbank Accession No. NC_001538 하의 BKV 전체 게놈에서의 624번째 뉴클레오타이드부터 1679번째 뉴클레오타이드까지의 서열, 또는 이에 대해 90% 이상, 예컨대 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 또는 그 초과의 동일성(identity)을 갖는 서열을 갖고, 다른 하나는 Genbank Accession No. NC_006273 하의 CMV 전체 게놈에서의 82066번째 뉴클레오타이드부터 84789번째 뉴클레오타이드까지의 서열, 또는 이에 대해 90% 이상, 예컨대 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 또는 그 초과의 동일성을 갖는 서열을 갖는다.
특정 구현예에서, 타겟 핵산은 2개이며, 그 중 하나는 Genbank Accession No. NC_001538 하의 BKV 전체 게놈에서의 948번째 뉴클레오타이드부터 1108번째 뉴클레오타이드까지의 서열, 또는 이에 대해 90% 이상, 예컨대 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 또는 그 초과의 동일성을 갖는 서열을 갖고, 다른 하나는 Genbank Accession No. NC_006273 하의 CMV 전체 게놈에서의 82871번째 뉴클레오타이드부터 83019번째 뉴클레오타이드까지의 서열, 또는 이에 대해 90% 이상, 예컨대 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 또는 그 초과의 동일성을 갖는 서열을 갖는다.
다시 말하면, 타겟 핵산은 2개이며, 그 중 하나는 Genbank Accession No. NC_001538 하의 BKV 전체 게놈 중 VP2 유전자에서의 325번째 뉴클레오타이드부터 485번째 뉴클레오타이드까지의 서열, 또는 이에 대해 90% 이상, 예컨대 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 또는 그 초과의 동일성을 갖는 서열을 갖고, 다른 하나는 Genbank Accession No. NC_006273 하의 CMV 전체 게놈 중 UL55 유전자에서의 806번째 뉴클레오타이드부터 954번째 뉴클레오타이드까지의 서열, 또는 이에 대해 90% 이상, 예컨대 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 또는 그 초과의 동일성을 갖는 서열을 갖는다.
특정 구현예에서, 타겟 핵산은 2개이며, 그 중 하나는 Genbank Accession No. NC_001538 하의 BKV 전체 게놈에서의 948번째 뉴클레오타이드부터 1108번째 뉴클레오타이드까지의 서열, 또는 이에 대해 90% 이상, 예컨대 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 또는 그 초과의 동일성(identity)을 갖는 서열을 갖고, 다른 하나는 Genbank Accession No. NC_006273 하의 CMV 전체 게놈에서의 82871번째 뉴클레오타이드부터 83019번째 뉴클레오타이드까지의 서열, 또는 이에 대해 90% 이상, 예컨대 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 또는 그 초과의 동일성을 갖는 서열을 갖는다.
특정 구현예에서, 타겟 핵산은 2개이며, 그 중 하나는 Genbank Accession No. NC_001538 하의 BKV 전체 게놈에서의 748번째 뉴클레오타이드 내지 948번째 뉴클레오타이드로 이루어진 군으로부터 선택된 어느 하나의 뉴클레오타이드부터 1108번째 뉴클레오타이드 내지 1308번째 뉴클레오타이드로 이루어진 군으로부터 선택된 어느 하나의 뉴클레오타이드까지의 서열, 또는 이에 대해 90% 이상, 예컨대 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 또는 그 초과의 동일성을 갖는 서열을 갖고, 다른 하나는 Genbank Accession No. NC_006273 하의 CMV 전체 게놈에서의 82671번째 뉴클레오타이드 내지 82871번째 뉴클레오타이드로 이루어진 군으로부터 선택된 어느 하나의 뉴클레오타이드부터 83019번째 뉴클레오타이드 내지 83219번째 뉴클레오타이드로 이루어진 군으로부터 선택된 어느 하나의 뉴클레오타이드까지의 서열, 또는 이에 대해 90% 이상, 예컨대 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 또는 그 초과의 동일성을 갖는 서열을 갖는다.
특정 구현예에서, 타겟 핵산은 2개이며, 그 중 하나는 Genbank Accession No. NC_001538 하의 BKV 전체 게놈에서의 848번째 뉴클레오타이드 내지 948번째 뉴클레오타이드로 이루어진 군으로부터 선택된 어느 하나의 뉴클레오타이드부터 1108번째 뉴클레오타이드 내지 1208번째 뉴클레오타이드로 이루어진 군으로부터 선택된 어느 하나의 뉴클레오타이드까지의 서열, 또는 이에 대해 90% 이상, 예컨대 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 또는 그 초과의 동일성을 갖는 서열을 갖고, 다른 하나는 Genbank Accession No. NC_006273 하의 CMV 전체 게놈에서의 82771번째 뉴클레오타이드 내지 82871번째 뉴클레오타이드로 이루어진 군으로부터 선택된 어느 하나의 뉴클레오타이드부터 83019번째 뉴클레오타이드 내지 83119번째 뉴클레오타이드로 이루어진 군으로부터 선택된 어느 하나의 뉴클레오타이드까지의 서열, 또는 이에 대해 90% 이상, 예컨대 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 또는 그 초과의 동일성을 갖는 서열을 갖는다.
특정 구현예에서, 타겟 핵산은 2개이며, 그 중 하나는 Genbank Accession No. NC_001538 하의 BKV 전체 게놈에서의 898번째 뉴클레오타이드 내지 948번째 뉴클레오타이드로 이루어진 군으로부터 선택된 어느 하나의 뉴클레오타이드부터 1108번째 뉴클레오타이드 내지 1158번째 뉴클레오타이드로 이루어진 군으로부터 선택된 어느 하나의 뉴클레오타이드까지의 서열, 또는 이에 대해 90% 이상, 예컨대 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 또는 그 초과의 동일성을 갖는 서열을 갖고, 다른 하나는 Genbank Accession No. NC_006273 하의 CMV 전체 게놈에서의 82821번째 뉴클레오타이드 내지 82871번째 뉴클레오타이드로 이루어진 군으로부터 선택된 어느 하나의 뉴클레오타이드부터 83019번째 뉴클레오타이드 내지 83069번째 뉴클레오타이드로 이루어진 군으로부터 선택된 어느 하나의 뉴클레오타이드까지의 서열, 또는 이에 대해 90% 이상, 예컨대 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 또는 그 초과의 동일성을 갖는 서열을 갖는다.
특정 구현예에서, 타겟 핵산은 2개이며, 그 중 하나는 서열번호: 1의 뉴클레오타이드 서열, 또는 이에 대해 90% 이상, 예컨대 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 또는 그 초과의 동일성을 갖는 서열을 갖고, 다른 하나는 서열번호: 5의 뉴클레오타이드 서열, 또는 이에 대해 90% 이상, 예컨대 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 또는 그 초과의 동일성을 갖는 서열을 갖는다.
특정 구현예에서, 타겟 핵산은 2개이며, 그 중 하나는 서열번호: 1의 뉴클레오타이드 서열을 갖고, 다른 하나는 서열번호: 5의 뉴클레오타이드 서열을 갖는다.
본 발명자들은 BKV의 다양한 유전자 중에서 VP2 유전자, 특히 서열번호: 1의 뉴클레오타이드 서열을 타겟팅하는 것이 가장 높은 특이성 및 민감성으로 BKV를 정량할 수 있음을 확인하였다. 또한, 본 발명자들은 CMV의 다양한 유전자 중에서 UL55 유전자, 특히 서열번호: 5의 뉴클레오타이드 서열을 타겟팅하는 것이 가장 높은 특이성 및 민감성으로 CMV를 정량할 수 있음을 확인하였다(데이터는 미제시).
본원에서 BKV의 VP2 유전자의 특정 서열 및 CMV의 UL55 유전자의 특정 서열이 언급되었으나, 상기 서열은 본 발명에 따른 올리고뉴클레오타이드 세트에 의해 분석되는 서열을 예시한 것일 뿐, BKV 및 CMV의 서브타입 또는 변이체의 VP2 및 UL55 유전자의 다양한 서열이 본원에서 언급된 타겟 핵산에 포함되는 것으로 이해되어야 한다.
본 발명의 방법에서는, BKV 및 CMV로부터의 타겟 핵산의 동시 정량을 위해 BKV의 타겟 핵산 검출용 조성물 및 CMV의 타겟 핵산 검출용 조성물이 사용된다.
상기 BKV의 타겟 핵산 검출용 조성물은 BKV의 타겟 핵산, 즉 VP2 유전자에 특이적이며, 상기 CMV의 타겟 핵산 검출용 조성물은 CMV의 타겟 핵산, 즉 UL55에 특이적이다.
본원에서 문구 "타겟 핵산 검출용 조성물이 타겟 핵산에 특이적"이라는 것은 상기 타겟 핵산 검출용 조성물이 상기 타겟 핵산을 검출하는 데 관여하지만, 그 외 핵산을 검출하는 데 관여하지 않는다는 것을 의미한다. 달리 말하면, 상기 문구는 상기 타겟 핵산 검출용 조성물이 상기 타겟 핵산과 상호작용하지만 그 외 핵산과는 상호작용하지 않는다는 것을 의미한다.
본원에서 상기 BKV의 타겟 핵산 검출용 조성물은 BKV의 타겟 핵산에 특이적이나 CMV의 타겟 핵산에는 비특이적이고, 상기 CMV의 타겟 핵산 검출용 조성물은 CMV의 타겟 핵산에는 특이적이나 BKV의 타겟 핵산에는 비특이적이다.
본원에서 사용되는 BKV의 타겟 핵산 검출용 조성물 및 CMV의 타겟 핵산 검출용 조성물은 하나의 반응에서 함께 사용되며, 따라서 하나의 반응액 또는 반응 용기 내에 함께 존재한다.
본원에서 사용된 용어 "타겟 핵산 검출용 조성물"은 타겟 핵산을 검출하기 위해 사용되는 구성요소들을 함유하는 조성물을 의미한다.
상기 타겟 핵산 검출용 조성물에 포함되는 구성요소의 예는, 비제한적으로 타겟 핵산을 증폭 또는 검출하기 위해 사용되는 올리고뉴클레오타이드 세트, 표지, 핵산 중합효소, 버퍼, 중합효소 보조인자, 및 dNTPs 등을 포함한다. 선택적으로, 상기 타겟 핵산 검출용 조성물은 반응을 촉진하기 위한 물질, 핵산 중합효소 활성을 억제하기 위한 분자, 오염을 방지하기 위한 분자 등의 다양한 추가 구성요소를 포함할 수 있다. 또한, 상기 타겟 핵산 검출용 조성물은 양성 대조군, 음성 대조군 또는 내부 대조군 반응을 실시하는 데 필요한 올리고뉴클레오타이드 또는 시약을 포함할 수 있다. 또한, 상기 타겟 핵산 검출용 조성물은 절대 정량을 위한 기지의 양의 표준 타겟 핵산을 함유하는 참조 샘플을 포함할 수 있다.
본 발명의 방법에 사용되는 각 구성요소의 최적량은 본 개시사항의 이점을 알고 있는 당업자에 의해서 용이하게 결정될 수 있다.
상기 타겟 핵산 검출용 조성물의 구성요소들은 반응 전에 하나의 용기에 함께 보관되거나 또는 복수의 용기 내에 나뉘어 보관될 수 있다.
본 발명의 방법에 따르면, BKV의 타겟 핵산 검출용 조성물은 BKV의 VP2 유전자에 혼성화가능한 제1 올리고뉴클레오타이드 세트를 포함한다.
특정 구현예에서, 상기 제1 올리고뉴클레오타이드 세트는 서열번호: 1의 뉴클레오타이드 서열 또는 이의 보체에 혼성화가능한 복수의 올리고뉴클레오타이드를 포함한다: 5'-GTTTCCACTGTAGGCCTCTATCAGCAATCAGGCATGGCTTTGGAATTGTTTAACCCAGATGAGTACTATGATATTCTGTTTCCTGGTGTAAATACTTTTGTTAATAATATTCAATACCTTGATCCTAGGCATTGGGGTCCTTCTTTGTTTGCTACTATTTC-3' (서열번호: 1). 상기 서열번호: 1의 뉴클레오타이드 서열은 BKV의 VP2 유전자 내의 보존 영역(conserved region)의 대표적인 예이다.
특정 구현예에서, 상기 제1 올리고뉴클레오타이드 세트에 포함된 복수의 올리고뉴클레오타이드 중 적어도 하나는 1-3개의 데옥시이노신을 갖고; 상기 데옥시이노신 중 1개 또는 2개는 올리고뉴클레오타이드의 3'-말단에 있는 3번째 뉴클레오타이드 내지 6번째 뉴클레오타이드 범위의 코어 영역에 위치하며, 나머지는 올리고뉴클레오타이드의 5'-말단에 있는 4번째 뉴클레오타이드 내지 3'-말단에 있는 7번째 뉴클레오타이드 범위의 영역에 위치한다.
멀티플렉스 증폭 반응에 사용되는 복수의 올리고뉴클레오타이드 중 일부가 전술한 바와 같이 특정 위치에 특정 개수의 데옥시이노신을 갖도록 디자인하는 것은 반응에서 비특이적 증폭 산물, 특히 프라이머 다이머의 형성을 억제하고, 핵산 증폭 효율을 감소시키며, 올리고뉴클레오타이드의 설계를 용이하게 하는 것으로 알려져 있다(국제특허공개 제WO2018-124665호 참조).
본 발명의 방법은 제1 올리고뉴클레오타이드 세트 내의 일부 또는 모든 올리고뉴클레오타이드가 전술한 요건을 만족하도록 상기 올리고뉴클레오타이드에 데옥시이노신을 혼입시킴으로써 보다 효과적인 타겟 핵산의 검출을 가능하게 한다.
본 발명의 방법에 따르면, CMV의 타겟 핵산 검출용 조성물은 CMV의 UL55 유전자에 혼성화가능한 제2 올리고뉴클레오타이드 세트를 포함한다.
특정 구현예에서, 상기 제2 올리고뉴클레오타이드 세트는 서열번호: 5의 뉴클레오타이드 서열 또는 이의 보체에 혼성화가능한 복수의 올리고뉴클레오타이드를 포함한다: 5'-CAGTACGGTCAACTGGGCGAGGACAACGAAATCCTGTTGGGCAACCACCGCACTGAGGAATGTCAGCTTCCCAGCCTCAAGATCTTCATCGCCGGGAACTCGGCCTACGAGTACGTGGACTACCTCTTCAAACGCATGATTGACCTCAG-3' (서열번호: 5). 상기 서열번호: 5의 뉴클레오타이드 서열은 CMV의 UL55 유전자 내의 보존 영역의 대표적인 예이다.
특정 구현예에서, 상기 제2 올리고뉴클레오타이드 세트에 포함된 복수의 올리고뉴클레오타이드 중 적어도 하나는 1-3개의 데옥시이노신을 갖고; 상기 데옥시이노신 중 1개 또는 2개는 올리고뉴클레오타이드의 3'-말단에 있는 3번째 뉴클레오타이드 내지 6번째 뉴클레오타이드 범위의 코어 영역에 위치하며, 나머지는 올리고뉴클레오타이드의 5'-말단에 있는 4번째 뉴클레오타이드 내지 3'-말단에 있는 7번째 뉴클레오타이드 범위의 영역에 위치한다.
상기 데옥시이노신의 포함에 관한 세부사항은 전술한 국제특허공개 제WO2018-124665호를 참조한다.
일 구현예에서, 상기 제1 올리고뉴클레오타이드 세트 및 제2 올리고뉴클레오타이드 세트 각각은 프라이머 쌍 및 프로브를 포함한다.
본 명세서에서 사용되는 용어 "프라이머"는 타겟 핵산(주형)에 상보적인 프라이머 연장 산물의 합성이 유도되는 조건, 즉, 뉴클레오타이드와 DNA 중합효소와 같은 중합제의 존재, 그리고 적합한 온도와 pH의 조건에서 합성의 개시점으로 작용할 수 있는 올리고뉴클레오타이드를 가리킨다. 프라이머는, 중합제의 존재 하에서 연장 산물의 합성을 프라이밍시킬 수 있을 정도로 충분히 길어야 한다. 프라이머의 적합한 길이는 다수의 요소, 예컨대, 온도, 응용분야 및 프라이머의 소스(source)에 따라 결정된다.
본 명세서에서 사용되는 용어 "프로브(probe)"는 타겟 핵산에 실질적으로 상보적인 부위 또는 부위들을 포함하는 단일-가닥 핵산 분자를 의미한다. 본 발명의 일 구현예에 따르면, 프로브의 3'-말단은 "블록킹"되어 그의 연장이 방지된다. 블록킹은 종래 방법에 따라 달성될 수 있다. 예를 들면, 블록킹은 마지막 뉴클레오타이드의 3'-히드록실기에 바이오틴, 표지, 포스페이트기, 알킬기, 비-뉴클레오타이드 링커, 포스포로티오에이트 또는 알칸-디올 잔기와 같은 화학적 모이어티(moiety)를 추가하여 실시할 수 있다. 택일적으로, 블록킹은 마지막 뉴클레오타이드의 3'-히드록실기를 제거하거나 또는 다이디옥시뉴클레오타이드와 같이 3'-히드록실기가 없는 뉴클레오타이드를 이용하여 실시할 수 있다.
"상보적"은 소정의 어닐링 조건 또는 혼성화 조건하에서 프라이머 또는 프로브가 타겟 핵산 서열에 선택적으로 혼성화할 정도로 충분히 상보적인 것을 의미하며, "실질적으로 상보적(substantially complementary)" 및 "완전히 상보적(perfectly complementary)"인 것을 모두 포괄하는 의미를 가지며, 바람직하게는 완전히 상보적인 것을 의미한다.
용어 "실질적으로 상보적"은 올리고뉴클레오타이드가 충분히 상보적이어서 지정된 어닐링 조건 또는 혼성화 조건하에서 선택적으로 주형 핵산 서열에 혼성화될 수 있어, 어닐링된 올리고뉴클레오타이드가 중합효소에 의해 연장되어 주형에 상보적인 복사본을 형성할 수 있음을 의미한다. 따라서, 이 용어는 "완전하게 상보적인" 또는 이와 관련된 용어와는 다른 의미를 갖는다.
본 명세서에서 사용되는 용어 "비-상보적(non-complementary)"은 지정된 어닐링 조건 또는 혼성화 조건하에서 프라이머 또는 프로브가 타겟 핵산 서열에 선택적으로 혼성화되지 않을 정도로 충분히 비-상보적인 것을 의미하며, 용어 "실질적으로 비-상보적(substantially non-complementary)" 및 "완전히 비-상보적(perfectly noncomplementary)"인 것을 모두 포괄하는 의미를 가지며, 바람직하게는 완전히 비-상보적인 것을 의미한다.
프라이머 또는 프로브는 단일쇄일 수 있다. 프라이머 또는 프로브는 디옥시리보뉴클레오타이드, 리보뉴클레오타이드 또는 이의 조합을 포함한다. 본 발명에서 이용되는 프라이머 또는 프로브는 자연 (naturally occurring) dNMP (즉, dAMP, dGMP, dCMP 및 dTMP), 변형 뉴클레오타이드 또는 비-자연 뉴클레오타이드를 포함할 수 있다.
용어 "어닐링" 또는 "프라이밍"은 주형 핵산에 올리고뉴클레오타이드 또는 핵산이 병치(apposition)되는 것을 의미하며, 상기 병치는 중합효소가 뉴클레오타이드를 중합시켜 주형 핵산 또는 그의 일부분에 상보적인 핵산 분자를 형성하게 한다.
본 명세서에서 용어 "혼성화"는 소정의 혼성화 조건 하에 2개의 단일-가닥 폴리뉴클레오타이드가 상보적인 뉴클레오타이드 서열 간의 비공유 결합을 통해 이중-가닥을 형성하는 것을 지칭한다.
용어 "어닐링"과 "혼성화"는 차이가 없으며, 본 명세서에서 혼용되어 사용될 것이다.
특정 구현예에서, 본 발명에 따른 제1 올리고뉴클레오타이드 세트는 JC 바이러스 또는 시미안 바이러스 40의 게놈 서열에 혼성화가능한 올리고뉴클레오타이드를 포함하지 않는다.
상기 JC 바이러스 및 시미안 바이러스 40은 BKV와 유전적 상동성이 높은 것으로 알려져 있다. 따라서, BKV와 유전적 상동성이 높은 서열을 고려하지 않고 BKV의 타겟 서열만을 고려하여 디자인된 올리고뉴클레오타이드는 JC 바이러스나 시미안 바이러스 40으로부터의 게놈 서열에 혼성화할 가능성이 높으며, 예를 들어 BKV가 존재하지 않지만 JC 바이러스나 시미안 바이러스 40이 존재하는 샘플에 대해, 위양성(false positive) 결과를 야기할 수 있다.
이를 방지하기 위해, 본 발명에 따른 제1 올리고뉴클레오타이드 세트는 이것이 JC 바이러스 또는 시미안 바이러스 40의 게놈 서열에 혼성화하지 않도록 JC 바이러스 및 시미안 바이러스 40 모두의 게놈 서열을 고려하여 디자인된다.
특정 구현예에서, 상기 제1 올리고뉴클레오타이드 세트는 서열번호: 2의 뉴클레오타이드 서열 또는 이에 적어도 90% 상동성, 예컨대 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 또는 그 초과의 상동성을 갖는 서열을 갖는 프라이머 및 서열번호: 3의 뉴클레오타이드 서열 또는 이에 적어도 90% 상동성, 예컨대 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 또는 그 초과의 상동성을 갖는 서열을 갖는 프라이머를 포함한다"
5'-GTTTCCACTGTAGGCCTITATCAGIAATC-3' (서열번호: 2)
5'-GAAATAGTAGCAAACAAIGAAGGACCICAA-3' (서열번호: 3).
상기 서열에서 보는 바와 같이, 상기 2개의 프라이머는 특정 위치에 데옥시이노신('I'로 표시됨)이 혼입될 수 있다.
상기 상동성의 계산시, 상기 데옥시이노신은 그 정렬에서 맞은편에 있는 자연 발생 염기와 매치되는 것으로 간주된다.
특정 구현예에서, 상기 제1 올리고뉴클레오타이드 세트는 서열번호: 2의 뉴클레오타이드 서열을 갖는 프라이머 및 서열번호: 3의 뉴클레오타이드 서열을 갖는 프라이머를 포함한다.
특정 구현예에서, 상기 제1 올리고뉴클레오타이드 세트는 서열번호: 4의 뉴클레오타이드 서열 또는 이에 적어도 90% 상동성, 예컨대 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 또는 그 초과의 상동성을 갖는 서열을 갖는 프로브를 포함한다:
5'-TGGAATTGTTTAACCCAGATGAGTACTATGATAT-3' (서열번호: 4).
상기 서열에서 보는 바와 같이, 상기 프로브는 데옥시이노신을 함유하지 않는다.
특정 구현예에서, 상기 제1 올리고뉴클레오타이드 세트는 서열번호: 4의 뉴클레오타이드 서열을 갖는 프로브를 포함한다.
본 발명에 따른 제1 올리고뉴클레오타이드 세트는 541개의 BKV의 다양한 서브타입 및 변이체의 VP2 유전자 서열에 대해 100% 타겟 커버리지를 나타낸다. 또한, 본 발명에 따른 제1 올리고뉴클레오타이드 세트는 본원의 표 3에 열거된 47종의 균주의 게놈 서열을 검출하지 않는다. 이와 같이, 본 발명에 따른 제1 올리고뉴클레오타이드 세트는 높은 특이성으로 BKV의 타겟 핵산을 검출한다.
특정 구현예에서, 본 발명에 따른 제2 올리고뉴클레오타이드 세트는 헤르페스 심플렉스 바이러스 1, 인간 헤르페스바이러스 2, 인간 헤르페스바이러스 4, 인간 헤르페스바이러스 6B, 인간 헤르페스바이러스 6, 또는 인간 헤르페스 7 바이러스의 게놈 서열에 혼성화가능한 올리고뉴클레오타이드를 포함하지 않는다.
상기 헤르페스 심플렉스 바이러스 1, 인간 헤르페스바이러스 2, 인간 헤르페스바이러스 4, 인간 헤르페스바이러스 6B, 인간 헤르페스바이러스 6, 및 인간 헤르페스 7 바이러스는 CMV와 유전적 상동성이 높은 것으로 알려져 있다. 따라서, CMV와 유전적 상동성이 높은 서열을 고려하지 않고 CMV의 타겟 서열만을 고려하여 디자인된 올리고뉴클레오타이드는 전술한 헤르페스바이러스로부터의 게놈 서열에 혼성화할 가능성이 높으며, 예를 들어 CMV가 존재하지 않지만 전술한 헤르페스바이러스가 존재하는 샘플에 대해, 위양성(false positive) 결과를 야기할 수 있다.
이를 방지하기 위해, 본 발명에 따른 제1 올리고뉴클레오타이드 세트는 이것이 헤르페스 심플렉스 바이러스 1, 인간 헤르페스바이러스 2, 인간 헤르페스바이러스 4, 인간 헤르페스바이러스 6B, 인간 헤르페스바이러스 6, 또는 인간 헤르페스 7 바이러스의 게놈 서열에 혼성화하지 않도록 전술한 헤르페스바이러스 전체의 게놈 서열을 고려하여 디자인된다.
특정 구현예에서, 상기 제2 올리고뉴클레오타이드 세트는 서열번호: 6의 뉴클레오타이드 서열 또는 이에 적어도 90% 상동성, 예컨대 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 또는 그 초과의 상동성을 갖는 서열을 갖는 프라이머 및 서열번호: 7의 뉴클레오타이드 서열 또는 이에 적어도 90% 상동성, 예컨대 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 또는 그 초과의 상동성을 갖는 서열을 갖는 프라이머를 포함한다:
5'-CAGTACIGTCAACTGGGIGAGG-3' (서열번호: 6)
5'-CTGAGGTIAATCATGCGTTTGAAIAGG-3' (서열번호: 7).
상기 서열에서 보는 바와 같이, 상기 2개의 프라이머는 특정 위치에 데옥시이노신('I'로 표시됨)이 혼입되어 있다.
상기 상동성의 계산시, 상기 데옥시이노신은 그 정렬에서 맞은편에 있는 자연 발생 염기와 매치되는 것으로 간주된다.
특정 구현예에서, 상기 제2 올리고뉴클레오타이드 세트는 서열번호: 6의 뉴클레오타이드 서열을 갖는 프라이머 및 서열번호: 7의 뉴클레오타이드 서열을 갖는 프라이머를 포함한다.
특정 구현예에서, 상기 제2 올리고뉴클레오타이드 세트는 서열번호: 8의 뉴클레오타이드 서열 또는 이에 적어도 90% 상동성, 예컨대 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 또는 그 초과의 상동성을 갖는 서열을 갖는 프로브를 포함한다:
5'-CCACCGCACTGAGGAATGTCAG-3' (서열번호: 8).
상기 서열에서 보는 바와 같이, 상기 프로브는 데옥시이노신을 함유하지 않는다.
특정 구현예에서, 상기 제2 올리고뉴클레오타이드 세트는 서열번호: 8의 뉴클레오타이드 서열을 갖는 프로브를 포함한다.
본 발명에 따른 제2 올리고뉴클레오타이드 세트는 523개의 CMV의 다양한 서브타입 및 변이체의 UL55 유전자 서열에 대해 실질적으로 100% 타겟 커버리지를 나타낸다. 또한, 본 발명에 따른 제2 올리고뉴클레오타이드 세트는 본원의 표 4에 열거된 47종의 균주의 게놈 서열을 검출하지 않는다. 이와 같이, 본 발명에 따른 제2 올리고뉴클레오타이드 세트는 높은 특이성으로 CMV의 타겟 핵산을 검출한다.
특정 구현예에서, 본 발명에 따른 BKV의 타겟 핵산 검출용 조성물, 특히 제1 올리고뉴클레오타이드 세트는 BKV의 VP2 유전자에 특이적으로 혼성화된 올리고뉴클레오타이드의 절단에 의존적인 방식으로 형광 표지로부터 시그널을 발생시킨다.
특정 구현예에서, 본 발명에 따른 CMV의 타겟 핵산 검출용 조성물, 특히 제2 올리고뉴클레오타이드 세트는 CMV의 UL55 유전자에 특이적으로 혼성화된 올리고뉴클레오타이드의 절단에 의존적인 방식으로 형광 표지로부터 시그널을 발생시킨다.
특히, 제1 올리고뉴클레오타이드 세트 및 제2 올리고뉴클레오타이드 세트에 의한 시그널의 발생은 타겟 핵산에 올리고뉴클레오타이드, 예를 들어 프로브가 혼성화된 다음, 이의 절단에 의해 이뤄질 수 있다.
이러한 시그널 발생의 예는, 비제한적으로 TaqMan 프로브 방법(미국 특허 제5,210,015호 및 미국 특허 제5,538,848호)을 포함한다.
TaqMan 프로브 방법에 의한 시그널 발생을 위해, 타겟 핵산 검출용 조성물은 프라이머 쌍 및 프로브를 포함하는 올리고뉴클레오타이드 세트뿐만 아니라 5'-뉴클레아제 활성을 갖는 핵산 중합효소를 포함한다. 상기 타겟 핵산에 혼성화된 프로브는 타겟 핵산의 증폭 동안 절단되어 상기 타겟 핵산의 존재를 나타내는 시그널을 발생시킨다.
TaqMan 프로브 방법에 의해 시그널을 발생시키는 특정 예는 다음의 단계를 포함한다: (a) 상기 타겟 핵산을 프라이머 쌍 및 적절한 표지(예컨대, 상호작용적 이중 표지)를 갖는 프로브와 혼성화시키는 단계; (b) 상기 단계 (a)의 결과물 및 5'뉴클레아제 활성을 갖는 핵산 중합효소를 이용하여 타겟 핵산을 증폭하는 단계로서; 상기 프로브는 절단되어 상기 표지를 방출하고; 및 (c) 상기 방출된 표지로부터 시그널 발생을 검출하는 단계.
제1 올리고뉴클레오타이드 세트 및 제2 올리고뉴클레오타이드 세트에 의한 시그널 발생은 전술한 방법 외에도 당업자에게 공지된 다양한 방법에 의해 이뤄질 수 있다.
일 구현예에서, 제1 올리고뉴클레오타이드 세트 내에 포함된 프로브 및 제2 올리고뉴클레오타이드 세트 내에 포함된 프로브 각각은 검출가능한 형광 표지 및 상기 형광 표지로부터의 시그널을 퀀칭할 수 있는 퀀칭 모이어티를 포함한다.
본원에서 형광 표지 및 퀀칭 모이어티는 상호작용 이중 표지로 지칭될 수 있고, 형광 표지는 형광 리포터 분자로 지칭될 수 있으며, 퀀칭 모이어티는 퀜처 분자로 지칭될 수 있다.
상기 상호작용 이중 표지를 포함하는 상호작용 표지 시스템의 대표적 예는 형광 리포터 분자(공여체 분자) 및 퀀처 분자(수용체 분자)를 포함하는 FRET(fluorescence resonance energy transfer) 표지 시스템을 포함한다. FRET에서 에너지 공여체는 형광성이나, 에너지 수용체는 형광성 또는 비-형광성일 수 있다. 상호작용 표지 시스템은 "접촉-매개 퀀칭(contact-mediated quenching)"에 기반한 이중 표지를 포함할 수 있다(Salvatore 등, Nucleic Acids Research, 2002 (30) no.21 e122 and Johansson 등, J. AM. CHEM. SOC 2002 (124) pp 6950-6956). 상기 상호작용적 표지 시스템은 최소 2개의 분자(예컨대, 염료) 간의 상호작용에 의해 시그널 변화를 유도하는 어떠한 표지 시스템도 포함할 수 있다.
본 발명에서 유용한 리포터 분자 및 퀀처 분자는 당업계에 알려진 어떠한 분자도 포함할 수 있다. 그 예는 다음과 같다: Cy2™ (506), YO-PRO™-1 (509), YOYO™-1 (509), Calcein (517), FITC (518), FluorX™ (519), Alexa™ (520), Rhodamine 110 (520), Oregon Green™ 500 (522), Oregon Green™ 488 (524), RiboGreen™ (525), Rhodamine Green™ (527), Rhodamine 123 (529), Magnesium Green™(531), Calcium Green™ (533), TO-PRO™-1 (533), TOTO1 (533), JOE (548), BODIPY530/550 (550), Dil (565), BODIPY TMR (568), BODIPY558/568 (568), BODIPY564/570 (570), Cy3™ (570), Alexa™ 546 (570), TRITC (572), Magnesium Orange™ (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange™ (576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red™ (590), Cy3.5™ (596), ROX (608), Calcium Crimson™ (615), Alexa™ 594 (615), Texas Red (615), Nile Red (628), YO-PRO™-3 (631), YOYO™-3 (631), Rphycocyanin (642), C-Phycocyanin (648), TO-PRO™-3 (660), TOTO3 (660), DiD DilC(5) (665), Cy5™ (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705) 및 Quasar 705 (610). 괄호의 숫자는 나노미터 단위로 표시한 최대 발광 파장이다. 바람직하게는, 리포터 분자 및 퀀처 분자는 JOE, FAM, TAMRA, ROX 및 플루오레세인-기반 표지를 포함할 수 있다.
적합한 형광 분자 및 적합한 리포터-퀀처 쌍은 다음과 같이 다양한 문헌에 개시되어 있다: Pesce 등, editors, Fluorescence Spectroscopy (Marcel Dekker, New York, 1971); White 등, Fluorescence Analysis: A Practical Approach (Marcel Dekker, New York, 1970); Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd Edition (Academic Press, New York, 1971); Griffiths, Color AND Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, editor, Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992); Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); Haugland, R. P., Handbook of Fluorescent Probes and Research Chemicals, 6th Edition (Molecular Probes, Eugene, Oreg., 1996); 미국 특허 제3,996,345호 및 제4,351,760호.
본 발명에서, 광범위 파장 또는 특정 파장의 형광을 퀀칭할 수 있는 비-형광 퀀처 분자(예컨대, 블랙 퀀처 또는 다크 퀀처)가 이용될 수 있다는 것은 주목할 만하다.
리포터 및 퀀처 분자를 포함하는 시그널링 시스템에서, 상기 리포터는 FRET의 공여체를 포함하고 퀀처는 FRET의 나머지 파트너(수용체)를 포함한다. 예를 들어, 플루오레세인 염료(fluorescein dye)는 리포터로 이용되고 로다민 염료(rhodamine dye)는 퀀처로 이용될 수 있다.
일 구현예에서, 상기 상호작용 이중 표지는 제1 올리고뉴클레오타이드 세트 내의 프로브에 연결된다.
일 구현예에서, 상기 상호작용 이중 표지는 제2 올리고뉴클레오타이드 세트 내의 프로브에 연결된다.
타겟 핵산이 존재하지 않는 경우, 상기 제1 올리고뉴클레오타이드 세트 및 제2 올리고뉴클레오타이드 세트 내의 각각의 프로브는 헤어핀 또는 랜덤 코일 구조의 단일-가닥 상태로 존재하고, 이 경우 상기 퀀처 분자가 상기 리포터 분자에 근접하여 상기 리포터 분자로부터 시그널을 퀀칭함으로써 시그널이 발생하지 않는다.
반면, 타겟 핵산이 존재하는 경우, 적절한 혼성화 조건 하에서 상기 각각의 프로브는 타겟 핵산에 혼성화되어 이합체를 형성하고, 이에 따라 상기 퀀처 분자가 상기 리포터 분자로부터 분리되어 상기 리포터 분자로부터의 시그널을 언퀀칭함으로써 시그널을 발생시키며, 또한 상기 프로브가 뉴클레아제의 작용에 의해 절단됨에 따라 상기 퀀처 분자와 상기 리포터 분자 간의 분리가 강화된다.
본 발명에 따르면, 제1 올리고뉴클레오타이드 세트에 포함된 프로브에 연결된 형광 표지는 제2 올리고뉴클레오타이드 세트에 포함된 프로브에 연결된 형광 표지와 상이하다. 두 형광 표지가 상이하다는 것은 상기 형광 표지로부터 발생하는 시그널이 실질적으로 상이한 시그널 특성(예컨대, 광학적 특성, 발광 파장 등)으로 인해 2개의 검출 채널을 사용하여 쉽게 구별되는 것을 의미한다.
일 구현예에서, 제1 올리고뉴클레오타이드 세트에 포함된 프로브에 연결된 형광 표지는 FAM 또는 이의 등가물이다.
일 구현예에서, 제2 올리고뉴클레오타이드 세트에 포함된 프로브에 연결된 형광 표지는 Cal Red 610 또는 이의 등가물이다.
본 발명에 따르면, BKV의 VP2 유전자 및 CMV의 UL55 유전자에 대한 핵산 증폭 반응이 수행된다.
상기 핵산 증폭 반응은 하나의 반응 용기에서 2개의 타겟 핵산을 동시에 증폭시키는 멀티플렉스 반응이다.
일 구현예에 있어서, 상기 타겟 핵산의 증폭은 중합효소 연쇄반응(polymerase chain reaction, PCR)을 통해 실시될 수 있다.
중합효소 연쇄반응은 타겟 핵산을 증폭하기 위해 해당 기술 분야에서 폭넓게 사용되고 있으며, 타겟 핵산 서열의 변성, 타겟 핵산 서열 및 프라이머 간의 어닐링(혼성화) 및 프라이머 연장으로 이루어진 사이클의 반복을 포함한다(미국 특허 제4,683,195호, 제4,683,202호 및 제4,800,159호; Saiki et al., (1985) Science 230, 1350-1354).
타겟 핵산이 이중-가닥인 경우, 이중-가닥을 단일-가닥 또는 부분적인 단일-가닥 형태로 만드는 것이 바람직하다. 이중-가닥을 분리하는 방법에는 가열, 알칼리, 포름아미드, 우레아 및 글리콕살 처리, 효소적 방법(예컨대, 헬리카아제 작용) 및 결합 단백질 등이 포함되나, 이에 한정되는 것은 아니다. 예를 들어, 가닥의 분리는 80℃ 내지 105℃ 범위의 온도에서 가열함으로써 달성될 수 있다. 이러한 처리를 달성하기 위한 일반적인 방법은 Joseph Sambrook, et. al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001)에 의해 제공된다.
프라이머와 타겟 핵산의 어닐링은 최적화 절차에 의하여 일반적으로 결정되는 적합한 혼성화 조건하에서 실시될 수 있다. 온도, 성분의 농도, 혼성화와 세척 횟수, 버퍼 성분, 및 이들의 pH와 이온 강도 등과 같은 조건은 프라이머와 타겟 핵산 서열의 길이 및 GC 함량을 포함하는 다양한 인자에 따라 달라질 수 있다. 혼성화를 위한 상세한 조건은 Joseph Sambrook et. al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001); 및 M.L.M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. N.Y.(1999)에서 확인할 수 있다.
타겟 핵산에 어닐링된 프라이머는 주형-의존적 중합효소에 의해 연장되며, 이는 E. coli DNA 중합효소 I의 "클레나우" 단편, 열안정성 DNA 중합효소 및 박테리오파아지 T7 DNA 중합효소를 포함한다. 본 개시의 일 구현예에서, 주형-의존적 중합효소는 다양한 박테리아 종으로부터 수득된 열안정성 DNA 중합효소이다.
본 발명의 일 구현예에 따르면, 뉴클레아제 활성(예컨대, 5’뉴클레아제 활성 또는 3’뉴클레아제 활성)을 갖는 핵산 중합효소가 사용될 수 있다.
본 발명에서 유용한 핵산 중합효소는 Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, Thermus antranikianii, Thermus caldophilus, Thermus chliarophilus, Thermus flavus, Thermus igniterrae, Thermus lacteus, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus, Thermus silvanus, Thermus species Z05, Thermus species sps 17, Thermus thermophilus, Thermotoga maritima, Thermotoga neapolitana, Thermosipho africanus, Thermococcus litoralis, Thermococcus barossi, Thermococcus gorgonarius, Thermotoga maritima, Thermotoga neapolitana, Thermosipho africanus, Pyrococcus woesei, Pyrococcus horikoshii, Pyrococcus abyssi, Pyrodictium occultum, Aquifex pyrophilus 및 Aquifex aeolieus를 포함하는, 다양한 박테리아 종으로부터 얻은 열안정성 DNA 중합효소이다. 특히, 상기 열안정성 DNA 중합효소는 Taq 중합효소이다.
중합 반응을 실시할 때, 반응에 필요한 성분들은 반응 용기에 과량으로 제공될 수 있다. 연장 반응의 성분들과 관련하여 과량은 기대하는 연장을 달성하는 능력이 상기 성분들의 농도에 의해 실질적으로 제한되지 않을 정도의 각 성분들의 양을 의미한다. 원하는 반응이 일어나게 하기 위해 Mg2+와 같은 필요한 보조인자, dATP, dCTP, dGTP 및 dTTP들을 충분한 양으로 반응 혼합물에 제공하는 것이 바람직하다.
본 발명의 방법에 따르면, 정량의 민감도를 높이기 위해 증가된 부피의 샘플을 사용할 수 있다. 상기 사용되는 샘플의 부피는, 비제한적으로 5 내지 15 ul, 특히 8 ul, 9 ul, 10 ul, 11 ul 또는 12 ul일 수 있다.
또한, 정량의 민감도를 높이기 위해, 본 발명의 방법은 증가된 총 반응 부피를 가질 수 있다. 본 발명에 따른 핵산 증폭 반응에서의 총 반응 부피는, 비제한적으로 20 내지 30 ul, 특히 25 ul, 26 ul, 27 ul, 28 ul, 29 ul, 또는 30 ul일 수 있다.
mRNA를 출발 물질로 이용하는 경우, 어닐링 단계 실시 이전에 역전사 단계가 필수적이며, 이의 상세한 내용은 문헌[Joseph Sambrook, 등, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001); 및 Noonan, K. F. 등, Nucleic Acids Res. 16:10366 (1988)]에 개시되어 있다. 역전사 반응을 위해, mRNA의 폴리 A 테일에 혼성화가능한 올리고뉴클레오타이드 dT 프라이머, 랜덤 프라이머 또는 타겟-특이적 프라이머가 이용될 수 있다.
다른 구현예에 따르면, 상기 타겟 핵산을 증폭하기 위한 방법으로 리가아제 연쇄 반응(ligase chain reaction; LCR, 참조 Wiedmann M, 등, "Ligase chain reaction (LCR)- overview and applications." PCR Methods and Applications 1994 Feb;3(4):S51-64), 갭 필링 LCR(gap filling LCR; GLCR, 참조 WO 90/01069, 유럽 특허 제439182호 및 WO 93/00447), Q-베타 리플리카제 증폭(Q-beta replicase amplification; Q-beta, 참조 Cahill P, 등, Clin Chem., 37(9): 1482-5(1991), 미국 특허 제5556751호), 가닥 치환 증폭(strand displacement amplification; SDA, 참조 G T Walker 등, Nucleic Acids Res. 20(7):16911696(1992), 유럽 특허 제497272호), 핵산 서열-기반 증폭(nucleic acid sequence-based amplification; NASBA, 참조 Compton, J. Nature 350(6313):912(1991)), 전사 매개 증폭(Transcription-Mediated Amplification; TMA, 참조 Hofmann WP 등, J Clin Virol. 32(4):289-93(2005); 미국 특허 제5888779호), 롤링 서클 증폭(Rolling Circle Amplification; RCA, 참조 Hutchison C.A. 등, Proc. Natl Acad. Sci. USA. 102:1733217336(2005)), RPA(Recombinase polymerase amplification) 또는 LAMP(Loop-mediated isothermal amplification) 등을 이용할 수 있으며, 이에 한정되는 것은 아니다.
상기 상술한 증폭 방법은 온도를 변화시키거나 변화시키지 않는 일련의 반응들의 반복을 통하여 타겟 핵산을 증폭시킬 수 있다. 상기 일련의 반응들의 반복을 포함하는 증폭의 단위는 "사이클(cycle)"로 표현된다. 상기 사이클의 단위는 증폭 방법에 따라 반복 횟수 또는 시간으로 표현될 수 있다.
예를 들어, 시그널의 검출은 증폭의 각 사이클, 선택된 일부 사이클, 또는 반응의 엔드-포인트(end-point of reaction)에서 실시될 수 있다.
본 발명의 일 구현예에 따르면, 타겟 핵산의 증폭은 비대칭 PCR(asymmetric PCR)에 의해 달성된다. 상기 프라이머의 비율은 다운스트림 올리고뉴클레오타이드의 절단 또는 혼성화를 고려하여 선택될 수 있다.
일 구현예에서, 본 발명에 따른 타겟 핵산 검출용 조성물은 내부 대조군 반응을 위한 올리고뉴클레오타이드 세트를 추가로 포함한다. 상기 내부 대조군 반응은 본 발명에 따른 BKV의 VP2 유전자 및 CMV의 UL55 유전자의 핵산 증폭 반응과 동시에 수행될 수 있다. 본원에서 "내부 대조군"은 반응의 적합성을 확인하기 위한 물질을 의미하며, 이는 타겟 핵산의 존재 여부, 핵산 추출시 타겟 핵산의 손실 여부, 증폭 반응에서의 저해 물질의 존재 등을 확인시켜 준다.
일 구현예에서, 상기 내부 대조군은 HBB(human hemoglobin subunit beta)이다.
일 구현예에서, 내부 대조군 반응에 필요한 올리고뉴클레오타이드 세트는 상기 내부 대조군과 혼성화가능한 프라이머 쌍 및 프로브를 포함한다.
일 구현예에서, 상기 내부 대조군 반응에 사용되는 프로브는 검출가능한 형광 표지 및 상기 형광 표지로부터의 시그널을 퀀칭할 수 있는 퀀칭 모이어티를 포함한다.
일 구현예에서, 상기 내부 대조군 반응에 사용되는 프로브에 연결된 형광 표지는 Quasar 670 또는 이의 등가물이다.
일 구현예에서, 본 발명에 따른 타겟 핵산 검출용 조성물은 양성 대조군 반응을 위한 양성 대조군을 추가로 포함한다. 상기 양성 대조군 반응은 본 발명에 따른 BKV의 VP2 유전자 및 CMV의 UL55 유전자의 핵산 증폭 반응과 동시에 또는 이전 또는 이후에 수행될 수 있다. 상기 양성 대조군은 전술한 BKV의 VP2 유전자이거나 전술한 CMV의 UL55의 유전자일 수 있다. 상기 양성 대조군은 본 발명에 따른 제1 올리고뉴클레오타이드 세트 또는 제2 올리고뉴클레오타이드 세트에 의해 증폭 및/또는 검출될 수 있다.
일 구현예에서, 본 발명에 따른 타겟 핵산 검출용 조성물은 음성 대조군 반응을 위한 음성 대조군을 추가로 포함한다. 상기 음성 대조군 반응은 본 발명에 따른 BKV의 VP2 유전자 및 CMV의 UL55 유전자의 핵산 증폭 반응과 동시에 또는 이전 또는 이후에 수행될 수 있다. 상기 음성 대조군은 타겟 핵산을 함유하지 않는 멸균수, 특히 초순수(ultrapure) PCR 등급의 물일 수 있다.
일 구현예에서, 본 발명에 따른 타겟 핵산 검출용 조성물은 UDG(Uracil DNA Glycosylase)를 추가로 포함한다. UDG는 이전 반응의 결과물(예컨대, cDNA 또는 증폭 산물)이 다양한 경로로 새로 수행되는 반응을 오염시키는 캐리-오버(carry-over) 오염을 방지할 수 있다. 구체적으로, dNTPs 중에서 dTTP 대신 dUTP를 사용하여, 역전사 반응 또는 증폭 반응을 수행한다. 이들의 결과물(즉, cDNA 또는 증폭산물)은 dUTP를 포함하고 있으며, 새로운 반응을 수행하기 이전에 UDG를 처리하여 dUTP를 포함하는 이전 결과물들을 가수분해시킴으로써 캐리-오버 오염을 방지할 수 있다.
적합한 UDG의 예로서, 열 취약성 UDG(heat labile Uracil DNA Glycosylase)를 이용할 수 있다. 상기 열 취약성 UDG는 저온성 생명체로부터 유래된 UDG, 예컨대, 호냉성(psychrophilic) 박테리아 또는 알래스카 대구(Atlantic cod)로부터 유래된 UDG를 포함할 수 있으나, 이에 한정되는 것은 아니다. 이들 효소는 각각 50℃ 또는 55℃의 온도에 노출되면, 빠르게 비가역적으로 불활성화되는 특징을 갖는다. 따라서, 열 취약성 UDG는 역전사 반응이 시작되기 전에 불활성화되어, 역전사 반응에 의한 cDNA 생성 과정에는 전혀 영향을 미치지 않고, 캐리-오버 오염 물질만을 제거할 수 있다.
본 발명에 따른 타겟 핵산 검출용 조성물은 이의 상응하는 타겟 핵산의 존재 하에 시그널을 발생시키고, 상기 발생된 시그널의 검출에 의해 타겟 핵산을 정량할 수 있게 한다.
본 발명의 일 구현예에 따르면, 핵산 증폭 반응은 타겟 핵산 검출용 조성물에 의한 시그널 발생과 함께 타겟 증폭이 가능한 조건하에서 실시된다.
일 구현예에 따르면, 상기 시그널의 발생은 표지로부터 "시그널 발생 또는 소멸" 및 "시그널 증가 또는 감소"를 포함한다. 본원에서 시그널의 발생은 유의한 시그널, 즉 타겟 핵산의 존재를 나타내는 시그널의 발생을 의미한다. 예를 들어, 유의한 시그널, 즉 타겟 핵산의 존재를 나타내는 시그널은 백그라운드 시그널의 강도 또는 타겟 핵산의 부재시에 발생할 수 있는 시그널의 강도를 초과하는 강도를 갖는 시그널을 의미하거나, 또는 유의한 시그널, 즉 타겟 핵산의 존재를 나타내는 시그널은 발생한 시그널의 강도로부터 백그라운드 시그널의 강도 또는 타겟 핵산의 부재시에 발생할 수 있는 시그널의 강도를 차감한 후의 강도를 갖는 시그널을 의미한다. 시그널은 발생하였지만 그의 강도가 백그라운드 시그널의 강도 또는 타겟 핵산의 부재시에 발생할 수 있는 시그널의 강도와 비슷하거나 낮은 경우, 상기 시그널의 발생은 본 발명의 방법에서 시그널 또는 시그널의 발생으로 간주되지 않는다.
본 발명의 방법에 따르면, 상기 핵산 증폭 반응은 샘플 내에 BKV의 존재시 BKV의 VP2 유전자의 증폭을 나타내는 제1 증폭 곡선을 생성하고, 샘플 내에 CMV의 존재시 CMV의 UL55 유전자의 증폭을 나타내는 제2 증폭 곡선을 생성한다.
본원에서, 증폭 곡선은 증폭 반응으로부터 얻은 타겟 핵산에 대한 데이터 세트를 플롯팅함으로써 수득된 곡선을 지칭한다. 일 구현예에서, 상기 데이터 세트는 사이클 번호 및 신호값을 포함하는 복수의 데이터 지점을 포함한다.
본 발명에서 용어 "사이클"은 일정한 조건의 변화를 수반한 복수의 측정에 있어, 상기 조건의 변화 단위를 말한다. 상기 일정한 조건의 변화는 예를 들어 온도, 반응시간, 반응횟수, 농도, pH, 측정 대상(예를 들어 핵산)의 복제 횟수 등의 증가 또는 감소를 의미한다. 따라서 사이클은 시간(time) 또는 과정(process) 사이클, 단위 운영(unit operation) 사이클 및 재생산(reproductive) 사이클일 수 있다.
일 예로 기질의 농도에 따른 효소의 기질 분해 능력을 측정하는 경우, 기질 농도를 달리하여 수 차례 효소의 기질 분해 정도를 측정한 후, 이로부터 효소의 기질 분해 능력을 분석한다. 이때 일정한 조건의 변화는 기질 농도의 증가이며, 사용된 기질 농도 증가 단위가 하나의 사이클로 설정된다.
다른 일 예로 핵산의 등온증폭 반응(isothermal amplification)의 경우 하나의 샘플을 반응시간을 달리하여 수차례 측정을 할 수 있으며, 이 경우 반응시간이 조건의 변화이며, 반응시간 단위가 하나의 사이클로 설정된다.
보다 구체적으로, 용어 "사이클"은 일정한 과정의 반응을 반복하거나 일정한 시간 간격 기준으로 반응을 반복하는 경우, 상기 반복의 하나의 단위를 의미한다.
일 예로 중합효소 연쇄 반응(PCR)의 경우 하나의 사이클은 핵산의 변성단계(denaturation), 프라이머의 어닐링 단계 및 프라이머의 연장 단계(extension)를 포함하는 반응을 의미한다. 이 경우 일정한 조건의 변화는 반응의 반복 횟수의 증가이며, 상기 일련의 단계를 포함하는 반응의 반복 단위가 하나의 사이클로 설정된다.
본 명세서에서 용어 “신호값”은 핵산 증폭 반응의 사이클에서 측정된 신호의 수준(예컨대, 신호의 세기)을 일정한 스케일에 따라 수치화한 값 또는 이들의 변형값을 의미한다. 상기 변형값은 상기 측정된 신호값의 수학적으로 가공된 신호값을 포함할 수 있다. 실제적으로 측정된 신호값(즉, 원시 데이터 세트의 신호값)의 수학적으로 가공된 신호값의 예는 로그값 또는 도함수값(derivatives)을 포함할 수 있다.
본 명세서에 용어 “데이터 지점(data point)”은 사이클 및 신호값을 포함하는 하나의 좌표값(a coordinate value)을 의미한다. 용어 “데이터”는 데이터 세트를 구성하는 모든 정보를 의미한다. 예컨대, 증폭 반응의 사이클 및 신호값 각각은 데이터이다.
증폭 반응에 의해 얻어진 데이터 지점들은 2차원 직교 좌표계에 나타낼 수 있는 좌표값으로 표시될 수 있다. 상기 좌표값에서 X-축은 해당 사이클 수를 나타내며, Y-축은 해당 사이클에서 측정 또는 가공된 신호값을 나타낸다.
본 명세서에 용어 “데이터 세트”는 상기 데이터 지점들의 집합을 의미한다. 예를 들어, 데이터 세트는 타겟 핵산에 특이적인 올리고뉴클레오타이드 세트의 존재 하에서 수행된 증폭 반응을 통하여 직접적으로 수득되는 데이터 지점의 집합일 수 있으며 또는 이의 변형된 데이터 세트일 수 있다. 상기 데이터 세트는 증폭 반응에 의해 수득되는 복수의 데이터 지점들 또는 이의 변형된 데이터 지점들의 일부 또는 전체일 수 있다.
일 구현예에서, 본 발명에 따른 증폭 곡선은 종래 공지된 방법에 따라 백그라운드 시그널을 차감함으로써 수득된 것이다.
단계 (b): BKV 및 CMV의 양의 결정
본 개시의 단계 (b)에서는, 상기 생성된 제1 증폭 곡선을 이용하여 샘플 내의 BKV의 양을 결정하고, 상기 생성된 제2 증폭 곡선을 이용하여 샘플 내의 CMV의 양을 결정한다.
구체적으로, 상기 생성된 제1 증폭 곡선을 기지의 양의 VP2 유전자를 함유하는 참조 샘플로부터 생성된 표준 곡선과 비교하여 상기 샘플 내의 BKV의 양을 결정하고, 상기 생성된 제2 증폭 곡선을 기지의 양의 UL55 유전자를 함유하는 또 다른 참조 샘플로부터 생성된 표준 곡선과 비교하여 상기 샘플 내의 CMV의 양을 결정한다.
VP2 유전자에 대한 표준 곡선과 UL55에 대한 표준 곡선은 상기 단계 (b)의 이전에 또는 동시에 준비된다.
본원에서, VP2 유전자를 함유하는 참조 샘플로부터 생성된 표준 곡선은 "VP2 유전자에 대한 표준 곡선" 또는 "BKV에 대한 표준 곡선"으로 지칭될 수 있고, UL55 유전자를 함유하는 참조 샘플로부터 생성된 표준 곡선은 "UL55 유전자에 대한 표준 곡선" 또는 "CMV에 대한 표준 곡선"으로 지칭될 수 있다.
이하, 각 표준 곡선에 대해 설명하기로 한다.
VP2 유전자에 대한 표준 곡선은 다양한 기지의 양의 VP2 유전자를 함유하는 참조 샘플을 사용한 핵산 증폭 반응으로부터 얻어진다.
마찬가지로, UL55 유전자에 대한 표준 곡선은 다양한 기지의 양의 UL55 유전자를 함유하는 또 다른 참조 샘플을 사용한 핵산 증폭 반응으로부터 얻어진다.
상기 표준 곡선을 얻기 위한 핵산 증폭 반응은 전술한 단계 (a)에서의 핵산 증폭 반응과 별도로 수행되며, 이는 표준 핵산 증폭 반응 또는 참조 핵산 증폭 반응으로 불릴 수 있다.
일 구현예에서, 상기 VP 유전자에 대한 표준 곡선 또는 UL55 유전자에 대한 표준 곡선은 당업계에 공지된 절대 정량법에 의해 수득될 수 있다.
특정 구현예에서, 상기 VP 유전자에 대한 표준 곡선 또는 UL55 유전자에 대한 표준 곡선은 하기 단계로부터 얻어진다: (i) 기지의 양의 VP 유전자 또는 UL55 유전자를 함유하는 참조 샘플을 사용한 핵산 증폭 반응에 의해 증폭 곡선을 얻는 단계, (ii) 상기 증폭 곡선으로부터 역치 사이클(Ct)를 결정하는 단계, 및 (iii) 상기 역치 사이클을 상기 VP 유전자 또는 UL 유전자의 기지의 양의 로그(log) 값에 대해 플롯팅하는 단계.
전술한 구현예에서, 단계 (i)에서 사용되는 기지의 양의 VP2 유전자 또는 기지의 양의 UL55 유전자는 상업적으로 또는 비상업적으로 입수가능한 표준 물질일 수 있다.
또한, 상기 유전자의 기지의 양은 상기 유전자의 양의 희석 시리즈일 수 있다.
상기 유전자의 양의 희석 시리즈는 일련의 희석된 양의 유전자를 함유하는 참조 샘플을 지칭하며, 이는 샘플, 특히 임상 샘플에서 일반적으로 존재하는 것으로 알려진 타겟 핵산의 양을 고려하여 준비될 수 있다.
일 구현예에서, 상기 기지의 양의 VP2 유전자를 함유하는 참조 샘플은 각각 101 copies/uL 내지 1010 copies/uL로부터 선택된 양을 포함하는 3개 이상이다.
특정 구현예에서, 상기 기지의 양의 VP2 유전자를 함유하는 참조 샘플은 103 copies/uL의 VP2 유전자를 포함하는 참조 샘플, 105 copies/uL의 VP2 유전자를 포함하는 참조 샘플 및 107 copies/uL의 VP2 유전자를 포함하는 참조 샘플을 포함한다.
일 구현예에서, 상기 기지의 양의 UL55 유전자를 함유하는 또 다른 참조 샘플은 각각 101 copies/uL 내지 1010 copies/uL로부터 선택된 양을 포함하는 3개 이상이다.
특정 구현예에서, 상기 기지의 양의 UL55 유전자를 함유하는 또 다른 참조 샘플은 103 copies/uL의 UL55 유전자를 포함하는 참조 샘플, 105 copies/uL의 UL55 유전자를 포함하는 참조 샘플 및 107 copies/uL의 UL55 유전자를 포함하는 참조 샘플을 포함한다.
전술한 구현예에서, 참조 샘플에 대한 핵산 증폭 반응의 조건은 본 발명에 따른 샘플에 대한 핵산 증폭 반응의 조건과 동일하다. 예를 들어, 참조 샘플을 사용한 핵산 증폭 반응의 조건(예컨대, 온도, 시간 등), 용기(또는 용기의 종류(예컨대, 플레이트 등)) 및 사용된 장치(또는 장치의 종류(예컨대, 열순환기(thermocycler) 등) 등은 샘플을 사용한 핵산 증폭 반응의 조건, 용기 및 사용된 장치 등과 동일하다.
전술한 구현예에서, 단계 (ii)에서의 역치 사이클(Ct)의 결정은 당업계에 공지된 다양한 방식에 의해 수행될 수 있다.
상기 역치 사이클은 샘플 내에 존재하는 타겟 핵산의 양과 선형 상관관계를 나타낸다. 높은 역치 사이클은 샘플 내에 존재하는 타겟 핵산의 양이 적다는 것을 나타내는 반면, 낮은 역치 사이클은 샘플 내에 존재하는 타겟 핵산의 양이 많다는 것을 나타낸다.
따라서, 103 copies/uL의 VP2 유전자를 포함하는 참조 샘플, 105 copies/uL의 VP2 유전자를 포함하는 참조 샘플 및 107 copies/uL의 VP2 유전자를 포함하는 참조 샘플에 대한 핵산 증폭 반응으로부터 역치 사이클을 결정하는 경우, 103 copies/uL의 VP2 유전자를 포함하는 참조 샘플이 가장 높은 역치 사이클을 나타낼 것이고, 107 copies/uL의 VP2 유전자를 포함하는 참조 샘플이 가장 낮은 역치 사이클을 나타낼 것이다. 이는 UL55의 참조 샘플에도 동일하게 적용될 것이다. 그러나, VP2 유전자와 UL55 유전자의 양이 동일하더라도, 이들로부터 수득되는 역치 사이클은 서로 상이할 수 있음에 유의한다.
상기 역치 사이클은 증폭 곡선에 미리 결정된 역치를 적용하여 상기 역치에 교차하는 점으로서 결정되거나, 또는 US 6,503,720호, US 6,783,934, US 10,176,293, US 8,285,489, US 7,565,250 등에 개시된 FDM(first derivative maximum), SDM(second derivative maximum) 등으로서 결정될 수 있음이 당업자에 의해 이해될 것이다. 또한, 당업자라면 상기 역치 사이클 대신에 다른 파라미터, 예컨대 Cp(crossing point), Cq(quantification cycle), △Ct, △Cp 또는 △Cq가 사용될 수 있음을 이해할 것이다.
전술한 구현예에서, 상기 역치 사이클을 상기 VP 유전자 또는 UL 유전자의 기지의 양의 로그(log) 값에 대해 플롯팅함으로써 각 표준 곡선이 수득된다.
일 구현예에서, 표준 곡선은 y 축에 역치 사이클을 갖고 x 축에 각 유전자의 양(출발 양, 로그 값)을 갖는다.
전술한 바와 같이 참조 샘플로부터 생성된 각 표준 곡선은 제1 증폭 곡선 및 제2 증폭 곡선 중 상응하는 증폭 곡선과 비교된다. 즉, 제1 증폭 곡선은 VP2 유전자에 대한 표준 곡선과 비교되고, 제2 증폭 곡선은 UL55 유전자에 대한 표준 곡선과 비교된다.
일 구현예에서, 샘플에 대한 제1 증폭 곡선으로부터 역치 사이클이 수득되고, VP2 유전자에 대한 표준 곡선에서 상기 역치 사이클(예컨대, y 축의 값)에 상응하는 VP2 유전자의 양(예컨대, x 축의 값)이 수득되며, 상기 수득된 양이 샘플 내의 BKV의 양으로 결정된다.
마찬가지로, 일 구현예에서, 제2 증폭 곡선으로부터 역치 사이클이 수득되고, UL55 유전자에 대한 표준 곡선에서 상기 역치 사이클(예컨대, y 축의 값)에 상응하는 UL55 유전자의 양(예컨대, x 축의 값)이 수득되며, 상기 수득된 양이 샘플 내의 CMV의 양으로 결정된다.
전술한 바와 같이, 본 발명의 방법은 BKV의 VP2 유전자에 혼성화가능한 제1 올리고뉴클레오타이드 세트 및 CMV의 UL55 유전자에 혼성화가능한 제2 올리고뉴클레오타이드 세트를 사용하여 샘플 내의 BK 바이러스(BKV) 및 사이토메갈로바이러스(CMV)의 동시 정량을 가능하게 한다.
본 발명의 방법에 따른 정량 결과는 샘플 내의 BKV의 정성 분석에 적용될 수 있다.
일 구현예에서, 특정 샘플에 대해 본 발명의 방법에 따라 결정된 BKV 또는 CMV의 양이 미리 결정된 수준을 초과하면 상기 샘플은 양성인 것으로 결정되는 반면, 상기 BKV 또는 CMV의 양이 미리 결정된 수준 이하이면 상기 샘플은 음성인 것으로 결정된다.
일 예로서, 특정 샘플에 대해 본 발명의 방법에 따라 결정된 BKV의 양이 500 copies/ml 및 1000 copies/ml 중 선택된 수준을 초과하면 상기 샘플은 양성인 것으로 결정되는 반면, 상기 수준 이하이면 상기 샘플은 음성인 것으로 결정될 수 있다.
다른 예로서, 특정 샘플에 대해 본 발명의 방법에 따라 결정된 BKV의 양이 34.5 IU/ml 및 137 IU/ml 중 선택된 수준을 초과하면 상기 샘플은 양성인 것으로 결정되는 반면, 상기 수준 이하이면 상기 샘플은 음성인 것으로 결정될 수 있다.
전술한 바와 같은, 미리 결정된 수준은 당업자에 의해 쉽게 결정될 수 있다.
II. 동시 정량을 위한 조성물
일 양태에 따르면, 하기를 포함하는, 샘플 내의 BK 바이러스(BKV) 및 사이토메갈로바이러스(CMV)의 동시 정량을 위한 조성물을 제공한다:
(a) BKV의 VP2 유전자에 혼성화가능한 제1 올리고뉴클레오타이드 세트;
(b) CMV의 UL55 유전자에 혼성화가능한 제2 올리고뉴클레오타이드 세트; 및
(c) 중합효소, dNTPs, 및 버퍼를 포함하는 핵산 증폭용 시약.
전술한 (a), (b) 및 (c)의 구성요소는 전술한 섹션 I에서 이미 설명하였으므로, 본 섹션에서는 그 설명을 생략하기로 한다.
특정 구현예에서, 상기 조성물은 기지의 양의 VP2 유전자를 함유하는 참조 샘플 및 기지의 양의 UL55 유전자를 함유하는 또 다른 참조 샘플을 추가로 포함한다.
특정 구현예에서, 상기 제1 올리고뉴클레오타이드 세트는 서열번호: 2의 뉴클레오타이드 서열 또는 이에 적어도 90% 상동성, 예컨대 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 또는 그 초과의 상동성을 갖는 서열을 갖는 프라이머 및 서열번호: 3의 뉴클레오타이드 서열 또는 이에 적어도 90% 상동성, 예컨대 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 또는 그 초과의 상동성을 갖는 서열을 갖는 프라이머를 포함한다.
특정 구현예에서, 상기 제1 올리고뉴클레오타이드 세트는 서열번호: 4의 뉴클레오타이드 서열 또는 이에 적어도 90% 상동성, 예컨대 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 또는 그 초과의 상동성을 갖는 서열을 갖는 프로브를 포함한다.
특정 구현예에서, 상기 제2 올리고뉴클레오타이드 세트는 서열번호: 6의 뉴클레오타이드 서열 또는 이에 적어도 90% 상동성, 예컨대 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 또는 그 초과의 상동성을 갖는 서열을 갖는 프라이머 및 서열번호: 7의 뉴클레오타이드 서열을 갖는 프라이머를 포함한다.
특정 구현예에서, 상기 제2 올리고뉴클레오타이드 세트는 서열번호: 8의 뉴클레오타이드 서열 또는 이에 적어도 90% 상동성, 예컨대 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 또는 그 초과의 상동성을 갖는 서열을 갖는 프로브를 포함한다.
본 명세서에서 달리 정의되어 있지 않는 한, 본 명세서에서 사용되는 모든 기술적 및 과학적 용어는 당업자가 일반적으로 이해하는 의미와 동일한 의미를 갖는다.
이하, 실시예를 통하여 본 발명을 보다 상세히 설명하고자 한다. 이들 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 첨부된 청구항에 제시된 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어 명백할 것이다.
실시예
실시예 1: 올리고뉴클레오타이드 세트의 타겟 커버리지(coverage) 확인
BKV를 검출하기 위한 타겟 핵산으로서 BKV의 VP2 유전자를 결정하였다. 상기 BKV의 VP2 유전자 내에서 서열 변이가 적은 보존 영역(conserved region)을 선택하였고, 상기 보존 영역에 혼성화가능한 서열번호: 2의 뉴클레오타이드 서열을 갖는 정방향 프라이머, 서열번호: 3의 뉴클레오타이드 서열을 갖는 역방향 프라이머, 및 서열번호: 4의 뉴클레오타이드 서열을 갖는 프로브를 디자인하였다. 상기 프로브의 경우, 하나의 말단에 FAM 형광 표지 및 다른 말단에 BHQ-2가 연결되어 있다. 상기 디자인된 프라이머 및 프로브를 제1 올리고뉴클레오타이드 세트로 총칭하였다.
상기 제1 올리고뉴클레오타이드 세트의 타겟 커버리지를 다음과 같이 분석하였다.
먼저, NCBI의 데이터베이스로부터 BKV(taxonomy ID: 1891762)의 게놈 서열을 수집하였다. 상기 수집 결과, 총 541개의 타겟 핵산 서열이 수집되었다. 이후, 제1 올리고뉴클레오타이드 세트 내의 서열번호: 2의 서열, 서열번호: 3의 서열, 및 서열번호: 4의 서열 각각을 상기 수집된 타겟 핵산 서열 각각과 비교하여 미스매치의 개수를 확인하였다.
상기 결과를 하기 표 1에 나타내었다.
미스매치 개수
서열번호 0 1 2 3 4 5 6 7 >=8 커버리지(%)
2 541/541 0/541 0/541 0/541 0/541 0/541 0/541 0/541 0/541 100
3 541/541 0/541 0/541 0/541 0/541 0/541 0/541 0/541 0/541 100
4 541/541 0/541 0/541 0/541 0/541 0/541 0/541 0/541 0/541 100
상기 표는 서열번호: 2, 3 및 4의 서열 각각에 대해 0, 1, 2, 3, 4, 5, 6, 7 및 8개의 미스매치된 뉴클레오타이드를 갖는 타겟 핵산의 개수를 보여준다. 상기 표 1에서 보는 바와 같이, 서열번호: 2, 3 및 4의 서열 각각은 541개의 타겟 핵산 모두와 0개의 미스매치를 갖는 것으로 나타났으며, 이는 본 발명에 따른 서열번호: 2, 3 및 4의 프라이머 및 프로브가 수집된 541개의 BKV의 게놈 서열과 100% 매치하며, 따라서 100% 타겟 커버리지를 나타낸다는 것을 입증한다.
한편, CMV를 검출하기 위한 타겟 핵산으로서 CMV의 UL55 유전자를 결정하였다. 상기 CMV의 UL55 유전자 내에서 서열 변이가 적은 보존 영역을 선택하였고, 상기 보존 영역에 혼성화가능한 서열번호: 6의 뉴클레오타이드 서열을 갖는 정방향 프라이머, 서열번호: 7의 뉴클레오타이드 서열을 갖는 역방향 프라이머, 및 서열번호: 8의 뉴클레오타이드 서열을 갖는 프로브를 디자인하였다. 상기 프로브의 경우, 하나의 말단에 Cal Red 610 형광 표지 및 다른 말단에 BHQ-2가 연결되어 있다. 상기 디자인된 프라이머 및 프로브를 제2 올리고뉴클레오타이드 세트로 총칭하였다.
상기 제2 올리고뉴클레오타이드 세트의 타겟 커버리지를 다음과 같이 분석하였다.
먼저, NCBI의 데이터베이스로부터 CMV(taxonomy ID: 10359)의 게놈 서열을 수집하였다. 상기 수집 결과, 총 523개의 타겟 핵산 서열이 수집되었다. 이후, 제2 올리고뉴클레오타이드 세트 내의 서열번호: 6의 서열, 서열번호: 7의 서열, 및 서열번호: 8의 서열 각각을 상기 수집된 타겟 핵산 서열 각각과 비교하여 미스매치의 개수를 확인하였다.
상기 결과를 하기 표 2에 나타내었다.
미스매치 개수
서열번호 0 1 2 3 4 5 6 7 >=8 커버리지(%)
6 523/523 0/523 0/523 0/523 0/523 0/523 0/523 0/523 0/523 100
7 521/523 2/523 0/523 0/523 0/523 0/523 0/523 0/523 0/523 99.6
8 521/523 0/523 0/523 0/523 0/523 0/523 0/523 0/523 0/523 99.6
상기 표는 서열번호: 6, 7 및 8의 서열 각각에 대해 0, 1, 2, 3, 4, 5, 6, 7 및 8개의 미스매치된 뉴클레오타이드를 갖는 타겟 핵산의 개수를 보여준다.
상기 표 2에서 보는 바와 같이, 서열번호: 6의 서열은 523개의 타겟 핵산 모두에 대해 0개의 미스매치를 갖는 것으로 나타났으며, 따라서, 상기 서열은 100% 타겟 커버리지를 나타내었다. 또한, 서열번호: 7 및 8의 서열은 523개의 타겟 핵산 중 521개의 타겟 핵산에 대해 0개의 미스매치를 갖고, 2개의 타겟 핵산에 대해 1개의 미스매치를 갖는 것으로 나타났다. 상기 서열번호: 7 및 8의 서열은 1개의 미스매치를 갖는 타겟 핵산에도 혼성화가능할 것으로 예상되므로, 본 발명에 따른 서열번호: 6, 7 및 8의 프라이머 및 프로브가 실질적으로 100% 타겟 커버리지를 나타낸다는 것을 확인하였다.
실시예 2: 올리고뉴클레오타이드 세트의 특이도 확인
실시예 1에서 디자인된 제1 및 제2 올리고뉴클레오타이드 세트의 특이도를 확인하였다.
먼저, BK 바이러스의 특이도 실험을 위해, 폴리오마 바이러스에 속하며 BK 바이러스와 유전적 상동성이 높은 JC 바이러스와 시미안 바이러스 40, 및 그 외에 사람에게 존재하는 것으로 알려져 있으나 본 발명에 따른 제1 올리고뉴클레오타이드 세트에 의해 검출되지 않아야 하는 균주를 포함하여 총 47종의 특이도 균주를 선택하였다.
상기 47종의 균주 각각의 지놈 DNA 10 ㎕, 상기 실시예 1에서 디자인된 제1 올리고뉴클레오타이드 세트 6.25 ㎕, 4X Master mix(final, 200 uM dNTPs, 2 mM MgCl2, 2 U의 Taq DNA 중합효소, 0.1 U의 UDG) 6.25 ㎕, 및 증류수 2.5 ㎕를 혼합하여 실시간 PCR을 위한 반응 혼합물을 준비하였다.
상기 제조된 반응 혼합물 각각을 서로 상이한 튜브에 넣어 실시간 열순환기(CFX96 Real-time Cycler, Bio-Rad)에서 95℃에서 15분 동안 변성시키고, 95℃에서 10초, 60℃에서 15초 및 72℃에서 10초의 45 사이클을 수행하였다. 상기 각 사이클 동안 72℃에서 시그널을 측정하여 증폭 곡선을 수득하였다.
상기 증폭 곡선에 미리 결정된 역치를 적용하여 각 타겟 핵산의 존재 여부를 결정하였다.
상기 결과를 하기 표 3에 나타내었다.
No. Analyte Result
1 Acinetobacter baumannii N.D.
2 Citrobacter freundii N.D.
3 Corynebacterium diphtheriae N.D.
4 Corynebacterium striatum N.D.
5 Corynebacterium urealyticus N.D.
6 Escherichia coli (O138:K81(B):H14) N.D.
7 Enterobacter cloacae subsp. cloacae N.D.
8 Enterococcus faecium N.D.
9 Escherichia coli N.D.
10 Escherichia fergusonii N.D.
11 Escherichia hermannii N.D.
12 Escherichia vulneris N.D.
13 Haemophilus aegyptius N.D.
14 Haemophilus aphrophilus N.D.
15 Listeria seeligeri N.D.
16 Listeria innocua Seeliger N.D.
17 Neisseria lactamica Hollis et al. N.D.
18 Neisseria mucosa N.D.
19 Pantoea agglomerans N.D.
20 Serratia marcescens N.D.
21 Staphylococcus capitis subsp. capitis N.D.
22 Staphylococcus hominis subsp. hominis N.D.
23 Staphylococcus epidermidis N.D.
24 Staphylococcus saprophyticus subsp. saprophyticus N.D.
25 Streptococcus pseudopneumoniae N.D.
26 Streptococcus australis N.D.
27 Streptococcus bovis N.D.
28 Streptococcus intermedius N.D.
29 Bacillus cereus N.D.
30 Bacillus subtilis N.D.
31 Salmonella bongori N.D.
32 Herpes simplex virus 1 (Strain: Maclntyre) N.D.
33 Herpes herpesvirus 2 N.D.
34 Human herpesvirus 4, Epstein Barr virus (EBV) N.D.
35 Human herpesvirus 6B N.D.
36 Human herpesvirus 6 N.D.
37 Human Herpes 7 virus (SB strain) N.D.
38 Dengue virus Type 2 N.D.
39 La Crosse Virus N.D.
40 Measles Virus N.D.
41 St. Louis Encephalitis Virus N.D.
42 International Standard for Hepatitis B virus N.D.
43 International Standard for Hepatitis C virus N.D.
44 Coxsackievirus B1_titering N.D.
45 Varicella zoster virus N.D.
46 JC virus N.D.
47 Simian virus 40 N.D.
(N.D.: Not Detected)
상기 표 3에서 보는 바와 같이, 본 발명에 따른 제1 올리고뉴클레오타이드 세트는 BKV와 높은 유전적 상동성을 갖는 JC 바이러스 및 시미안 바이러스 40을 포함하여 임상적으로 중요한 다른 균주를 검출하지 않는 것으로 나타났으며, 이는 본 발명에 따른 제1 올리고뉴클레오타이드 세트의 높은 타겟 특이성을 입증한다.
다음으로, CMV 바이러스의 특이도 실험을 위해, 헤르페스 바이러스과에 속하며 CMV 바이러스와 유전적 상동성이 높은 헤르페스 심플렉스 바이러스 1 (균주: Maclntyre), 인간 헤르페스바이러스 2, 인간 헤르페스바이러스 4 엡스타인 바 바이러스(EBV), 인간 헤르페스바이러스 6B, 인간 헤르페스바이러스 6 및 인간 헤르페스 7 바이러스(SB 균주), 및 그 외에 사람에게 존재하는 것으로 알려져 있으나 본 발명에 따른 제2 올리고뉴클레오타이드 세트에 의해 검출되지 않아야 하는 균주를 포함하여 총 47종의 특이도 균주를 선택하였다.
상기 47종의 균주 각각의 지놈 DNA 10 ㎕, 상기 실시예 1에서 디자인된 제2 올리고뉴클레오타이드 세트 6.25 ㎕, 4X Master mix(final, 200 uM dNTPs, 2 mM MgCl2, 2 U의 Taq DNA 중합효소, 0.1 U의 UDG) 6.25 ㎕, 및 증류수 2.5 ㎕를 혼합하여 실시간 PCR을 위한 반응 혼합물을 준비하였다.
상기 제조된 반응 혼합물 각각을 서로 상이한 튜브에 넣어 실시간 열순환기(CFX96 Real-time Cycler, Bio-Rad)에서 95℃에서 15분 동안 변성시키고, 95℃에서 10초, 60℃에서 15초 및 72℃에서 10초의 45 사이클을 수행하였다. 상기 각 사이클 동안 72℃에서 시그널을 측정하여 증폭 곡선을 수득하였다.
상기 증폭 곡선에 미리 결정된 역치를 적용하여 각 타겟 핵산의 존재 여부를 결정하였다.
상기 결과를 하기 표 4에 나타내었다.
No. Analyte Result
1 Acinetobacter baumannii N.D.
2 Citrobacter freundii N.D.
3 Corynebacterium diphtheriae N.D.
4 Corynebacterium striatum N.D.
5 Corynebacterium urealyticus N.D.
6 Escherichia coli (O138:K81(B):H14) N.D.
7 Enterobacter cloacae subsp. cloacae N.D.
8 Enterococcus faecium N.D.
9 Escherichia coli N.D.
10 Escherichia fergusonii N.D.
11 Escherichia hermannii N.D.
12 Escherichia vulneris N.D.
13 Haemophilus aegyptius N.D.
14 Haemophilus aphrophilus N.D.
15 Listeria seeligeri N.D.
16 Listeria innocua Seeliger N.D.
17 Neisseria lactamica Hollis et al. N.D.
18 Neisseria mucosa N.D.
19 Pantoea agglomerans N.D.
20 Serratia marcescens N.D.
21 Staphylococcus capitis subsp. capitis N.D.
22 Staphylococcus hominis subsp. hominis N.D.
23 Staphylococcus epidermidis N.D.
24 Staphylococcus saprophyticus subsp. saprophyticus N.D.
25 Streptococcus pseudopneumoniae N.D.
26 Streptococcus australis N.D.
27 Streptococcus bovis N.D.
28 Streptococcus intermedius N.D.
29 Bacillus cereus N.D.
30 Bacillus subtilis N.D.
31 Salmonella bongori N.D.
32 Herpes simplex virus 1 (Strain: Maclntyre) N.D.
33 human herpesvirus 2 N.D.
34 Human herpesvirus 4, Epstein Barr virus (EBV) N.D.
35 Human herpesvirus 6B N.D.
36 Human herpesvirus 6 N.D.
37 Human Herpes 7 virus (SB strain) N.D.
38 Dengue virus Type 2 N.D.
39 La Crosse Virus N.D.
40 Measles Virus N.D.
41 St. Louis Encephalitis Virus N.D.
42 International Standard for Hepatitis B virus N.D.
43 International Standard for Hepatitis C virus N.D.
44 Coxsackievirus B1_titering N.D.
45 Varicella zoster virus N.D.
46 JC virus N.D.
47 Simian virus 40 N.D.
(N.D.: Not Detected)
상기 표 4에서 보는 바와 같이, 본 발명에 따른 제2 올리고뉴클레오타이드 세트는 CMV와 높은 유전적 상동성을 갖는 헤르페스 심플렉스 바이러스 1 (균주: Maclntyre), 인간 헤르페스바이러스 2, 인간 헤르페스바이러스 4 엡스타인 바 바이러스(EBV), 인간 헤르페스바이러스 6B, 인간 헤르페스바이러스 6 및 인간 헤르페스 7 바이러스(SB 균주)를 포함하여 임상적으로 중요한 다른 균주를 검출하지 않는 것으로 나타났으며, 이는 본 발명에 따른 제2 올리고뉴클레오타이드 세트의 높은 타겟 특이성을 입증한다.
실시예 3: 타겟 핵산의 정량
실시예 1에서 디자인된 제1 및 제2 올리고뉴클레오타이드 세트가 타겟 핵산을 정량하는 데 효과적인지 확인하였다.
먼저, BKV에 대해 임상적으로 양성인 것으로 확인된 혈장 샘플 32개 및 BKV에 대해 음성인 것으로 확인된 혈장 샘플 98개를 포함하는 총 130개의 혈장 샘플 각각에 대하여 본 발명에 따른 제1 올리고뉴클레오타이드 세트를 이용한 실시간 PCR을 수행하였다.
상기 혈장 샘플로부터 QIAsymphony DSP Virus/pathogen Midi Kit(Qiagen, Cat. No. 937055)를 사용하여 게놈 DNA를 추출하였다. 이후, 상기 추출된 게놈 DNA를 상기 실시예 1에 기재된 실시간 PCR에 적용하여 제1 증폭 곡선을 수득하였다.
그 다음, 상기 제1 증폭 곡선에 역치로서 RFU 300을 적용하여 Ct 값을 계산하였다.
이후, 미리 준비된 BKV의 VP2 유전자에 대한 표준 곡선에 상기 제1 증폭 곡선에서의 Ct 값을 대입하여 BKV의 양을 계산하였다.
상기 계산된 BKV의 양이 500 copies/ml을 초과하면 샘플을 양성으로 결정하고, 상기 수준 이하이면 샘플을 음성으로 결정하였다.
상기 결과를 하기 표 5에 나타내었다.
양성 결정 음성 결정
양성 샘플 = 32개 32개 0개
음성 샘플 = 98개 0개 98개
상기 표 5에서 보는 바와 같이, 본 발명에 따른 제1 올리고뉴클레오타이드 세트를 사용한 실시간 PCR은 BKV에 대한 양성 샘플 32개를 모두 양성으로 결정하였고, 음성 샘플 98개를 모두 음성으로 결정하였다. 따라서, 본 발명에 따른 제1 올리고뉴클레오타이드 세트는 BKV의 양성 및 음성 샘플을 정확히 정량/정성할 수 있음이 확인되었다.
다음으로, CMV에 대해 임상적으로 양성인 것으로 확인된 혈장 샘플 33개 및 CMV에 대해 음성인 것으로 확인된 혈장 샘플 97개를 포함하는 총 130개의 혈장 샘플에 대하여 본 발명에 따른 제2 올리고뉴클레오타이드를 이용한 실시간 PCR을 수행하였다.
상기 혈장 샘플로부터 QIAsymphony DSP Virus/pathogen Midi Kit(Qiagen, Cat. No. 937055)를 사용하여 게놈 DNA를 추출하였다. 이후, 상기 추출된 게놈 DNA를 상기 실시예 1에 기재된 실시간 PCR에 적용하여 제2 증폭 곡선을 수득하였다.
그 다음, 상기 제2 증폭 곡선에 역치로서 RFU 300을 적용하여 Ct 값을 계산하였다.
이후, 미리 준비된 CMV의 UL55 유전자에 대한 표준 곡선에 상기 제2 증폭 곡선에서의 Ct 값을 대입하여 CMV의 양을 계산하였다.
상기 계산된 CMV의 양이 34.5 IU/ml을 초과하면 샘플을 양성으로 결정하고, 상기 수준 이하이면 샘플을 음성으로 결정하였다.
상기 결과를 하기 표 6에 나타내었다.
양성 결정 음성 결정
양성 샘플 = 33개 33개 0개
음성 샘플 = 98개 5개 92개
상기 표 6에서 보는 바와 같이, 본 발명에 따른 제2 올리고뉴클레오타이드 세트를 사용한 실시간 PCR은 CMV에 대한 양성 샘플 33개 모두를 양성으로 결정하였고, CMV에 대한 음성 샘플 97개 중 92개는 음성으로 결정하였으나 5개는 양성으로 결정하였다.
본 발명에 따른 실시간 PCR에 의해 양성으로 판정된 음성 샘플 5개에 대해, 시퀀싱에 의해 CMV를 함유하고 있는지 확인하였다. 시퀀싱 결과, 상기 음성 샘플 5개는 모두 CMV를 함유하고 있는 것으로 나타났다. 하지만, 상기 수집된 음성 샘플은 CMV의 양이 137 IU/ml 이하일 때 음성 샘플로 결정하는 반면, 본 발명의 방법의 경우 CMV의 양이 34.5 IU/ml 초과이면 음성으로 결정한다. 상기 5개의 샘플은 34.5 IU/ml 내지 137 IU/ml 사이의 CMV의 양을 함유하고 있는 것으로 나타났다. 이러한 차이는 음성으로 결정하는 기준의 차이에 의한 것일 뿐, 본 발명에 따른 제2 올리고뉴클레오타이드 세트는 CMV의 양성 및 음성 샘플을 정확히 정량/정성할 수 있음이 확인되었다.
상기 결과에서 보는 바와 같이, 본 발명에 따른 방법은 높은 민감도 및 특이도로 보다 정확한 BKV 및 CMV의 동시 진단을 가능하게 한다.

Claims (25)

  1. 하기 단계를 포함하는, 샘플 내의 BK 바이러스(BKV) 및 사이토메갈로바이러스(CMV)의 동시 정량 방법:
    (a) 단일 반응 용기에서 샘플을 BKV의 VP2 유전자에 혼성화가능한 제1 올리고뉴클레오타이드 세트 및 CMV의 UL55 유전자에 혼성화가능한 제2 올리고뉴클레오타이드 세트와 접촉시키는 것을 포함하는 핵산 증폭 반응을 수행하는 단계로서, 상기 핵산 증폭 반응은 샘플 내에 BKV의 존재시 BKV의 VP2 유전자의 증폭을 나타내는 제1 증폭 곡선을 생성하고, 샘플 내에 CMV의 존재시 CMV의 UL55 유전자의 증폭을 나타내는 제2 증폭 곡선을 생성하며; 및
    (b) 상기 생성된 제1 증폭 곡선을 기지의 양의 VP2 유전자를 함유하는 참조 샘플로부터 생성된 표준 곡선과 비교하여 상기 샘플 내의 BKV의 양을 결정하고, 상기 생성된 제2 증폭 곡선을 기지의 양의 UL55 유전자를 함유하는 또 다른 참조 샘플로부터 생성된 표준 곡선과 비교하여 상기 샘플 내의 CMV의 양을 결정하는 단계.
  2. 제1항에 있어서, 상기 제1 올리고뉴클레오타이드 세트는 서열번호: 1의 뉴클레오타이드 서열 또는 이의 보체에 혼성화가능한 복수의 올리고뉴클레오타이드를 포함하는 것을 특징으로 하는 방법.
  3. 제2항에 있어서, 상기 복수의 올리고뉴클레오타이드 중 적어도 하나는 1-3개의 데옥시이노신을 갖고; 상기 데옥시이노신 중 1개 또는 2개는 올리고뉴클레오타이드의 3'-말단에 있는 3번째 뉴클레오타이드 내지 6번째 뉴클레오타이드 범위의 코어 영역에 위치하며, 나머지는 올리고뉴클레오타이드의 5'-말단에 있는 4번째 뉴클레오타이드 내지 3'-말단에 있는 7번째 뉴클레오타이드 범위의 영역에 위치하는 것을 특징으로 하는 방법.
  4. 제1항에 있어서, 상기 제1 올리고뉴클레오타이드 세트는 JC 바이러스 또는 시미안 바이러스 40의 게놈 서열에 혼성화가능한 올리고뉴클레오타이드를 포함하지 않는 것을 특징으로 하는 방법.
  5. 제2항에 있어서, 상기 제1 올리고뉴클레오타이드 세트는 서열번호: 2의 뉴클레오타이드 서열을 갖는 프라이머 및 서열번호: 3의 뉴클레오타이드 서열을 갖는 프라이머를 포함하는 것을 특징으로 하는 방법.
  6. 제2항에 있어서, 상기 제1 올리고뉴클레오타이드 세트는 서열번호: 4의 뉴클레오타이드 서열을 갖는 프로브를 포함하는 것을 특징으로 하는 방법.
  7. 제6항에 있어서, 상기 프로브는 검출가능한 형광 표지 및 상기 형광 표지로부터의 시그널을 퀀칭할 수 있는 퀀칭 모이어티를 포함하는 것을 특징으로 하는 방법.
  8. 제1항에 있어서, 상기 제2 올리고뉴클레오타이드 세트는 서열번호: 5의 뉴클레오타이드 서열 또는 이의 보체에 혼성화가능한 복수의 올리고뉴클레오타이드를 포함하는 것을 특징으로 하는 방법.
  9. 제8항에 있어서, 상기 복수의 올리고뉴클레오타이드 중 적어도 하나는 1-3개의 데옥시이노신을 갖고; 상기 데옥시이노신 중 1개 또는 2개는 올리고뉴클레오타이드의 3'-말단에 있는 3번째 뉴클레오타이드 내지 6번째 뉴클레오타이드 범위의 코어 영역에 위치하며, 나머지는 올리고뉴클레오타이드의 5'-말단에 있는 4번째 뉴클레오타이드 내지 3'-말단에 있는 7번째 뉴클레오타이드 범위의 영역에 위치하는 것을 특징으로 하는 방법.
  10. 제1항에 있어서, 상기 제2 올리고뉴클레오타이드 세트는 헤르페스 심플렉스 바이러스 1, 인간 헤르페스바이러스 2, 인간 헤르페스바이러스 4, 인간 헤르페스바이러스 6B, 인간 헤르페스바이러스 6, 또는 인간 헤르페스 7 바이러스의 게놈 서열에 혼성화가능한 올리고뉴클레오타이드를 포함하지 않는 것을 특징으로 하는 방법.
  11. 제8항에 있어서, 상기 제2 올리고뉴클레오타이드 세트는 서열번호: 6의 뉴클레오타이드 서열을 갖는 프라이머 및 서열번호: 7의 뉴클레오타이드 서열을 갖는 프라이머를 포함하는 것을 특징으로 하는 방법.
  12. 제8항에 있어서, 상기 제2 올리고뉴클레오타이드 세트는 서열번호: 8의 뉴클레오타이드 서열을 갖는 프로브를 포함하는 것을 특징으로 하는 방법.
  13. 제12항에 있어서, 상기 프로브는 검출가능한 형광 표지 및 상기 형광 표지로부터의 시그널을 퀀칭할 수 있는 퀀칭 모이어티를 포함하는 것을 특징으로 하는 방법.
  14. 제1항에 있어서, 상기 핵산 증폭 반응은 실시간 PCR 또는 등온 증폭 반응인 것을 특징으로 하는 방법.
  15. 제1항에 있어서, 상기 기지의 양의 VP2 유전자를 함유하는 참조 샘플은 각각 101 copies/uL 내지 1010 copies/uL로부터 선택된 양을 포함하는 3개 이상인 것을 특징으로 하는 방법.
  16. 제1항에 있어서, 상기 기지의 양의 UL55 유전자를 함유하는 또 다른 참조 샘플은 각각 101 copies/uL 내지 1010 copies/uL로부터 선택된 양을 포함하는 3개 이상인 것을 특징으로 하는 방법.
  17. 제1항에 있어서, 상기 샘플은 신장 이식을 받은 대상체로부터 채취한 전혈, 혈장 또는 혈청인 것을 특징으로 하는 방법.
  18. 제17항에 있어서, 상기 대상체는 신장 이식을 받은 후 1년 이하인 것을 특징으로 하는 방법.
  19. 제1항에 있어서, 상기 샘플은 5 내지 15 ul의 부피를 가지며, 상기 핵산 증폭 반응의 총 부피는 20 내지 30 ul인 것을 특징으로 하는 방법.
  20. 하기를 포함하는, 샘플 내의 BK 바이러스(BKV) 및 사이토메갈로바이러스(CMV)의 동시 정량을 위한 조성물:
    (a) BKV의 VP2 유전자에 혼성화가능한 제1 올리고뉴클레오타이드 세트;
    (b) CMV의 UL55 유전자에 혼성화가능한 제2 올리고뉴클레오타이드 세트; 및
    (c) 중합효소, dNTPs, 및 버퍼를 포함하는 핵산 증폭용 시약.
  21. 제20항에 있어서, 상기 조성물은 기지의 양의 VP2 유전자를 함유하는 참조 샘플 및 기지의 양의 UL55 유전자를 함유하는 또 다른 참조 샘플을 추가로 포함하는 것을 특징으로 하는 조성물.
  22. 제20항에 있어서, 상기 제1 올리고뉴클레오타이드 세트는 서열번호: 2의 뉴클레오타이드 서열을 갖는 프라이머 및 서열번호: 3의 뉴클레오타이드 서열을 갖는 프라이머를 포함하는 것을 특징으로 하는 조성물.
  23. 제20항에 있어서, 상기 제1 올리고뉴클레오타이드 세트는 서열번호: 4의 뉴클레오타이드 서열을 갖는 프로브를 포함하는 것을 특징으로 하는 조성물.
  24. 제1항에 있어서, 상기 제2 올리고뉴클레오타이드 세트는 서열번호: 6의 뉴클레오타이드 서열을 갖는 프라이머 및 서열번호: 7의 뉴클레오타이드 서열을 갖는 프라이머를 포함하는 것을 특징으로 하는 조성물.
  25. 제1항에 있어서, 상기 제2 올리고뉴클레오타이드 세트는 서열번호: 8의 뉴클레오타이드 서열을 갖는 프로브를 포함하는 것을 특징으로 하는 조성물.
PCT/KR2024/005857 2023-06-13 2024-04-30 샘플 내의 bk 바이러스 및 사이토메갈로바이러스의 동시 정량 방법 Ceased WO2024258052A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020257030948A KR20250169531A (ko) 2023-06-13 2024-04-30 샘플 내의 bk 바이러스 및 사이토메갈로바이러스의 동시 정량 방법

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20230075834 2023-06-13
KR10-2023-0075834 2023-06-13

Publications (1)

Publication Number Publication Date
WO2024258052A1 true WO2024258052A1 (ko) 2024-12-19

Family

ID=93852247

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2024/005857 Ceased WO2024258052A1 (ko) 2023-06-13 2024-04-30 샘플 내의 bk 바이러스 및 사이토메갈로바이러스의 동시 정량 방법

Country Status (2)

Country Link
KR (1) KR20250169531A (ko)
WO (1) WO2024258052A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102344970A (zh) * 2010-07-27 2012-02-08 温州医学院附属第一医院 同时检测人cmv和bk病毒dna的引物序列及定量检测试剂盒
CN102363818A (zh) * 2011-06-28 2012-02-29 同昕生物技术(北京)有限公司 同时检测人ebv、bkv和 cmv的三重实时荧光定量pcr方法及试剂盒
KR20190092611A (ko) * 2016-12-29 2019-08-07 주식회사 씨젠 프라이머 다이머 형성을 감소시키고 증폭 효율을 증가시키는 방법

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102344970A (zh) * 2010-07-27 2012-02-08 温州医学院附属第一医院 同时检测人cmv和bk病毒dna的引物序列及定量检测试剂盒
CN102363818A (zh) * 2011-06-28 2012-02-29 同昕生物技术(北京)有限公司 同时检测人ebv、bkv和 cmv的三重实时荧光定量pcr方法及试剂盒
KR20190092611A (ko) * 2016-12-29 2019-08-07 주식회사 씨젠 프라이머 다이머 형성을 감소시키고 증폭 효율을 증가시키는 방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
AHMED HIND HAIDAR, ALTYAB HISHAM N., SAEED SAMAR M., ABDALLA WAFAA MOHAMMED, OMER ALFADIL ELOBEID: "Molecular Detection and Glycoprotein B (UL55) Genotyping of Cytomegalovirus among Sudanese Renal Transplant Recipients", BIOMED RESEARCH INTERNATIONAL, HINDAWI PUBLISHING CORPORATION, vol. 2022, no. 1, 1 January 2022 (2022-01-01), pages 1 - 9, XP093248608, ISSN: 2314-6133, DOI: 10.1155/2022/5403694 *
WU CUN-ZAO, CHEN XIAO-QIAN, WANG ZHANG-YANG, PAN XIAO-DONG, BAI YONG-HENG, YANG YI-RONG, ZHENG SHAO-LING, XIA PENG: "Simultaneous monitoring of CMV and BKV by quantitative PCR in renal transplant recipients", JOURNAL OF VIROLOGICAL METHODS, ELSEVIER BV, NL, vol. 210, 1 December 2014 (2014-12-01), NL , pages 40 - 44, XP093248564, ISSN: 0166-0934, DOI: 10.1016/j.jviromet.2014.09.018 *

Also Published As

Publication number Publication date
KR20250169531A (ko) 2025-12-03

Similar Documents

Publication Publication Date Title
WO2013133680A1 (ko) 핫스타트 역전사반응 또는 핫스타트 역전사 중합효소 연쇄반응용 조성물
WO2011149255A2 (en) Modified rnase h and detection of nucleic acid amplification
WO2022265463A1 (en) Detection of multiple target nucleic acid using multiple detection temperatures
WO2012030136A2 (en) Oligonucleotides for detecting listeria spp. and use thereof
WO2012046981A2 (en) Real time pcr detection of single nucleotide polymorphisms
WO2025009802A1 (ko) 단일 신호로 2가지 이상의 다중 표적핵산을 검출하기 위한 pcr 방법
WO2021261864A1 (en) Method for providing preparation for detecting target nucleic acid sequence in specimen
JP7693035B2 (ja) 水痘帯状疱疹ウイルスを増幅または検出するための組成物および方法
WO2020145711A1 (ko) Egfr 돌연변이 검출을 위한 dna 중합효소 및 이를 포함하는 키트
WO2026005528A1 (ko) 시료 내 타겟 분석물에 대한 데이터 세트의 보정 방법 및 장치
WO2023219343A1 (ko) 샘플 핸들링 시스템을 이용하여 샘플 내 핵산 증폭 반응을 위한 반응 혼합물을 준비하는 방법
WO2020060003A1 (ko) 락토바실러스 애시도필러스 균주 판별용 조성물 및 이를 이용한 판별방법
EP4301880A1 (en) Method for detection of sars-cov-2 mutations
WO2022045843A1 (en) Method for positive control reaction using pre-positive control composition
WO2024005458A1 (ko) 베타-하이드록시산을 이용한 타겟 핵산의 증폭 방법
WO2023195780A1 (en) Method for detecting three target nucleic acids in sample
WO2025089722A1 (en) Composition for lysing cells in biological sample and method for detecting target nucleic acid using same
WO2024186140A1 (ko) 인공핵산을 이용한 표적핵산의 검출 방법
WO2013081207A1 (ko) 살모넬라 종 및 대장균 0157:h7의 표적 서열을 동시에 증폭하는 방법 및 그를 위한 키트
WO2024181774A1 (en) Detection of target nucleic acid by lpho-assisted pto cleavage and extension assay
WO2025116499A1 (en) Method for analyzing activity of nucleic acid polymerase using self-dimer primer
WO2023146243A1 (ko) 샘플 내 타겟 핵산을 검출하는 방법
WO2026005351A1 (ko) 내재 내부 대조군으로 corynebacterium spp. 또는 cutibacterium spp.를 이용하여 피부로부터 채취한 시료로부터 타겟 미생물의 핵산을 검출하는 방법
WO2024106890A1 (ko) 퀀칭-pto 절단 및 연장(quenching-pto cleavage and extension; q-ptoce) 어세이에 의한 타겟 핵산의 검출
WO2025053620A1 (ko) 3개의 프로브를 이용하여 타겟 핵산을 검출하는 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 24823573

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 1020257030948

Country of ref document: KR

Free format text: ST27 STATUS EVENT CODE: A-0-1-A10-A15-NAP-PA0105 (AS PROVIDED BY THE NATIONAL OFFICE)

WWE Wipo information: entry into national phase

Ref document number: KR1020257030948

Country of ref document: KR

NENP Non-entry into the national phase

Ref country code: DE