WO2024252011A2 - Circular rnas and methods for making the same - Google Patents

Circular rnas and methods for making the same Download PDF

Info

Publication number
WO2024252011A2
WO2024252011A2 PCT/EP2024/065837 EP2024065837W WO2024252011A2 WO 2024252011 A2 WO2024252011 A2 WO 2024252011A2 EP 2024065837 W EP2024065837 W EP 2024065837W WO 2024252011 A2 WO2024252011 A2 WO 2024252011A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
recombinant nucleic
acid molecule
sequence
eaca
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2024/065837
Other languages
English (en)
French (fr)
Other versions
WO2024252011A3 (en
Inventor
Yifei DU
Venkatraman Ramakrishnan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
United Kingdom Research and Innovation
Original Assignee
United Kingdom Research and Innovation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by United Kingdom Research and Innovation filed Critical United Kingdom Research and Innovation
Priority to KR1020267000650A priority Critical patent/KR20260038314A/ko
Priority to AU2024285014A priority patent/AU2024285014A1/en
Priority to CN202480051929.9A priority patent/CN121773210A/zh
Priority to EP24732591.3A priority patent/EP4724586A2/en
Publication of WO2024252011A2 publication Critical patent/WO2024252011A2/en
Publication of WO2024252011A3 publication Critical patent/WO2024252011A3/en
Priority to PCT/EP2025/065903 priority patent/WO2025252998A2/en
Priority to IL325227A priority patent/IL325227A/he
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/50—Physical structure
    • C12N2310/53—Physical structure partially self-complementary or closed
    • C12N2310/532—Closed or circular

Definitions

  • an important feature of the invention is the presence of an extended anticodon arm (eACA) sequence provided in the recombinant nucleic acid molecule to be circularized.
  • eACA extended anticodon arm
  • This sequence provides a structure that is structurally similar to the anticodon arm found in Ana tRNA, comprising a stem and a loop, and enables circularization with greater efficiency compared to existing PIE methods and methods such as those described in WO2022/191642.
  • eACA sequences that is, sequences capable of forming a stem-loop structure as described herein
  • the recombinant nucleic acid molecules described herein may produce circular RNAs comprising only the gene of interest, without exogenous splicing sequences or unwanted spacer sequences, and may do so in a highly efficient way by utilising the propensity of the eACA sequence to form a stem-loop structure.
  • EGS - extended guide sequence elGS - extended internal guide sequence eACA - anticodon arm-like structure GOI - gene of interest IGS - internal guide sequence
  • nucleic acid molecules are provided herein for making circular RNAs.
  • the nucleic acid molecules are generally linear prior to circularization.
  • the nucleic acid molecule for circularization comprises the gene of interest (GOI), which is the gene to be circularized, a ribozyme, capable of performing the circularization, and an extended anticodon arm (eACA) sequence, split into two portions.
  • GOI gene of interest
  • eACA extended anticodon arm
  • the ribozyme may be any ribozyme capable of acting as a trans-splicing ribozyme.
  • the ribozyme is derived from or is a group I intron.
  • suitable ribozymes are the Tetrahymena ribosomal intron, T4 phage thymidylate synthase intron, Anabaena (Ana) pre-tRNA intron, Azoarcus sp. BH72 lie tRNA intron, and Staphylococcus phage Twort ribonucleotide reductase intron. Sequences of these ribozymes are shown below, with the internal guide sequence (IGS) shown with underlined, shaded letters.
  • IGS internal guide sequence
  • Tetrahymena ribosomal intron AAATAG CAATATTTACCTTTGGAGGGAAAAGTTATCAGGCATG CACCTG GTAG CTAGTCTTTAAAC CAATAGATTGCATCGGTTTAAAAGGCAAGACCGTCAAATTGCGGGAAAGGTCAACAGCCGTTC AGTACCAAGTCTCAGGGGAAACTTTGAGATGGCCTTGCAAAGGGTATGGTAATAAGCTGACGGA CATGGTCCTAACCACGCAGCCAAGTCCTAAGTCAACAGATCTTCTGTTGATATGGATGCAGTTCA CAGACTAAATGTCGGTCGGGGAAGATGTATTCTTCTCATAAGATATAGTCGGACCTCCTTAATG GGAGCTAGCGGATGAAGTGATGCAACACTGGAGCCGCTGGGAACTAATTTGTATGCGAAAGTAT ATTGATTAGTTTTGGAGTACTCG (SEQ ID NO: 3)
  • Staphylococcus phage Twort ribonucleotide reductase intron Staphylococcus phage Twort ribonucleotide reductase intron:
  • Recombinant nucleic acid molecules described herein also generally comprise an internal guide sequence (IGS).
  • IGS may be part of the ribozyme, such as part of the group I intron. Generally, this enables the TRIO approach to use an intact intron. However, it is possible to use a truncated ribozyme sequence in the TRIO method, with the native IGS removed and replaced by a different IGS to that which would normally be present.
  • the function of the IGS is to base pair with the end regions of the gene of interest, in order to bring them into proximity with each other so that circularization may occur.
  • the IGS binds through complementary base pairing to both first and second portions of the eACA sequence, which are located at either end of the GOI to be circularised.
  • An extended anticodon arm (eACA) sequence is one which is capable of forming a stem-loop structure (also known as a hairpin or hairpin loop).
  • Stem-loop structures form when two regions of single-stranded RNA which are generally complementary to each other (when read in opposite directions) base-pair with each other. The base-pairing results in a double helix structure ending in an unpaired loop.
  • the natural propensity of eACA sequences to form stem-loop structures may be utilised to enable circularization of a gene of interest, as shown in Figure 12.
  • the linear recombinant nucleic acid molecule Prior to circularization, the linear recombinant nucleic acid molecule comprises an eACA sequence in two separate portions. A first portion of the eACA sequence is positioned at or near the 5’ end of the gene of interest, and a second portion of the eACA sequence is positioned at or near the 3’ end of the gene of interest, as shown in Figure 10A (top panel).
  • splicing by the trans- ribozyme causes the first and second portions of the eACA sequence to be covalently joined, in order to create a circular version of the gene of interest.
  • the first and second portions are joined to form the eACA sequence, which is generally capable of forming a stemloop structure as shown in Figure 8C, Figure 10A, and Figure 12.
  • the first portion of the eACA sequence may comprise a first eACA stem portion and a first eACA loop portion.
  • the second portion of the eACA sequence may comprise a second eACA stem portion and a second eACA loop portion.
  • stem portion it is meant a part of the first (or second) portion of the eACA sequence that is capable of forming the stem of a stem-loop structure.
  • loop portion it is meant a part of the first (or second) portion of the eACA sequence that is capable of forming the loop of a stem-loop structure.
  • Figure 12 shows how a stem-loop forming structure can be identified in a gene of interest, and subsequently used for circularizing the RNA.
  • the stem and loop portions of the eACA sequence are capable of forming a stem-loop structure in the recombinant nucleic acid molecules described herein.
  • the specific nucleotide sequence of the eACA sequence is not important for TRIC and does not determine whether circularization will occur. Rather, it is the structure as opposed to the sequence of the eACA that is important. Consequently, the eACA may be of any nucleotide sequence, provided that the last nucleotide in the second eACA loop portion is one which can form a wobble base pair with a corresponding nucleotide in the internal guide sequence described herein.
  • the last nucleotide in the second eACA loop portion may be a uracil that forms a wobble base pair with a corresponding guanine in the internal guide sequence.
  • the last nucleotide in the second eACA loop portion may be a cytosine that forms a wobble base pair with a corresponding adenine in the internal guide sequence.
  • the first and second eACA stem portions may be complementary to each other, though this is not necessary.
  • the first and second eACA stem portions are generally each at least 5 nucleotides in length but may be a short as 1 nucleotide in length each.
  • the stem portion lengths may be adapted depending on the gene of interest to be circularized. For example, longer stem lengths (such as lengths greater than 15 nt) may be advantageous if circularizing long (>500 nt) genes of interest.
  • the first and second stem portions may each be at least 1 , at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25 or at least 30 nucleotides in length.
  • the first and second stem portions may each be at least 15 or at least 25 nucleotides in length.
  • the first and second eACA stem portions may be 1 to 50 nucleotides in length, for example 5 to 40 nucleotides.
  • the first and second stem portions need not be the same length, for example one stem portion may be one or two nucleotides shorter than the other, provided a stem-loop structure can still be formed.
  • the anticodon arm loop of the Ana tRNA group I intron is naturally 7 nucleotides in length. Consequently, in the circular RNAs described herein, the loop of the stem-loop structure may be 7 nucleotides in length, particularly when the ribozyme used is, or is derived from, the Ana group I intron. If other group I introns are used, the loop of the stem-loop structure may have a different nucleotide length.
  • the loop of the stem-loop structure may be between 3 to 40 nucleotides in length and is generally between 3 and 10 nucleotides in length.
  • the loop of the stem-loop structure is at least 3 nucleotides in length, at least 4 nucleotides in length or at least 5 nucleotides in length, particularly if the ribozyme is or is derived from the Ana group I intron. In some embodiments, the loop of the stem-loop structure is generally between 5 and 11 nucleotides in length.
  • the first eACA loop portion comprises 4 nucleotides
  • the second eACA loop portion comprises 3 nucleotides.
  • the first and second eACA stem portions may each be at least 15 nucleotides in length
  • the first eACA loop portion may be 4 nucleotides in length
  • the second eACA loop portion may be 3 nucleotides in length.
  • the first portion of the eACA sequence may comprise as few as 5 nucleotides (for example, 1 stem nucleotide and 4 loop nucleotides).
  • the second portion of the eACA sequence may comprise as few as 4 nucleotides (for example, 1 stem nucleotides and 3 loop nucleotides).
  • the first portion of the eACA sequence may comprise, for example, 19 nucleotides (e.g. 15 stem nucleotides and 4 loop nucleotides), or 29 nucleotides (e.g. 25 stem nucleotides and 4 loop nucleotides).
  • the second portion of the eACA sequence may comprise, for example, 18 nucleotides (e.g. 15 stem nucleotides and 3 loop nucleotides), or 28 nucleotides (e.g. 25 stem nucleotides and 3 loop nucleotides).
  • An exemplary first portion of the eACA sequence comprising a 1 nucleotide stem and a 4 nucleotide loop may comprise the nucleotide sequence 5 -NNNNN-3’, wherein N is any nucleotide
  • an exemplary second portion of the eACA sequence comprising a 1 nucleotide stem and a 3 nucleotide loop may comprise the nucleotide sequence 5’-NNNU-3’, wherein N is any nucleotide.
  • a possible ACA sequence is GATCACCACTTTAAGGTGATC (SEQ ID NO: 58).
  • the NLuc GOI is rearranged such that the ACA sequence is provided in two portions (a 5’ first portion and a 3’ second portion).
  • the first portion of the eACA sequence comprises the sequence TTAAGGTGATC (SEQ ID NO: 59).
  • the second portion of the eACA sequence comprises the sequence GATCACCACT (SEQ ID NO: 60).
  • the first and second eACA loop portions base pair with the internal guide sequence (IGS) to form the P1 and P10 regions, which are critical for ribozyme activity.
  • the first eACA loop portion positioned towards the 5’ end of the gene of interest, base pairs with the IGS to form the P10 region. It is not necessary for all the nucleotides in the first eACA loop portion to form the P10 region, and in some cases only two nucleotides of the first eACA loop portion form the P10 region.
  • the second eACA loop portion positioned towards the 3’ end of the gene of interest, base pairs with the IGS to form the P1 region.
  • the last nucleotide of the second eACA loop portion may form a wobble base pair with a corresponding nucleotide in the IGS.
  • the wobble base pair is a GU wobble base pair, with G in the IGS and U in the second eACA loop portion or an AC wobble base pair with A in the IGS and C in the second eACA loop portion.
  • the wobble base pair provides the circularization site, such that once circularized, the nucleotide at the 3’ end of the second eACA loop portion forms the third nucleotide in the loop of the eACA stem-loop structure. This is depicted in Figure 8C.
  • the P1 region may also be formed by base pairing of the IGS with a region adjacent to the second eACA loop portion in the 3’ direction, known as the “P1 extension”. If present, the P1 extension typically comprises between 2 and 4 nucleotides, which base pair with the IGS. The P1 region may therefore be formed by the P1 extension and second eACA loop portion base pairing with the IGS, as shown in Figure 10A. Consequently, in some embodiments, the second portion of the eACA sequence and the P1 extension together are capable of forming a P1 region. If the P1 extension is not present, the P1 region is formed by only the second eACA loop portion base pairing with the IGS. P1 extensions have been described in Olson & Muller (2012) RNA 18:581-589. The contents of which are incorporated herein by reference. Generally, if an extended guide sequence (EGS) is used, the P1 extension region will be present.
  • EGS extended guide sequence
  • a particular advantage of the TRIC method is that it may utilise eACA sequences which are already present in the gene of interest. For example, if a stem-loop forming eACA sequence can be found in a gene of interest, this gene may be circularized efficiently without introducing any additional sequences. This in turn means that the resulting circular RNA is far less likely to be immunogenic.
  • Figure 12 shows first the identification of an eACA sequence (i.e. a stem-loop forming structure) in a gene of interest. Subsequently, the gene of interest is rearranged such that the eACA sequence is split into two portions, one at each end of the gene of interest. This rearranged gene is then cloned into the TRIC construct for circularization.
  • This circular RNA already comprises an eACA sequence in its natural sequence. This means a circularization site can be introduced using the naturally occurring eACA sequence, without the need to perform mutations or introduce additional sequence.
  • Codon redundancy means that mutations may be made to the nucleotide sequence of the GOI without affecting the resulting peptide sequence. Consequently, an eACA sequence may be provided in the GOI without requiring the introduction of additional sequences. Instead, only selective mutation of the existing sequence is needed, following the rules of codon redundancy. Examples of this are the T2A-EGFP and circZNF609 circular RNAs described in Example 5, in which mutations are introduced based on codon redundancy to introduce the circularization site.
  • the circularization site may be created by introducing additional nucleotides. For example, as shown in Figure 8C, 5 nucleotides (light grey nt) may be introduced to create a stem portion of the eACA sequence, using the existing sequence (black nt) of the GOI to provide the remainder of the eACA.
  • the first and/or second portions of the eACA sequence may naturally occur in the gene of interest. In other words, they may be part of the gene of interest and so are present without having to mutate the existing sequence or introduce additional sequence.
  • all or part of the eACA sequence may be derived from human ribosomal RNA (rRNA).
  • rRNA ribosomal RNA
  • the use of human rRNA has the potential to provide circular RNAs which are less immunogenic.
  • the recombinant nucleic acids described herein may further comprise an extended guide sequence (EGS), in particular a first EGS and a second EGS which are capable of complementary base pairing to each other.
  • EGS extended guide sequence
  • the function of the EGS is to increase the length of the complementary base-pairing region at the two ends of the recombinant nucleic acid molecule. In this way, the EGS may be included to compensate for a shorter IGS, in particular when longer (>500 nt) GOIs are circularized.
  • the recombinant nucleic acids described herein may comprise a first EGS positioned 5’ of the IGS.
  • the recombinant nucleic acids described herein may comprise a second EGS positioned 3’ to the second portion of the eACA sequence.
  • there is a loop sequence situated between the first EGS and the IGS as described in more detail below.
  • the first and second EGS may be partly or fully complementary to each other. Generally, mismatches are tolerated well and do not materially affect circularization.
  • the first EGS may be at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 100% complementary to the second EGS.
  • the first and second EGS may each be between 1 and 500 nucleotides in length.
  • the first and second EGS may each be between 10 and 50 nucleotides in length.
  • the first and second EGS may each be 20, 30, or 40 nucleotides in length.
  • An exemplary first EGS sequence is GGUCAAUCGGUUGGCUUCCG (SEQ ID NO: 56).
  • An exemplary second EGS sequence is CGGAAGCCAACCGAUUGACC (SEQ ID NO: 57).
  • the recombinant nucleic acids described herein may further comprise loop sequences, such as a first loop sequence and a second loop sequence.
  • the first and second loops may act as spacers between, at the 5’ end, the internal guide sequence (IGS) and the first extended guide sequence (EGS), and at the 3’ end, the P1 region and the second EGS.
  • the loop sequences are preferably not complementary to each other, such that there is little or no base pair interaction between the first and second loop sequences. Because of the low or noncomplementarity between the two loop sequences, the base-paired P1 region remains at a fixed length.
  • the first loop may alternatively be described herein as “left loop”.
  • the second loop may alternatively be described herein as “right loop”.
  • the first and second loop sequences may each be between 1 and 10 nucleotides in length. It is not necessary for the first and second loop sequences to have the same number of nucleotides, and in fact the TRIC method works well when the first and second loop sequences are different lengths.
  • the first loop sequence may be 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides in length.
  • the second loop sequence may be 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides in length.
  • a preferred combination is a 6 nucleotide first loop sequence and a 5 nucleotide second loop sequence.
  • Another preferred combination is a 3 nucleotide first loop sequence and a 2 nucleotide second loop sequence.
  • the first loop sequence is positioned 3’ to the first EGS and 5’ to the IGS, in other words, in between the first EGS and the IGS.
  • the second loop sequence is positioned 3’ to the second portion of the eACA sequence, and 5’ to the second EGS, in other words, between the second portion of the eACA sequence and the second EGS. If the P1 extension region is present, the second loop sequence is 3’ to the P1 extension.
  • the recombinant nucleic acids described herein may comprise only a first loop sequence, positioned in between the first EGS and the IGS, without a second loop sequence.
  • the recombinant nucleic acids described herein may comprise only the loop sequence positioned between the second portion of the eACA sequence (or, if present, P1 extension) and the second EGS.
  • An exemplary sequence for the first loop sequence is AAATAA (SEQ ID NO: 54).
  • An exemplary sequence for the second loop sequence is ACACC (SEQ ID NO: 55).
  • the gene of interest refers to the sequence which is to be circularized.
  • the GOI may comprise a coding sequence, coding for a peptide or protein, or may be a noncoding sequence.
  • the GOI may also comprise a combination of coding and noncoding sequence.
  • the term “gene of interest” encompasses sequences which include additional sequence elements, for example, a translation initiation element, such as an internal ribosome entry site (IRES) sequence, multiple siRNA target sites (msiTS), spacer sequences such as polyAC sequences, start codons, stop codons, and any other sequence elements known to be useful in the art for producing circular RNA.
  • a translation initiation element such as an internal ribosome entry site (IRES) sequence, multiple siRNA target sites (msiTS), spacer sequences such as polyAC sequences, start codons, stop codons, and any other sequence elements known to be useful in the art for producing circular RNA.
  • the GOI may comprise, in the 5’ to 3’ direction: a stop codon, a polyAC sequence, multiple siRNA target sites (msiTS), an IRES, a start codon, and the coding sequence including the eACA.
  • the GOI may comprise, in the 5’ to 3’ direction: multiple siRNA target sites (msiTS), an IRES, a start codon, a coding sequence, a stop codon, a polyAC sequence, and the eACA. See, for example, Figures 10A and 10B.
  • IRESs for use in the invention may include viral IRESs, such as the Coxsackievirus B3 (CVB3), cafeteria roenbergensis Virus (CroV), or Classical Swine Fever Virus (CSFV) IRES, the DNA sequences of which are set out below.
  • CVB3 Coxsackievirus B3
  • CroV Clustereteria roenbergensis Virus
  • CSFV Classical Swine Fever Virus
  • a viral IRES may be modified to remove stop codons in open reading frames.
  • Suitable modified viral IRESs include modified CSFV IRESs.
  • a modified CSFV IRES may for example comprise the DNA sequence of SEQ ID NO: 96; nucleotides 324 to 696 of SEQ ID NO: 75; or nucleotides 596 to 968 of SEQ ID NO: 77. Modified IRESs may be useful in the rolling circle translation of the circular RNA as described herein.
  • TRIO is suitable for genes of interest of any length. TRIO is particularly suitable for long genes of interest.
  • long is generally considered to mean a sequence of at least 500 nucleotides.
  • the gene of interest may be at least 100, at least 250, at least 500, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, or at least 8000 nucleotides in length.
  • recombinant nucleic acid molecules for making a circular RNA as described herein may comprise, in the 5’ to 3’ direction: a) an internal guide sequence (IGS), b) a ribozyme, c) a first portion of an extended anticodon arm (eACA) sequence, d) a gene of interest, and e) a second portion of the eACA sequence, wherein a nucleotide in the second portion of the eACA sequence forms a wobble base pair with a nucleotide in the IGS.
  • IGS internal guide sequence
  • eACA extended anticodon arm
  • recombinant nucleic acids described herein may comprise, in a 5’ to 3’ direction: a) a first EGS, b) a first loop sequence, c) an internal guide sequence (IGS), d) a ribozyme, e) a first portion of an extended anticodon arm (eACA) sequence, f) a gene of interest, g) a second portion of the eACA sequence, h) a P1 extension, i) a second loop sequence, and j) a second EGS.
  • IGS internal guide sequence
  • eACA extended anticodon arm
  • the first and second eACA stem portions may be 15 or 25 base pairs and the loop of the resulting stem-loop structure may be 7 nucleotides.
  • the recombinant nucleic acids described herein may further comprises elements to facilitate the transcription or circularization process.
  • the recombinant nucleic acids described herein may further comprise a T7 high efficiency sequence, one or more restriction enzyme cleavage sites, and/or a poly(A) tail.
  • the recombinant nucleic acid is a DNA template, it may further comprise a T7 promoter sequence.
  • a recombinant nucleic acid may further comprise a nucleotide sequence encoding a self-cleaving peptide to ensure the production of monomeric protein during rolling circle amplification. Such additional elements are known in the art.
  • the recombinant nucleic acids described herein may lack stop codons.
  • the recombinant nucleic acids may be engineered or modified to remove stop codons in open reading frames. This may facilitate rolling circle amplification. Methods for producing a circular RNA
  • methods for producing a circular RNA comprise the provision of a linear recombinant nucleic acid molecule, such as those described herein, and the splicing of that molecule to generate a circular RNA.
  • methods for producing a circular RNA may comprise: a) providing a recombinant nucleic acid molecule as described herein, and b) circularizing the recombinant nucleic acid molecule.
  • recombinant nucleic acid molecule may refer to either a DNA template molecule or an RNA precursor.
  • the recombinant nucleic acid molecule is a linear DNA template molecule.
  • in vitro transcription is performed using the DNA template molecule to obtain a linear RNA precursor molecule.
  • a circularization/splicing step is performed with the RNA precursor, to generate a circular RNA molecule.
  • methods for producing a circular RNA may comprise: a) providing a recombinant nucleic acid molecule as described herein, b) transcribing the recombinant nucleic acid molecule to produce an RNA precursor, and c) circularizing the RNA precursor.
  • some splicing may occur during transcription, known as co-transcriptional splicing.
  • the methods described herein may additionally comprise the suppression of splicing (and circularization) during step (b) (the transcription step).
  • the methods described herein may comprise performing step (b) in the presence of NTPs at a concentration of approximately 24 mM, and Mg2+ at a concentration less than 18 mM, less than 16 mM, less than 14 mM, or less than 12 mM.
  • the transcribing step is performed in the presence of nucleoside triphosphates (NTPs) at a concentration of approximately 24 mM and Mg2+ at a concentration of 16 mM or less. If the concentration of NTPs is more or less than 24 mM, the concentration of Mg2+ may also vary.
  • NTPs nucleoside triphosphates
  • Methods for producing a circular RNA may therefore comprise: a) providing a recombinant nucleic acid molecule as described herein, b) transcribing the recombinant nucleic acid molecule to produce an RNA precursor, and c) circularizing the RNA precursor; wherein step (b) is performed in the presence of Mg2+ at a concentration of 16 mM or less and NTPs at a concentration of approximately 24 mM.
  • RNAs comprising: a) providing a recombinant nucleic acid molecule as described herein, and b) transcribing and circularizing the recombinant nucleic acid molecule, wherein splicing occurs co-transcriptionally.
  • an advantage of the TRIC method is that it can be used to circularise genes of interest that naturally comprise a sequence that is capable of forming an eACA stem-loop. This enables a circular RNA to be created that does not contain exogenous sequence material (such as exon sequences), which are frequently immunogenic, and so provides clear benefits over existing methods such as PIE.
  • methods for producing a circular RNA may comprise: a) identifying a gene of interest comprising a sequence capable of forming an eACA stem-loop, b) preparing a recombinant nucleic acid molecule comprising, in a 5’ to 3’ direction: an internal guide sequence (IGS) - a ribozyme - a sequence encoding the gene of interest, and c) circularizing the recombinant nucleic acid molecule.
  • IGS internal guide sequence
  • Step (b) above may comprise rearranging the gene of interest to place a first portion of the sequence capable of forming an eACA stem-loop at the 5’ end, and a second portion of the sequence capable of forming an eACA stem-loop at the 3’ end.
  • Suitable genes of interest comprising a sequence capable of forming an eACA stem-loop may be identified by the skilled person using approaches known in the art, including the use of software such as RNAFold (University of Vienna).
  • Methods for producing a circular RNA may also comprise the expression of the recombinant nucleic acid molecule in a cell, with subsequent circularization being performed in the cell.
  • Circular RNAs can be generated using the recombinant nucleic acid molecules described herein.
  • the circular RNAs comprise a sequence encoding a gene of interest.
  • One advantage of the described circular RNAs is that in some cases, they do not comprise exogenous splicing sequences, such as the circular RNAs obtained with the PIE method, which typically comprise exogenous exon sequences.
  • Circular RNAs described herein may not comprise RNA from a circularization agent.
  • circular RNAs described herein may not contain any RNA from a ribozyme, in particular from a group I intron.
  • the circular RNAs described herein may comprise only the gene of interest. This in turn reduces the immunogenicity of the circular RNAs compared to circular RNAs generated using methods of the art (such as the PIE method).
  • the circular RNAs described herein may be less immunogenic compared to circular RNAs (e.g. those encoding the same GOI) which comprise exogenous exon sequences.
  • immunogenicity By less immunogenic, it is meant that transfection with the circular RNA produces less of an immune response by the host cell, for example, reduced production of cytokines, chemokines or other immune signalling molecules. Suitable methods for determining immunogenicity are known in the art. For example, immunogenicity can be determined by measuring the production of immune factors (cytokines, chemokines, etc) in transfected cells for a period of time following transfection.
  • immune factors cytokines, chemokines, etc
  • the sequence encoding the gene of interest may comprise a sequence capable of forming an eACA stem-loop structure as described herein.
  • the sequence capable of forming an eACA stem-loop structure may be naturally occurring in the gene of interest, or may have been introduced prior to circularization.
  • circular RNAs obtainable by the methods disclosed herein.
  • a circular RNA obtainable by a method comprising: a) providing a recombinant nucleic acid molecule as described herein, b) transcribing the recombinant nucleic acid molecule to produce an RNA precursor, and c) circularizing the RNA precursor.
  • Circular RNAs obtained from the recombinant nucleic acids described herein may be used in various ways to exert a therapeutic effect.
  • circular RNAs can act as a “sponge” for micro RNAs (miRNA), in turn preventing or reducing the degradation of a target mRNA by the miRNA.
  • Circular RNAs may also influence protein trafficking and subcellular protein localisation. The specific therapeutic effect will be determined by the gene of interest, including whether the gene of interest is a coding or noncoding sequence.
  • circular RNAs can also be used to drive expression of a gene of interest in vivo or in vitro.
  • a recombinant nucleic acid molecule as described herein is circularized to provide a circular RNA comprising the gene of interest, and the circular RNA is administered to the cell.
  • Circular RNAs obtained from the recombinant nucleic acid molecules as described herein may be used to drive expression of a gene of interest through rolling circle amplification.
  • Suitable circular RNAs may lack in-frame stop codons.
  • a circular RNA may comprise a modified viral IRES as described herein which lacks in frame stop codons.
  • the circular RNA may be translated continuously multiple times by a ribosome to generate polyproteins.
  • a suitable circular RNA may further comprise a DNA sequence encoding a self-cleaving peptide.
  • the self-cleaving peptide causes ribosomal skipping during translation of the circular RNA by a ribosome to generate monomeric proteins.
  • Suitable self-cleaving peptides are well-known in the art and include 2A peptides, such as T2A, P2A, E2A and F2A.
  • Described herein are methods for treating a disease in a subject, the methods comprising (a) circularizing a recombinant nucleic acid molecule as described herein to provide a circular RNA, and (b) administering the circular RNA to the subject.
  • recombinant nucleic acid molecules such as those described herein for use as a medicament; recombinant nucleic acid molecules as described herein for use in a method of treating a disease in a subject; circular RNA obtained from a recombinant nucleic acid molecule as described herein for use as a medicament; and circular RNA obtained from a recombinant nucleic acid molecule as described herein for use in a method of treating a disease in a subject
  • compositions comprising a circular RNA or a or recombinant nucleic acid molecule as described herein, and a pharmaceutically acceptable excipient.
  • DNA templates were linearized and cleaned by phenol:chloroform:isoamyl alcohol extraction.
  • IVT was performed at 50 ng/ul of DNA template, 14 ug/ul of homemade T7 polymerase, 0.04 U/ul of RNase inhibitor (Promega), 6 mM of each NTPs and 1X IVT buffer.
  • 1X IVT buffer contains 80 mM HEPES-K (pH7.5), 2 mM spermidine, 40 mM DTT and 24 mM MgCI2.
  • the concentration of MgCI2 in 1X IVT buffer is 14 mM.
  • IVT reactions were incubated at 37 °C for 3-5h and then digested by RNase-free DNase I for 20min. Afterwards, 100 mM EDTA was added to a concentration of 25 mM to clear any precipitation. Then equal volume of 7.5 M lithium chloride is added to precipitate RNAs for 30 min to overnight at -20 °C. Then precipitations were spun down at 13000 rpm/min for at least 20min. RNA pellets were washed by 75% alcohol, air dried and dissolved in DEPC treated H2O.
  • RNAs were circularized during IVT.
  • DNA template digested IVT reactions were supplied with extra GTP at 2 mM concentration and heated at 55 °C for 20min.
  • Concentration of ribozyme was fixed at 1 uM and concentration of GTP was varied from 1 uM to 2000 uM. At each concentration of GTP, time course of circularization of TRIC-V2 and PIE were monitored. Then time for 50% circularization completeness (t1/2) for each sample was calculated and used for estimation of initial circularization speed of each construct at each GTP concentration (Vobs). Vobs was then plotted against GTP concentration to calculate kinetics parameters of the TRIC-V2.
  • Reverse transcriptase and DNA polymerase used here are the SuperScrip IV Reverse Transcriptase (Thermo Fisher) and the Q5 High-Fidelity DNA Polymerase (NEB). Manufacturer’s manuals were followed for reverse transcription and PCR. The IVT sample, RNA I and II were used as templates for reverse transcription and PCR using the using primers indicated in Figure 2B.
  • RNA clean & concentrator kit ZYMO RESEARCH
  • A549 and HEK 293F cells were cultured in DMEM (with 10% FBS, High Glucose GlutaMAX, Life Technologies Ltd) and Freestyle (Gibco) medias, respectively.
  • NIuc expression and siRNA knocking down studies 50 ng of circular NIuc and an equal molar amount of linear mRNA were transfected into 10,000 cells in 96-well plates using the MessengerMax transfection reagent. For protein expression, 5ul of cells were taken for luciferase assay using the Nano-Gio® Luciferase Assay System (Promega). For siRNA knocking down, siRNAs were transfected into cells using the RNAiMax (Invitrogen) on day 3. 5 hours after siRNA transfection, expression of NIuc was measured using the above kit.
  • the inventors selected the tRNA Leu intron from the cyanobacterium Anabaena (Ana) for the initial test of the TRIC approach. This first construct was designated TRIC-V0.
  • Ana is short (249 nt) but highly active.
  • the Ana intron divides the leucine transfer RNA (tRNA) into a 34 nt left half and a 51 nt right half (L34/R51) in the anticodon arm (ACA) ( Figure 2A-insert labelled “tRNA”).
  • the inventors set out to determine whether using some of the leucine tRNA sequence would enable circularization.
  • Leu tRNA anticodon arm a L15/R30 portion was reserved and joined on either side of a gene of interest (in this case a 3*Flag coding sequence) for circularization.
  • the construct is shown in Figure 2B (SEQ ID NO: 14).
  • Both the major species I and II contained a fast-moving minor species, and both run faster than themselves in the 12% PAGE, indicating that they are circular RNAs. Since the minor bands in I and II run at the same place as linear intron and nicking 3*Flag, respectively, the inventors concluded that species I is circular intron and species II is circular 3*Flag (the gene of interest). To further confirm the circular identity of 3*Flag, the inventors performed reverse transcription followed by PCR (RT-PCR) on the IVT sample and species I and II ( Figure 2D). As expected, a 109 bp DNA product was produced from IVT and II but not I. The inventors then cloned this PCR product to a sequencing vector and performed Sanger sequencing.
  • RT-PCR reverse transcription followed by PCR
  • the internal guide sequence (IGS) of the Ana group I intron is short (5 nucleotides), and the inventors speculated that a short IGS might make it difficult to circularize long genes of interest.
  • the inventors introduced an extended guide sequence (EGS) at the 5’ end of the TRIC, which could form a 20 nucleotide base-paired structure with a corresponding region at the 3’ end ( Figure 3A). This construct was designated TRIC-V1 .
  • the sequence connecting the IGS and EGS constitutes an internal loop, which the inventors also optimised in TRIC-V1 .
  • Three constructs were created, each containing a different loop configuration.
  • TRIC-V1.0 SEQ ID NO: 15
  • V1 .1 SEQ ID NO: 16
  • V1 .2 SEQ ID NO: 17
  • the 3’ loop length was 3 nucleotides in V1 .1 and V1 .2, whilst the 3’ loop length was 5 nucleotides in V1 .0.
  • the efficiency (that is, the ratio of full-length precursor to circular GOI) of the three V1 .1 variants was similar, since full length precursors mostly converted to circular RNAs during in vitro transcription.
  • One advantage of the V1 variants compared to VO is that the amount of circular intron is reduced. Reduction of circular introns is beneficial because these circular introns cannot be removed by RNase R digestion.
  • V1 .1 gave the highest ratio of circular 3*Flag to linear intron, so this variant was taken forward for further investigation.
  • the 3*Flag sequence (SEQ ID NO: 18) is 141 nucleotides in length.
  • the inventors also determined the capacity of TRIC-V1 for circularization of long genes of interest.
  • Five new constructs were created with the aim of producing circular CVB3-EGFP (EGFP, 1638 nt) (SEQ ID NO: 19), CVB3-Firefly luciferase (Flue, 2601 nt) (SEQ ID NO: 20), CVB3-Spike protein of SARS-CoV 2-EGFP (Spike, 5469 nt) (SEQ ID NO: 21), CVB3-spCas9-EGFP (Cas9, 5757 nt) (SEQ ID NO: 22) and CVB3-Factor 8- EGFP (Factor s, 8706 nt) (SEQ ID NO: 23) ( Figure 4A).
  • Spike protein of SARS-CoV 2-EGFP AAAATCCGTTGACCTTAAACGGTCGTGTGGGTTCAAGTCCCTCCACCCCCACGCCGGAAACGCAATAGCCGAAAAACAA
  • TRIC V1 can circularize long genes of interest co-transcriptionally, as indicated by the multiple RNA species observed for each construct in Figure 4B, without the post-transcriptional circularization protocol.
  • TRIC-V1 produces more splicing products than the PIE approach for all the genes of interest, suggesting that the co-transcriptional circularization efficiency of TRIC-V1 is higher than PIE.
  • co-transcriptionally produced circular RNAs are heavily nicked, since circular RNAs for EGFP and Fluci are nicked at over 50% and circular RNAs for Spike, Cas9 and Factor 8 were difficult to detect.
  • the additional 20 minute post-transcriptional circularization did increase the amount of splicing product, but mainly by increasing the amount of nicking.
  • Co- transcriptional nicking for the short GOI 3*Flag but fatal for the long GOIs used in this experiment.
  • the inventors sought to identify a protocol that could be used to produce long circular GOIs.
  • Mg2+ is believed to be the major source of circular RNA nicking (Wesselhoeft et al. (2016)). Since Mg2+ is essential for both in vitro transcription and circularization, the inventors speculated that reasonable ways to reduce nicking of the circular RNAs would be to suppress co-transcriptional circularization and to increase the speed of post-transcriptional circularization.
  • NTPs nucleoside triphosphates
  • Both the TRIC-V1 and the PIE rely on native exon sequences, namely the tRNA sequence in the case of the Ana, to work. These native exon sequences will unavoidably be part of resulting circular GOIs (as shown in Figures 5A and 5B), although their inclusion is associated with certain drawbacks.
  • the native exon sequences are immunogenic (Liu, C. X. et al. Mol Cell 82, 420-434 e426 (2022)), which hinders the biomedical applications of circular RNAs produced by group I intron-based methods such as PIE.
  • the inclusion of the native exon sequences means that circularization sites must be positioned at untranslated regions (UTRs) of protein coding circular RNAs. Since UTRs are normally highly structured internal ribosome entry sites (IRESs), extra unwanted spacer sequences are needed to ensure the group I intron and remaining exons are separated from the IRESs.
  • the inventors restored the left arm (L15/R2 - V1 .32 (SEQ ID NO: 31)) or the right arm (L3/R30 - V1.33 (SEQ ID NO: 32)) of the tRNA sequence.
  • Restoration of the right arm (V1 .33) restored most of the circularization efficiency.
  • the length of the right arm was reduced gradually in constructs V1 .34 (L3/R25) (SEQ ID NO: 33), V1 .35 (L3/R16) (SEQ ID NO: 34) and V1 .36 (L3/R9) (SEQ ID NO: 35).
  • V1 .36 The minimum length for the right arm was identified as 9 nucleotides (V1 .36, L3/R9). Subsequently, the right arm was fixed at 9 nucleotides and an 8 nt left arm was tested (V1 .39, L8/R9 (SEQ ID NO: 38)). The L8/R9 construct fully restored circularization efficiency to the V1 .0 level. The requirement of the tRNA sequence in V1 .39 has therefore been reduced to a 17-nucleotide structure which mimics the anticodon arm (ACA) found in the Ana tRNA.
  • ACA anticodon arm
  • the inventors sought to determine whether the group I intron activity could be replicated based on structure, rather than specific nucleotide sequences. To that end, the inventors reversed the sequence of the ACA stem, whilst keeping the sequence of the ACA loop the same (construct designated V2.0 (SEQ ID NO: 39)) and found the circularization efficiency is at least as high as V1 .0 and V1 .39. With V2.0, the requirement on tRNA sequence is reduced to 5nt (L-CTT/R-AA). A 5 nt sequence cannot be specific to any species, therefore TRIC-V2 doesn’t rely on the original bacterial tRNA sequence.
  • the inventors also identified that the stem length could be increased to 15 base pairs (V2.1 (SEQ ID NO: 40)) without abolishing circularization efficiency.
  • V2.1 SEQ ID NO: 40
  • the only tRNA sequence present is the L-CTT/R-AA sequence, and the remaining base pairs were not derived from the tRNA sequence.
  • the longer stem is advantageous since it may enable better circularization of longer GOIs.
  • the inventors subsequently reversed the sequence of the P1 and P10 regions (from L-CTT/R-AA to L- GAT/R-TT), except for the uracil which forms a wobble base pair with the internal guide sequence (construct designated V2.2 (SEQ ID NO: 41). Again, circularization efficiency was found to be unaffected. In this way, the inventors have shown that the IGS requires only a GU wobble base pair for circularization and is not otherwise dependent on sequence.
  • an anticodon arm-like structure which consists of a 7 nt loop with a uracil as the third nucleotide and a >5 base pair stem can be found in a gene of interest, this gene of interest can be circularized efficiently without introducing any unwanted sequence (Figure 8). If the circularization site is placed in a coding sequence, the site of choice can be extended because of codon redundancy. Potentially, only a few nt mutations would need to be made without affecting the peptide sequence. If the circularization site is placed in a noncoding RNA or UTR of a protein coding circular RNA, the circularization site can be assembled by introducing as few as 5 extra nucleotides to create an eACA.
  • eACA anticodon arm-like structure
  • the TRIC-V2 construct was then tested on three protein coding circular RNAs, including circular T2A- EGFP, T2A-Nano Luciferase, and circular Znf609.
  • the circularization site was positioned at the CDS. For all the circular RNAs tested, multiple circularization sites in the CDS were found. Full-length precursors of those three RNAs were produced and circularized for 20 minutes as already described and shown in Figure 12.
  • the sequences of the full length precursors for T2A-EGFP, T2A-Nano Luciferase and Znf609 are set forth in SEQ ID NOs: 42, 43 and 44 respectively. As shown in Figure 8D (urea-agarose gel), these long circular RNAs were all produced efficiently with TRIC-V2.
  • the CVB3-EGFP was cloned to the TRIC-V2 construct and two stem lengths were tested: 15 nt (SEQ ID NO: 45) and 25 nt (SEQ ID NO: 46).
  • the effect of increasing the length of the extended guide sequence (EGS) was determined by providing a TRIC-V1 construct (that is, one having L15/R51 of the tRNA sequence) with a 40 nt EGS (SEQ ID NO: 47). Full length precursors of all these constructs were produced and circularization was performed for 4 minutes.
  • TRIC-V1.0 converts -50% of full length precursor to circular RNA.
  • Increasing the EGS from 20 to 40 did not substantially increase circularization efficiency.
  • TRIC-V2 was then compared with the PIE method on circularization of long GOIs EGFP, Spike and Cas9, for 1 or 3 minutes of circularization.
  • PIE converts a small number of EGFP precursors to circular RNAs
  • TRIC-V2 converts many more.
  • Figure 9B 2% native agarose gel
  • PIE converts less than 50% of full-length EGFP precursor to circular RNAs but TRIC-V2 converts most of full-length precursors to circular RNAs.
  • Circularization efficiency, circular RNA yield (ratio between circular RNAs and total RNAs) and nicking ratio were then calculated using the CVB3-EGFP as an example.
  • a yield of 74.8% is 90.3% of the limit yield (MW ratio between circular RNA and its precursor).
  • TRIC-V2 provides higher efficiency, higher yield, and lower nicking compared to PIE, all without the issues of native exon sequences in the resulting circular RNAs.
  • TRIC-V2 can produce circular genes of interest without any bacterial sequence.
  • the inventors determined whether circular RNAs produced by TRIC-V2 were less immunogenic than those produced by PIE.
  • Circular RNAs were purified by gel filtration (using an SRT-2000 SEC column (Sepax)) and RNase R digestion.
  • A549 cells were then transfected with the circular RNAs, and the expression levels of immune factors (IL6, CCL5, and INF beta) was monitored by RT-qPCR.
  • Various controls were included in the experiment, such as mocks (Mock and Lipo), a positive control (poly I :C), unmodified linear mRNAs (lin. EGFP and lin. NIuc) and modified linear mRNAs (lin. EGFP-modi and lin. Nluc-modi).
  • GAPDH was used as the internal reference.
  • Figures 11 D-F depict the results.
  • Circular RNAs are more stable than mRNAs and are thus promising alternatives to mRNAs for therapeutics.
  • Natural circRNAs can serve as sponges for microRNAs and proteins but are also templates for translation.
  • IRS internal ribosome entry site
  • CircRNAs that lack an in-frame termination codon allow ribosomes to translate completely around the circRNA multiple times, resulting in a polyprotein, a process known as rolling circle translation (RCT) ( Figure 15a).
  • the polyprotein can in principle be cleaved by a protease or a self-cleaving sequence, thus allowing multiple copies of the GOI to be made in a single round of initiation.
  • RCT can be 100-fold more efficient than single-shot translation.
  • RCT encounters two challenges: low initiation efficiency and accessory sequences introduced by currently used in vitro circularization methods.
  • This eACA structure is essential for circularization to happen.
  • This eACA is a stem-loop structure which contains a stem >1 bp and a 7 nt loop with a U at the third position ( Figure 16A a-0). This minimal structure enables circularization of GOIs with little restriction without introducing unwanted sequences.
  • the G and U wobble base pair between IGS (internal guide sequence) and GOIs is known to be important for ribozyme to function.
  • Tetrahymena thermophila (Tetra) group I intron-derived constructs the Tetra-STS (RZ construct, WO2022/191642) and the Tetra-Rzy, for circRNA synthesis.
  • CVB3-EGFP into Tetra-STS (AU-rich no. 16) and Tetra-Rzy (CVB3IRES-GFP) constructs (SEQ ID Nos: 94 and 95).
  • V2 outperforms both constructs ( Figure 18).
  • the Tetra-V2 (SEQ ID NO: 93) also produced circCVB3-EGFP efficiently, demonstrating that optimizations from the Ana intron can be effectively applied to other group I introns.

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/EP2024/065837 2023-06-09 2024-06-07 Circular rnas and methods for making the same Ceased WO2024252011A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
KR1020267000650A KR20260038314A (ko) 2023-06-09 2024-06-07 원형 rna 및 이를 제조하는 방법
AU2024285014A AU2024285014A1 (en) 2023-06-09 2024-06-07 Circular rnas and methods for making the same
CN202480051929.9A CN121773210A (zh) 2023-06-09 2024-06-07 环状rna及其制备方法
EP24732591.3A EP4724586A2 (en) 2023-06-09 2024-06-07 Circular rnas and methods for making the same
PCT/EP2025/065903 WO2025252998A2 (en) 2024-06-07 2025-06-06 Materials and methods for making circular rnas
IL325227A IL325227A (he) 2023-06-09 2025-12-09 Rna מעגליים ושיטות לייצורם

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB2308675.4 2023-06-09
GBGB2308675.4A GB202308675D0 (en) 2023-06-09 2023-06-09 Circular rnas and methods for making the same

Publications (2)

Publication Number Publication Date
WO2024252011A2 true WO2024252011A2 (en) 2024-12-12
WO2024252011A3 WO2024252011A3 (en) 2025-02-06

Family

ID=87291639

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2024/065837 Ceased WO2024252011A2 (en) 2023-06-09 2024-06-07 Circular rnas and methods for making the same

Country Status (7)

Country Link
EP (1) EP4724586A2 (he)
KR (1) KR20260038314A (he)
CN (1) CN121773210A (he)
AU (1) AU2024285014A1 (he)
GB (1) GB202308675D0 (he)
IL (1) IL325227A (he)
WO (1) WO2024252011A2 (he)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025252998A3 (en) * 2024-06-07 2026-01-29 RNAvate Limited Materials and methods for making circular rnas

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022191642A1 (ko) 2021-03-10 2022-09-15 알지노믹스 주식회사 자가 환형화 rna 구조체
WO2023046153A1 (en) 2021-09-26 2023-03-30 Center For Excellence In Molecular Cell Science, Chinese Academy Of Sciences Circular rna and preparation method thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018237372A1 (en) * 2017-06-23 2018-12-27 Cornell University RNA MOLECULES, METHODS FOR PRODUCING CIRCULAR RNA, AND METHODS OF TREATMENT
EP4392560B1 (en) * 2021-08-27 2026-03-11 Peking University Constructs and methods for preparing circular rna
DK4271818T3 (da) * 2021-09-17 2024-11-04 Flagship Pioneering Innovations Vi Llc Sammensætninger og fremgangsmåder til fremstilling af cirkulære polyribonukleotider
US20260078370A1 (en) * 2022-09-06 2026-03-19 Rznomics Inc. Self-circularization rna structure
EP4585691A1 (en) * 2022-09-06 2025-07-16 Rznomics Inc. Self-circularized rna structure

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022191642A1 (ko) 2021-03-10 2022-09-15 알지노믹스 주식회사 자가 환형화 rna 구조체
WO2023046153A1 (en) 2021-09-26 2023-03-30 Center For Excellence In Molecular Cell Science, Chinese Academy Of Sciences Circular rna and preparation method thereof

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
BEEN, MD ET AL.: "One binding site determines sequence specificity of Tetrahymena pre-rRNA self-splicing trans-splicing and RNA enzyme activity", CELL, vol. 47, no. 2, 1986, XP023883128, DOI: 10.1016/0092-8674(86)90443-5
INOUE T ET AL.: "Intermolecular exon ligation of the rRNA precursor of Tetrahymena: Oligonucleotides can function as 5' exons", CELL, vol. 43, no. 2, 1985, XP023911634, DOI: 10.1016/0092-8674(85)90173-4
JONES JT ET AL.: "Tagging ribozyme reaction sites to follow trans-splicing in mammalian cells", NAT MED, vol. 2, no. 6, 1996, XP000652816, DOI: 10.1038/nm0696-643
KOHLER U ET AL.: "Trans-splicing Ribozymes for Targeted Gene Delivery", J MOL BIOL, vol. 285, no. 5, 1999, XP004464306, DOI: 10.1006/jmbi.1998.2447
LAN, N.HOWREY, R. P.LEE, S. W.SMITH, C. ASULLENGER, B. A: "Ribozyme-mediated repair of sickle beta-globin mRNAs in erythrocyte precursors", SCIENCE, vol. 280, 1998, pages 1593 - 1596
LIU, C. X. ET AL., MOL CELL, vol. 82, 2022, pages 420 - 434
OLSONMULLER, RNA, vol. 18, 2012, pages 581 - 589
PETKOVIC, SMULLER, S: "RNA circularization strategies in vivo and in vitro", NUCLEIC ACIDS RES, vol. 43, 2015, pages 2454 - 2465, XP055488942, DOI: 10.1093/nar/gkv045
PUTTARAJU, MBEEN, M. D: "Group I permuted intron-exon (PIE) sequences self-splice to produce circular exons", NUCLEIC ACIDS RES, vol. 20, 1992, pages 5357 - 5364, XP055622176, DOI: 10.1093/nar/20.20.5357
PUTTARAJUBEEN, NUCLEIC ACIDS RES, vol. 20, 1992, pages 5357 - 5364
SULLENGER BA ET AL.: "Ribozyme-mediated repair of defective mRNA by targeted trans-splicing", NATURE, vol. 371, 1994, XP002033257, DOI: 10.1038/371619a0
WESSEL HOEFT, R. A.KOWALSKI, P. SANDERSON, D. G, NAT COMMUN, vol. 9, 2018, pages 2629
WESSELHOEFT, R. A.KOWALSKI, P. SANDERSON, D. G: "Engineering circular RNA for potent and stable translation in eukaryotic cells", NAT COMMUN, vol. 9, 2018, pages 2629, XP055622155, DOI: 10.1038/s41467-018-05096-6

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025252998A3 (en) * 2024-06-07 2026-01-29 RNAvate Limited Materials and methods for making circular rnas

Also Published As

Publication number Publication date
GB202308675D0 (en) 2023-07-26
KR20260038314A (ko) 2026-03-18
WO2024252011A3 (en) 2025-02-06
EP4724586A2 (en) 2026-04-15
AU2024285014A1 (en) 2026-01-22
IL325227A (he) 2026-02-01
CN121773210A (zh) 2026-03-31

Similar Documents

Publication Publication Date Title
US20240392304A1 (en) Circular rna and preparation method thereof
US11939580B2 (en) Construct of self-circularization RNA
US20230242916A1 (en) Method and drug for treating hurler syndrome
JP6625521B2 (ja) 環状rnaの細胞内翻訳
Beaudry et al. An efficient strategy for the synthesis of circular RNA molecules
US11834670B2 (en) Site-specific DNA modification using a donor DNA repair template having tandem repeat sequences
US20250146005A1 (en) Methods of making circular rna
WO2024140987A1 (en) Rna circularization
EP4724586A2 (en) Circular rnas and methods for making the same
EP4585690A1 (en) Self-circularization rna structure
CN113528582A (zh) 基于leaper技术靶向编辑rna的方法和药物
JP2025530198A (ja) 自己環状化rna構造体
CN115927331A (zh) 一种用于促进circRNA成环和过表达的DNA框架及其构建方法和用途
WO2025252998A2 (en) Materials and methods for making circular rnas
Ai et al. Aptazyme-directed A-to-I RNA editing
WO2025140537A1 (en) Rna circularization
AU2024333434A1 (en) Methods for making circular rnas
Liu et al. Scalable production of immune-silent circular RNAs for efficient protein expression
WO2024260432A1 (zh) 线性rna的环化组件及其应用
WO2025076037A1 (en) Circular rna vectors comprising modified nucleotides
CN120004994A (zh) 一种胞嘧啶脱氨酶抑制剂SflSddi及其应用
CN118910006A (zh) 基于NiCas12b蛋白的CRISPR/Cas12b基因编辑系统及其相关应用
CN116732076A (zh) 一种闭合线性dna制备方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 24732591

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2025571622

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 325227

Country of ref document: IL

Ref document number: 2025571622

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: AU2024285014

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2024732591

Country of ref document: EP

Ref document number: 202647002467

Country of ref document: IN

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2024285014

Country of ref document: AU

Date of ref document: 20240607

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2024732591

Country of ref document: EP

Effective date: 20260109

WWE Wipo information: entry into national phase

Ref document number: 11202508278Y

Country of ref document: SG

WWP Wipo information: published in national office

Ref document number: 11202508278Y

Country of ref document: SG

Ref document number: 202647002467

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2024732591

Country of ref document: EP

Effective date: 20260109

WWP Wipo information: published in national office

Ref document number: 325227

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2024732591

Country of ref document: EP

Effective date: 20260109

WWP Wipo information: published in national office

Ref document number: 2024732591

Country of ref document: EP