WO2024219795A1 - Mir-223을 유효성분으로 포함하는 간 손상 예방 또는 치료용 조성물 - Google Patents

Mir-223을 유효성분으로 포함하는 간 손상 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2024219795A1
WO2024219795A1 PCT/KR2024/005101 KR2024005101W WO2024219795A1 WO 2024219795 A1 WO2024219795 A1 WO 2024219795A1 KR 2024005101 W KR2024005101 W KR 2024005101W WO 2024219795 A1 WO2024219795 A1 WO 2024219795A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
liver damage
parp1
mimic
preventing
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2024/005101
Other languages
English (en)
French (fr)
Inventor
탁은영
이주영
강서온
김지예
이은경
최지완
이륜진
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Asan Foundation
University of Ulsan Foundation for Industry Cooperation
Original Assignee
Asan Foundation
University of Ulsan Foundation for Industry Cooperation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Asan Foundation, University of Ulsan Foundation for Industry Cooperation filed Critical Asan Foundation
Publication of WO2024219795A1 publication Critical patent/WO2024219795A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics

Definitions

  • the present invention relates to a composition for preventing or treating liver damage containing miR-223 as an active ingredient.
  • Ischemia is a phenomenon that occurs when the blood supply to the heart and other tissues is blocked, preventing the supply of oxygen and various nutrients contained in the blood. This is analyzed as being due to the excessive production of reactive oxygen species when oxygen supply is rapidly increased. Reactive oxygen species are known to directly damage tissues or indirectly damage them by inducing inflammation.
  • ischemic damage ischemic reperfusion damage
  • the organs that are damaged by ischemia are typically the heart and brain tissue, but it can also be fatal to kidneys and livers that undergo frequent transplant surgeries.
  • ischemic liver damage can occur during liver transplantation and has a critical impact on the survival rate of the transplanted liver in living donor liver transplantation.
  • research has focused on suppressing ischemic liver damage by removing active oxygen, but no significant results have been obtained.
  • miRNA is composed of RNA of 15 to 25 bases, its existence has been confirmed in various organisms, and is transcribed from genomic DNA as a hairpin-shaped RNA (precursor).
  • This precursor is cleaved by a dsRNA cleavage enzyme (Drosha, Dicer) with a specific enzyme RNase III cleavage activity, and then changes into a double-stranded form, and then becomes a single-strand.
  • RISC protein complex
  • the form of miRNA is different at each stage after transcription, it is necessary to consider various forms such as a hairpin structure, a double-stranded structure, and a single-stranded structure when detecting miRNA.
  • miRNA has been studied in various ways as a diagnostic, preventive, and therapeutic agent for various diseases including cancer, but its effects on ischemic liver damage have not been reported.
  • One object of the present invention is to provide a pharmaceutical composition for preventing or treating liver damage comprising miR-223 or a mimic thereof as an active ingredient.
  • Another object of the present invention is to provide a kit for preventing or treating liver damage, comprising the pharmaceutical composition and instructions.
  • the present invention provides a pharmaceutical composition for preventing or treating liver damage containing miR-223 or a mimic thereof as an active ingredient.
  • the miR-223 may be miR-223-3p, but is not limited thereto.
  • the liver damage may be, but is not limited to, ischemic liver damage.
  • the miR-223 or a mimic thereof may be included together with any one carrier selected from the group consisting of, but not limited to, a nanocarrier, a nanoparticle mimic, a nanotube, an exosome, a liposome, a lipidoid, a lipoplex, a lipid nanoparticle (LNP), a polymeric compound, a peptide, a protein, and a cell.
  • a nanocarrier a nanoparticle mimic, a nanotube, an exosome, a liposome, a lipidoid, a lipoplex, a lipid nanoparticle (LNP), a polymeric compound, a peptide, a protein, and a cell.
  • the composition may be characterized by, but is not limited to, one or more of the following:
  • the composition may be administered by at least one method selected from the group consisting of intravenous administration, oral administration, and rectal administration, but is not limited thereto.
  • the present invention provides a kit for preventing or treating liver damage, comprising the pharmaceutical composition and an instruction manual.
  • the present invention provides a use of miR-223 or a mimic thereof, or a composition containing the same as an active ingredient, for preventing or treating liver damage.
  • the present invention provides a method for preventing or treating liver damage, comprising a step of administering miR-223 or a mimic thereof, or a composition containing the same as an active ingredient, to a subject in need thereof.
  • the present invention provides the use of miR-223 or a mimic thereof, or a composition comprising the same as an active ingredient, for preparing a preparation for preventing or treating liver damage.
  • a composition for preventing or treating liver damage containing miR-223 as an active ingredient the role of miR-223 was verified in an ischemic liver damage animal model, ischemic liver damage was confirmed in a miR-223 deficient animal model, and the ischemic liver damage prevention or treatment effect was confirmed in a PARP1 deficient animal model.
  • miR-223 directly binds to PARP1 and exhibits inhibitory activity, not only was a negative correlation confirmed between the two substances, but also the in vivo/in vitro ischemic liver damage treatment effect through PARP1 inhibition was confirmed, and therefore, it is expected to be utilized in the treatment of various diseases related to ischemic liver damage.
  • Figure 1a shows a schematic of an animal model of ischemic liver injury.
  • Figures 1b to 1f are graphs showing AST and ALT, histological changes in the liver, Suzuki scores, changes in the expression level of miR-223-3p, and the expression of Parp1, Tnf, and il6 in an ischemic liver injury model.
  • Figure 2a shows a schematic diagram of the miR-223 deletion model.
  • Figures 2b to 2e are graphs showing AST and ALT, liver histological changes, suzuki scores, and Parp1, Tnf, and il6 expression in a miR-223 deletion model.
  • Figure 3a is a graph showing the changes in the levels of miR-223-3p and Parp1 in hepatocyte-like cells introduced with a miR-223-3p mimic
  • Figure 3b is a graph showing the results of confirming and quantifying the decrease in expression of Parp1 protein by Western blot.
  • Figure 3c shows the Parp1 gene binding site of miR-223-3p.
  • Figure 3d is a graph showing that the luciferase activity of the PARP1 3' UTR region was reduced when treated with a miR-223-3p mimic.
  • Figure 4a shows a schematic of a Parp1 deletion animal model.
  • Figures 4b to 4e are graphs showing AST and ALT, liver histological changes, Suzuki scores, and Parp1, Tnf, and il6 expression in Parp1-deficient animal models.
  • Figure 5a shows a schematic of a miR-223 deletion mouse model.
  • Figures 5b to 5e are graphs showing the increase in miR-223 expression, AST and ALT reduction, liver histological changes, Suzuki scores, and Parp1, Tnf, and il6 expression by miR-223-containing nanocarriers in a miR-223 deficient mouse model.
  • Figure 6a illustrates a schematic for inducing ischemic liver damage by collecting liver tissue from a living donor liver transplant patient.
  • Figures 6b and 6c are graphs showing the increase in the expression of miR-223-3p and the decrease in the expression of the PARP1 gene in patients after ischemic liver damage was induced, respectively.
  • the present invention provides a pharmaceutical composition for preventing or treating liver damage containing miR-223 or a mimic thereof as an active ingredient.
  • the miR-223 may be miR-223-3p, but is not limited thereto.
  • miR refers to a small non-coding RNA consisting of 18-25 nucleotides (nt), which regulates gene expression by binding to the 3'-untranslated region (UTR) of a target gene and promoting its degradation or inhibiting its translation.
  • nt nucleotides
  • miRNAs are processed from introns, exons, or intergenic regions. Generally, microRNAs are transcribed as a precursor of about 70-80 nt (nucleotides) in length with a hairpin structure called pre-miRNA, and then cut by the RNAse III enzyme Dicer to produce a mature form. MicroRNAs form a ribonucleolytic complex called miRNP, and cleave target genes through complementary binding to target sites or inhibit translation. More than 30% of human miRNAs exist in clusters, and are transcribed as a single precursor, then go through a cleavage process to form the final mature miRNA.
  • miRNA has a structure such as a hair pin, and when the structure is cut and divided, the one derived from the left arm of the hairpin is referred to as 5p, and the one derived from the right arm is referred to as 3p.
  • miR-223 may include both miR-223-3p and miR-223-5p, and preferably may include miR-223-3p, but is not limited thereto.
  • the mature sequences of miRNAs used in this study can be obtained from the miRNA database (http:/www.mirbase.org). According to the miRNA database (19th edition, miRBase) in August 2012, 25,141 mature miRNAs from 193 species are registered.
  • the term "mimic” may collectively refer to all substances that have a miRNA having a sequence identical or similar to a corresponding miRNA molecule, or exhibit an identical or extremely similar phenotype thereto, and perform a function identical to or similar to miR-223, or exhibit an effect thereof.
  • the miR-223 mimic according to the present invention is a miRNA that can perform a function equivalent to miR-223 in vivo/ex vivo, and may be represented by SEQ ID NO: 21 in the present invention, but is not limited thereto.
  • the liver damage may be ischemic liver damage, but is not limited thereto.
  • ischemic liver damage may include all symptoms and diseases that occur or are derived from ischemia of the liver, including ischemic hepatitis, hepatocyte necrosis, etc., but is not limited thereto.
  • the miR-223 or a mimic thereof may be included together with any one carrier selected from the group consisting of, but not limited to, a nanocarrier, a nanoparticle mimic, a nanotube, an exosome, a liposome, a lipidoid, a lipoplex, a lipid nanoparticle (LNP), a polymeric compound, a peptide, a protein, and a cell.
  • a nanocarrier a nanoparticle mimic, a nanotube, an exosome, a liposome, a lipidoid, a lipoplex, a lipid nanoparticle (LNP), a polymeric compound, a peptide, a protein, and a cell.
  • “nanocarrier” may mean any nano-sized material capable of effectively capturing miR-223 or a mimic thereof of the present invention and delivering it into the body, but is not limited thereto.
  • liposome may be composed of a phospholipid bilayer membrane that encapsulates both water-soluble and fat-soluble components, but is not limited thereto.
  • micro RNA miR, miRNA
  • miRNA is vulnerable to nucleases and has polyanionic properties, it is very difficult to stably deliver miRNA to the target site without loss in an in vivo environment, and even if it is delivered to the target site, there is still a problem that the efficiency of releasing miRNA back into the cytoplasm is low.
  • the delivery system comprising miR-223 or a mimic thereof may additionally contain substances necessary for accurate delivery without instability, instability, or loss of the substance, for example, peptides, lipids, other ligands, etc., and may process hormones, endorphins, etc., if necessary, but is not limited thereto.
  • the composition may be characterized by, but is not limited to, one or more of the following:
  • the composition may be administered by at least one method selected from the group consisting of intravenous administration, oral administration, and rectal administration, but is not limited thereto.
  • the "pharmaceutical composition” according to the present invention may further include suitable carriers, excipients and diluents commonly used in the manufacture of pharmaceutical compositions.
  • the excipients may be, for example, at least one selected from the group consisting of diluents, binders, disintegrants, lubricants, adsorbents, moisturizers, film-coating materials, and controlled-release additives.
  • the pharmaceutical composition according to the present invention may be formulated and used in the form of external preparations such as powders, granules, sustained-release granules, enteric-coated granules, liquids, eye drops, ellipses, emulsions, suspensions, alcohols, troches, aromatic waters, limonades, tablets, sustained-release tablets, enteric-coated tablets, sublingual tablets, hard capsules, soft capsules, sustained-release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, irrigants, ointments, pastes, sprays, inhalants, patches, sterile injection solutions, or aerosols, and the external preparations may have formulations such as creams, gels, patches, sprays, ointments, ointments, lotions, liniments, pastes, or cataplasmas.
  • external preparations may have formulations such as creams, gels, patches, sprays
  • Carriers, excipients and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharides, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants.
  • the additives of the tablets, powders, granules, capsules, pills and troches according to the present invention include excipients such as corn starch, potato starch, wheat starch, lactose, sucrose, glucose, fructose, D-mannitol, precipitated calcium carbonate, synthetic aluminum silicate, calcium monohydrogen phosphate, calcium sulfate, sodium chloride, sodium bicarbonate, purified lanolin, microcrystalline cellulose, dextrin, sodium alginate, methylcellulose, sodium carboxymethylcellulose, kaolin, urea, colloidal silica gel, hydroxypropyl starch, hydroxypropyl methyl cellulose (HPMC) 1928, HPMC 2208, HPMC 2906, HPMC 2910, propylene glycol, casein, calcium lactate and Primogel; Gelatin, gum arabic, ethanol, agar powder, cellulose acetate phthalate, carboxymethylcellulose, calcium carboxymethylcellulose, glucose, purified water, sodium caseinate, glycer
  • Lubricants that can be used include calcium stearate, magnesium stearate, stearic acid, hydrogenated vegetable oil, talc, lycopodium dentata, kaolin, petrolatum, sodium stearate, cocoa butter, sodium salicylate, magnesium salicylate, polyethylene glycol 4000, PEG 6000, liquid paraffin, hydrogenated soybean oil (Lubri wax), aluminum stearate, zinc stearate, sodium lauryl sulfate, magnesium oxide, macrogol, synthetic aluminum silicate, anhydrous silicic acid, higher fatty acids, higher alcohols, silicone oil, paraffin oil, polyethylene glycol fatty acid ether, starch, sodium chloride, sodium acetate, sodium oleate, dl-leucine, and light anhydrous silicic acid.
  • Additives that can be used in the liquid formulation according to the present invention include water, diluted hydrochloric acid, diluted sulfuric acid, sodium citrate, monostearate sucrose, polyoxyethylene sorbitol fatty acid esters (twin esters), polyoxyethylene monoalkyl ethers, lanolin ethers, lanolin esters, acetic acid, hydrochloric acid, ammonia water, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethylcellulose, sodium carboxymethylcellulose, and the like.
  • the syrup according to the present invention may use a solution of white sugar, other sugars or sweeteners, and may also use a flavoring agent, a coloring agent, a preservative, a stabilizer, a suspending agent, an emulsifier, a viscosity increasing agent, etc., as needed.
  • Purified water may be used in the emulsion according to the present invention, and an emulsifier, preservative, stabilizer, fragrance, etc. may be used as needed.
  • the suspension according to the present invention may use suspending agents such as acacia, tragacanth, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose, HPMC 1828, HPMC 2906, and HPMC 2910, and may also use surfactants, preservatives, stabilizers, colorants, and fragrances as needed.
  • suspending agents such as acacia, tragacanth, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose, HPMC 1828, HPMC 2906, and HPMC 2910, and may also use surfactants, preservatives, stabilizers, colorants, and fragrances as needed.
  • the injection according to the present invention includes: solvents such as distilled water for injection, 0.9% sodium chloride injection, Ringer's injection, dextrose injection, dextrose + sodium chloride injection, PEG, lactated Ringer's injection, ethanol, propylene glycol, nonvolatile oils such as sesame oil, cottonseed oil, peanut oil, soybean oil, corn oil, ethyl oleate, isopropyl myristate, and benzene benzoate; solubilizers such as sodium benzoate, sodium salicylate, sodium acetate, urea, urethane, monoethylacetamide, butazolidine, propylene glycol, Tween, nitrile acid amide, hexamine, and dimethylacetamide; buffers such as weak acids and their salts (acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, albumin, peptone, and gums; It may
  • the suppository according to the present invention comprises cocoa butter, lanolin, witepsol, polyethylene glycol, glycerogelatin, methylcellulose, carboxymethylcellulose, a mixture of stearic acid and oleic acid, subanal, cottonseed oil, peanut oil, palm oil, cocoa butter + cholesterol, lecithin, ranet wax, glycerol monostearate, Tween or Span, Imhausen, monolene (propylene glycol monostearate), glycerin, Adeps solidus, Buytyrum Tego-G, Cebes Pharma 16, hexalide base 95, Cotomar, Hydroxocote SP, S-70-XXA, S-70-XX75 (S-70-XX95), Hydroxocote Mechanisms such as (Hydrokote) 25, Hydrokote 711, Idropostal, Massa estrarium (A, AS, B, C, D, E, I, T), Massa-MF
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations are prepared by mixing the extract with at least one excipient, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc.
  • excipients such as starch, calcium carbonate, sucrose or lactose, gelatin, etc.
  • lubricants such as magnesium stearate and talc are also used.
  • Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups, and in addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, flavoring agents, and preservatives may be included.
  • Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories.
  • Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • the pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount.
  • the "pharmaceutically effective amount” means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dosage level can be determined according to the type and severity of the patient's disease, the activity of the drug, the sensitivity to the drug, the time of administration, the route of administration and the excretion rate, the treatment period, the concurrently used drugs, and other factors well known in the medical field.
  • the pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or in multiple doses. It is important to administer an amount that can achieve the maximum effect with the minimum amount without side effects by taking all of the above factors into consideration, and this can be easily determined by a person skilled in the art to which the present invention belongs.
  • the pharmaceutical composition of the present invention can be administered to a subject by various routes. All modes of administration are conceivable, and can be administered by, for example, oral ingestion, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, intrathecal (intrathecal) injection, sublingual administration, buccal mucosa administration, rectal insertion, vaginal insertion, ocular administration, otic administration, nasal administration, inhalation, spraying through the mouth or nose, dermal administration, transdermal administration, etc.
  • the pharmaceutical composition of the present invention is determined according to the type of drug as an active ingredient, along with various related factors such as the disease to be treated, the route of administration, the age, sex, weight of the patient, and the severity of the disease.
  • the effective amount of the composition according to the present invention may vary depending on the age, sex, and weight of the patient, and is generally 0.001 to 150 mg per 1 kg of body weight, preferably 0.01 to 100 mg, administered daily or every other day, or divided into 1 to 3 times a day.
  • the dosage may increase or decrease depending on the route of administration, the severity of the disease, sex, weight, age, etc., the above dosage does not limit the scope of the present invention in any way.
  • the term “subject” means a subject requiring treatment for a disease, and more specifically, means a mammal such as a human or non-human primate, mouse, rat, dog, cat, horse, or cow.
  • administration means providing a predetermined composition of the present invention to a subject by any suitable method.
  • prevention means any act of inhibiting or delaying the onset of a target disease
  • treatment means any act of improving or beneficially changing a target disease and its metabolic abnormality symptoms by administering a pharmaceutical composition according to the present invention
  • improvement means any act of reducing a parameter related to a target disease, for example, the degree of symptoms, by administering a composition according to the present invention.
  • the pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount.
  • the "pharmaceutically effective amount” means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dosage level can be determined according to the type and severity of the patient's disease, the activity of the drug, the sensitivity to the drug, the time of administration, the route of administration and the excretion rate, the treatment period, the concurrently used drugs, and other factors well known in the medical field.
  • the present invention provides a kit for preventing or treating liver damage, comprising the pharmaceutical composition and an instruction manual.
  • the "kit” of the present invention may include other components, devices, substances, etc. that are usually necessary to be suitable for administration to enhance the function and effect of mirR223 and its mimics.
  • all components included in the kit may be used one or more times without limitation on the number of times, there is no limitation on the order in which each substance is used, and the application of each substance may be performed simultaneously or microscopically.
  • the kit of the present invention may include a container in addition to the formulation and instructions.
  • the container may serve to package the composition, and may also serve to store and fix it.
  • the material of the container may take the form of, for example, a bottle, a tub, a sachet, an envelope, a tube, an ampoule, and the like, and these may be formed partly or wholly from plastic, glass, paper, foil, wax, and the like.
  • the container may be initially equipped with a completely or partially detachable stopper, which may be part of the container or may be attached to the container by mechanical, adhesive, or other means, and may also be equipped with a stopper for allowing access to the contents by means of a syringe needle.
  • the kit may include an outer package, which may include, but is not limited to, instructions for the use of the components.
  • Liver tissues were cut into approximately 0.5 cm pieces and fixed overnight in 10% formaldehyde solution (Cat. No. HT501320; Sigma-Aldrich, Merck KGaA, Darmstadt, Germany). The fixed tissues were embedded in paraffin and cut into 4- ⁇ m-thick sections using a microtome. Tissue slides were stained with hematoxylin and eosin for morphological analysis. The tissues were observed under a BX53 microscope (Cat. No. BX53; Olympus, Tokyo, Japan), and images were captured using a digital camera (Cat. No. DP27; Olympus). The degree of liver damage was evaluated using the Suzuki method for the presence and degree of congestion, cytoplasmic swelling, and hepatocyte necrosis, and was scored from 0 to 4 (Table 1).
  • RNA and miRNA were extracted from liver tissue (40-50 mg) or cultured cells. Frozen tissues were ground using a polypropylene pestle in a tube containing QIAzolTM lysis reagent (Cat. No. 79306; Qiagen, Hilden, Germany), and water-soluble substances were dissolved with chloroform. The supernatant was separated by centrifugation and transferred to a new tube. It was precipitated with 70% ethanol and bound to a silica column. The solution passing through the column was reprecipitated with 100% ethanol and collected on the same silica column. The RNA-binding column was washed, dried, and dissolved in DEPC-treated water.
  • QIAzolTM lysis reagent Cat. No. 79306; Qiagen, Hilden, Germany
  • Gene expression was measured using quantitative real-time polymerase chain reaction (QPCR) technology.
  • the equipment used was CFX Connect Real-Time PCR Detection System (Cat. No. 1855201; Bio-Rad, Hercules, CA, USA).
  • 5 ⁇ HOT FIREPol ® EvaGreen ® qPCR Supermix (Cat. No. 08-36-00001; Solis BioDyne, Tartu, Estonia) was used to detect fluorescence emitted during gene amplification.
  • the mixture of gene amplification primers, cDNA, and fluorescence was denatured at 95 ° C. for 12 min, followed by 40 cycles of denaturation at 95 ° C. for 15 s, annealing at 60 ° C. for 20 s, and elongation at 72 ° C. for 20 s. Data were expressed as fold-change between the experimental and control groups and normalized to Actin expression levels.
  • cDNA synthesis was performed using the miRCURY LNA RT Kit (Cat. No. 339340; Qiagen), and qRT-PCR was performed using the miRCURY LNA SYBR ® Green PCR Kit (Cat. No. 339345; Qiagen).
  • PCR cycling conditions were as follows: 95 °C for 2 min, followed by 45 cycles of 95 °C for 10 s and 56 °C for 60 s.
  • U6 snRNA was used to normalize the miRNA expression level. Primer sequences are presented in Table 2.
  • Sequence number Gene name 5' - 3' sequences Sequence number 1 Hs_PARP1 Forward GCTCCTGAACAATGCAGACA Sequence number 2 reverse CATTGTGTGTGGTTGCATGA Sequence number 3 Hs_ACTB Forward GGAGAAAATCTGGCACCACA Sequence number 4 reverse AGAGGCGTACAGGGATAGCA Sequence number 5 Hs_TNF Forward TCCTTCAGACACCCTCAACC Sequence number 6 reverse AGGCCCCAGTTTGAATTCTT Sequence number 7 Hs_IL6 Forward AGGAGACTTGCCTGGTGAAA Sequence number 8 reverse CAGGGGTGGTTATTGCATCT Sequence number 9 Mm_Parp1 Forward GCAGCGAGAGTATTCCCAAG Sequence number 10 reverse CCGTCTTCTTGACCTTCTGC Sequence number 11 Mm_Actb Forward AGCCATGTACGTAGCCATCC Sequence number 12 reverse CTCTCAGCTGTGGTGGTGAA Sequence number 13 Mm_Tnf Forward CTATGTCTCAGCCTCTTCTC Sequence number 14 reverse CATTT
  • an ischemic liver injury animal model was created using wild-type C57BL/6J mice.
  • the exact name of the mouse is C57BL/6JBomTac, and it was provided by DBL, located in Chungcheongbuk-do, South Korea.
  • the mice were raised in a specific pathogen free (SPF) condition, and the experimental procedures were reviewed and approved by the Animal Experiment Ethics Committee of the Asan Institute for Life Sciences.
  • SPF pathogen free
  • mice were anesthetized with a mixture of tiletamine, zolazepam, and xylazine, the abdomen was incised to expose the hepatic artery and portal vein, and then the hepatic artery and portal vein were physically occluded using a bulldog clamp to block blood flow to approximately 70% of the entire liver for 45 minutes. Thereafter, blood was collected from the mice at 0, 1, 2, and 6 hours, and serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were measured (Fig. 1a).
  • AST serum aspartate aminotransferase
  • ALT alanine aminotransferase
  • Liver tissues were obtained at the same time points and stained with hematoxylin and eosin to identify histological changes, and congestion, vacuolation, and necrosis of the liver tissues were evaluated using the Suzuki score method.
  • miR-223-3p and PARP1 gene in the tissues was investigated using real-time polymerase chain reaction (qRT-PCR).
  • qRT-PCR real-time polymerase chain reaction
  • AST and ALT which are ischemic liver damage indicators, were increased in the ischemic liver injury animal model (Fig. 1b).
  • histological changes in the liver were shown as in Fig. 1c.
  • the histological observation results confirmed that the characteristic patterns observed in the process of hepatocytes undergoing necrosis occurred more widely as the reperfusion time passed.
  • the cell membrane collapsed the cell membrane collapsed, the cytoplasm was stained lightly by eosin, and the nucleus shrank and became smaller (pyknosis) or disappeared through the process of nuclear lysis (karyolysis).
  • Hepatocyte necrosis was preferentially observed around the central vein of the liver at 1 hour after reperfusion, and the area of hepatocyte necrosis expanded as the reperfusion time increased, reaching around the portal vein at 6 hours.
  • the Suzuki Scores for hepatic tissue congestion, swelling, and necrosis increased with the passage of blood flow occlusion time (Fig. 1d), and above all, the expression of miR-223-3p also increased, and the increase was confirmed to be statistically significant at 6 hours after blood flow occlusion (Fig. 1e).
  • miR-223-/y animals in which the miR-223 gene is deleted, were used. Since the miR-223 gene is located on the X chromosome, the genotype of male animals is miR-223-/y. miR-223 knockout mice were obtained from The Jackson Laboratory, USA (Cat. No. IMSR_JAX:002779). Mice were raised under specific pathogen free (SPF) conditions, and the experimental procedures were reviewed and approved by the Animal Experiment Ethics Committee of the Asan Institute for Life Sciences. The genotypes of the gene-deficient animals were verified through polymerase chain reaction-based genotyping before the experiment.
  • SPF pathogen free
  • ischemic liver damage indicators AST and ALT were further increased in miR-223 deficient mice (Fig. 2b), and histological damage (hepatocyte necrosis and congestion) was also confirmed to be increased the most (Figs. 2c and 2d).
  • the decrease in PARP1 gene expression observed in wild-type mice was not observed in miR-223 deficient mice, and inflammatory indicators Tnf and Il6 were also further increased in miR-223 deficient mice (Fig. 2e).
  • Example 3-1 Confirmation of negative correlation between miR-223 and PARP1 in hepatocyte-like cells
  • HepaRGTM To determine whether miR-223 regulates PARP1 gene expression in hepatocytes, fully differentiated HepaRGTM was used.
  • Fully differentiated HepaRGTM (Cat. No. HPRGC10, Thermo Fisher Scientific), a commercial cell line, was used in William's E medium (Cat. No. 12551-032, Thermo Fisher Scientific) supplemented with thaw, plate & general purpose medium supplement (Cat. No. HPRG670, Thermo Fisher Scientific) and GlutaMAXTM supplement (Cat. No. 35050-061, Thermo Fisher Scientific).
  • the cells were cultured at 37°C and 5% CO 2 .
  • miR-223-3p mimic was prepared in the form of liposomes using Lipofectamine 2000 (Cat. No. 11668-019, Thermo Fisher Scientific) and introduced into cultured cells.
  • the expression of miR-223-3p and PARP1 genes in the cell lines introduced with miR-223-3p mimic was examined by qRT-PCR.
  • the decrease in the expression of PARP1 protein was confirmed by Western blot.
  • the cell lines were treated with a solution containing T-PERTM Tissue Protein Extraction Reagent (Cat. No. 78510; Thermo Fisher Scientific) plus a protease inhibitor (Cat. No.
  • the PARP1 gene binding site of miR-223-3p was predicted by miRDB (https:/mirdb.org/) (Fig. 3c). HepaRG cells were treated with pMirTarget plasmid (0.8 ⁇ g; Ori Gene), which was constructed by inserting the miR-223-3p binding region into the 3' UTR of PARP1, and were also treated with control miRNA (50 nmol/L) or hsa-miR-223-3p mimic (50 nmol/L) at the same time. Intracellular introduction was performed using Lipofectamine ® 2000 (Cat. No. 11668019; Thermo Fisher Scientific) at 37°C for 48 h in 60% confluent cells in 24-well plates.
  • Firefly and Renilla luciferase activities were measured using the Dual-Luciferase ® Reporter assay (DLRTM; Cat. No. E1910; Promega, Madison, Wisconsin, USA). Renilla luciferase activity in each sample was normalized to Firefly luciferase.
  • DLRTM Dual-Luciferase ® Reporter assay
  • PARP1-deficient mice were obtained from The Jackson Laboratory, USA (Cat. No. IMSR_JAX:002779; Strain of origin: 129S2/SvPas). Mice were raised under specific pathogen free (SPF) conditions, and the experimental procedures were reviewed and approved by the Animal Experiment Ethics Committee of the Asan Institute for Life Sciences. The genotypes of the genetically defective animals were verified through polymerase chain reaction-based genotyping before the experiment.
  • bionanocarriers containing control miRNA mimic (Cat. No. SMC-2002; AccuTargetTM miRNA mimic Negative Control #1; Bioneer, Daejeon, South Korea) or miR-223-3p mimic (Cat. No. SMM-002; AccuTargetTM Human miRNA Mimic; Bioneer) were fabricated. Specifically, they were conjugated to artificial liposomes, DOPC (phospholipid 1,2-dioleonyl-sn-glycero-3-phosphatidylcholine), by ultrasonication, and commercialized product MaxSuppressorTM In Vivo RNA-LANCEr II (Cat. No. 3410-01; BIOO Scientific, Perkin Elmer, Massachusetts, USA) was used. The molecular weight of miRNA was calculated according to the following formula.
  • MWssRNA NA ⁇ MWA+NU ⁇ MWU+NC ⁇ MWC+NG ⁇ MWG+159
  • the molecular weights of A, U, C, and G are 329.2, 306.2, 305.2, and 345.2 g/mol, respectively. Additionally, 159 indicates the presence of a 5'-triphosphate residue. In addition, N represents the number of each base.
  • the molecular weight of the sequence complementary to the base sequence should also be considered. Therefore, the final molecular weight was obtained using the following calculation formula.
  • Anti-sense base sequence UGGGGUAUUUGACAAACUGACA
  • the calculated molecular weight of the double-stranded form of the miR-223-3p mimic (base sequence: UGUCAGUUUGUCAAAUACCCCA_SEQ ID NO: 21) is 14431.8 g/mol, and the expected weight of 10 nmol product is 144.32 ⁇ g.
  • 10 nmol product was administered to five mice, and the amount administered to one mouse was approximately 28.9 ⁇ g.
  • the nanocarrier was administered twice to a total of 25 mice.
  • miR-223 knockout mice were used. miR-223 knockout mice were treated with miRNA-containing nanocarriers i.v. via the orbital vein plexus injection technique 24 and 48 h before the induction of hepatic ischemia/reperfusion injury. After that, miR-223 knockout mice were anesthetized with a mixture of tiletamine, zolazepam, and xylazine. The abdomen was incised to expose the hepatic artery and portal vein, and then the hepatic artery and portal vein were physically occluded using a bulldog clamp to block blood flow to approximately 70% of the entire liver for 45 min.
  • Fig. 5a Liver tissues were obtained at the same time points, stained with hematoxylin and eosin to identify histological changes, and hepatic tissue congestion, swelling, and necrosis were evaluated using the Suzuki scoring method.
  • miR-223-3p and PARP1 gene in the tissues was investigated through real-time polymerase chain reaction.
  • TNF and IL6 which are genes related to inflammation signals expressed due to PARP1 activity, was investigated. The results are shown in the figure below.
  • the miR-223-containing nanocarrier increased the expression level of miR-223 in liver tissue (Fig. 5b) and decreased AST, ALT, which are liver damage indicators, and Suzuki score, which is a histological damage measure (Fig. 5c and Fig. 5d).
  • AST, ALT which are liver damage indicators
  • Suzuki score which is a histological damage measure
  • TNF and IL6 which are cell damage-related genes increased by PARP1 overactivation
  • the miR-223-containing nanocarrier inhibits hepatocyte damage through the mechanism of inhibiting PARP1 protein activity in liver tissue.
  • Liver tissues were collected from living donor liver transplant recipients. Before ischemic liver damage, the tissues were obtained immediately after cold ischemia. After ischemic liver damage, the tissues were obtained from the recipients after the liver transplant surgery and the vascular anastomosis was completed. All tissues were frozen immediately after acquisition and stored at -80°C until analysis (Fig. 6a). The use of all patient samples was conducted in compliance with the ethical standards and regulations of the Institutional Review Board (IRB; approval number 2018-1386) of Seoul Asan Medical Center, and written informed consent was obtained after providing sufficient information about the study to each patient.
  • IRS Institutional Review Board
  • the role of miR-223 was verified in an ischemic liver damage animal model, ischemic liver damage was confirmed in a miR-223 deficient animal model, and the ischemic liver damage prevention or treatment effect was confirmed in a PARP1 deficient animal model.
  • miR-223 directly binds to PARP1 and exhibits inhibitory activity, not only was a negative correlation confirmed between the two substances, but also the in vivo/in vitro ischemic liver damage treatment effect through PARP1 inhibition was confirmed, and therefore, it can be utilized for the treatment of various diseases related to ischemic liver damage, and thus has industrial applicability.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 miR-223을 유효성분으로 포함하는 간 손상 예방 또는 치료용 조성물에 관한 것으로, 허혈성 간 손상 동물 모델에서 miR-223의 역할이 검증되었고, miR-223 결손 동물 모델에서 허혈성 간 손상 여부가 확인되었으며, PARP1 결손 동물 모델에서는 허혈성 간 손상 예방 또는 치료 효과가 확인되었다. 또한, miR-223이 PARP1와 직접적으로 결합하여 억제활성을 나타냄에 따라 양 물질 사이의 음의 상관관계가 확인되었을 뿐만 아니라, PARP1 억제를 통한 생체 내/외에서의 허혈성 간 손상 치료 효과가 확인되었는 바, 허혈성 간 손상과 관련된 다양한 질환 치료에 활용될 것으로 기대된다.

Description

MIR-223을 유효성분으로 포함하는 간 손상 예방 또는 치료용 조성물
본 발명은 miR-223을 유효성분으로 포함하는 간 손상 예방 또는 치료용 조성물에 관한 것이다.
본 발명은 2023년 4월 17일에 출원된 대한민국 특허출원 제10-2023-0050330호에 기초한 우선권을 주장하며, 상기 출원들의 명세서 및 도면에 개시된 모든 내용은 본 출원에 원용된다.
신체 각 부분이 기능을 정상적으로 수행하려면 혈관을 통하여 적절한 산소와 영양이 공급되어야 한다. 허혈은 심장 및 기타 조직에서 혈액공급의 차단으로 산소와 혈액 내에 포함되어 있는 여러 가지 영양분이 공급되지 못해 일어나는 현상이다. 이는 산소 공급이 급격히 이뤄지면서 활성산소종이 과도하게 생성되기 때문으로 분석되는데, 활성산소종은 조직을 직접 손상시키거나 염증을 유도해 간접적인 손상을 가하는 것으로 알려져 있다.
심근경색이나 뇌졸중, 말초동맥질환이 발생할 때나 장기이식 수술을 받는 과정에서 혈관이 막히면 혈액 공급이 일시적으로 중단될 수 있다. 문제는 혈액 흐름이 복구될 때 산소 공급이 급격히 이뤄지면서 조직이 손상을 입는 경우가 발생한다. 이를 허혈성 재관류에 의한 손상 (허혈성 손상)이라 한다. 허혈증으로 인해 손상 받는 장기는 대표적으로 심장, 뇌 조직이 있으나, 이식 수술이 잦은 신장, 간 등에서도 치명적으로 작용한다.
특히, 허혈성 간손상은 간이식 수술 과정에서 발생할 수 있으며, 생체 간이식 수술 시 이식된 간의 생존율에 결정적인 영향을 준다. 지금까지 연구에서는 활성산소를 제거해 허혈성 간손상 억제 초점을 맞춰왔지만 유의한 성과는 얻지 못하고 있다.
한편, miRNA (마이크로 RNA)는 15~25 염기의 RNA로 이루어지고, 다양한 생물에서 그 존재가 확인되고 있으며, 게놈 DNA로부터 헤어핀 모양 구조의 RNA (전구체)로서 전사된다. 이 전구체는 특정효소 RNaseIII 절단 활성을 갖는 dsRNA 절단 효소 (Drosha, Dicer)에 의해 절단된 후, 2본쇄의 형태로 변화하고, 그 후 1본쇄가 된다. 그리고, 한쪽의 안티센스쇄가 RISC라고 칭하는 단백질 복합체에 도입되어 mRNA의 번역 억제에 관여한다고 여겨지고 있다. 이렇게 miRNA는 전사 후, 각 단계에 있어서 그 양태는 상이하기 때문에 통상 miRNA를 검출 대상으로 하는 경우는 헤어핀 구조체, 2본쇄 구조체, 1본쇄 구조체 등의 각종 형태를 고려할 필요가 있다.
최근 miRNA를 이용하여 다양한 암 등을 포함하는 질환의 진단, 예방, 치료제로 다양하게 연구되고 있으나, 허혈성 간 손상과 관련된 효과는 보고된 바 없다.
본 발명의 하나의 목적은 miR-223 또는 이의 모방체 (mimic)를 유효성분으로 포함하는 간 손상 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은 상기 약학적 조성물, 및 설명서를 포함하는 간 손상 예방 또는 치료용 키트를 제공하는 것이다.
그러나, 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 본 발명이 속하는 기술 분야의 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
본 발명은 miR-223 또는 이의 모방체 (mimic)를 유효성분으로 포함하는 간 손상 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 일 실시예에 있어서, 상기 miR-223은 miR-223-3p일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 일 실시예에 있어서, 상기 간 손상은 허혈성 간 손상일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 일 실시예에 있어서, 상기 miR-223 또는 이의 모방체는 나노전달체, 나노입자 모방체, 나노튜브, 엑소좀 (exosome), 리포좀 (liposome), 리피도이드 (lipidoid), 리포플렉스 (lipoplex), 지질 나노입자 (Lipid Nano Particle, LNP), 중합체성 화합물, 펩티드, 단백질, 및 세포로 이루어진 군으로부터 선택되는 어느 하나의 전달체와 함께 포함될 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 일 실시예에 있어서, 상기 조성물은 하기 중 어느 하나 이상을 특징으로 할 수 있으나, 이에 제한되는 것은 아니다:
알라닌 아미노전이조효소 및 아스파르트산 아미노전이조효소 억제;
Parp1의 기능 및 발현 억제; 및
Tnf 및 Il6 억제.
본 발명의 일 실시예에 있어서, 상기 조성물은 정맥투여, 경구투여, 및 직장투여로 이루어진 군으로부터 선택되는 어느 하나 이상의 방법으로 처리될 수 있으나, 이에 제한되는 것은 아니다.
본 발명은 상기 약학적 조성물, 및 설명서를 포함하는 간 손상 예방 또는 치료용 키트를 제공한다.
또한, 본 발명은 miR-223 또는 이의 모방체 (mimic), 또는 이를 유효성분으로 포함하는 조성물의 간 손상 예방 또는 치료 용도를 제공한다.
또한, 본 발명은 miR-223 또는 이의 모방체 (mimic), 또는 이를 유효성분으로 포함하는 조성물을 이를 필요로 하는 개체에게 투여하는 단계를 포함하는 간 손상 예방 또는 치료 방법을 제공한다.
또한, 본 발명은 간 손상 예방 또는 치료 제제를 제조하기 위한 miR-223 또는 이의 모방체 (mimic), 또는 이를 유효성분으로 포함하는 조성물의 용도를 제공한다.
miR-223을 유효성분으로 포함하는 간 손상 예방 또는 치료용 조성물에 따르면, 허혈성 간 손상 동물 모델에서 miR-223의 역할이 검증되었고, miR-223 결손 동물 모델에서 허혈성 간 손상 여부가 확인되었으며, PARP1 결손 동물 모델에서는 허혈성 간 손상 예방 또는 치료 효과가 확인되었다. 또한, miR-223이 PARP1와 직접적으로 결합하여 억제활성을 나타냄에 따라 양 물질 사이의 음의 상관관계가 확인되었을 뿐만 아니라, PARP1 억제를 통한 생체 내/외에서의 허혈성 간 손상 치료 효과가 확인되었는 바, 허혈성 간 손상과 관련된 다양한 질환 치료에 활용될 것으로 기대된다.
도 1a는 허혈성 간 손상 동물 모델의 설계도를 나타낸 것이다.
도 1b 내지 도 1f는 허혈성 간 손상 모델에서의 AST 및 ALT, 간 조직학적 변화, suzuki scores, miR-223-3p의 발현 수준 변화, 및 Parp1, Tnf, il6 발현 여부를 나타낸 그래프이다.
도 2a는 miR-223 결손 모델의 설계도를 나타낸 것이다.
도 2b 내지 도 2e는 miR-223 결손 모델에서의 AST 및 ALT, 간 조직학적 변화, suzuki scores, 및 Parp1, Tnf, il6 발현 여부를 나타낸 그래프이다.
도 3a는 miR-223-3p 모방체 도입 간세포 유사세포에서의 miR-223-3p 및 Parp1의 수준 변화를 나타낸 그래프이며, 도 3b는 Parp1 단백질의 발현 감소를 웨스턴 블롯으로 확인 및 정량한 결과를 나타낸 그래프이다.
도 3c는 miR-223-3p의 Parp1 유전자 결합 부위를 나타낸 것이다.
도 3d는 miR-223-3p 모방체 처리 시 PARP1 3' UTR 영역의 luciferase 활성이 감소한 것을 나타낸 그래프이다.
도 4a는 Parp1 결손 동물 모델의 설계도를 나타낸 것이다.
도 4b 내지 도 4e는 Parp1 결손 동물 모델에서의 AST 및 ALT, 간 조직학적 변화, suzuki scores, 및 Parp1, Tnf, il6 발현 여부를 나타낸 그래프이다.
도 5a는 miR-223 결손 마우스 모델의 설계도를 나타낸 것이다.
도 5b 내지 도 5e는 miR-223 결손 마우스 모델에서의 miR-223 함유 나노전달체에 의한 miR-223 발현량 증가, AST, 및 ALT 감소효과, 간 조직학적 변화, suzuki scores, 및 Parp1, Tnf, il6 발현 여부를 나타낸 그래프이다.
도 6a는 생체 간 이식 환자로부터 간 조직을 수집하여 허혈성 간 손상을 유도하기 위한 설계도를 나타낸 것이다.
도 6b 및 도 6c는 각각 허혈성 간 손상이 유도된 이후 환자에서의 miR-223-3p의 발현 증가 및 PARP1 유전자의 발현 감소를 나타낸 그래프이다.
본 발명은 miR-223 또는 이의 모방체 (mimic)를 유효성분으로 포함하는 간 손상 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 일 실시예에 있어서, 상기 miR-223은 miR-223-3p일 수 있으나, 이에 제한되는 것은 아니다.
본 명세서에서, "miR"또는 "miRNA"는 18-25 뉴클레오티드 (nucleotide, nt)로 구성된 작은 비-암호화 RNA로서, 표적 유전자의 3'-비번역 부위 (untranslated region, UTR)에 결합하여 이의 분해 (degradation)을 촉진시키거나 또는 그들의 번역을 억제시킴으로써 유전자 발현을 조절하는 조절하는 21 내지 23개의 비코딩 RNA를 말한다.
miRNA는 인트론 (intron), 엑손 (exon) 또는 유전자 간 부위 (intergenic region)로부터 공정된다. 일반적으로 마이크로 RNA는 pre-miRNA라 불리는 헤어핀 구조를 갖는 약 70-80 nt (nucleotide) 길이의 전구체로 전사된 후, RNAse III 효소인 Dicer에 의해 잘려 성숙된 형태로 생성된다. 마이크로 RNA는 miRNP라 불리는 리보뉴클레오복합체를 형성하여 표적 부위에 상보적 결합을 통해 표적 유전자를 절단하거나, 번역을 억제한다. 30% 이상의 인간 miRNA는 클러스터로 존재하며, 하나의 전구체로 전사된 후, 절단 과정을 거쳐 최종 성숙 miRNA가 형성된다.
miRNA는 hair pin등의 구조를 하고 있다가 상기 구조가 절단되어 나뉘어지게 되는데 hairpin의 left arm에서 유래하는 것을 5p, right arm에서 유래하는 것을 3p라 지칭한다. 본 발명에서, miR-223은 miR-223-3p, miR-223-5p를 모두 포함할 수 있고, 바람직하게는 miR-223-3p를 포함할 수 있으나, 이에 제한되는 것은 아니다.
본원에 사용된 miRNA의 성숙 서열은 miRNA 데이터베이스 (http:/www.mirbase.org)에서 얻을 수 있다. 2012년 8월 miRNA 데이터베이스 (19판, miRBase)에 의하면 193개 종에서 유래한 25,141개의 성숙 miRNA가 등록되어 있다.
본 발명에서, "모방체 (mimic)"란 해당 miRNA 분자와 동일 또는 유사한 서열을 가지는 miRNA로, 또는 그와 동일 또는 극히 유사한 표현형을 나타내는 것으로, miR-223과 동일, 또는 유사한 기능을 수행하거나, 효과를 나타내는 물질을 모두 총칭할 수 있다. 본 발명에 따른 miR-223의 모방체는 체내/외에서 miR-223과 동등한 기능을 수행할 수 있는 miRNA으로, 본 발명에서는 서열번호 21로 표시될 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 일 실시예에 있어서, 상기 간 손상은 허혈성 간 손상일 수 있으나, 이에 제한되는 것은 아니다. 예를 들어, 허혈성 간 손상은 허혈성 간염, 간세포 괴사 등을 포함하여 간에 대한 허혈에 따라 발생, 파생되는 모든 증상, 질환을 모두 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 일 실시예에 있어서, 상기 miR-223 또는 이의 모방체는 나노전달체, 나노입자 모방체, 나노튜브, 엑소좀 (exosome), 리포좀 (liposome), 리피도이드 (lipidoid), 리포플렉스 (lipoplex), 지질 나노입자 (Lipid Nano Particle, LNP), 중합체성 화합물, 펩티드, 단백질, 및 세포로 이루어진 군으로부터 선택되는 어느 하나의 전달체와 함께 포함될 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서, "나노전달체"는 본 발명의 miR-223 또는 이의 모방체를 효과적으로 포집하여 체내에 전달할 수 있는 나노크기의 모든 물질을 의미할 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서, "리포좀"이란 수용성과 지용성성분을 모두 캡슐화 하는 인지질 이중막으로 구성될 수 있으나, 이에 제한되는 것은 아니다.
micro RNA (miR, miRNA)는 핵산분해효소에 취약하고, 다중음이온 특성을 가지고 있기 때문에, in vivo 환경에서 타겟 부위까지 소실없이 안정적으로 miRNA를 전달하는 것은 매우 어려우며, 타겟 부위로 이동하였다고 하더라도 miRNA를 다시 세포질로 방출하는 효율이 떨어진다는 문제점이 여전히 존재한다.
miR-223 또는 이의 모방체를 포함하는 전달체는 상기 물질의 불안정성, 불안전성, 소실 없이 정확한 전달에 필요한 물질을 추가적으로 포함할 수 있으며, 예를 들어, 펩타이드, 지질, 기타 리간드 등이 있을 수 있고, 필요한 경우 호르몬, 엔돌핀 등을 처리할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 일 실시예에 있어서, 상기 조성물은 하기 중 어느 하나 이상을 특징으로 할 수 있으나, 이에 제한되는 것은 아니다:
알라닌 아미노전이조효소 및 아스파르트산 아미노전이조효소 억제;
Parp1의 기능 및 발현 억제; 및
Tnf 및 Il6 억제.
본 발명의 일 실시예에 있어서, 상기 조성물은 정맥투여, 경구투여, 및 직장투여로 이루어진 군으로부터 선택되는 어느 하나 이상의 방법으로 처리될 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 따른 "약학적 조성물"은 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다. 상기 부형제는 예를 들어, 희석제, 결합제, 붕해제, 활택제, 흡착제, 보습제, 필름-코팅 물질, 및 제어방출첨가제로 이루어진 군으로부터 선택된 하나 이상일 수 있다.
본 발명에 따른 약학적 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 서방형 과립제, 장용과립제, 액제, 점안제, 엘실릭제, 유제, 현탁액제, 주정제, 트로키제, 방향수제, 리모나아데제, 정제, 서방형정제, 장용정제, 설하정, 경질캅셀제, 연질캅셀제, 서방캅셀제, 장용캅셀제, 환제, 틴크제, 연조엑스제, 건조엑스제, 유동엑스제, 주사제, 캡슐제, 관류액, 경고제, 로션제, 파스타제, 분무제, 흡입제, 패취제, 멸균주사용액, 또는에어로졸 등의 외용제 등의 형태로 제형화하여 사용될 수 있으며, 상기 외용제는 크림, 젤, 패치, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 또는 카타플라스마제 등의 제형을 가질 수 있다.
본 발명에 따른 약학적 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 올리고당, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.
제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다.
본 발명에 따른 정제, 산제, 과립제, 캡슐제, 환제, 트로키제의 첨가제로 옥수수전분, 감자전분, 밀전분, 유당, 백당, 포도당, 과당, 디-만니톨, 침강탄산칼슘, 합성규산알루미늄, 인산일수소칼슘, 황산칼슘, 염화나트륨, 탄산수소나트륨, 정제 라놀린, 미결정셀룰로오스, 덱스트린, 알긴산나트륨, 메칠셀룰로오스, 카르복시메칠셀룰로오스나트륨, 카올린, 요소, 콜로이드성실리카겔, 히드록시프로필스타치, 히드록시프로필메칠셀룰로오스 (HPMC) 1928, HPMC 2208, HPMC 2906, HPMC 2910, 프로필렌글리콜, 카제인, 젖산칼슘, 프리모젤 등 부형제; 젤라틴, 아라비아고무, 에탄올, 한천가루, 초산프탈산셀룰로오스, 카르복시메칠셀룰로오스, 카르복시메칠셀룰로오스칼슘, 포도당, 정제수, 카제인나트륨, 글리세린, 스테아린산, 카르복시메칠셀룰로오스나트륨, 메칠셀룰로오스나트륨, 메칠셀룰로오스, 미결정셀룰로오스, 덱스트린, 히드록시셀룰로오스, 히드록시프로필스타치, 히드록시메칠셀룰로오스, 정제쉘락, 전분호, 히드록시프로필셀룰로오스, 히드록시프로필메칠셀룰로오스, 폴리비닐알코올, 폴리비닐피롤리돈 등의 결합제가 사용될 수 있으며, 히드록시프로필메칠셀룰로오스, 옥수수전분, 한천가루, 메칠셀룰로오스, 벤토나이트, 히드록시프로필스타치, 카르복시메칠셀룰로오스나트륨, 알긴산나트륨, 카르복시메칠셀룰로오스칼슘, 구연산칼슘, 라우릴황산나트륨, 무수규산, 1-히드록시프로필셀룰로오스, 덱스트란, 이온교환수지, 초산폴리비닐, 포름알데히드처리 카제인 및 젤라틴, 알긴산, 아밀로오스, 구아르고무 (Guar gum), 중조, 폴리비닐피롤리돈, 인산칼슘, 겔화전분, 아라비아고무, 아밀로펙틴, 펙틴, 폴리인산나트륨, 에칠셀룰로오스, 백당, 규산마그네슘알루미늄, 디-소르비톨액, 경질무수규산 등 붕해제; 스테아린산칼슘, 스테아린산마그네슘, 스테아린산, 수소화식물유 (Hydrogenated vegetable oil), 탈크, 석송자, 카올린, 바셀린, 스테아린산나트륨, 카카오지, 살리실산나트륨, 살리실산마그네슘, 폴리에칠렌글리콜 4000, PEG 6000, 유동파라핀, 수소첨가대두유 (Lubri wax), 스테아린산알루미늄, 스테아린산아연, 라우릴황산나트륨, 산화마그네슘, 마크로골 (Macrogol), 합성규산알루미늄, 무수규산, 고급지방산, 고급알코올, 실리콘유, 파라핀유, 폴리에칠렌글리콜지방산에테르, 전분, 염화나트륨, 초산나트륨, 올레인산나트륨, dl-로이신, 경질무수규산 등의 활택제가 사용될 수 있다.
본 발명에 따른 액제의 첨가제로는 물, 묽은 염산, 묽은 황산, 구연산나트륨, 모노스테아린산슈크로스류, 폴리옥시에칠렌소르비톨지방산에스텔류 (트윈에스텔), 폴리옥시에칠렌모노알킬에텔류, 라놀린에텔류, 라놀린에스텔류, 초산, 염산, 암모니아수, 탄산암모늄, 수산화칼륨, 수산화나트륨, 프롤아민, 폴리비닐피롤리돈, 에칠셀룰로오스, 카르복시메칠셀룰로오스나트륨 등이 사용될 수 있다.
본 발명에 따른 시럽제에는 백당의 용액, 다른 당류 혹은 감미제 등이 사용될 수 있으며, 필요에 따라 방향제, 착색제, 보존제, 안정제, 현탁화제, 유화제, 점조제 등이 사용될 수 있다.
본 발명에 따른 유제에는 정제수가 사용될 수 있으며, 필요에 따라 유화제, 보존제, 안정제, 방향제 등이 사용될 수 있다.
본 발명에 따른 현탁제에는 아카시아, 트라가칸타, 메칠셀룰로오스, 카르복시메칠셀룰로오스, 카르복시메칠셀룰로오스나트륨, 미결정셀룰로오스, 알긴산나트륨, 히드록시프로필메칠셀룰로오스, HPMC 1828, HPMC 2906, HPMC 2910 등 현탁화제가 사용될 수 있으며, 필요에 따라 계면활성제, 보존제, 안정제, 착색제, 방향제가 사용될 수 있다.
본 발명에 따른 주사제에는 주사용 증류수, 0.9%염화나트륨주사액, 링겔주사액, 덱스트로스주사액, 덱스트로스+염화나트륨주사액, 피이지 (PEG), 락테이티드 링겔주사액, 에탄올, 프로필렌글리콜, 비휘발성유-참기름, 면실유, 낙화생유, 콩기름, 옥수수기름, 올레인산에칠, 미리스트산 이소프로필, 안식향산벤젠과 같은 용제; 안식향산나트륨, 살리실산나트륨, 초산나트륨, 요소, 우레탄, 모노에칠아세트아마이드, 부타졸리딘, 프로필렌글리콜, 트윈류, 니정틴산아미드, 헥사민, 디메칠아세트아마이드와 같은 용해보조제; 약산 및 그 염 (초산과 초산나트륨), 약염기 및 그 염 (암모니아 및 초산암모니움), 유기화합물, 단백질, 알부민, 펩톤, 검류와 같은 완충제; 염화나트륨과 같은 등장화제; 중아황산나트륨 (NaHSO3), 이산화탄소가스, 메타중아황산나트륨 (Na2S2O5), 아황산나트륨 (Na2SO3), 질소가스 (N2), 에칠렌디아민테트라초산과 같은 안정제; 소디움비설파이드 0.1%, 소디움포름알데히드 설폭실레이트, 치오우레아, 에칠렌디아민테트라초산디나트륨, 아세톤소디움비설파이트와 같은 황산화제; 벤질알코올, 클로로부탄올, 염산프로카인, 포도당, 글루콘산칼슘과 같은 무통화제; 시엠시나트륨, 알긴산나트륨, 트윈 80, 모노스테아린산알루미늄과 같은 현탁화제를 포함할 수 있다.
본 발명에 따른 좌제에는 카카오지, 라놀린, 위텝솔, 폴리에틸렌글리콜, 글리세로젤라틴, 메칠셀룰로오스, 카르복시메칠셀룰로오스, 스테아린산과 올레인산의 혼합물, 수바날 (Subanal), 면실유, 낙화생유, 야자유, 카카오버터+콜레스테롤, 레시틴, 라네트왁스, 모노스테아린산글리세롤, 트윈 또는 스판, 임하우젠 (Imhausen), 모놀렌 (모노스테아린산프로필렌글리콜), 글리세린, 아뎁스솔리두스 (Adeps solidus), 부티룸 태고-G (Buytyrum Tego-G), 세베스파마 16 (Cebes Pharma 16), 헥사라이드베이스 95, 코토마 (Cotomar), 히드록코테 SP, S-70-XXA, S-70-XX75 (S-70-XX95), 히드록코테 (Hydrokote) 25, 히드록코테 711, 이드로포스탈 (Idropostal), 마사에스트라리움 (Massa estrarium, A, AS, B, C, D, E, I, T), 마사-MF, 마수폴, 마수폴-15, 네오수포스탈-엔, 파라마운드-B, 수포시로 (OSI, OSIX, A, B, C, D, H, L), 좌제기제 IV 타입 (AB, B, A, BC, BBG, E, BGF, C, D, 299), 수포스탈 (N, Es), 웨코비 (W, R, S, M ,Fs), 테제스터 트리글리세라이드 기제 (TG-95, MA, 57)와 같은 기제가 사용될 수 있다.
경구 투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 추출물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트 (calcium carbonate), 수크로스 (sucrose) 또는 락토오스 (lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다.
경구 투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜 (propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다.
본 발명에 따른 약학적 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에 있어서, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.
본 발명에 따른 약학적 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 본 발명이 속하는 기술분야에 통상의 기술자에 의해 용이하게 결정될 수 있다.
본 발명의 약학적 조성물은 개체에게 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구 복용, 피하 주사, 복강 투여, 정맥 주사, 근육 주사, 척수 주위 공간 (경막 내) 주사, 설하 투여, 볼점막 투여, 직장 내 삽입, 질 내 삽입, 안구 투여, 귀 투여, 비강 투여, 흡입, 입 또는 코를 통한 분무, 피부 투여, 경피 투여 등에 따라 투여될 수 있다.
본 발명의 약학적 조성물은 치료할 질환, 투여 경로, 환자의 연령, 성별, 체중 및 질환의 중등도 등의 여러 관련 인자와 함께 활성성분인 약물의 종류에 따라 결정된다. 구체적으로, 본 발명에 따른 조성물의 유효량은 환자의 나이, 성별, 체중에 따라 달라질 수 있으며, 일반적으로는 체중 1 kg 당 0.001 내지 150 mg, 바람직하게는 0.01 내지 100 mg을 매일 또는 격일 투여하거나 1일 1 내지 3회로 나누어 투여할 수 있다. 그러나 투여 경로, 질환의 중증도, 성별, 체중, 연령 등에 따라서 증감될 수 있으므로 상기 투여량이 어떠한 방법으로도 본 발명의 범위를 한정하는 것은 아니다.
본 발명에서 개체란 질병의 치료를 필요로 하는 대상을 의미하고, 보다 구체적으로는 인간 또는 비-인간인 영장류, 생쥐 (mouse), 쥐 (rat), 개, 고양이, 말, 및 소 등의 포유류를 의미한다.
본 발명에서 투여란 임의의 적절한 방법으로 개체에게 소정의 본 발명의 조성물을 제공하는 것을 의미한다. 본 발명에서 예방이란 목적하는 질환의 발병을 억제하거나 지연시키는 모든 행위를 의미하고, 치료란 본 발명에 따른 약학적 조성물의 투여에 의해 목적하는 질환과 그에 따른 대사 이상 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미하며, 개선이란 본 발명에 따른 조성물의 투여에 의해 목적하는 질환과 관련된 파라미터, 예를 들면 증상의 정도를 감소시키는 모든 행위를 의미한다.
본 발명에 따른 약학적 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에 있어서, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.
본 발명은 상기 약학적 조성물, 및 설명서를 포함하는 간 손상 예방 또는 치료용 키트를 제공한다.
본 발명의 "키트"에는 상기 구성 이외에도 mirR223 및 이의 모방체의 기능 및 효과를 증진시키기 위해 투여에 적합할 수 있도록 통상적으로 필요한 다른 구성 성분, 장치, 물질 등이 포함될 수 있다. 또한, 키트에 포함된 모든 구성은 1회 이상 횟수에 제한 없이 사용될 수 있으며, 각 물질을 사용하는 선후에는 제한이 없고, 각 물질의 적용은 동시에 진행될 수도 있고 미시에 진행될 수도 있다.
본 발명의 키트는 상기 제제, 및 설명서 이외에도 컨테이너를 포함할 수 있다. 상기 컨테이너는 상기 구성을 포장하는 역할을 할 수 있고, 보관 및 고정하는 역할을 할 수도 있다. 상기 컨테이너의 재질은 예컨대, 병, 통 (tub), 작은 봉지 (sachet), 봉투 (envelope), 튜브, 앰플 (ampoule) 등과 같은 형태를 취할 수 있고, 이들은 부분적 또는 전체적으로 플라스틱, 유리, 종이, 호일, 왁스 등으로부터 형성될 수 있다. 상기 용기는 처음에는 용기의 일부이거나 또는 기계적, 접착성, 또는 기타 수단에 의해 용기에 부착될 수 있는, 완전히 또는 부분적으로 분리가 가능한 마개를 장착할 수 있으며, 또한 주사바늘에 의해 내용물에 접근할 수 있는 스토퍼가 장착될 수 있다. 상기 키트는 외부 패키지를 포함할 수 있으며, 외부 패키지는 구성 요소들의 사용에 관한 지시서를 포함할 수 있으나, 이에 제한되는 것은 아니다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
동물의 혈청 측정
혈청 지표 측정을 위해 마우스의 하대정맥에서 전혈을 채취하였다. 전혈 채취는 BD Microtainer® SST gel tube (Cat. No. 365967; BD, 뉴저지주 프랭클린레이크스)에 수집하였으며, 22 ± 2℃에서 30분 동안 응고시켰다. 응고된 샘플은 4℃에서 2,500 Х g로 20분간 원심분리하였다. 투명한 상층액을 새로운 폴리프로필렌 튜브로 옮겨서 혈청 샘플로 보관하였다. 혈청 알라닌 아미노 전이 조효소 (alanine aminotransferase, ALT) 및 아스파르트산 아미노전이소효소 (aspartate aminotransferase, AST) 수치 측정은 Hitachi 7180 autoanalyzer (도쿄, 일본)를 이용하여 수행하였다.
조직학적 조사
간 조직을 약 0.5 cm 크기로 자르고, 10% 포름알데하이드 (Cat. No. HT501320; Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) 용액에 하룻밤 동안 고정시켰다. 고정된 조직은 파라핀으로 포매하여 마이크로톰으로 4 μm 두께의 절편으로 잘랐다. 조직 슬라이드는 형태학적 분석을 위해 헤마톡실린과 에오신으로 염색하였다. BX53 현미경 (Cat. No. BX53; Olympus, Tokyo, Japan)으로 관찰하였으며, 디지털 카메라 (Cat. No. DP27; Olympus)를 이용하여 이미지를 촬영하였다. 간 손상 정도는 Suzuki의 방법을 이용하여 울혈, 세포질 팽창 및 간세포의 괴사 유무와 정도를 평가하여 0에서 4까지의 점수로 산정하였다 (표 1).
Score Congestion (울혈) Vacuolation (팽창) Necrosis (괴사)
0 None None None
1 Minimal Minimal Single cell necrosis
2 Mild Mild ~ 30%
3 Moderate Moderate ~ 60%
4 Severe Severe > 60%
유전자 발현 조사
상기 연구에서는 간 조직 (40-50 mg) 또는 배양 세포로부터 mRNA와 miRNA를 추출하였다. 동결된 조직은 QIAzol™ lysis reagent (Cat. No. 79306; Qiagen, Hilden, Germany)이 담긴 튜브에서 폴리프로필렌 막자 (pestle)를 사용하여 분쇄하였고 클로로포름을 통해 수용성 물질을 용해시켰다. 이후 원심분리를 거쳐 상층액을 분리한 후 새로운 튜브에 옮겨 담았다. 이를 70% 에탄올로 침전시키고 실리카 컬럼에 결합시켰다. 컬럼을 통과한 용액은 100% 에탄올로 재침전시키고 동일한 실리카 칼럼에서 수집하였다. RNA 결합 칼럼은 세척하고 건조시킨 후 DEPC 처리된 물에 용해시켰다. 추출한 RNA의 품질은 A260/280 비율 (약 2.0)로 확인하였으며, 농도는 Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific)로 측정하였다. mRNA는 ReverTra Ace qPCR RT Master Mix (Toyobo, Osaka, Japan)를 이용하여 cDNA로 전환하였다.
유전자의 발현 조사는 정량적 실시간 중합효소연쇄반응 기법을 통해 측정하였다. 장비는 CFX Connect Real-Time PCR Detection System (Cat. No. 1855201; Bio-Rad, Hercules, CA, USA)을 사용하였다. 유전자 증폭 과정에서 발광되는 형광의 검출을 위해 5Х HOT FIREPol® EvaGreen® qPCR Supermix (Cat. No. 08-36-00001;Solis BioDyne, Tartu, Estonia)를 사용하였다. 유전자 증폭 프라이머와 cDNA와 형광 혼합액은 95℃에서 12분 동안 변성되었으며, 이후 95℃에서 15초 동안 변성 (denaturation), 60℃에서 20초 동안 결합 (annealing), 72℃에서 20초 동안 연장 (elongation)되는 40개의 사이클이 진행되었다. 데이터는 실험군과 대조군 간의 폴드-차이 (fold-change)로 표현되었으며 Actin 발현 수준에 정규화되었다.
miRNA의 경우, miRCURY LNA RT Kit (Cat. No. 339340; Qiagen)를 사용하여 cDNA 합성을 수행하였으며, miRCURY LNA SYBR® Green PCR Kit (Cat. No. 339345; Qiagen)를 사용하여 qRT-PCR을 수행하였다. PCR 순환 조건은 다음과 같았다: 95℃에서 2분 동안 유지한 후, 95℃에서 10초, 56℃에서 60초를 반복하는 45개의 사이클로 진행하였다. 또한 miRNA 발현량의 표준화를 위해 U6 snRNA를 사용하였다. 프라이머 시퀀스는 표 2에 제시되었다.
서열번호 Gene name 5' - 3' sequences
서열번호 1 Hs_PARP1 Forward GCTCCTGAACAATGCAGACA
서열번호 2 reverse CATTGTGTGTGGTTGCATGA
서열번호 3 Hs_ACTB Forward GGAGAAAATCTGGCACCACA
서열번호 4 reverse AGAGGCGTACAGGGATAGCA
서열번호 5 Hs_TNF Forward TCCTTCAGACACCCTCAACC
서열번호 6 reverse AGGCCCCAGTTTGAATTCTT
서열번호 7 Hs_IL6 Forward AGGAGACTTGCCTGGTGAAA
서열번호 8 reverse CAGGGGTGGTTATTGCATCT
서열번호 9 Mm_Parp1 Forward GCAGCGAGAGTATTCCCAAG
서열번호 10 reverse CCGTCTTCTTGACCTTCTGC
서열번호 11 Mm_Actb Forward AGCCATGTACGTAGCCATCC
서열번호 12 reverse CTCTCAGCTGTGGTGGTGAA
서열번호 13 Mm_Tnf Forward CTATGTCTCAGCCTCTTCTC
서열번호 14 reverse CATTTGGGAACTTCTCATCC
서열번호 15 Mm_Il6 Forward AGTTGCCTTCTTGGGACTGA
서열번호 16 reverse TCCACGATTTCCCAGAGAAC
서열번호 17 RNU-6 snRNA Forward GCTTCGGCAGCACATATACTAAAAT
서열번호 18 reverse CGCTTCACGAATTTGCGTGTCAT
서열번호 19 miR-223-3p Forward CGCAGTGTCAGTTTGTCA
서열번호 20 reverse CCAGTTTTTTTTTTTTTTTGGGGTA
실시예 1. 허혈성 간 손상 동물에서 miR-223의 역할 검증
본 기술의 검증을 위하여 야생형 C57BL/6J 마우스를 사용하여 허혈성 간 손상 동물 모델을 제작하였다. 마우스의 정확한 명칭은 C57BL/6JBomTac이며, 대한민국 충청북도 소재의 DBL사에서 분양되었다. 마우스는 특정병원체 부재 상태 (specific pathogen free; SPF)에서 사육되었으며, 실험 과정은 아산생명과학연구원 동물실험윤리위원회로부터 검토 후 승인되었다. 마우스는 틸레타민 (Tiletamine), 졸라제팜 (Zolazepam), 자일라진 (Xylazine) 혼합액으로 마취 후 복부를 절개하여 간동맥과 간문맥을 노출시킨 후 불독 클램프를 사용하여 간동맥과 간문맥을 물리적으로 폐쇄시켜 간 전체의 약 70%에 혈류를 45분 간 차단하였다. 이후 0, 1, 2, 6시간 경과 시점에서 마우스의 혈액을 채취하여 혈청 아스파르트산아미노전이효소 (AST)와 알라닌아미노전이효소 (ALT)를 측정하였다 (도 1a). 동일한 시점에서 간 조직을 획득하여 헤마톡실린과 에오신으로 염색하여 조직학적 변화를 확인하였으며, Suzuki 점수 방법으로 간 조직의 울혈 (congestion), 팽창 (vacuolation), 괴사 (necrosis)를 평가하였다. 또한 실시간 중합효소연쇄반응 (qRT-PCR)을 통해 조직 내 miR-223-3p의 발현과 PARP1 유전자의 발현을 조사하였다. PARP1의 활성으로 인해 발현되는 염증 신호와 관련 유전자인 Tnf 및 Il6의 발현을 조사하였다.
그 결과, 허혈성 간 손상 동물 모델에서 허혈성 간 손상 지표인 AST 및 ALT가 상승하였다 (도 1b). 또한, 간 조직학적 변화는 도 1c와 같이 나타났다. 구체적으로, 조직학적 관찰 결과 간세포가 괴사를 겪는 과정에서 관찰되는 특징적인 양상이 재관류 시간의 경과에 따라 더욱 광범위하게 발생함을 확인할 수 있었다. 괴사가 일어난 간 조직은 세포막이 붕괴되어 세포질이 에오신에 의해 연한 색상으로 염색이 되며, 핵이 수축하여 작아지거나 (pyknosis) 핵 융해 (karyolysis) 과정에 의해 소실된다. 간세포 괴사는 재관류 1시간 시점에 간 중심정맥 주변에서 우선적으로 관찰 되었으며, 재관류 시간이 증가할수록 간세포 괴사 영역이 확대되어 6시간 경과 시점에는 간 문맥 주변까지 확대되었다. 뿐만 아니라, 간 조직의 울혈, 팽창, 및 괴사에 대한 Suzuki Scores는 혈류 차단 시간 경과에 따라 상승하였고 (도 1d), 무엇보다도 miR-223-3p의 발현 역시 증가하였으며, 혈류 차단한 후 6시간에는 그 증가가 통계적으로 유의한 것으로 확인되었다 (도 1e). 또한, 혈류 차단 시간 경과에 따라 PARP1의 발현은 감소하였고 6시간째에는 통계적으로 유의한 수준이었으며, PARP1의 활성으로 인한 염증 신호 Tnf 및 Il6은 통계적으로 유의하게 상승하는 것으로 나타났다 (도 1f). 이와 같은 결과에 따르면, 허혈성 간 손상 모델에서 간 조직 손상 증가가 발생하였을 때 miR-223-3p의 발현이 증가한 반면 PARP1 유전자의 발현은 감소하였으며, Tnf 및 Il6 유전자의 발현은 간 손상과 비례하여 증가하는 것이 확인되었다.
실시예 2. miR-223 결손 동물에서 허혈성 간 손상 평가
miR-223 유전자를 결손시킨 miR-223-/y 동물을 사용하였다. miR-223 유전자는 X 염색체에 위치하고 있으므로 수컷 동물의 유전형은 miR-223-/y이다. miR-223 결손 마우스는 미국 The Jackson Laboratory로부터 분양되었다 (Cat. No. IMSR_JAX:002779). 마우스는 특정병원체 부재 상태 (specific pathogen free; SPF)에서 사육되었으며, 실험 과정은 아산생명과학연구원 동물실험윤리위원회로부터 검토 후 승인되었다. 유전자 결손 동물은 실험 전 중합효소연쇄반응 기반 유전자형 확인을 통해 유전형을 검증하였다. miR-223 결손 마우스는 틸레타민, 졸라제팜, 자일라진 혼합액으로 마취한 후 복부를 절개하여 간동맥과 간문맥을 노출시킨 후 불독 클램프를 사용하여 간동맥과 간문맥을 물리적으로 폐쇄시켜 간 전체의 약 70%에 혈류를 45분 동안 차단하였다. 이후 6시간 경과 시점에서 마우스의 혈액을 채취하여 혈청 AST와 ALT를 측정하였다 (도 2a). 동일한 시점에서 간 조직을 획득하여 헤마톡실린과 에오신으로 염색하여 조직학적 변화를 확인하였으며, Suzuki 점수 방법으로 간 조직의 울혈, 팽창, 괴사를 평가하였다. 또한 실시간 중합효소연쇄반응을 통해 조직 내 miR-223-3p의 발현과 PARP1 유전자의 발현을 조사하였다. PARP1의 활성으로 인해 발현되는 염증 신호와 관련 유전자인 Tnf 및 Il6의 발현을 조사하였다.
그 결과, 허혈성 간 손상 지표 AST와 ALT는 miR-223 결손 마우스에서 더욱 상승하였으며 (도 2b), 조직학적 손상 (간세포 괴사 및 충혈) 또한 가장 크게 증가하는 것으로 확인되었다 (도 2c 및 도 2d). 야생형 마우스에서 관찰되는 PARP1 유전자 발현의 감소가 miR-223 결손 마우스에서는 관측되지 않았으며, 염증성 지표인 Tnf 및 Il6 역시 miR-223 결손에서 더욱 증가하였다 (도 2e).
실시예 3. miR-223의 PARP1 억제 효과 확인
실시예 3-1. 간세포 유사세포에서의 miR-223 및 PARP1의 음의 상관관계 확인
간세포 내에서 miR-223에 의한 PARP1 유전자 발현의 조절 여부를 확인하기 위해 완전분화 HepaRG™를 사용하였다. 상용 세포주인 완전분화 HepaRG™ (Cat. No. HPRGC10, Thermo Fisher Scientific) 세포는 William's E medium (Cat. No. 12551-032, Thermo Fisher Scientific)에 thaw, plate & general purpose medium supplement (Cat. No. HPRG670, Thermo Fisher Scientific)와 GlutaMAX™ supplement (Cat. No. 35050-061, Thermo Fisher Scientific)를 첨가하여 사용하였다. 세포는 37℃ 5% CO2 조건에서 배양되었다. 배양 간세포 유사 세포에서 miR-223의 PARP1 억제를 확인하기 위해 Lipofectamine 2000 (Cat. No. 11668-019, Thermo Fisher Scientific)을 사용하여 miR-223-3p 모방체 (mimic)를 리포좀 (liposome) 형태로 만든 후 배양 세포 내로 도입하였다. miR-223-3p 모방체 도입 세포주에서 miR-223-3p와 PARP1 유전자의 발현을 qRT-PCR 방법으로 조사하였다. 또한 PARP1 단백질의 발현 감소를 웨스턴 블롯 (Western blot) 방법으로 확인하였다. 웨스턴 블롯을 위해 세포주는 T-PER™ Tissue Protein Extraction Reagent (Cat. No. 78510; Thermo Fisher Scientific)에 프로테아제 억제제 (Cat. No. 78410; Thermo Fisher Scientific)가 첨가된 용액에 처리하여 단백질을 획득하였다. 획득된 단백질은 Pierce™ BCA Protein Assay Kit (Cat. No. 23227; Thermo Fisher Scientific)를 통해 정량되었다. 동일 양의 총 단백질 (10 또는 20 μg)을 가진 샘플은 12% SDS-PAGE에 의해 전기영동 및 분리되었으며, Trans-Blot® Turbo™ Transfer System (Cat. No. 1704150; Bio-Rad Laboratories)을 사용하여 0.2 μm 니트로셀룰로오스 멤브레인 (Cat. No. 1704270; Bio-Rad Laboratories)으로 옮겨졌다. 니트로셀룰로오스 멤브레인은 5% BSA (Bovine serum albumin) 용액에 블로킹 후 PARP1 항체 (Cat. No. ab32138, Abcam)와 HRP 결합 anti-rabbit IgG 2차 항체 (sc-2004, Santa Cruz)를 사용하여 ECL을 이용한 화학적 발광을 탐지하는 방법으로 측정되었다. 밴드의 신호는 SuperSignal™ West Femto Maximum Sensitivity Substrate (Cat. No. 34095; Thermo Fisher Scientific)를 사용하여 획득하였다. 단백질 발현 수준은 chemiluminescence imaging system (Luminograph II; Cat. No. WSE-6200; ATTO, Tokyo, Japan)을 이용하여 측정되었고, 8-bit 이미지 파일 기반으로 정량화 및 분석을 수행하였다. 세포 내 miRNA 유전자 전달 방법에 있어, HepaRG 세포는 생물학적 활성이 없는 대조 miRNA (50 nmol/L) 또는 miR-223-3p mimic (50 nmol/L)을 전달하는 방법을 사용하였다. 대조 miRNA 또는 miR-223-3p mimic은 Lipofectamine® 2000와 혼합하여 15분 동안 방치한 후, 세포 배양용 접시에 첨가하여 지정된 시간 동안 배양하였고, 이후 세포를 분석하였다.
그 결과, miR-223-3p 모방체 도입 세포주에서 miR-223-3p의 발현이 현저히 증가된 반면, PARP1 유전자의 발현은 감소되었으며, 이는 통계적으로 유의한 수준인 것으로 확인되었다 (도 3a). 또한, PARP1 단백질의 발현 감소를 웨스턴 블롯으로 확인 및 정량한 결과 그 감소 수준 역시 뚜렷한 것으로 확인되었다 (도 3b).
실시예 3-2. 직접 결합에 따른 miR-223-3p의 PARP1 억제 효과 확인
miR-223-3p의 PARP1 유전자 결합 부위는 miRDB (https:/mirdb.org/)에서 예측되었다 (도 3c). HepaRG 세포는 PARP1 3' UTR 중에서 miR-223-3p 결합 영역을 삽입하여 제작한 pMirTarget 플라스미드 (0.8 μg; Ori Gene)를 처리하였고, 또한 대조 miRNA (50 nmol/L) 또는 hsa-miR-223-3p mimic (50 nmol/L)을 동시에 처리하였다. 세포 내 도입은 24-well 플레이트에 60% confluent cell 상태에서 Lipofectamine® 2000 (Cat. No. 11668019; Thermo Fisher Scientific)을 사용하여 37℃에서 48시간 동안 수행되었다. 세포 내 유전자 도입 24시간 후, Firefly 및 Renilla luciferase의 활성도는 Dual-Luciferase® Reporter assay (DLR™; Cat. No. E1910; Promega, Madison, Wisconsin, USA)를 사용하여 측정되었다. 각 샘플의 Renilla luciferase 활성도는 Firefly luciferase에 대해 정규화되었다.
그 결과, miR-223-3p 모방체 처리 시 PARP1 3' UTR 영역의 luciferase 활성이 감소하였다 (도 3d). 이는 miR-223-3p가 직접적으로 PARP1 유전자의 발현을 감소시킬 수 있음을 시사한다.
실시예 4. PARP1 결손 동물의 허혈성 간 손상 예방 효과 확인
PARP1 유전자를 결손시킨 PARP1-/-동물을 사용하여 PARP1 결손 동물 모델에서의 miR-223의 허혈성 간 손상 예방 효과를 확인하였다. 구체적으로, PARP1 결손 마우스는 미국 The Jackson Laboratory로부터 분양되었다 (Cat. No. IMSR_JAX:002779; Strain of origin: 129S2/SvPas). 마우스는 특정병원체 부재 상태 (specific pathogen free; SPF)에서 사육되었으며, 실험 과정은 아산생명과학연구원 동물실험윤리위원회로부터 검토 후 승인되었다. 유전자 결손 동물은 실험 전 중합효소연쇄반응 기반 유전자형 확인을 통해 유전형을 검증하였다. PARP1 결손 마우스는 틸레타민, 졸라제팜, 자일라진 혼합액으로 마취 후 복부를 절개하여 간동맥과 간문맥을 노출시킨 후 불독 클램프를 사용하여 간동맥과 간문맥을 물리적으로 폐쇄시켜 간 전체의 약 70%에 혈류를 45분 간 차단하였다. 이후 6시간 경과 시점에서 마우스의 혈액을 채취하여 혈청 AST와 ALT를 측정하였다 (도 4a). 동일한 시점에서 간 조직을 획득하여 헤마톡실린과 에오신으로 염색하여 조직학적 변화를 확인하였으며, Suzuki 점수 방법으로 간 조직의 울혈, 팽창, 괴사를 평가하였다. 또한 실시간 중합효소연쇄반응을 통해 조직 내 miR-223-3p의 발현과 PARP1 유전자의 발현을 조사하였다. PARP1의 활성으로 인해 발현되는 염증 신호와 관련 유전자인 TNF와 IL6의 발현을 조사하였다.
그 결과, PARP1 단백질을 유전적으로 결손시키는 경우 허혈성 간 손상에 의한 조직 손상이 감소하는 것으로 확인되었다. 이는 AST와 ALT의 감소 및 조직 염색 슬라이드로 평가한 Suzuki 점수를 통해 확인되었다 (도 4b 내지 도 4d). 또한 TNF와 IL6 역시 PARP1 결손 동물에서 상승이 유의미하게 억제되어 있음을 확인하였다 (도 4e). 이는 PARP1 단백질 부재시 허혈성 간 손상의 발생이 감소할 수 있음을 시사하는 것이다.
실시예 5. miR-223-3p의 허혈성 간 손상 예방 효과 확인
miR-223-3p의 허혈성 간 손상 예방 효과를 확인하기 위하여 대조 miRNA mimic (Cat. No. SMC-2002; AccuTarget™ miRNA mimic Negative Control #1; Bioneer, Daejeon, South Korea) 또는 miR-223-3p mimic (Cat. No. SMM-002; AccuTarget™ Human miRNA Mimic; Bioneer)을 함유한 생체 나노전달체가 제작되었다. 구체적으로 인공 리포좀인 DOPC (phospholipid 1,2-dioleonyl-sn-glycero-3-phosphatidylcholine)에 초음파를 처리하여 결합시켰으며, 상용화된 제품 MaxSuppressor™ In Vivo RNA-LANCEr II (Cat. No. 3410-01; BIOO Scientific, Perkin Elmer, Massachusetts, USA)를 사용하였다. miRNA의 분자량은 다음 공식을 따라 계산되었다.
MWssRNA= NAХMWA+NUХMWU+NCХMWC+NGХMWG+159
A, U, C, G의 분자량은 각각 329.2, 306.2, 305.2 및 345.2 g/mol이다. 추가적으로 159은 5'-트리포스페이트 잔여물의 존재를 나타낸다. 또한 N은 각 염기의 개수를 의미한다. 여기서 miRNA-223-3p 모방체는 이중가닥(double strand) 구조로 안정화 되어 있으므로 염기 서열과 상보 결합되어 있는 서열의 분자량도 함께 고려해야 한다. 따라서 최종 분자량은 다음의 계산식으로 획득하였다.
1. sense 염기서열: UGUCAGUUUGUCAAAUACCCCA
6 (A의 개수) * 329.2 (A의 분자량) + 7 (U의 개수) * 306.2 (U의 분자량)+ 6 (C의 개수) * 305.2 (C의 분자량) + 3 (G의 개수) * 345.2 (G의 분자량) + 159 (5'-삼인산 잔기의 분자량) = 7144.4
2. anti-sense 염기서열: UGGGGUAUUUGACAAACUGACA
7 * 329.2 + 6 * 306.2 + 3 * 305.2 + 6 * 345.2 + 159 = 7287.4
3. 7144.4 (sense 염기서열의 분자량) + 7287.4 (anti-sense 염기서열의 분자량) = 14431.8
miR-223-3p 모사체의 이중 가닥 형태의 계산된 분자량 (염기서열: UGUCAGUUUGUCAAAUACCCCA_서열번호 21)은 14431.8 g/mol이며, 10 nmol 제품의 예상 무게는 144.32 μg이다. 본 실험에서는 5 마리의 쥐에게 10 nmol 제품을 투여하였으며, 한 마리에게 투여 된 양은 약 28.9 μg이다. 나노전달체는 총 25 마리에 대해 2회 투여되었다.
miR-223-3p 나노전달체의 효과를 극대화하기 위해 miR-223 결손 마우스가 사용되었다. miR-223 결손 마우스는 간 허혈/재관류 손상 유도 24시간 및 48시간 전에 안와정맥총 주사 기법을 통해 i.v. 경로로 miRNA 함유 나노전달체를 처리하였다. 이후 miR-223 결손 마우스는 틸레타민, 졸라제팜, 자일라진 혼합액으로 마취 후 복부를 절개하여 간동맥과 간문맥을 노출시킨 후 불독 클램프를 사용하여 간동맥과 간문맥을 물리적으로 폐쇄시켜 간 전체의 약 70%에 혈류를 45분 간 차단하였다. 6시간 경과 시점에서 마우스의 혈액을 채취하여 혈청 AST와 ALT를 측정하였다 (도 5a). 동일한 시점에서 간 조직을 획득하여 헤마톡실린과 에오신으로 염색하여 조직학적 변화를 확인하였으며, Suzuki 점수 방법으로 간 조직의 울혈, 팽창, 괴사를 평가하였다. 또한 실시간 중합효소연쇄반응을 통해 조직 내 miR-223-3p의 발현과 PARP1 유전자의 발현을 조사하였다. PARP1의 활성으로 인해 발현되는 염증 신호와 관련 유전자인 TNF와 IL6의 발현을 조사하였다. 결과는 이하의 도면에 나타내었다.
그 결과, miR-223 함유 나노전달체는 간 조직 내 miR-223 발현량을 증가시켰고 (도 5b), 간 손상 지표인 AST, ALT 및 조직학적 손상 척도인 Suzuki 점수를 감소시켰다 (도 5c 및 도 5d). 또한 PARP1 과활성에 의해 상승하는 세포 손상 관련 유전자인 TNF와 IL6의 발현을 감소시켰다 (도 5e). 이는 miR-223 함유 나노전달체가 간 조직 내의 PARP1 단백질 활성 억제 기전을 통해 간세포 손상을 억제함을 시사한다.
실시예 6. 생체 간 이식 환자에서의 miR-223의 PARP1 억제를 통한 허혈성 간 손상 치료 효과 확인
생체 간 이식 환자로부터 간 조직을 수집하였다. 허혈성 간 손상 유도 전 조직은 Cold ischemia 직후에 획득되었다. 허혈성 간 손상 유도 후 조직은 간 이식 수술 완료 후 간 이식 수혜자의 생체에서 혈관 문합을 완료한 조직을 획득하였다. 모든 조직은 획득 즉시 동결되었으며 분석 전까지 -80℃에 보관되었다 (도 6a). 모든 환자 샘플의 사용은 서울아산병원 기관생명윤리심의위원회 (IRB; 승인 번호 2018-1386)의 윤리적 기준과 규정을 준수하여 진행되었으며, 각 환자에게 연구에 관한 충분한 설명을 제공하고 서면 동의를 획득하였다.
그 결과, 허혈성 간 손상이 유도된 이후 환자에서는 miR-223-3p의 발현이 유의미하게 증가하였고 (도 6b), PARP1 유전자의 발현은 감소하였으며, miR-223와 PARP1 유전자의 발현 사이에 음의 상관관계가 존재하는 것이 확인되었다 (도 6c).
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야 한다.
본 발명의 miR-223을 유효성분으로 포함하는 간 손상 예방 또는 치료용 조성물에 따르면, 허혈성 간 손상 동물 모델에서 miR-223의 역할이 검증되었고, miR-223 결손 동물 모델에서 허혈성 간 손상 여부가 확인되었으며, PARP1 결손 동물 모델에서는 허혈성 간 손상 예방 또는 치료 효과가 확인되었다. 또한, miR-223이 PARP1와 직접적으로 결합하여 억제활성을 나타냄에 따라 양 물질 사이의 음의 상관관계가 확인되었을 뿐만 아니라, PARP1 억제를 통한 생체 내/외에서의 허혈성 간 손상 치료 효과가 확인되었는 바, 허혈성 간 손상과 관련된 다양한 질환 치료에 활용될 수 있으므로 산업상 이용가능성이 있다.

Claims (10)

  1. miR-223 또는 이의 모방체 (mimic)를 유효성분으로 포함하는 간 손상 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서,
    상기 miR-223은 miR-223-3p인 것인, 약학적 조성물.
  3. 제1항에 있어서,
    상기 간 손상은 허혈성 간 손상인 것인, 약학적 조성물.
  4. 제1항에 있어서,
    상기 miR-223 또는 이의 모방체는 나노전달체, 나노입자 모방체, 나노튜브, 엑소좀 (exosome), 리포좀 (liposome), 리피도이드 (lipidoid), 리포플렉스 (lipoplex), 지질 나노입자 (Lipid Nano Particle, LNP), 중합체성 화합물, 펩티드, 단백질, 및 세포로 이루어진 군으로부터 선택되는 어느 하나의 전달체와 함께 포함되는 것인, 약학적 조성물.
  5. 제1항에 있어서,
    상기 조성물은 하기 중 어느 하나 이상을 특징으로 하는, 약학적 조성물:
    알라닌 아미노전이조효소 및 아스파르트산 아미노전이조효소 억제;
    Parp1의 기능 및 발현 억제; 및
    Tnf 및 Il6 억제.
  6. 제1항에 있어서,
    상기 조성물은 정맥투여, 경구투여, 및 직장투여로 이루어진 군으로부터 선택되는 어느 하나 이상의 방법으로 처리되는 것인, 약학적 조성물.
  7. 제1항 내지 제5항 중 어느 한 항의 약학적 조성물, 및 설명서를 포함하는 간 손상 예방 또는 치료용 키트.
  8. miR-223 또는 이의 모방체 (mimic)를 유효성분으로 포함하는 조성물의 간 손상 예방 또는 치료 용도.
  9. miR-223 또는 이의 모방체 (mimic)를 유효성분으로 포함하는 조성물을 이를 필요로 하는 개체에게 투여하는 단계를 포함하는 간 손상 예방 또는 치료 방법.
  10. 간 손상 예방 또는 치료 제제를 제조하기 위한 miR-223 또는 이의 모방체 (mimic)를 유효성분으로 포함하는 조성물의 용도.
PCT/KR2024/005101 2023-04-17 2024-04-16 Mir-223을 유효성분으로 포함하는 간 손상 예방 또는 치료용 조성물 Ceased WO2024219795A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020230050330A KR20240154159A (ko) 2023-04-17 2023-04-17 miR-223을 유효성분으로 포함하는 간 손상 예방 또는 치료용 조성물
KR10-2023-0050330 2023-04-17

Publications (1)

Publication Number Publication Date
WO2024219795A1 true WO2024219795A1 (ko) 2024-10-24

Family

ID=93152791

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2024/005101 Ceased WO2024219795A1 (ko) 2023-04-17 2024-04-16 Mir-223을 유효성분으로 포함하는 간 손상 예방 또는 치료용 조성물

Country Status (2)

Country Link
KR (1) KR20240154159A (ko)
WO (1) WO2024219795A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110293653A1 (en) * 2010-03-11 2011-12-01 University Of Massachusetts Antagonists of mir-155 for the treatment of inflammatory liver disease
KR20170007492A (ko) * 2014-05-29 2017-01-18 쿠아크 파마수티칼스 인코퍼레이티드 장기에서의 허혈 재관류 손상 방지 방법 및 방지용 조성물
KR20220101631A (ko) * 2019-10-16 2022-07-19 유니버시티 오브 피츠버그 - 오브 더 커먼웰쓰 시스템 오브 하이어 에듀케이션 간 질환 치료를 위한 조성물 및 방법

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2021302972A1 (en) 2020-07-01 2023-02-09 Biorchestra Co., Ltd. miRNA-485 inhibitor for huntington's disease

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110293653A1 (en) * 2010-03-11 2011-12-01 University Of Massachusetts Antagonists of mir-155 for the treatment of inflammatory liver disease
KR20170007492A (ko) * 2014-05-29 2017-01-18 쿠아크 파마수티칼스 인코퍼레이티드 장기에서의 허혈 재관류 손상 방지 방법 및 방지용 조성물
KR20220101631A (ko) * 2019-10-16 2022-07-19 유니버시티 오브 피츠버그 - 오브 더 커먼웰쓰 시스템 오브 하이어 에듀케이션 간 질환 치료를 위한 조성물 및 방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CHAO-HUI YU ; CHENG-FU XU ; YOU-MING LI: "Association of MicroRNA-223 Expression with Hepatic Ischemia/Reperfusion Injury in Mice", DIGESTIVE DISEASES AND SCIENCES, KLUWER ACADEMIC PUBLISHERS-PLENUM PUBLISHERS, NE, vol. 54, no. 11, 23 December 2008 (2008-12-23), Ne , pages 2362 - 2366, XP019747723, ISSN: 1573-2568 *
JIMENEZ CALVENTE CAROLINA, DEL PILAR HANA, TAMEDA MASAHIKO, JOHNSON CASEY D., FELDSTEIN ARIEL E.: "MicroRNA 223 3p Negatively Regulates the NLRP3 Inflammasome in Acute and Chronic Liver Injury", MOLECULAR THERAPY, ELSEVIER INC., US, vol. 28, no. 2, 1 February 2020 (2020-02-01), US , pages 653 - 663, XP093222363, ISSN: 1525-0016, DOI: 10.1016/j.ymthe.2019.09.013 *

Also Published As

Publication number Publication date
KR20240154159A (ko) 2024-10-25

Similar Documents

Publication Publication Date Title
WO2020080861A1 (ko) Syt11 억제제를 유효성분으로 포함하는 위암 치료용 조성물
EP3091972B1 (en) Method of treating liver disorders
WO2024219795A1 (ko) Mir-223을 유효성분으로 포함하는 간 손상 예방 또는 치료용 조성물
CN116510017A (zh) Trpv4抑制剂在慢性乙型肝炎、肝纤维化、肝癌的治疗中的应用
WO2024014792A1 (ko) 망막 오가노이드 유래 엑소좀을 포함하는 안구 질환 치료용 약학적 조성물
WO2017155053A1 (ja) 非アルコール性脂肪性肝疾患／非アルコール性脂肪性肝炎の治療剤
WO2020010958A1 (zh) Metrnl蛋白或基因在血管堵塞性疾病中的应用
US20230142547A1 (en) Compounds for treating or preventing a coronaviridae infection & methods and uses for assessing the occurrence of a coronaviridae infection
WO2017010382A1 (ja) 筋強直性ジストロフィー治療薬
WO2013165061A1 (ko) Ｓｃｆ 또는 이의 수용체를 억제하는 물질을 포함하는 혈관 투과성 관련 질환의 치료 또는 예방용 조성물
Chevallier et al. The emerging role of connexin 43 in testis pathogenesis
WO2022086276A1 (ko) 특정 유전자의 발현이 증가 또는 감소된 줄기세포를 유효성분으로 포함하는 류마티스 관절염 예방 또는 치료용 약학적 조성물
EP3139911B1 (en) Method of treating advanced non-alcoholic steatohepatitis
WO2023195783A1 (ko) 암의 난소 전이 예측용 바이오마커로서의 drg2의 용도
Zhao et al. Effect of hydrogen-rich water on the lactic acid level in metformin-treated diabetic rats under hypoxia
WO2024204961A1 (ko) 젬시타빈, mir-342-3p 억제제 및 삼산화비소를 포함하는 암 예방, 개선, 또는 치료용 조성물
WO2010095879A2 (ko) 세포사멸 관련 유전자의 전사체에 결합하는 ｓｉＲＮＡ 및 이를 이용한 암 치료용 조성물
WO2022154636A1 (ko) Mir 145 억제제를 유효성분으로 포함하는 심근경색증의 치료용 조성물
Aboughazala Study on serum cholinesterase as marker of chronic liver disease
CN116687932B (zh) ((3-氨甲酰-5-氟吡嗪-2-基)氧基)甲基异丁酸酯的医药用途
CN119033802B (zh) 非编码调控性rna在制备预防或治疗癌症或组织纤维化疾病的药物中的用途
CN115974719B (zh) 化合物、包括所述化合物的药物组合物及其用途
CN117257796B (zh) 奥巴克拉甲磺酸盐在制备抗bkv药物中的应用
WO2023043152A1 (ko) 간세포 표적화 엑소좀 및 이의 간질환의 예방 또는 치료를 위한 용도
WO2012053758A2 (ko) 실로스타졸을 유효성분으로 함유하는 알코올성 간질환 치료 또는 예방용 약학조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 24792980

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 24792980

Country of ref document: EP

Kind code of ref document: A1