WO2024169908A1

WO2024169908A1 - Sirna for regulating expression of complement c5, and conjugate, pharmaceutical composition, and use thereof

Info

Publication number: WO2024169908A1
Application number: PCT/CN2024/076866
Authority: WO
Inventors: 刘楠; 陈平; 张红丽
Original assignee: 苏州时安生物技术有限公司
Priority date: 2023-02-17
Filing date: 2024-02-08
Publication date: 2024-08-22

Abstract

The present invention relates to an siRNA for regulating the expression of complement C5, and a conjugate, pharmaceutical composition and the use thereof. The siRNA comprises a sense strand and an antisense strand, and each nucleotide in the siRNA is independently a modified or unmodified nucleotide. The sense strand comprises a sequence as shown in SEQ ID NO: 1-76, 169 and 171 or a nucleotide sequence having no more than three base mutations in the sequence; and the antisense strand comprises a sequence as shown in SEQ ID NO: 77-152, 170 and 172 or a nucleotide sequences having no more than five base mutations in the sequence. The siRNA, the siRNA conjugate and the pharmaceutical composition provided in the present invention show excellent inhibitory activity against complement C5 expression in cell experiments and animal experiments, and have good potential for treating diseases associated with complement C5 expression.

Description

A siRNA for regulating complement C5 expression, its conjugate and pharmaceutical composition and use thereof

Technical Field

The present invention belongs to the field of biomedicine technology, and specifically relates to a siRNA for regulating complement C5 expression, a conjugate and a pharmaceutical composition thereof, and uses thereof.

Background Art

The complement system is an ancient host defense system, whose biological origin can be traced back to more than one billion years ago. It was named complement for its auxiliary role in the process of sterilization and phagocytosis. Both innate and adaptive immunity include the complement system, which defends the host's intravascular environment through opsonization and lysis. Generally, the complement system begins with three activation pathways, namely the classical pathway, the lectin pathway, and the alternative pathway. The classical pathway begins with the binding of the C1q fragment of complement factor C1 to the antigen-antibody complex. Lectins are carbohydrate-binding proteins, and the lectin pathway begins with the binding of mannose-binding lectins to polysaccharide or glycoprotein motifs on the surface of foreign cells or damaged host cells. The difference between the alternative activation pathway and the classical activation pathway is that the activation bypasses the three components of C1, C4, and C2, and directly activates C3. With the participation of factor B, factor D, and properdin (P), C3 convertase and C5 convertase are formed to initiate a cascade of enzymatic reactions. Complement exists in a delicate balance between activation and regulation. When this balance is disrupted, tissues will be damaged and diseases will follow. Complement has been implicated in many different diseases, in some cases driving pathology and in others amplifying or exacerbating the inflammatory and damaging effects of non-complement disease triggers, and anti-complement therapy is thought to play a key role in the treatment of these diseases.

Among many complement components, C5 plays an important role in the complement cascade reaction and has become the main therapeutic target for many diseases including paroxysmal nocturnal hemoglobinuria (PNH), hemolytic uremic syndrome (aHUS), myasthenia gravis (MG), IgA nephritis, etc. C5 inhibition can effectively target the terminal complement pathway, blocking the release of C5a and the assembly of the membrane attack complex (MAC). At present, the drugs for the treatment of complement-related diseases are mainly peptides and monoclonal antibodies, and the types of drugs developed with C5 as the target are mainly antibody drugs (see references 1-11); the indications under development are mainly PNH, HUS, and MG; there are many projects in the late stage of development, and two drugs have been approved for marketing: Eculizumab (trade name Soliris) and Ravulizumab (trade name Ultomiris). Although these two drugs can better control hemolysis and reduce inflammatory responses, Eculizumab/Ravulizumab has no effect on some PNH patients with SNP mutations. In addition, antibody drugs have a short half-life, a short duration of effectiveness, and are expensive to use. Obviously, these drugs cannot meet all clinical needs, so the demand for treatments for this type of disease has become increasingly urgent.

Summary of the invention

The purpose of the present invention is to provide a siRNA, its conjugate and pharmaceutical composition and use for regulating the expression of complement component C5 mRNA and protein, by which specific siRNA binds to C5 mRNA to inhibit the translation of mRNA, thereby inhibiting the expression of C5 protein.

To achieve the above object, the technical solution adopted by the present invention is:

In a first aspect, the present invention provides an siRNA comprising a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently a modified or unmodified nucleotide, the sense strand comprises the following sequence or a nucleotide sequence with no more than 3 base mutations from the following sequence, and the antisense strand comprises the following sequence or a nucleotide sequence with no more than 5 base mutations from the following sequence.

According to one embodiment, the sequence of the sense chain is such as SEQ ID NO:8, and the sequence of the antisense chain is such as SEQ ID NO:84.

According to another embodiment, the sequence of the sense chain is SEQ ID NO: 2, and the sequence of the antisense chain is SEQ ID NO: 78.

According to another embodiment, the sequence of the sense chain is such as SEQ ID NO:55, and the sequence of the antisense chain is such as SEQ ID NO:131.

According to some further embodiments, the sequence of the sense chain is such as SEQ ID NO:1, and the sequence of the antisense chain is such as SEQ ID NO:77; or, the sequence of the sense chain is such as any one of SEQ ID NO:3 to 7, and the sequence of the antisense chain is such as any one of SEQ ID NO:79 to 83; or, the sequence of the sense chain is such as any one of SEQ ID NO:9 to 54, and the sequence of the antisense chain is such as any one of SEQ ID NO:85 to 130; or, the sequence of the sense chain is such as any one of SEQ ID NO:56 to 76, and the sequence of the antisense chain is such as any one of SEQ ID NO:132 to 152.

According to another embodiment, the sequence of the sense chain is such as SEQ ID NO:169, and the sequence of the antisense chain is such as SEQ ID NO:170.

According to yet another embodiment, the sequence of the sense strand is such as SEQ ID NO:171, and the sequence of the antisense strand is such as SEQ ID NO:172.

According to certain embodiments, the positive strand includes a nucleotide sequence with no more than 2 base mutations and no more than 1 base mutation compared to any of the above nucleotide sequences.

According to certain embodiments, the base mutation of the sense strand can be at any position of the nucleotide sequence, for example, at any one, two or three of the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth, eighteenth and nineteenth positions.

According to certain embodiments, the antisense strand includes a nucleotide sequence with no more than 5 base mutations, a nucleotide sequence with no more than 4 base mutations, a nucleotide sequence with no more than 3 base mutations, a nucleotide sequence with no more than 2 base mutations, and a nucleotide sequence with no more than 1 base mutation compared to any of the above-mentioned nucleotide sequences.

According to certain embodiments, the base mutation of the antisense strand can be at any position of the nucleotide sequence, for example, any one, two, three, four or five of the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth, eighteenth, nineteenth, twentieth, and twenty-first positions.

According to certain embodiments, in the 5' to 3' direction, the base mutation of the sense chain is at the 3' end of its nucleotide sequence, and the base mutation of the antisense chain is at any one or more of the 5' end, positions 2 to 8, and the last two positions at the 3' end of its nucleotide sequence.

According to certain embodiments, the base mutation includes base substitution, insertion or deletion.

According to certain embodiments, in the 5' to 3' direction, the base mutation of the sense strand is at the 3' end of its nucleotide sequence, and the base mutation of the antisense strand is at the 5' end of its nucleotide sequence.

In certain embodiments, the modified nucleotide is a 2'-methoxy-modified nucleotide, a 2'-fluoro-modified nucleotide, a 2'-O-CH ₂ -CH ₂ -O-CH ₃ -modified nucleotide, a 2'-O-CH ₂ -CH＝CH ₂ -modified nucleotide, a 2'-CH ₂ -CH ₂ -CH＝CH ₂ -modified nucleotide, a 2'-deoxy nucleotide, a 2'-methoxyethyl-modified nucleotide, a phosphorothioate bond-modified nucleotide, a VP-modified nucleotide, LNA, ENA, cET BNA, UNA, GNA or a combination of one or more of SAFE-01, wherein R1 in the structural formula shown in SAFE-01 is H, OH or CH ₃ , and Base is a natural nucleobase, a modified nucleobase, a universal base or an H atom.

In certain embodiments, the number of modified nucleotides in the sense strand is one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, or nineteen.

In certain embodiments, the number of modified nucleotides in the antisense strand is one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty or twenty-one.

In certain embodiments, all of the nucleotides in the sense strand and the antisense strand are modified nucleotides.

In certain embodiments, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 8 and 9 of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides.

In other embodiments, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 8 and 9 of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; in the 5' to 3' direction, the phosphate group at the 5' end of the antisense strand is replaced by VP, and the 2'-fluoro-modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides.

In some other embodiments, from 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 8 and 9 of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; from 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 2, 14 and 16 of the antisense strand, the 6th position of the antisense strand is SAFE-01, and the remaining positions are 2'-methoxy-modified nucleotides.

In some other embodiments, from 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 8 and 9 of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; from 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, the 7th position of the antisense strand is SAFE-01, and the remaining positions are 2'-methoxy-modified nucleotides.

In some other embodiments, the 2'-fluoro modified nucleotides are located at positions 7, 8 and 9 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; in the 5' to 3' direction, the phosphate group at the 5' end of the antisense strand is replaced by VP, and the 2'-fluoro The 2'-methoxy modified nucleotides are located at positions 2, 14, and 16 of the antisense strand, the 6th position of the antisense strand is SAFE-01, and the remaining positions are 2'-methoxy modified nucleotides.

In some other embodiments, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 7th, 9th and 11th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 14th and 16th positions of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides.

In the above various embodiments, further, at least one of the following connections between nucleotides in the siRNA is a phosphorothioate connection:

The connection between the first nucleotide and the second nucleotide at the 5' end of the sense strand;

The connection between the second nucleotide and the third nucleotide at the 5' end of the sense strand;

The connection between the first nucleotide and the second nucleotide at the 3' end of the sense strand;

The connection between the second nucleotide and the third nucleotide at the 3' end of the sense strand;

The connection between the first nucleotide and the second nucleotide at the 5' end of the antisense strand;

The connection between the second nucleotide and the third nucleotide at the 5' end of the antisense strand;

The connection between the first nucleotide and the second nucleotide at the 3' end of the antisense strand;

The connection between the second nucleotide and the third nucleotide at the 3' end of the antisense strand.

Further, in the 5' to 3' direction, the sense strand comprises a phosphorothioate group located at the following positions:

Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand;

Between the second nucleotide and the third nucleotide starting from the 5' end of the sense strand;

Between the first nucleotide and the second nucleotide starting from the 3' end of the sense strand;

Between the second nucleotide and the third nucleotide starting from the 3' end of the sense strand;

or,

The sense strand contains phosphorothioate groups located at the positions shown below:

The positive strand is located between the second and third nucleotides starting from the 5' end.

Further, in the 5' to 3' direction, the antisense strand comprises a phosphorothioate group located at the following position:

Between the first nucleotide and the second nucleotide starting from the 5' end of the antisense strand;

Between the second nucleotide and the third nucleotide starting from the 5' end of the antisense strand;

Between the first nucleotide and the second nucleotide starting from the 3' end of the antisense strand;

Between the second and third nucleotides starting from the 3' end of the antisense strand.

In certain embodiments, the siRNA is selected from the siRNAs in Table 1 or Table 2.

The second aspect of the present invention provides a siRNA conjugate, which comprises one or more of the above-mentioned siRNAs, and one or more conjugated groups conjugated to any position of the siRNA.

According to certain embodiments, two, three or four consecutively linked conjugated groups are linked to any position of the siRNA.

According to certain embodiments, the conjugate group is attached to the 3' end and/or the 5' end of the sense strand.

According to certain embodiments, the siRNA conjugate has any one of the following structures:

The siRNA of the present invention is coupled with N-acetylgalactosamine residues and is specifically taken up by liver cells through asialoglycoprotein receptors, so that a relatively long half-life can be maintained, thereby prolonging the drug effect time.

According to certain embodiments, the siRNA conjugate is selected from the siRNA conjugates shown in Table 6, Table 9, Table 11, Table 12, Table 13, Table 14 or Table 15.

The third aspect of the present invention provides a pharmaceutical composition, which includes the above-mentioned siRNA or the above-mentioned siRNA conjugate, and a pharmaceutically acceptable carrier or excipient.

In certain embodiments, the pharmaceutical composition is used to modulate the expression of complement C5.

The fourth aspect of the present invention provides use of the above siRNA, or the above siRNA conjugate, or the above pharmaceutical composition for preparing a medicament for regulating complement C5 expression.

The fifth aspect of the present invention provides use of the above siRNA, or the above siRNA conjugate, or the above pharmaceutical composition for preparing a medicament for treating and/or preventing diseases related to the expression of complement C5.

According to certain embodiments, the diseases include paroxysmal nocturnal hemoglobinuria, atypical hemolytic uremic syndrome, age-related macular degeneration, myasthenia gravis, IgA nephritis, neuromyelitis optica, and C3 glomerular disease.

The sixth aspect of the present invention provides a method for regulating complement C5 expression, comprising contacting a therapeutically effective amount of the siRNA of the present invention, or the siRNA conjugate of the present invention, or the pharmaceutical composition of the present invention with cells expressing C5 or administering it to a subject in need thereof.

The present invention also provides a method for treating and/or preventing diseases associated with complement C5 expression, comprising administering a therapeutically effective amount of the siRNA of the present invention, or the siRNA conjugate of the present invention, or the pharmaceutical composition of the present invention to a subject in need thereof.

Due to the application of the above technical solution, the present invention has the following advantages compared with the prior art:

The siRNA, siRNA conjugate and pharmaceutical composition provided by the present invention show excellent complement C5 expression inhibition activity in cell experiments and animal experiments, and have good potential for treating diseases associated with complement C5 expression. For example, the siRNA, siRNA conjugate and pharmaceutical composition of the present invention have good tissue specificity and high safety; long duration of efficacy, subcutaneous administration, and high medication compliance; compared with existing drugs of the same type, both efficacy and safety are greatly improved.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the remaining expression level of C5 mRNA in mouse liver after using the test conjugate in Example 5;

FIG2 shows the remaining expression level of C5 mRNA in rat liver after using the test conjugate in Example 6;

FIG3 shows the remaining expression level of C5 mRNA in mouse liver after using the test conjugate in Example 9;

FIG4 shows the remaining expression level of C5 mRNA in rat liver after using the test conjugate in Example 10;

FIG5 shows the remaining expression level of C5 mRNA in rat liver after using the test conjugate in Example 11;

Figure 6 shows the remaining expression level of C5 mRNA in cynomolgus monkeys after using the test conjugate in Example 12;

Figure 7 shows the remaining expression level of C5 mRNA in crab-eating monkeys after using the test conjugate in Example 14.

DETAILED DESCRIPTION

It should be noted that, unless otherwise defined, the technical terms or scientific terms used in this application should have the common meanings understood by technicians in the relevant field.

The experimental methods in the following examples are conventional methods unless otherwise specified. The raw materials, reagents, etc. used in the following examples are commercially available products unless otherwise specified.

definition

In the above and below, unless otherwise specified, capital letters A, C, G, and U represent adenosine-3'-phosphate, cytidine-3'-phosphate, guanosine-3'-phosphate, and uridine-3'-phosphate, respectively; a lowercase letter m indicates that the nucleotide adjacent to the left of the letter m is a 2'-methoxy-modified nucleotide; a lowercase letter f indicates that the nucleotide adjacent to the left of the letter f is a 2'-fluoro-modified nucleotide; a lowercase letter s in the middle of a capital letter indicates that the two nucleotides adjacent to the left and right of s are linked by a thiophosphate group; when s is the first at the 3' end, it indicates that the terminal of a nucleotide adjacent to the left of the letter s is a thiophosphate group; when s is the first at the 5' end, it indicates that the terminal of a nucleotide adjacent to the right of the letter s is a thiophosphate group; when s is between two conjugated molecules, it indicates that the two conjugated molecules are linked by a thiophosphate group. The capital letter P indicates that the nucleotide adjacent to the right of the letter P is a 5'-phosphate nucleotide; the letter combination VP indicates that the nucleotide adjacent to the right of the letter combination VP is a nucleotide modified with vinyl phosphate (5'-(E)-vinylphosphonate, E-VP); dT is deoxythymidine. L96 represents N-[tri(GalNAc-alkyl)-amide decanoyl]-4-hydroxyprolinol-(GalNAc-alkyl); SA20 represents N-(GalNAc-alkanoyl)-4-hydroxyprolinol (for specific structure and synthesis, see US2022/0008541A1).

In the above and below, 2'-methoxy-modified nucleotide refers to a nucleotide in which the hydroxyl group at the 2'-ribose group of the nucleotide is replaced by a methoxy group; similarly, 2'-fluoro-modified nucleotide, 2'-O-CH ₂ -CH ₂ -O-CH ₃ -modified nucleotide, 2'-O-CH ₂ -CH＝CH ₂ -modified nucleotide, 2'-CH ₂ -CH ₂ -CH＝CH ₂ -modified nucleotide, 2'-deoxy nucleotide, and 2'-methoxyethyl-modified nucleotide refer to nucleotides in which the hydroxyl group at the 2'-ribose group of the nucleotide is replaced by the corresponding group.

LNA is shown in formula (1), ENA is shown in formula (2), cET BNA is shown in formula (3), UNA is shown in formula (4), GNA is shown in formula (5), and SAFE-01 is shown in formula (6):

In the above formulae (1) to (6), Base represents a natural nucleobase, a modified nucleobase, a universal base, such as A, U, G or C. In the above formulae (4) to (5), R is selected from H, OH or alkoxy (O-alkyl). In formula (6), R1 is H, OH or CH ₃ . According to some embodiments, R1 is H. According to some embodiments, R1 is OH. According to some embodiments, R1 is CH ₃ .

In the above and below, especially when describing the preparation method of the siRNA, pharmaceutical composition or siRNA conjugate of the present disclosure, unless otherwise specified, the nucleoside monomer refers to the modified or unmodified nucleoside phosphoramidite monomer used in the solid phase phosphoramidite synthesis according to the type and order of nucleotides in the siRNA or siRNA conjugate to be prepared. Solid phase phosphoramidite synthesis is a method used in RNA synthesis known to those skilled in the art. The nucleoside monomers used in the present disclosure are all commercially available.

In the context of the present disclosure, unless otherwise specified, "conjugation" refers to the connection between two or more chemical moieties, each having a specific function, in a covalently linked manner; accordingly, "conjugate" refers to a compound formed by covalently linking the chemical moieties. Further, "siRNA conjugate" means a compound formed by covalently linking one or more chemical moieties having a specific function to siRNA. Depending on the context, siRNA conjugates should be understood as a general term for multiple siRNA conjugates or an siRNA conjugate shown by a certain chemical formula. In the context of the present disclosure, "conjugated molecule" should be understood as a specific compound that can be conjugated to siRNA through a reaction to ultimately form the siRNA conjugate of the present disclosure.

Various hydroxyl protecting groups can be used in the present disclosure. In general, the protecting group makes the chemical functional group insensitive to specific reaction conditions, and the functional group in the molecule can be added and removed without substantially damaging the rest of the molecule. Representative hydroxyl protecting groups are disclosed in Beaucage et al., Tetrahedron 1992, 48, 2223-2311, and Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2d ed, John Wiley & Sons, New York, 1991, each of which is incorporated herein by reference in its entirety. In some embodiments, the protecting group is stable under alkaline conditions, but can be removed under acidic conditions. In some embodiments, non-exclusive examples of hydroxyl protecting groups that can be used herein include dimethoxytrityl (DMT), monomethoxytrityl, 9-phenyloxanthene-9-yl (Pixyl) and 9-(p-methoxyphenyl)oxanthene-9-yl (Mox). In some embodiments, non-exclusive examples of hydroxy protecting groups that may be used herein include Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4'-dimethoxytrityl), and TMTr (4,4',4"-trimethoxytrityl).

The pharmaceutically acceptable carrier described in the present disclosure can be a carrier conventionally used in the field of siRNA administration, such as but not limited to magnetic nanoparticles (such as nanoparticles based on Fe3O4 or Fe2O3), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine), PLL, chitosan (c hitosan), 1,2-dioleoyl-3-trimethylammonium-propane (1,2-dioleoyl-3-trimethylammonium-propane, DOTAP), poly D- or L-lactic/glycolic acid copolymer (poly(D&L-lactic/glycolic acid) copolymer, PLGA), poly(aminoethyl ethylene phosphate) (poly(2-aminoethyl ethylene phosphate), PPEEA) and poly(methacrylate-N,N-dimethylaminoethyl ester) (poly(2-dimethylaminoethyl methacrylate), PDMAEMA) and their derivatives. One or more of the excipients can be one or more of various preparations or compounds conventionally used in the art. For example, the other pharmaceutically acceptable excipients can include at least one of a pH buffer, a protective agent and an osmotic pressure regulator.

As used herein, "optional" or "optionally" means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

The term "subject", as used herein, refers to any animal, such as a mammal or marsupial. Subjects of the present disclosure include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cows, rabbits, sheep, rats, and poultry of any kind.

As used herein, "treatment" refers to an approach to obtaining beneficial or desired results, including but not limited to a therapeutic benefit. "Therapeutic benefit" means eradication or amelioration of the underlying disorder being treated. In addition, a therapeutic benefit is obtained by eradication or amelioration of one or more physiological symptoms associated with the underlying disorder, such that an improvement is observed in the subject, although the subject may still be afflicted with the underlying disorder.

As used herein, "prevention" refers to an approach to obtaining beneficial or desired results, including but not limited to a prophylactic benefit. To obtain a "prophylactic benefit," siRNA, siRNA conjugate, or pharmaceutical composition can be administered to a subject at risk for a particular disease, or to a subject reporting one or more physiological symptoms of a disease, even though a diagnosis of the disease may not have been made.

The conjugation site of siRNA and conjugation group can be at the 3' end or 5' end of the siRNA sense strand, at the 3' end or 5' end of the antisense strand, or in the internal sequence of siRNA. In some embodiments, the conjugation site of siRNA and conjugation group is at the 3' end of the siRNA sense strand.

In some embodiments, the conjugated group can be connected to the phosphate group, 2'-hydroxyl group or base of the nucleotide. In some embodiments, the conjugated group can also be connected to the 3'-hydroxyl group, in which case the nucleotides are connected by a 2'-5' phosphodiester bond. When the conjugated group is connected to the end of the siRNA chain, the conjugated group is usually connected to the phosphate group of the nucleotide; when the conjugated group is connected to the internal sequence of the siRNA, the conjugated group is usually connected to the ribose sugar ring or the base. Various connection methods can be referred to in the literature: Muthiah Manoharan et.al. siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked through nucleosides elicit robust gene silencing in vivo in hepatocytes. ACS Chemical biology, 2015, 10(5): 1181-7.

In some embodiments, the siRNA and the conjugated group can be connected by acid-labile or reducible chemical bonds, which can be degraded in the acidic environment of the cell endosome, thereby making the siRNA free. For non-degradable conjugation methods, the conjugated group can be connected to the sense strand of the siRNA, thereby minimizing the effect of conjugation on the activity of the siRNA.

In some embodiments, multiple conjugated groups can be linked using phosphate groups or thiophosphate groups.

In some embodiments, the pharmaceutically acceptable targeting group may be a ligand conventionally used in the field of siRNA administration, such as various ligands described in WO2009082607A2, which is incorporated herein by reference in its entirety.

In this article, SD. means standard deviation and AVG means average.

The technical solution provided by the present invention is further described below in conjunction with specific embodiments. The following embodiments are only used to illustrate the present invention and will not limit the protection scope of the present invention.

Example 1 Design and synthesis of siRNA

Herein, if the actual source is not specifically given, the reagent can be obtained from any supplier of molecular biology reagents in a quality/purity suitable for molecular biology applications.

1) siRNA design, human C5 (NM_001735.3) was used as the target gene, and 19/21nt siRNA was designed to meet the general rules of active siRNA. The detailed list of unmodified sense and antisense strand sequences is shown in Table 1 below, and the detailed list of modified sense and antisense strand sequences is shown in Table 2 below.

2) siRNA synthesis, using solid support-mediated phosphoramidite chemistry on a Dr.Oligo48 synthesizer (Biolytic), the C5siRNA sequence was synthesized at a specification of 200 nanomoles (nmol). The solid support was a universal solid support (Shenzhen Comma Biotech). Nucleoside monomer raw materials 2'-F RNA, 2'-O-methyl RNA and other nucleoside phosphoramidite monomers were purchased from Shanghai Zhaowei or Suzhou Jima. The coupling time of all phosphoramidites (50mM acetonitrile solution) was 6 minutes (min), 5-ethylthio-1H-tetrazole (ETT) was used as an activator (0.6M acetonitrile solution), 0.22M phenylacetyl disulfide (PADS) dissolved in a 1:1 volume ratio of acetonitrile and trimethylpyridine (Suzhou Kelema) solution was used as a sulfurization reagent, the sulfurization reaction time was 3 minutes (min), and iodine pyridine/water solution (Kelema) was used as an oxidant, and the oxidation reaction time was 2 minutes (min).

After solid phase synthesis, the oligoribonucleotides were cleaved from the solid support and soaked in a 3:1 28% ammonia and ethanol solution at 50°C for 16 hours. Then, the supernatant was transferred to another centrifuge tube by high-speed centrifugation, concentrated and evaporated to dryness, and purified by C18 reverse chromatography with a mobile phase of 0.1M triethylamine acetate (TEAA) and acetonitrile, and 4,4'-dimethoxytrityl (DMTr) was removed using a 3% trifluoroacetic acid solution. The target oligonucleotides were collected and freeze-dried, identified as the target product by LC-MS, and then quantified by UV (260nm).

The single-stranded oligonucleotides obtained were annealed according to an equimolar ratio and two complementary paired sequences. The final double-stranded siRNA was dissolved in 1X PBS and adjusted to the required concentration for the experiment.

Table 1

Table 2

Example 2 siRNA inhibition of human complement C5 in Hep3B cells, single concentration point inhibitory activity screening

The effect of siRNA targeting C5 on the expression level of C5 mRNA was tested in vitro. Hep3B cells were cultured in DMEM high glucose medium containing 10% fetal bovine serum at 37°C and 5% CO _2. During transfection, Hep3B cells were seeded in 96-well plates at a seeding density of 20,000 cells per well with 100 μL of culture medium per well.

According to the product manual, siRNA was transfected using Lipofectamine RNAiMAX (ThermoFisher, 13778150), and the final concentration of siRNA transfection was 10 nM. After 24 hours of treatment, RNA was isolated from cells using a cell RNA extraction kit (Zhiang Bio, MNTR/FX96), and reverse transcription was performed using a reverse transcription kit (Takara PrimeScript ^TM II 1st Strand cDNA Synthesis Kit, 6210A) according to standard procedures, and quantitative real-time PCR was performed using a qPCR reaction kit (Vazyme, Q711) to determine the mRNA level of C5, and the mRNA level of C5 was corrected according to the level of the GAPDH internal reference gene.

Primers for C5:

Forward primer: ATCAGGCCAGGGAAGGTTAC (SEQ ID NO: 153);

Reverse primer: TCGGGATGAAGGAACCATGT (SEQ ID NO: 154);

Primers for GAPDH:

Forward primer: GGTCGGAGTCAACGGATTT (SEQ ID NO: 155);

Reverse primer: CCAGCATCGCCCCACTTGA (SEQ ID NO: 156);

The results are expressed as the remaining percentage relative to the C5 mRNA expression of cells not treated with siRNA (which is 100%). The smaller the remaining percentage, the higher the inhibitory activity of siRNA. The results are shown in Table 3.

Table 3

Example 3 siRNA inhibition of human C5 in Hep3B cells, double concentration point activity

Multiple siRNAs in Table 3 that showed 65% or higher in vitro inhibition were screened at two concentrations (10 nM, 0.1 nM) in Hep3B cells.

Hep3B cells were cultured in DMEM high-glucose medium containing 10% fetal bovine serum at 37°C and 5% CO _2. 24 h before transfection, Hep3B cells were seeded in 96-well plates at a seeding density of 10,000 cells per well with 100 μL of culture medium per well.

Referring to the product manual, siRNA was transfected using Lipofectamine RNAiMAX (ThermoFisher, 13778150) at a final concentration of 10 nM and 1 nM. After 24 hours of treatment, the mRNA level of C5 was determined in the same manner as in Example 2.

The results are expressed as the remaining percentage of C5 mRNA expression relative to cells not treated with siRNA (which is 100%), and the results are shown in Table 4.

Table 4

Example 4 Conjugate Preparation

Through the solid phase phosphoramidite method, the desired conjugated molecule is used to start the cycle, and the nucleoside monomers are connected one by one from the 3'-5' direction according to the nucleotide arrangement order. Each connection of a nucleoside monomer includes four steps of deprotection, coupling, capping, oxidation or sulfurization. The same synthesis conditions are used for the sense chain and the antisense chain.

Instrument model: Biolytic Dr. Oligo 48 solid phase synthesizer, Biocomma Embed CPG Frits universal synthesis column DS0200, Biocomma 96-well plate desalting column DC189650 (80 mg). The reagents used to synthesize siRNA conjugates are shown in Table 5.

Table 5

The synthesis conditions are given as follows:

The nucleoside monomer was provided in an acetonitrile solution with a concentration of 0.05 M. The conditions of the deprotection reaction in each step were the same, namely, the temperature was 25° C., the reaction time was 3 minutes, the deprotection reagent was DCA, and the injection volume was 180 μL.

The reaction conditions for each coupling step were the same, including a temperature of 25°C, a reaction time of 3 minutes, a nucleoside monomer injection volume of 90 μL, and a catalyst ACT injection volume of 110 μL.

The capping conditions were the same in each step, including a temperature of 25°C and a reaction time of 2 minutes. The capping reagent solution was a mixed solution of CapA and CapB at a molar ratio of 1:1. The capping reagent injection volume was 180 μL.

The oxidation reaction conditions were the same in each step, including a temperature of 25°C, a reaction time of 3 minutes, and an injection volume of 180 μL of the oxidation reagent OXD.

The reaction conditions for each step of the sulfurization reaction were the same, including a temperature of 25 °C, a reaction time of 4 minutes, and a sulfurization reagent of 0.05 M PADS in pyridine acetonitrile. The injection volume of the sulfurization reagent was 180 μL.

After the last nucleoside monomer is connected, the nucleic acid sequence connected to the solid phase carrier is cut, deprotected, purified, desalted, and then freeze-dried to obtain the sense chain and antisense chain.

1. The cleavage and deprotection conditions are as follows: add the synthesized nucleotide sequence connected to the vector to a mixed solution of ammonia water: ethanol = 3:1 to a volume of 0.8 mL. React at 50°C for 15 hours, filter to remove the remaining vector, and vacuum concentrate the supernatant to dryness.

2 Purification and desalting conditions are as follows: Desalting is performed using a C18 reverse phase column. Specific conditions include:

2-1 Sample Preparation

0.1 M TEAA (triethylamine acetate) was added to the oligonucleotide sample to a volume of 0.8 mL.

2-2 Activation of 96-well plates

Activation: 0.8 mL of acetonitrile was passed through each well of a 96-well plate for activation

Balance: Use 0.8 mL TEAA (pH 7.0) solution to balance the 96-well plate.

2-3 The purification process is carried out as follows

Pass 0.8 mL of the solution containing the oligonucleotide through the desalting column.

Wash the 96-well plate twice with 0.8 mL 6.5% ammonia to remove failed sequences.

Rinse the 96-well plate twice with 0.8 mL of deionized water to remove salt.

The 96-well plate was rinsed three times with 0.8 mL of 3% trifluoroacetic acid to remove DMT, and the adsorption layer was observed to turn orange-red.

Rinse the 96-well plate with 0.8 mL 0.1 M TEAA

Rinse the 96-well plate twice with 0.8 mL of deionized water to remove trifluoroacetic acid and residual salt.

Elute with 0.6 mL 20% acetonitrile and collect the lyophilized

The detection method is as follows: Waters Acquity UPLC-LTQ LCMS (column: ACQUITY UPLC BEH C18) was used to detect the purity of the above-mentioned sense chain and antisense chain and analyze the molecular weight. The measured values are consistent with the theoretical values, indicating that the synthesized sense chain and antisense chain are conjugated with groups at the 3' end and/or 5' end.

The annealing operation is as follows: the sense chain and antisense chain synthesized in step 1 are dissolved in water for injection respectively to prepare a solution of 0.1 mg/mL-40 mg/mL, and the mixture is calibrated with a concentration meter to equimolar ratio, heated at 90°C for 5 minutes, and then slowly cooled naturally to form a double-stranded structure through hydrogen bonding, and samples are taken for testing the SEC purity of the product.

The double-stranded samples were lyophilized.

Example 5 Activity of the conjugate tested in mice

SPF female C57BL/6J mice aged 6-8 weeks were selected, and the weight of the mice was 20±2g. The mice were weighed and observed before administration, and animals with uniform weight and normal condition were randomly divided into groups, with 3 mice in each group. The mice in the experimental group were given the conjugate, and the mice in the vehicle group were given phosphate buffered saline (PBS). The conjugate was administered subcutaneously at a dose of 3 mg/kg per mouse. Seven days after administration, the animals were sacrificed by cervical dislocation, and the liver tissue was taken. According to conventional methods, the liver was cut into pieces and placed in RNALater (Invitrogen, AM7021M) for subsequent RNA extraction. The liver tissue was placed in a lysis buffer (Zhiang Bio, MNTR/FX96) and ground (Shanghai Jingxin, JXFSTPRP-48L) to extract total RNA, which was reverse transcribed into cDNA (Takara, 6210B), and C5 was detected by fluorescence qPCR (Vazyme, Q711). mRNA expression levels.

Target gene C5 primer:

Forward primer: CCAGCCCAATCAAGTTCCTAGAG (SEQ ID NO: 157);

Reverse primer: CGGCGTGTAAACAGGTTTGTC (SEQ ID NO: 158);

Primers for internal reference gene GAPDH:

Forward primer: TGCACCACCAACTGCTTAG (SEQ ID NO: 159);

Reverse primer: GATGCAGGGATGATGTTC (SEQ ID NO: 160);

The results are expressed as the residual expression level of the siRNA administration group compared to the vehicle group (the vehicle group is 100%). The sequences of the conjugates for injection of the present invention are shown in Table 6, and the positive control sequences are shown in Table 7. The conjugates in Table 6 and Table 7 were prepared according to the method of Example 4. After using the tested conjugates, the residual expression level of C5 mRNA in the liver of mice is shown in Table 8 and Figure 1. As shown in Figure 1, compared with the positive compound SD003317, the conjugates SD003562, SD003565, SD003569, and SD003571 showed better inhibitory activity.

Table 6

Table 7

Table 8

Example 6 Activity of the conjugate tested in rats

6-8 week old female SD SPF rats were selected, with a body weight of 200±2g. The rats were weighed and observed before administration, and animals with uniform body weight and normal condition were randomly divided into groups, with 4 rats in each group. The rats in the experimental group were given the conjugate, and the rats in the vehicle group were given Phosphate buffered saline (PBS) was administered subcutaneously at a dose of 5 mg/kg of the conjugate per rat. 14 days after administration, the animals were sacrificed by cervical dislocation, liver tissue was taken, and the liver was cut into pieces and placed in RNALater (Invitrogen, AM7021M) according to conventional methods for subsequent RNA extraction. The liver tissue was placed in a lysis solution (Zhiang Bio, MNTR/FX96) and ground (Shanghai Jingxin, JXFSTPRP-48L) to extract total RNA, which was reverse transcribed into cDNA (Takara, 6210B), and the expression level of the C5 gene was measured by fluorescence qPCR (Vazyme, Q711).

Target gene C5 primer:

Forward primer: GGTGGCCGTGACAATGTAGA (SEQ ID NO: 165);

Reverse primer: TGGGCACACGGTGTTTGTAT (SEQ ID NO: 166);

Primers for internal reference gene GAPDH:

Forward primer: GCCTGGAGAAACCTGCCAA (SEQ ID NO: 167);

Reverse primer: GTCATTGAGAGCAATGCCAGC (SEQ ID NO:168).

The results are expressed as the residual expression level of the siRNA administration group compared to the vehicle group (the vehicle group is 100%). The conjugate sequence for injection is shown in Table 9, and the conjugate is prepared according to the method of Example 4. After using the tested conjugate of the present invention, the residual expression level of C5 mRNA in rat liver is shown in Table 10 and Figure 2. As shown in Figure 2, compared with the positive compound SD003317, the conjugates SD003574, SD003575, SD003576, and SD003577 showed better inhibitory activity.

Table 9

Table 10

Example 7 Synthesis of Ugo monomer, Cgo monomer and Ago monomer

1. The synthetic route of Ugo monomer is as follows:

(1) Compound 1-4 (9.99 g, 30.8 mmol), compound U-1 (commercially available, purchased from Shanghai Haohong Biopharmaceutical Technology Co., Ltd.) (9.33 g, 43.1 mmol, 1.4 equiv) and triphenylphosphine (16.6 g, 63.2 mmol, 2.0 equiv) were dissolved in dry tetrahydrofuran (350.0 mL) under ice-water bath conditions, and diisopropyl azodicarboxylate (13.1 g, 64.7 mmol, 12.6 mL, 2.1 equiv) was then added dropwise to the reaction system. The reaction solution was then stirred at room temperature for 2 hours. After the reaction was completed, the reaction solution was extracted with saturated sodium bicarbonate solution and ethyl acetate for 3 times, the organic phases were combined and spin-dried, and the crude product was separated and purified by silica gel column chromatography (petroleum ether/ethyl acetate 10:1 to 8:1) to obtain a white solid compound 3-1 (16.1 g, reaction yield 99%). ¹ H NMR data of compound 3-1: (400 MHz, DMSO-d ₆ ) δ 7.89-7.74 (m, 4H), 7.56-7.53 (m, 2H), 7.33-7.29 (m, 5H), 5.80-5.73 (m, 1H), 4.46-4.38 (m, 2H), 4.00-3.91 (m, 2H), 3.60-3.50 (m, 1H), 3.49-3.43 (m, 2H) 2.17-1.98 (m, 1H), 1.13 (s, 3H), 0.83 (s, 9H), 0.01 (d, J=6.0 Hz, 6H). Mass spectrum identification of compound 3-1 (C ₂₉ H ₃₈ N ₂ O ₅ Si, molecular weight 522.1, [M+H]=523.2).

(2) Compound 3-1 (8.05 g, 15.4 mmol) was dissolved in methanol (160.0 mL) at room temperature, and then sodium methoxide (2.77 g, 15.4 mmol, 30% purity, 1.0 equiv) was slowly added to the reaction system. The reaction solution was then stirred at room temperature for 12 hours. After the reaction was completed, the solvent methanol was removed by distillation under reduced pressure, and the remaining system was extracted with 1M hydrochloric acid solution and ethyl acetate for 3 times. The organic phases were combined and spin-dried, and the obtained crude product was separated and purified by silica gel column chromatography (petroleum ether/ethyl acetate 10:1 to 0:1) to obtain a white solid compound 3-2 (6.1 g, reaction yield 94%). ¹ H NMR data of compound 3-2: (400 MHz, DMSO-d ₆ ) δ 11.1 (s, 1H), 7.48 (d, J = 8.0 Hz, 1H), 7.30-7.24 (m, 5H), 5.47-5.44 (m, 1H), 4.45-4.35 (m, 2H), 3.98-3.94 (m, 1H), 3.79-3.78 (m, 1H), 3.63-3.57 (m, 1H), 3.38-3.35 (m, 2H), 2.04-1.95 (m, 1H), 1.10 (s, 3H), 0.83 (s, 9H), 0.01 (d, J = 6.0 Hz, 6H). Mass spectrometry identification of compound 3-2 (C ₂₂ H ₃₄ N ₂ O ₄ Si, molecular weight 418.1, [M+H]=418.2).

(3) Compound 3-2 (4.0 g, 9.56 mmol) was dissolved in dichloromethane (30.0 mL) at -70 °C, and then boron trichloride (1.0 M in DCM, 66.9 mL, 7.0 equiv) was slowly added to the reaction system. The reaction solution was then stirred at -70 °C for 3 hours. After completion, the reaction was quenched with triethylamine (5.0 mL) and methanol (30.0 mL), and the remaining system was extracted with water and dichloromethane for 3 times. The organic phases were combined and dried by rotation, and the obtained crude product was prepared by C18 reverse phase column to obtain white solid compound 3-3 (0.7 g, reaction yield 33%). ¹ H NMR data of compound 3-3: (400 MHz, DMSO-d ₆ ) δ 7.54 (d, J = 8.0 Hz, 1H), 5.51 (d, J = 7.6 Hz, 1H), 3.88-3.84 (m, 1H), 3.72-3.70 (m, 1H), 3.61-3.59 (m, 2H), 1.75-1.68 (m, 1H), 1.09 (d, J = 6.4 Hz, 3H). Mass spectrometry identification of compound 3-3 (C ₉ H ₁₄ N ₂ O ₄ , molecular weight 214.1, [M+H]=215.2).

(4) Compound 3-1 (0.4 g, 1.87 mmol) was dissolved in pyridine (4.0 mL) at room temperature, and 4,4'-bismethoxytrityl chloride (949.0 mg, 2.8 mmol, 1.5 equiv) was added to the reaction system under ice-water bath conditions. The reaction solution was then stirred at room temperature for 2 hours. After the reaction was completed, the solvent pyridine was removed by distillation under reduced pressure, and the remaining system was extracted with saturated sodium bicarbonate solution and ethyl acetate for 3 times. The organic phases were combined and dried by spin drying, and the obtained crude product was separated and purified by silica gel column chromatography (petroleum ether/ethyl acetate 4:1 to 0:1) to obtain a white solid compound 3-4 (0.7 g, reaction yield 70%). ¹ H NMR data of compound 3-4: (400 MHz, DMSO-d ₆ ) δ 11.3 (s, 1H), 7.37 (d, J = 8.0 Hz, 1H), 7.33-7.29 (m, 4H), 7.20-7.17 (m, 5H), 6.86-6.83 (m, 4H), 5.40 (d, J = 8.0 Hz, 1H), 4.61 (d, J = 4.8 Hz, 2H), 3.83-3.79 (m, 2H), 3.72 (s, 6H), 3.71-3.68 (m, 1H), 3.08-2.90 (m, 2H), 1.90 (s, 1H), 1.01 (d, J = 6.4 Hz, 3H). Mass spectrometry identification of compound 3-4 (C ₃₀ H ₃₂ N ₂ O ₆ , molecular weight 516.1, [M+H]=517.4).

(5) Compound 3-4 (1.2 g, 2.32 mmol) was dissolved in dichloromethane (12.0 mL) under nitrogen conditions at room temperature, and 4,5-dicyanoimidazole (357.0 mg, 3.02 mmol, 1.3 equiv) and bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.05 g, 3.48 mmol, 1.5 equiv) were added to the reaction system respectively. The reaction solution was then stirred at room temperature for 2 hours. After the reaction was completed, the reaction solution was dissolved in methyl tert-butyl ether (10.0 mL) and 1% sodium hydroxide solution (10.0 mL), and continued to stir at room temperature for 0.5 hours. The remaining system was extracted with ethyl acetate for 3 times, and the organic phases were combined and dried by rotation. The crude product was used to prepare the white solid compound SA000016 (1.2 g, reaction yield 71%) using a C18 reverse phase column. ¹ H NMR data of compound SA000016: (400 MHz, CD ₃ CN) δ9.39 (s, 1H), 7.39-7.24 (m, 10H), 6.85-6.81 (m, 4H), 5.43-5.39 (m, 1H), 4.21-4.18 (m, 1H), 3.86-3.77 (m, 1H), 3.75 (s, 6H), 3.56-3.53 (m, 5H), 3.28-3.05 (m, 2H), 2.62-2.61 (m, 2H), 2.22-2.19 (m, 2H), 1.22-1.07 (m, 15H). ³¹ P NMR data: (400 MHz, CD ₃ CN) δ147.6, 146.5. Mass spectrometry identification of compound SA000016 (C ₃₉ H ₄₉ N ₄ O ₇ P, molecular weight 716.1, [M+H]=717.5).

2. The synthetic route of Cgo monomer is as follows:

(1) Compound 3-2 (8.5 g, 20.3 mmol, prepared by Example 5) and 1,2,4-triazole (19.5 g, 282.0 mmol, 13.9 equiv) were dissolved in pyridine (128.0 mL) at room temperature, and then 4-chlorophenyl dichlorophosphate (56.9 mmol, 9.25 mL, 2.8 equiv) was added dropwise to the reaction system under ice-water bath conditions. The reaction solution was stirred at 30° C. for 16 hours. After the reaction was completed, the solvent pyridine was removed by distillation under reduced pressure. The remaining system was extracted with water and ethyl acetate for 3 times, and the organic phases were combined and dried to obtain a crude yellow oily product, compound C-1 (9.5 g), which was directly used in the next step. Mass spectrometry identification of compound C-1 (C ₂₄ H ₃₅ N ₅ O ₃ Si, molecular weight 469.1, [M+H] = 470.3).

(2) Compound C-1 (9.5 g, 20.2 mmol) was dissolved in 1,4-dioxane (95.0 mL) at room temperature, and then aqueous ammonia (1.38 mol, 212.1 mL, 25% purity, 68.0 equiv) was added to the reaction system. The reaction solution was stirred at 30°C for 16 hours. After the reaction was completed, the solvent was removed by distillation under reduced pressure, and the remaining system was extracted with water and dichloromethane for 3 times. The organic phases were combined and dried to obtain a crude yellow solid compound C-2 (8.5 g), which was directly used in the next step. The mass spectrometry of compound C-2 was identified (C ₂₂ H ₃₅ N ₃ O ₃ Si, molecular weight 417.1, [M+H] = 418.2).

(3) Compound C-2 (8.5 g, 20.2 mmol) was dissolved in N,N-dimethylformamide (85.0 mL) at room temperature, and then acetic anhydride (3.1 g, 30.4 mmol, 2.85 mL, 1.5 equiv) was slowly added to the reaction system. The reaction solution was stirred at 30°C for 3 hours. After the reaction was completed, the solvent was removed by distillation under reduced pressure, and the remaining system was extracted with saturated sodium bicarbonate solution and ethyl acetate for 3 times. The organic phases were combined and dried by spin drying, and the obtained crude product was separated and purified by silica gel column chromatography (dichloromethane/methanol 1:0 to 100:1) to obtain yellow solid compound C-3 (4.2 g, reaction yield 43%). ¹ H NMR data of compound C-3: (400 MHz, DMSO-d ₆ ) δ 10.7 (s, 1H), 7.79 (d, J = 7.2 Hz, 1H), 7.29 (m, 5H), 7.08 (d, J = 7.2 Hz, 1H), 4.36 (d, J = 1.2 Hz, 2H), 4.05-3.99 (m, 2H), 3.72-3.67 (m, 1H), 3.39 (dd, J = 6.4 Hz, 2H), 2.15-2.08 (m, 1H), 2.08 (s, 3H), 1.15 (d, J = 6.4 Hz, 3H), 0.85 (s, 9H), 0.02 (d, J = 6.8 Hz, 6H). Mass spectrometry identification of compound C-3 (C ₂₄ H ₃₇ N ₃ O ₄ Si, molecular weight 459.1, [M+H]=460.2).

(4) Compound C-3 (4.3 g, 9.35 mmol) was dissolved in dichloromethane (46.0 mL) at -78 °C, and then boron trichloride (1.0 M in DCM, 46.8 mL, 5.0 equiv) was slowly added to the reaction system. The reaction solution was then stirred at -78 °C for 4 hours. After the reaction was completed, the reaction was quenched with triethylamine (40.0 mL) and methanol (88.0 mL). The remaining system was extracted with water and dichloromethane for 3 times. The organic phases were combined and dried by rotation. The crude product was used to prepare a white solid compound C-4 (0.96 g, reaction yield 40%) using a C18 reverse phase column. ¹ H NMR data of compound C-4: (400 MHz, DMSO-d ₆ ) δ 10.7 (s, 1H), 8.01 (d, J = 7.2 Hz, 1H), 7.12 (d, J = 7.2 Hz, 1H), 4.60 (d, J = 4.8 Hz, 2H), 4.53-4.50 (m, 1H), 4.00-3.99 (m, 1H), 3.75-3.70 (m, 2H), 3.37-3.32 (m, 2H), 2.08 (s, 3H), 1.81-1.77 (m, 1H), 1.01 (d, J = 6.4 Hz, 3H). Mass spectrometry identification of compound C-4 (C ₁₁ H ₁₇ N ₃ O ₄ , molecular weight 255.1, [M+H] = 256.2).

(5) Compound C-4 (1.5 g, 5.88 mmol) was dissolved in pyridine (10.0 mL) at room temperature, and 4,4'-bismethoxytrityl chloride (2.4 g, 7.05 mmol, 1.2 equiv) was added to the reaction system under ice-water bath conditions. The reaction solution was then stirred at room temperature for 4 hours. After the reaction was completed, the solvent pyridine was removed by distillation under reduced pressure, and the remaining system was extracted with saturated sodium bicarbonate solution and ethyl acetate for 3 times. The organic phases were combined and dried by spin drying, and the obtained crude product was separated and purified by silica gel column chromatography (petroleum ether/ethyl acetate 4:1 to 0:1) to obtain a white solid compound C-5 (0.7 g, reaction yield 70%). ¹ H NMR data of compound C-5: (400 MHz, CDCl ₃ ) δ9.71 (s, 1H), 7.39 (d, J=7.3 Hz, 3H), 7.35-7.21 (m, 7H), 7.06 (d, J=7.1 Hz, 1H), 6.85 (d, J=8.8 Hz, 4H), 4.71 (d, J=3.3 Hz, 1H), 4.43 (dd, J=13.8, 4.5 Hz, 1H), 4.23-3.99 (m, 2H), 3.80 (s, 6H), 3.50-3.38 (m, 1H), 3.31 (dd, J=10.0, 4.1 Hz, 1H), 2.69 (t, J=9.4 Hz, 1H), 2.21 (s, 3H), 1.08 (d, J=6.1 Hz, 3H). Mass spectrometry identification of compound C-5 (C ₃₂ H ₃₅ N ₃ O ₆ , molecular weight 557.1, [M+H]＝558.4).

(6) Compound C-5 (2.0 g, 3.59 mmol) was dissolved in dichloromethane (20.0 mL) under nitrogen conditions at room temperature, and 4,5-dicyanoimidazole (466.0 mg, 3.95 mmol, 1.1 equiv) and bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.4 g, 4.66 mmol, 1.48 mL, 1.3 equiv) were added to the reaction system respectively. The reaction solution was then stirred at room temperature for 2 hours. After the reaction was completed, the reaction solution was dissolved in methyl tert-butyl ether (10.0 mL) and 1% sodium hydroxide solution (10.0 mL), and continued to stir at room temperature for 0.5 hours. The remaining system was extracted with saturated sodium bicarbonate solution and dichloromethane for 3 times, and the organic phases were combined and spin-dried. The crude product was used on a C18 reverse phase column to obtain a white solid compound SA000015 (1.5 g, reaction yield 55%). ¹ H NMR data of compound SA000015: (400 MHz, CD ₃ CN) δ9.15 (s, 1H), 7.50-7.18 (m, 11H), 6.84-6.80 (m, 4H), 4.22-4.08 (m, 2H), 3.75-3.22 (m, 11H), 3.23-3.22 (m, 2H), 2.62-2.51 (m, 2H), 2.38-2.35 (m, 1H), 2.12 (s, 3H), 1.022-1.07 (m, 15H). ³¹ P NMR data: (400 MHz, CD ₃ CN) δ147.5, 146.7. Mass spectrometry identification of compound SA000015 (C ₄₁ H ₅₂ N ₅ O ₇ P, molecular weight 757.1, [M+H]=758.5).

3. The synthetic route of Ago monomer is as follows:

(1) Dissolve anhydrous diisopropylamine (16.2 g, 160.0 mmol, 22.6 mL, 2.0 equiv) in 350 mL of anhydrous tetrahydrofuran, cool to -70°C to -78°C, replace with nitrogen, and add n-butyl lithium solution (2.5 M, 67.1 mL) dropwise (slowly dropwise, the dropwise addition process lasts for at least 10 minutes), and the reaction solution is stirred at -70°C to -78°C for half an hour. Dissolve compound 1 (9.44 g, 79.9 mmol, 9.17 mL, 1.0 equiv) in 175 mL of anhydrous tetrahydrofuran, cool to -70°C to -78°C, and replace with nitrogen, and add the solution obtained in the previous step dropwise (slowly dropwise, the dropwise addition process lasts for at least 10 minutes). The reaction solution is stirred at -70°C to -78°C for half an hour. Maintaining the previous temperature, hexamethylphosphoric acid triamide (26.1 g, 146 mmol, 25.6 mL, 1.82 equiv) and benzyl chloromethyl ether (17.5 g, 112 mmol, 15.5 mL, 1.4 equiv) were slowly added dropwise to the previous reaction solution (slowly added dropwise, the addition process lasted for at least 10 minutes), and after the addition was completed, the temperature was raised to 0°C and stirring was continued for 3 hours. TLC and LCMS detected the disappearance of compound 1. 600 mL of saturated ammonium chloride solution was added in two batches to quench the reaction, and the mixture was extracted with 200 mL of methyl tert-butyl ether. The organic phase was collected, washed with saturated brine, and dried over anhydrous sodium sulfate. After filtration, the filtrate was concentrated. The crude product was separated and purified by silica gel column chromatography (petroleum ether/ethyl acetate = 100/1 to 1/1) to obtain a light brown compound 2 (9.69 g, 40.7 mmol, 51% yield). ¹ H NMR (400 MHz, CDCl ₃ ): δ7.46-7.28 (m, 10H), 4.58-4.46 (m, 2H), 4.19-4.08 (m, 1H), 3.82-3.67 (m, 5H), 2.77 (q, J = 6.1 Hz, 1H), 1.24 (d, J = 6.5 Hz, 4H). LC-MS: C ₁₃ H ₁₈ O ₄ , molecular weight 238.1,239.1(M+H).

(2) Compound 2 (14.7 g, 61.7 mmol, 1.0 equiv) was dissolved in 150 mL of dichloromethane, and under nitrogen protection, imidazole (16.8 g, 247.0 mmol, 4.0 equiv) and tert-butyldimethylsilyl chloride (27.9 g, 185.0 mmol, 22.7 mL, 3.0 equiv) were added at room temperature. The reaction solution was stirred at room temperature for one hour, and TLC and LCMS detection showed that compound 2 disappeared. 100 mL of dichloromethane was added to the reaction solution, and the reaction solution was washed twice with 400 mL of saturated brine. The organic phase was dried, filtered and concentrated, and the crude product was separated and purified by silica gel column chromatography (petroleum ether/ethyl acetate = 100/1 to 10/1) to obtain a light yellow oil compound 3 (12.0 g, 34.0 mmol, 55% yield). ¹ H NMR (400MHz, CDCl ₃ ): δ7.40-7.25 (m, 5H), 4.52 (d, J = 2.4Hz, 2H), 4.10 (t, J = 6.3Hz, 1H), 3.75-3.65 (m, 4H), 3.59 (dd, J = 9.2, 5.3Hz, 1H), 2.79 (dt, J = 8.4 ,5.9Hz,1H),1.17(d,J＝6.2Hz,3H),0.86(s,9H),0.04(d,J＝8.6Hz,6H).LC- MS: C ₁₉ H ₃₂ O ₄ Si, molecular weight 352.1, 353.2 (M+H).

(3) Compound 3 (11.1 g, 31.5 mmol, 1.0 equiv) was dissolved in tetrahydrofuran, cooled to between -70°C and -60°C, and diisobutylaluminum hydride (1.0 M, 69.3 mL, 2.2 equiv) was added dropwise under nitrogen protection. Stirring was continued at this temperature for two hours. LCMS detection showed that compound 3 disappeared. The temperature was raised to 0°C, 20 mL of ethyl acetate was added, and the reaction was quenched with 100 mL of potassium sodium tartrate solution, and stirring was continued for half an hour. The mixture was washed with 100 mL of saturated brine, dried over anhydrous sodium sulfate, filtered and concentrated to give a light yellow oily compound 4 (9.75 g, 30.0 mmol, 95% yield). ¹ H NMR (400 MHz, CDCl ₃ ): δ7.40-7.27 (m, 5H), 4.59-4.45 (m, 2H), 4.19 (dd, J=6.2, 3.7 Hz, 1H), 4.01 (dd, J=11.3, 4.0 Hz, 1H), 3.78-3.60 (m, 3H), 1.78-1.68 (m, 1H), 1.29-1.21 (m, 3H), 0.95-0.87 (m, 9H), 0.12-0.02 (m, 6H). LC-MS: C ₁₈ H ₃₂ O ₃ Si, molecular weight 324.1, 325.2 (M+H).

(4) Compound 4 (9.75 g, 30.0 mmol, 1.0 equiv) was dissolved in tetrahydrofuran, cooled to 0°C, and p-toluenesulfonyl chloride (11.5 g, 60.1 mmol, 2.0 equiv) and methylimidazole (6.17 g, 75.1 mmol, 5.99 mL, 2.5 equiv) were added dropwise under nitrogen protection. After the addition was completed, the temperature was raised to room temperature and stirring was continued for 16 hours. LCMS detection showed that compound 4 disappeared. 20 mL of ethyl acetate was added to the reaction solution, and the reaction was quenched with 100 mL of potassium sodium tartrate solution under ice bath, and stirring was continued for half an hour. The mixture was washed with 100 mL of saturated brine, dried over anhydrous sodium sulfate, filtered and concentrated to obtain a crude product of light yellow oily compound 5 (13.7 g, 28.6 mmol, 95% yield). ¹ H NMR (400MHz, CDCl ₃ ): δ7.89-7.68(m,2H),7.42-7.17(m,10H),4.47-4.33(m,2H),4.23(dd,J=9.6,5.1Hz,1H),4.13-4.06(m,1H),4.01-3.94(m,1H),3 .52-3.34(m,2H),2.43(s,3H),2.02-1.89(m,1H),1.10(d,J＝6.3Hz,3H),0.81(s,8H),0.04--0.05(m,6H).LC-MS:C ₂₅ H ₃₈ O ₅ SSi, molecular weight 478.1, 479.2(M+H) .

(5) Under nitrogen protection, compound 5 (13.7 g, 28.6 mmol, 1.0 equiv) and 35 mL of acetonitrile were added to a dry reaction bottle, and the acetonitrile was evaporated at 35-40°C to remove the water in compound 5. Under nitrogen protection, 80 mL of N,N-dimethylformamide, compound 5-1 (9H-purin-6-amine) (4.25 g, 31.5 mmol, 1.1 equiv) and potassium carbonate (3.96 g, 28.6 mmol, 1.0 equiv) were added to another clean and dry reaction bottle, and the temperature was raised to 95-100°C and stirred for half an hour. At this temperature, a solution of compound 5 (13.7 g, 28.6 mmol, 1.0 equiv) in N,N-dimethylformamide (60 mL) was added dropwise to the reaction solution, and stirring was continued for 12 hours. LCMS detection showed that compound 5 disappeared. The reaction solution was cooled to room temperature, 200 mL of ethyl acetate was added, and the mixed solution was washed with 200 mL of sodium bicarbonate solution and 100 mL of saturated brine in sequence. The organic phase was dried over anhydrous sodium sulfate, filtered and the filtrate was concentrated. The crude product was separated and purified by silica gel column chromatography (petroleum ether/ethyl acetate = 20/1 to 10/1) to give compound 6 (6.2 g, 14.0 mmol, 49% yield) as a light yellow oil. ¹ H NMR (400MHz, CDCl ₃ ): δ8.37(s,1H),7.75(s,1H),7.39-7.24(m,6H),5.66(br,s,2H),4.47-4.34(m,3H),4.21(dd _, J＝14.1,8.8Hz,1H), _4.07 (dd,J＝6.2,4 ... ₎ _.

(6) Palladium carbon (3.0 g, 10% purity) was dissolved in 25 mL of methanol at room temperature, and 25 mL of compound 6 (5.2 g, 11.8 mmol, 1.0 equiv) methanol solution and trifluoroacetic acid (134.0 mg, 1.18 mmol, 87.2 uL) were added. The reaction solution was stirred under 50 psi hydrogen pressure for 48 hours. LCMS detection showed that compound 6 disappeared. The reaction solution was filtered and concentrated to obtain a crude product of light yellow oil compound 7 (3.9 g, 11.1 mmol). ¹ H NMR (400MHz, CDCl ₃ ): δ8.21(s,1H),8.12(s,1H),4.50-4.36(m,1H),4.33-4.22(m,1H),4.15-4.02(m,1H),3.53(d,J＝5.9Hz,2H),2.21-2.09(m,1H) ,1.25(d,J＝6.4Hz,3H),0.88(s,9H),0.05(d,J＝3.1Hz,6H).LC-MS:C ₁₆ H ₂₉ N ₅ O ₂ Si, molecular weight 351.1, 352.2(M+1).

(7) Compound 7 (3.9 g, 11.1 mmol, 1.0 equiv) was placed in a clean dry reaction bottle, 10 mL of pyridine was added under nitrogen protection, the temperature was raised to evaporate the pyridine, and this operation was repeated once to remove the water in compound 7. 28 mL of pyridine was added, trimethylsilyl chloride (4.8 g, 44.4 mmol, 5.63 mL, 4.0 equiv) was added under ice bath, the temperature was raised to room temperature, and stirring was continued for two hours. TLC detection showed that compound 7 disappeared. Benzoyl chloride (6.2 g, 44.4 mmol, 5.15 mL, 4.0 equiv) was added under ice bath, and stirring was continued for 2 hours. TLC detection showed that the raw material reaction disappeared. 60 mL of water and 90 mL of concentrated ammonia were added dropwise and stirring was continued for half an hour. The reaction solution was extracted with 250 mL of ethyl acetate, and the organic phase was washed with saturated brine, dried, filtered, and concentrated. The crude product was separated and purified by silica gel column chromatography (elution system: dichloromethane/methanol=50/1 to 10/1) to obtain a light yellow oily compound 8 (4.0 g, 8.78 mmol, 79% yield). ¹ H NMR (400 MHz, CDCl ₃ ): δ9.22-8.90 (m, 1H), 8.79 (s, 1H), 8.07-8.04 (m, 2H), 8.03 (d, J=1.4 Hz, 1H), 7.65-7.59 (m, 1H), 7.57-7.50 (m, 2H), 4.62-4.50 (m, 1H), 4.42 (dd, J=14.3, 8.6 Hz, 1H), 4.2 4-4.09(m,1H),4.05(d,J＝6.3Hz,1H),3.59-3.48(m,1H),3.47-3.35(m,1H),2.04-1.98(m,1H),1.31(d,J＝6.3Hz,3H),0.98-0.84(m,9H),0.11(d,J =10.1Hz,5H).LC-MS:C ₂₃ H ₃₃ N ₅ O ₃ Si, molecular weight 455.2,456.3(M+H).

(8) Compound 8 (4.0 g, 8.78 mmol, 1.0 equiv) was placed in a clean dry reaction bottle, 10 mL of pyridine was added under nitrogen protection, the pyridine was evaporated by heating, and this operation was repeated once to remove the water in compound 8. 28 mL of pyridine was added, and 4,4'-bismethoxytrityl chloride (3.27 g, 9.66 mmol, 1.1 equiv) was added under ice bath, the mixture was heated to room temperature and stirred for 1 hour. TLC detection showed that compound 8 disappeared. 150 mL of ethyl acetate was added to the reaction mixture, and the mixture was washed with 200 mL of sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered and the filtrate was concentrated. The crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether/ethyl acetate = 10/1 to 0/1) to obtain a light yellow oil compound 9 (5.91 g, 7.8 mmol, 88% yield). ¹ H NMR (400 MHz, CDCl ₃ ): δ9.07 (br s,1H),8.82(s,1H),8.04(d,J＝7.1Hz,2H),7.80(s,1H),7.65-7.58(m,1H),7.57-7.50(m,2H),7.28-7.13(m,9H),6.81-6.69(m,4H),4.52-4.43(m ,1H),4.25(dd,J＝14.2,8.6Hz,1H),4.07(dd,J＝6 .3,4.2Hz,1H),3.76(d,J＝4.5Hz,6H),3.22(dd,J＝9.8,5.4Hz,1H),3.04(dd,J＝9.8,6.1Hz,1H),2.34(dd,J＝8.1,4.5Hz,1H),1.19(d,J＝6.3Hz,3H),0.90-0. 77(m,9H),0.07--0.09(m,6H).LC-MS:C ₄₄ H ₅₁ N ₅ O ₅ Si, molecular weight 757.3, 758.4(M+H).

(9) Compound 9 (3.00 g, 3.96 mmol, 1.0 equiv) was dissolved in tetrahydrofuran, and pyridinium hydrofluoride (2.26 g, 79.2 mmol, 2.1 mL, 20.0 equiv) and imidazole (10.8 g, 158.0 mmol, 40.0 equiv) were added under nitrogen protection and ice bath. The temperature was raised to room temperature and stirring was continued for 2 hours. LCMS detection showed that compound 9 disappeared. 50 mL of ethyl acetate was added, and the mixture was washed with 100 mL of sodium bicarbonate solution and 50 mL of saturated brine, dried and filtered, and the filtrate was concentrated. The crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether/ethyl acetate = 10/1 to 0/1) to obtain a light yellow oil compound 10 (2.44 g, 3.79 mmol, 96% yield). ¹ H NMR (400 MHz, DMSO-d ₆ ): δ11.16 (br s,1H),8.70(s,1H),8.33(s,1H),8.05(d,J＝7.4Hz,2H),7.69-7.61(m,1H),7.60-7.52(m,2H),7.25-7.12(m,5H),7.05(t,J＝8.9Hz,4H),6.78(dd,J＝8 .9,3.1Hz,4H),4.79(d,J ＝4.0Hz,1H),4.51-4.28(m,2H),3.81(d,J＝4.0Hz,1H),3.70(s,6H),3.10(dd,J＝9.8,4.9Hz,1H),2.89(dd,J＝9.7,5.1Hz,1H),2.37-2.23(m,1H),1.03(d , J=6.3Hz, 3H). LC-MS: C ₃₈ H ₃₇ N ₅ O ₅ , molecular weight 643.2, 644.2 (M+H).

(10) Compound 10 (1.5 g, 2.33 mmol, 1.0 equiv) was placed in a clean dry reaction bottle, 4 mL of acetonitrile was added under nitrogen protection, the temperature was raised to 35-40 °C to evaporate the acetonitrile, and this operation was repeated once to remove the water in compound 10. 15 mL of anhydrous dichloromethane was added to the above reaction bottle at room temperature. Compound 11-1 (1.05 g, 3.5 mmol, 1.11 mL, 1.5 equiv) and 4,5-dicyanoimidazole (358 mg, 3.03 mmol, 1.3 equiv) were added, and stirring was continued at room temperature for one hour. TLC detection showed that compound 10 disappeared. 30 mL of dichloromethane was added, and the mixture was washed with sodium bicarbonate solution (50 mL x 2) and saturated brine (50 mL). The organic phase was dried, filtered and the filtrate was concentrated. The crude product was dissolved in 50 mL of methyl tert-butyl ether, and 100 mL of 1% sodium hydroxide aqueous solution was added and stirred for half an hour. The organic phase was collected after standing and stratified, washed with saturated brine, dried, filtered and concentrated, and the crude product was purified by C18 reverse phase column to obtain a light yellow product SA000001 (1.1 g, 1.3 mmol, 56% yield). ¹ H NMR (400 MHz, CD ₃ CN): δ9.33 (br s, 1H), 8.61 (br s, 1H), 7.99 (d, J = 11.0 Hz, 3H), 7.67-7.60 (m, 1H), 7.59-7.49 (m, 2H), 7.32-6.99 (m, 9H), 6.75 (td, J = 9.2, 6.5 Hz, 4H), 4.50-4.38 (m, 1H), 4.36-4.13 (m, 2H), 3.72 (dd, J = 4.8, 1.5H z,6H),3.66-3.45(m,3H),3.25(td,J＝9.6,5.4Hz,1H),3.01(ddd,J＝17.9,10.0,5.8Hz,1H),2.62(t,J＝5.9Hz,1H),2.53(t,J＝5.9Hz,1H),1.32-1.22(m,4 H), 1.17-1.05 (m, 12H). ³¹ P NMR (DMSO-d ₆ , 162MHz): δppm 147.7, 146.8. LCMS: C ₄₇ H ₅₄ N ₇ O ₆ P, molecular weight 843.3, 844.5 (M+H).

Example 8 Synthesis of conjugated molecule SIN

The synthesis route of SIN (i.e. compound I-1-1) is shown in the figure below:

(1) Preparation of intermediate 1-1

Compound 1-Cbz-4-hydroxymethylpiperidine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (40.1mmol, 10.0g) was placed in a clean dry reaction bottle, 100mL of pyridine was added, and 4,4'-bismethoxytrityl chloride (1.2equiv, 48.1mmol, 16.3g) was added at room temperature, and then stirred at room temperature for 1 hour. After the reaction, 150mL of ethyl acetate was added to the reaction solution, and washed with 150mL of saturated sodium bicarbonate solution and 150mL of saturated brine, the organic phase was dried, filtered and concentrated, and the crude product was separated and purified by silica gel column chromatography (petroleum ether/ethyl acetate = 20/1-4/1) to obtain a light yellow oil compound 1-1 (21.7g, 39.3mmol, 98% yield).

Compound 1-1, molecular formula: C ₃₅ H ₃₇ O ₅ N, molecular weight: 551.3, LC-MS measured: 552.4 (M+H). ¹ H NMR (400 MHz, DMSO-d6): δ7.31–7.22 (m, 9H), 7.17 (d, J=8.6 Hz, 5H), 6.82 (d, J=8.7 Hz, 4H), 4.99 (s, 2H), 3.93 (d, J=12.6 Hz, 2H), 3.66 (s, 6H), 2.78–2.61 (m, 4H), 2.44 (s, 1H), 1.62 (d, J=12.6 Hz, 2H), 0.97 (qd, J=12.7, 3.6 Hz, 2H).

(2)1.2 Preparation of intermediate 1-2

Compound 1-1 (39.3mmol, 21.7g) was placed in a clean dry reaction bottle, 150mL of methanol was added, palladium carbon (wet basis, 10% Pd/C) (10% wt, 2.2g) was added under hydrogen at room temperature, and then stirring was continued at room temperature for 12 hours. After the reaction, palladium carbon was removed by filtration, and the filtrate was concentrated to obtain a crude product of white solid compound 1-2 (16.1g, 38.5mmol, 98% yield), which was directly used in the next step without purification. Compound 1-2 molecular formula: C ₂₇ H ₃₁ O ₃ N, molecular weight: 417.2, LC-MS measured: 418.4 (M+H).

(3)1.3 Preparation of intermediate 1-3

The compound N-benzyloxycarbonyl-L-serine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (35.0 mmol, 8.4 g) was placed in a clean dry reaction bottle, 100 mL of dichloromethane was added, and benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.5 equiv, 52.5 mmol, 19.9 g), compound 1-2 (1.1 equiv, 38.5 mmol, 16.1 g) and N,N-diisopropylethylamine (3.0 equiv, 105.0 mmol, 13.5 g) were added at room temperature, followed by stirring at room temperature for 1 hour. After the reaction, 150 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered and concentrated. The crude product was separated and purified by silica gel column chromatography (petroleum ether/ethyl acetate = 10/1-2/3) to give white solid compound 1-3 (14.9 g, 23.5 mmol, 67% yield). Molecular formula of compound 1-3: C ₃₈ H ₄₂ O ₇ N ₂ , molecular weight: 638.3, LC-MS measured: 639.4 (M+H). ¹ H NMR (400MHz, DMSO-d6): δ7.42–7.26 (m, 9H), 7.23 (d, J＝8.7 Hz, 5H), 6.89 (d, J＝8.8 Hz, 4H), 5.03–4.96 (m, 2H), 4.79 (dt, J＝25.7, 5.4 Hz, 1H), 4.55–4.48 (m, 1H), 4.36 (d,J＝10.7Hz,1H),4.01(dt,J＝24.8,8.8Hz,1H),3.73(s,6H),3.56(ddd,J＝18.7,12.7,5.8Hz,1H),3.43–3.38(m,1H),3.00(t,J＝12.3Hz,1H),2.85–2.7 9(m,2H),2.69(s,1H),2.56(d,J＝10.2Hz,1H),1.88(d,J＝21.0Hz,1H),1.69(dd,J＝36.5,11.3Hz,2H),1.19–0.98(m,2H).

(4) Preparation of Intermediate 1-4

Compound 1-3 (23.5mmol, 14.9g) was placed in a clean dry reaction bottle, 100mL of methanol was added, palladium carbon (wet basis, 10% Pd/C) (10% wt, 1.5g) was added under hydrogen at room temperature, and then stirring was continued at room temperature for 12 hours. After the reaction, palladium carbon was removed by filtration, and the filtrate was concentrated to obtain a crude product, white solid compound 1-4 (11.6g, 23.0mmol, 98% yield), which was directly used for the next step without purification. Compound 1-4 molecular formula: C ₃₀ H ₃₆ O ₅ N ₂ , molecular weight: 504.2, LC-MS measured: 527.6 (M+Na). ¹ H NMR (400MHz, DMSO-d6): δ7.36(d,J＝7.5Hz,2H),7.31(t,J＝7.6Hz,2H),7.23(d,J＝8.8Hz,5H),6.89(d,J＝8.8Hz,4H),4.39(t,J＝12.2Hz,1H),3.97(d,J＝13.0Hz, 1H),3. 73(s,6H),3.69(t,J＝6.3Hz,1H),3.43–3.36(m,5H),3.01–2.92(m,2H),2.83(d,J＝6.1Hz,2H),1.84(dd,J＝11.6,8.1Hz,1H),1.72(d,J＝12.0Hz,2H),1. 17–0.91(m,2H).

(5) Preparation of Intermediate 1-5

Compound 5-(((2R,3R,4R,5R,6R)-3-acetylamino-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoic acid (commercially available, purchased from Noganlin Biopharmaceutical Technology (Suzhou) Co., Ltd.) (9.3 g, 20.9 mmol) was placed in a clean dry reaction bottle, 100 mL of dichloromethane was added, and benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.5 equiv, 31.3 mmol, 11.9 g) was added at room temperature and stirred for ten minutes. Subsequently, compound 1-4 (1.1 equiv, 23.0 mmol, 11.6 g) and N,N-diisopropylethylamine (3.0 equiv, 62.7 mmol, 8.1 g) were added to the reaction system, and then stirring was continued at room temperature for 1 hour. After the reaction, 150 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered and concentrated. The crude product was separated and purified by silica gel column chromatography (dichloromethane/methanol = 50/1-20/1) to obtain white solid compound 1-5 (15.4 g, 16.5 mmol, 79% yield). Compound 1-5 molecular formula: C ₄₉ H ₆₃ O ₁₃ N ₅ , molecular weight: 933.4, LC-MS measured: 932.5 (MH). ¹ H NMR (400MHz, DMSO-d6): δ7.93(dd,J＝24.8,8.3Hz,1H),7.80(dd,J＝8.8,5.3Hz,1H),7.36(d,J＝7.8Hz,2H),7.31(t,J＝7.6Hz,2H),7.23(d,J＝8.7Hz,5H),6.89(d, J＝8.8Hz,4H),5.21(d,J＝3.3Hz,1H),4.97(dd,J＝11.2,3.4Hz,1H),4.79(d,J＝4.7Hz,1H),4.47(dd,J＝8.0,3.6Hz,1H),4.37(d,J＝1 2.7Hz,1H),4.05–4.00(m,5H),3.87(dd,J＝20.2,10.3Hz,1H),3.73(s,6H),3.57–3.50(m,1H),3.14(qd,J＝7.3,4.3Hz,1H),2.99(t,J＝14.2Hz,1H),2.82 (d,J＝3.8Hz,2H),2.10(s,5H),1.99–1.98(m,6H),1.89(s,3H),1.76(d,J＝9.2Hz,4H),1.25(dd,J＝12.6,6.5Hz,5H),1.17(t,J＝7.1Hz,3H).

(6) Preparation of Compound I-1-1

Compound 1-5 (16.5 mmol, 15.4 g) was placed in a clean dry reaction bottle and 50 mL of anhydrous dichloromethane was added. Compound 2-cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (2.0 equiv, 33.0 mmol, 9.9 g) and 4,5-dicyanoimidazole (1.5 equiv, 24.7 mmol, 2.9 g) were added under argon protection at room temperature and stirred for one hour at room temperature. After the reaction, 50 mL of dichloromethane was added to the reaction solution and washed with 100 mL of saturated sodium bicarbonate solution. The organic phase was dried, filtered and concentrated. The crude product was purified by C18 reverse phase column (specification: 30 μm; Commercially available, purchased from Shanghai Boyun Biotechnology Co., Ltd.) (MeCN:H2O=75%:25%) to prepare white solid I-1-1 (11.6 g, 10.2 mmol, 62% yield). Compound I-1-1 molecular formula: C ₅₈ H ₈₀ O ₁₅ N ₆ P, molecular weight: 1133.5, LC-MS measured: 1132.4 (MH). ¹ H NMR (400MHz, DMSO-d6): δ8.22–8.04(m,1H),7.79(t,J＝8.2Hz,1H),7.35(d,J＝2.3Hz,2H),7.30(t,J＝7.6Hz,2H),7.22(d,J＝8.5Hz,5H),6.88(d,J＝8.7Hz,4H), 5.21(d,J＝3.3Hz,1H),4.93(ddd,J＝18.3,11.7,4.3Hz,2H),4.49–4.45(m,1H ),4.40–4.30(m,1H),3.99(p,J＝8.9Hz,4H),3.85(dt,J＝13.0,6.6Hz,2H),3.7 3 (s,6H),3.71(s,2H),3.68–3.62(m,2H),3.49(ddd,J＝15.7,13.6,6.6Hz,2H),3.42–3.36(m,1H),3.00(t,J＝14.4Hz,1H),2.82–2.79(m,2H),2.77–2.7 2(m,1H),2.69–2.64(m,1H),2.60–2.54(m,1H),2.10(s,5H),1.98(dd,J＝8.7,3.5Hz,3H),1.89(s,4H),1.77–1.63(m,5H),1.50–1.37(m,4H),1.19–1. 10(m,12H).31P NMR (162MHz, DMSO-d6): δ147.90,147.30.

Example 9 Testing the activity of the conjugate in mice

Select 6-8 week old SPF grade female C57BL/6J mice with a body weight of 20±2g. Weigh the mice and observe their condition before administration. Select animals with uniform body weight and normal condition and randomly divide them into groups, with 4 mice in each group. The mice in the experimental group were given the conjugate, and the mice in the vehicle group were given The mice were given phosphate buffered saline (PBS) and subcutaneously administered with a dose of 1 mg/kg of the conjugate per mouse. 7 and 21 days after administration, the animals were sacrificed by cervical dislocation, and liver tissues were obtained to detect the expression level of C5 mRNA in the same manner as in Example 5.

The results are expressed as the residual expression level of the siRNA administration group compared to the vehicle group (the vehicle group is 100%). The conjugate sequences used for injection are shown in Table 11. The conjugates are prepared according to the method of Example 4 using L-96 or the conjugate molecules prepared in Example 8 as starting materials, respectively. The synthesis methods of Ugo, Cgo, and Ago are shown in Example 7. After using the tested conjugates, the residual expression level of C5 mRNA in mouse liver is shown in Figure 3. As shown in Figure 3, compared with the positive compound SD003317, the conjugates SD004001 and SD004071 showed better inhibitory activity.

Table 11

Among them, the sequence of the positive chain of the naked sequence of SD004071 is AUAACUCACUAUAAUUACA (SEQ ID NO: 169), and the sequence of the antisense chain is UGUAAUUAUAGUGAGUUAUUU (SEQ ID NO: 170).

Example 10 Activity of the conjugate tested in rats

6-8 week old SD female SPF rats were selected, and the weight of the rats was 200 ± 2g. The rats were weighed and observed before administration, and animals with uniform weight and normal state were randomly divided into groups of 4, wherein the rats in the experimental group were given the conjugate, and the rats in the vehicle group were given phosphate buffered saline (PBS), and each rat was given a dose of 2.5 mg/kg of the conjugate for subcutaneous administration. 7 days and 21 days after administration, the animals were sacrificed by cervical dislocation, liver tissue was taken, and the expression level of the C5 gene was measured by the same method as in Example 6.

The results are expressed as the residual expression level of the siRNA administration group compared to the vehicle group (the vehicle group is 100%). The conjugate sequence for injection is shown in Table 12, and the conjugate is prepared according to the method of Example 4. After using the tested conjugate of the present invention, the residual expression level of C5 mRNA in rat liver is shown in Figure 4. As shown in Figure 4, compared with the positive compound SD003317, the conjugate SD003988 showed better inhibitory activity.

Table 12

Among them, the sequence of the positive chain of the naked sequence of SD003988 is CUAUGACAAUGGAUUUCUA (SEQ ID NO: 171), and the sequence of the antisense chain is UAGAAAUCCAUUGUCAUAGGU (SEQ ID NO: 172).

Example 11 Activity of the conjugate tested in rats

6-8 week old SD female SPF rats were selected, and the weight of the rats was 200 ± 2g. The rats were weighed and observed before administration, and animals with uniform weight and normal state were randomly divided into groups of 4, wherein the rats in the experimental group were given the conjugate, and the rats in the vehicle group were given phosphate buffered saline (PBS), and the conjugate was administered subcutaneously at a dose of 1 mg/kg per rat. 7 days and 21 days after administration, the animals were sacrificed by cervical dislocation, liver tissue was taken, and the expression level of the C5 gene was measured in the same manner as in Example 6.

The results are expressed as the residual expression level of the siRNA administration group compared to the vehicle group (the vehicle group is 100%). The conjugate sequence for injection is shown in Table 13, and the conjugate is prepared according to the method of Example 4. After using the tested conjugate of the present invention, the results of the residual expression level of C5 mRNA are shown in Figure 5. As shown in Figure 5, compared with the positive compound SD003317, the conjugate SD004072 showed better inhibitory activity.

Table 13

Example 12 In vivo activity test in cynomolgus monkeys

In this example, siRNA was selected for conjugation synthesis, and the in vivo activity of the siRNA conjugate was further evaluated in cynomolgus monkeys. Animals with uniform body weight and normal state were randomly divided into groups, 3 in each group, and the conjugates in Table 14 were given respectively, and the conjugates were prepared according to the method of Example 4. Subcutaneous administration was performed according to a dose of 5 mg/kg given to each monkey. Blood was collected and serum was collected on -13 days, -7 days, 0 days before administration, and 7 days, 14 days, 21 days, 28 days, 35 days and 44 days after administration. The C5 protein level in serum was detected by Elisa method. Compared with the average level of C5 in serum on -7 and 0 days before administration, the results of the remaining percentage are shown in Figure 6. The activity of SD004072 in cynomolgus monkeys is significantly better than that of SD004073.

Table 14

Example 13 Preparation of conjugated molecule SA102

(1) Preparation of intermediate 1-1

Compound (R)-(+)-N-benzyl-3-hydroxypyrrolidine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (16.9 mmol, 3.0 g) and imidazole (3.0 equiv, 50.7 mmol, 3.45 g) were placed in a clean dry reaction bottle, 50 mL of acetonitrile was added, tert-butyldimethylsilyl chloride (1.3 equiv, 21.9 mmol, 3.31 g) was slowly added at room temperature, and then stirred at room temperature for 12 hours. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine, the organic phase was dried, filtered and concentrated, and the crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether/ethyl acetate = 20/1-5/1) to obtain a colorless oil compound 1-1 (4.9 g, 16.8 mmol, 99% yield). Compound 1-1 molecular formula: C ₁₇ H ₂₉ ONSi, molecular weight: 291.2, LC-MS found 292.4 (M+H).

(2) Preparation of intermediate 1-2

Compound 1-1 (16.8 mmol, 4.9 g) was placed in a clean dry reaction bottle, 100 mL of methanol was added, palladium carbon (wet basis, 10% Pd/C) (10% wt, 490.0 mg) was added under hydrogen at room temperature, and then stirred at room temperature for 12 hours. After the reaction, palladium carbon was removed by filtration, and the filtrate was concentrated to obtain a crude product. The white solid compound 1-2 (3.31 g, 16.5 mmol, 98% yield) was directly used in the next step without purification. Compound 1-2 molecular formula: C ₁₀ H ₂₃ ONSi, molecular weight: 201.1, LC-MS found 202.3 (M+H).

(3) Preparation of intermediate 1-3

The compound N-benzyloxycarbonyl-L-serine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (15.0 mmol, 3.58 g) was placed in a clean dry reaction bottle, 100 mL of dichloromethane was added, and benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.5 equiv, 22.5 mmol, 8.53 g), compound 1-2 (1.1 equiv, 16.5 mmol, 3.31 g) and N,N-diisopropylethylamine (3.0 equiv, 45.0 mmol, 5.78 g) were added at room temperature, followed by stirring at room temperature for 1 hour. After the reaction, 150 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered and concentrated. The crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether/ethyl acetate = 10/1-1/3) to obtain white solid compound 1-3 (4.5 g, 10.65 mmol, 63% two-step yield). Compound 1-3 molecular formula: C ₂₁ H ₃₄ O ₅ N ₂ Si, molecular weight: 422.2, LC-MS found 423.3 (M+H). ¹ H NMR (400 MHz, CDCl ₃ ): δ7.35–7.29(m,5H),5.96(dd,J＝14.3,8.3Hz,1H),5.10(s,2H),4.61–4.40(m,2H),3.85–3.68(m,2H),3.65–3.49(m,2H),3.41(d,J＝12.7Hz,1H),3. 31(s,1H),1.95(qdd,J＝15.0,11.8,5.3Hz,2H),1.77(s,1H),0.86(s,9H),0.06(d,J＝3.1Hz,6H).

(4) Preparation of Intermediate 1-4

Compound 1-3 (10.65mmol, 4.5g) was placed in a clean dry reaction bottle, 100mL of pyridine was added, and 4,4'-bismethoxytrityl chloride (1.2equiv, 12.78mmol, 4.32g) was added at room temperature, and then stirred at room temperature for 12 hours. After the reaction, 150mL of ethyl acetate was added to the reaction solution, and it was washed with 150mL of saturated sodium bicarbonate solution and 150mL of saturated brine, the organic phase was dried, filtered and concentrated, and the crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether/ethyl acetate = 20/1-1/1) to obtain a light yellow oil compound 1-4 (7.56g, 10.43mmol, 98% yield). Compound 1-4 molecular formula: C ₄₂ H ₅₂ O ₇ N ₂ Si, molecular weight: 724.3, LC-MS found 747.4 (M+Na). ¹ H NMR (400MHz, CDCl ₃ ): δ7.35–7.31(m,1H),7.28(d,J＝4.7Hz,4H),7.27–7.23(m,2H),7.23–7.14(m,5H),7.13–7.11(m,2H),6.80–6.78(m,1H),6.76(dd,J＝7.7,5.4Hz,4H) ,5.72(dd,J＝22.7,8.3Hz,1H),5.08–4.99(m,2 H),4.69–4.59(m,1H),4.35–4.30(m,1H),3.73(dd,J＝4.5,3.7Hz,6H),3.65–3.44(m,2H),3.36–3.20(m,3H),1.86–1.81(m,1H),1.70(s,1H),0.80(d ,J＝13.1Hz,9H),-0.02(dd,J＝14.9,4.2Hz,6H).

(5) Preparation of Intermediate 1-5

Compound 1-4 (10.43 mmol, 7.56 g) was placed in a clean dry reaction bottle, 100 mL of methanol was added, palladium carbon (wet basis, 10% Pd/C) (10% wt, 750.0 mg) was added under hydrogen at room temperature, and then stirred at room temperature for 12 hours. After the reaction, palladium carbon was removed by filtration, and the filtrate was concentrated to obtain The crude product, white solid compound 1-5 (6.0 g, 10.22 mmol, 98% yield), was directly used in the next step without purification. Compound 1-5 molecular formula: C ₃₄ H ₄₆ O ₅ N ₂ Si, molecular weight: 590.3, LC-MS found 591.6 (M+H).

(6) Preparation of Intermediate 1-6

Compound 1-5 (10.22mmol, 6.0g) was placed in a clean dry reaction bottle, 100mL of dichloromethane was added, 4-dimethylaminopyridine (30mol%, 3.07mmol, 374.6mg) and N,N-diisopropylethylamine (3.0equiv, 30.66mmol, 3.96g) were added at room temperature, and then adipic anhydride (1.5equiv, 15.33mmol, 1.96g) was added to the reaction system, and stirring was continued at room temperature for 4 hours. After the reaction, the reaction solution was directly concentrated, and the crude product was separated and purified by silica gel column chromatography (gradient elution: dichloromethane/methanol = 50/1-8/1) to obtain white solid compound 1-6 (5.28g, 7.36mmol, 72% yield). Compound 1-6 molecular formula: C ₄₀ H ₅₄ O ₈ N ₂ Si, molecular weight: 718.3, LC-MS found 717.3 (MH).

(7) Preparation of Intermediate 1-8

Compound 1-6 (7.36 mmol, 5.28 g) was placed in a clean dry reaction bottle, 100 mL of dichloromethane was added, and benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.5 equiv, 11.04 mmol, 4.19 g), N,N-diisopropylethylamine (3.0 equiv, 22.08 mmol, 2.85 g) and compound 1-7 (commercially available, purchased from Tianjin WuXi AppTec New Drug Development Co., Ltd.) (1.1 equiv, 8.1 mmol, 4.31 g) were added at room temperature, and stirring was continued at room temperature for 1 hour. After the reaction, 150 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered and concentrated. The crude product was separated and purified by silica gel column chromatography (gradient elution: dichloromethane/methanol = 50/1-10/1) to obtain a light yellow solid compound 1-8 (6.75 g, 6.04 mmol, 82% yield). Compound 1-8 molecular formula: C ₅₈ H ₈₂ O ₁₆ N ₄ Si, molecular weight: 1118.5, LC-MS found 1117.3 (MH).

(8) Preparation of Intermediate 1-9

Compound 1-8 (6.04mmol, 6.75g) was placed in a clean dry reaction bottle, 50mL of tetrahydrofuran was added, and tetrabutylammonium fluoride (1.0M in THF) (2.0equiv, 12.08mmol, 12.08mL) was added at room temperature, and then stirred at room temperature for 2 hours. After the reaction, 100mL of ethyl acetate was added to the reaction solution, and it was washed with 100mL of saturated sodium bicarbonate solution and 100mL of saturated brine, the organic phase was dried, filtered and concentrated, and the crude product was separated and purified by silica gel column chromatography (gradient elution: dichloromethane/methanol = 50/1-8/1) to obtain a light yellow solid compound 1-9 (5.22g, 5.19mmol, 86% yield). Compound 1-9 molecular formula: C ₅₂ H ₆₈ O ₁₆ N ₄ , molecular weight: 1004.4, LC-MS found 1003.3 (MH).

(9) Preparation of compound SA102

Compound 1-9 (5.19 mmol, 5.22 g) was placed in a clean dry reaction bottle and 50 mL of anhydrous dichloromethane was added. Compound 2-cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (2.0 equiv, 10.38 mmol, 3.13 g) and 4,5-dicyanoimidazole (1.5 equiv, 7.79 mmol, 920.2 mg) were added under argon protection at room temperature and stirred for one hour at room temperature. After the reaction, 50 mL of dichloromethane was added to the reaction solution and washed with 100 mL of saturated sodium bicarbonate solution. The organic phase was dried, filtered and concentrated. The crude product was purified by C18 reverse phase column (specification: 30 μm; Commercially available, purchased from Shanghai Boyun Biotechnology Co., Ltd.) (MeCN:H ₂ O=75%:25%) to prepare white solid SA102 (4.44 g, 3.68 mmol, 71% yield). Compound SA102 molecular formula: C ₆₁ H ₈₅ O ₁₇ N ₆ P, molecular weight: 1204.5, LC-MS found 1227.3 (M+Na). ¹ H NMR (400 MHz, DMSO-d ₆ ): δ8.10(q,J＝8.3Hz,1H),7.80(d,J＝9.2Hz,1H),7.68(dd,J＝8.8,4.9Hz,1H),7.35–7.28(m,4H),7.20(ddd,J＝11.2,6.7,2.2Hz,5H),6.89–6.87(m,4H),5 .21(d,J＝3.3Hz,1H),4.96(dd,J＝11.2,3.4Hz,1H),4.85–4.74(m,1H),4.48(d,J＝8.5Hz,2H),4.04–3.99(m,3H),3.87(dd,J＝20.0,8.9Hz,1H),3.74(s,6 H), 3.72–3.67(m,2H),3.63–3.46(m,4H),3.44–3.38(m,2H),3.18(qd,J＝8.8,4.6Hz,2H),3.06–2.97(m,3H),2.74(ddd,J＝16.6,11.8,5.9Hz,1H),2.61( td,J＝5.8,1.8Hz,1H),2.10(s,5H),1.99(s,6H),1.89(s,3H),1.76(s,3H),1.46–1.33(m,8H),1.24–1.09(m,12H),1.06(d,J＝6.7Hz,1H),1.00(d,J =6.7Hz,1H). ³¹ P NMR (162MHz, DMSO-d ₆ ): δ147.07 (s), 146.74 (t, J = 32.0Hz).

Example 14 In vivo activity test in cynomolgus monkeys

In this example, siRNA was selected for conjugation synthesis, and the in vivo activity of the siRNA conjugate was further evaluated in cynomolgus monkeys. Animals with uniform body weight and normal state were randomly divided into groups, 3 in each group, and the conjugates in Table 15 were given respectively. The conjugates were prepared according to the method of Example 4 using SA102 of Example 13 as the starting material. Subcutaneous administration was performed according to a dose of 3 mg/kg given to each monkey. Blood was collected and serum was collected on days -7 before administration, 0 days, and 7 days, 14 days, 28 days, 42 days, and 56 days after administration. The C5 protein level in serum was detected by Elisa method. Compared with the average level of C5 in serum on days -7 and 0 before administration, the results of the remaining percentage are shown in Figure 7. The activity of SD004727 and SD004728 in cynomolgus monkeys is comparable.

Table 15

References:

1.Ricklin D, et al. Complement in clinical medicine: Clinical trials, case reports and therapy monitoring. Mol Immunol. 2017Sep; 89:10-21.

2.Zelek WM, et al. Compendium of current complement therapeutics. Mol Immunol. 2019 Oct; 114:341-352.

3.Mastellos DC, et al.Expanding Complement Therapeutics for the Treatment of Paroxysmal Nocturnal Hemoglobinuria.Seminars in Hematology.2018 Jul; 55(3):167-175.

4.Harris CL, et al. Developments in anti-complement therapy; from disease to clinical trial. Mol Immunol. 2018 Oct; 102:89-119.

5. Poppelaars F, et al. The Contribution of Complement to the Pathogenesis of IgA Nephropathy: Are Complement-Targeted Therapies Moving from Rare Disorders to More Common Diseases? J Clin Med.2021 Oct 14;10(20):4715.

6.Howard JF Jr.Myasthenia gravis: the role of complement at the neuromuscular junction.Ann N Y Acad Sci.2018 Jan; 1412(1):113-128.

7.Halawa OA,et al.A Review of Completed and Ongoing Complement Inhibitor Trials for Geographic Atrophy Secondary to Age-Related Macular Degeneration.J Clin Med.2021 Jun 11;10(12):2580.

8.Harris CL, et al. Developments in anti-complement therapy; from disease to clinical trial. Mol Immunol. 2018 Oct; 102:89-119.

9.Hillmen P,et al.Pegcetacoplan versus Eculizumab in Paroxysmal Nocturnal Hemoglobinuria.N Engl J Med.2021 Mar 18;384(11):1028-1037.

10.Kusner LL, et al.Investigational RNAi Therapeutic Targeting C5 Is Efficacious in Pre-clinical Models of Myasthenia Gravis.Mol Ther Methods Clin Dev.2019 May 10;13:484-492.

Badri P,et al.Pharmacokinetic and Pharmacodynamic Properties of Cemdisiran,an RNAi Therapeutic Targeting Complement Component 5,in Healthy Subjects and Patients with Paroxysmal Nocturnal Hemoglobinuria.Clin Pharmacokinet.2021 Mar;60(3):365-378.

The above detailed description of the present invention is intended to enable persons familiar with the art to understand the contents of the present invention and implement them, but it does not limit the protection scope of the present invention. Any equivalent changes or modifications made according to the spirit of the present invention should be included in the protection scope of the present invention.

Claims

A siRNA, comprising a sense strand and an antisense strand, characterized in that: each nucleotide in the siRNA is independently a modified or unmodified nucleotide, the sense strand comprises the following sequence or a nucleotide sequence with no more than 3 base mutations from the following sequence, and the antisense strand comprises the following sequence or a nucleotide sequence with no more than 5 base mutations from the following sequence,

The sequence of the sense chain is SEQ ID NO:8, and the sequence of the antisense chain is SEQ ID NO:84; or, the sequence of the sense chain is SEQ ID NO:2, and the sequence of the antisense chain is SEQ ID NO:78; or, the sequence of the sense chain is SEQ ID NO:55, and the sequence of the antisense chain is SEQ ID NO:131; or, the sequence of the sense chain is SEQ ID NO:1, and the sequence of the antisense chain is SEQ ID NO:77; or , the sequence of the sense chain is any one of SEQ ID NO:3 to 7, and the sequence of the antisense chain is any one of SEQ ID NO:79 to 83; or, the sequence of the sense chain is any one of SEQ ID NO:9 to 54, and the sequence of the antisense chain is any one of SEQ ID NO:85 to 130; or, the sequence of the sense chain is any one of SEQ ID NO:56 to 76, and the sequence of the antisense chain is any one of SEQ ID NO:132 to 152; or,

The sequence of the sense chain is such as SEQ ID NO:169, and the sequence of the antisense chain is such as SEQ ID NO:170; or, the sequence of the sense chain is such as SEQ ID NO:171, and the sequence of the antisense chain is such as SEQ ID NO:172.
The siRNA according to claim 1 is characterized in that: in the 5' to 3' direction, the base mutation of the sense strand is at the 3' end of its nucleotide sequence, and the base mutation of the antisense strand is at any one or more of the 5' end, the 2nd to 8th positions, and the last two positions of the 3' end of its nucleotide sequence.
The siRNA according to claim 1, characterized in that the modified nucleotide is a 2'-methoxy modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-O-CH 2 -CH 2 -O-CH 3 modified nucleotide, a 2'-O-CH 2 -CH＝CH 2 modified nucleotide, a 2'-CH 2 -CH 2 -CH＝CH 2 modified nucleotide, a 2'-deoxy nucleotide, a 2'-methoxyethyl modified nucleotide, a phosphorothioate bond modified nucleotide, a VP modified nucleotide, LNA, ENA, cET BNA, UNA, GNA or One or more combinations thereof, wherein R1 is H, OH or CH 3 , and Base is a natural nucleobase, a modified nucleobase, a universal base or an H atom.
The siRNA according to any one of claims 1 to 3, characterized in that one or more nucleotides in the sense strand or the antisense strand are modified nucleotides.
The siRNA according to any one of claims 1 to 3, characterized in that: from 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 9 and 11 of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; from 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 2, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides.
The siRNA according to any one of claims 1 to 3, characterized in that: from 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 8 and 9 of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; from 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides.
The siRNA according to any one of claims 1 to 3, characterized in that: in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at positions 7, 8 and 9 of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; in the 5' to 3' direction, the phosphate group at the 5' end of the antisense strand is replaced by VP, the 2'-fluoro-modified nucleotides are located at positions 2, 6, 14 and 16 of the antisense strand, and the remaining positions are 2'-methoxy-modified nucleotides; or,

From 5' to 3', the 2'-fluoro-modified nucleotides are located at positions 7, 8, and 9 of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; from 5' to 3', the 2'-fluoro-modified nucleotides are located at positions 2, 14, and 16 of the antisense strand, and the 6th position of the antisense strand is The remaining positions are 2'-methoxy modified nucleotides; or,

From 5' to 3', the 2'-fluoro-modified nucleotides are located at positions 7, 8, and 9 of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; from 5' to 3', the 2'-fluoro-modified nucleotides are located at positions 2, 6, 14, and 16 of the antisense strand, and the 7th position of the antisense strand is The remaining positions are 2'-methoxy modified nucleotides; or,

From 5' to 3', the 2'-fluoro modified nucleotides are located at positions 7, 8 and 9 of the sense strand, and the remaining positions are 2'-methoxy modified nucleotides; from 5' to 3', the phosphate group at the 5' end of the antisense strand is replaced by VP, the 2'-fluoro modified nucleotides are located at positions 2, 14 and 16 of the antisense strand, and the 6th position of the antisense strand is The remaining positions are 2'-methoxy modified nucleotides.
The siRNA according to any one of claims 5 to 7, characterized in that: at least one of the following connections between nucleotides in the siRNA is a phosphorothioate connection:

The connection between the first nucleotide and the second nucleotide at the 5' end of the sense strand;

The connection between the second nucleotide and the third nucleotide at the 5' end of the sense strand;

The connection between the first nucleotide and the second nucleotide at the 3' end of the sense strand;

The connection between the second nucleotide and the third nucleotide at the 3' end of the sense strand;

The connection between the first nucleotide and the second nucleotide at the 5' end of the antisense strand;

The connection between the second nucleotide and the third nucleotide at the 5' end of the antisense strand;

The connection between the first nucleotide and the second nucleotide at the 3' end of the antisense strand;

The connection between the second nucleotide and the third nucleotide at the 3' end of the antisense strand.
The siRNA according to claim 1, characterized in that: the siRNA is selected from the siRNA in Table 1 or Table 2.
A siRNA conjugate, characterized in that it comprises one or more of the siRNAs according to any one of claims 1 to 9, and one or more conjugated groups conjugated to any position of the siRNA.
The siRNA conjugate according to claim 10, characterized in that two, three or four consecutively connected conjugated groups are connected to any position of the siRNA.
The siRNA conjugate according to claim 10 or 11, characterized in that the conjugated group is connected to the 3' end and/or 5' end of the sense strand.
The siRNA conjugate according to claim 10 or 11, characterized in that: the siRNA conjugate has any one of the following structures:

in, indicates siRNA;

R represents a conjugated group, and R is any one or more of the following structures:

Indicates the attachment site for a phosphate group, a thiophosphate group, or H.
The siRNA conjugate according to claim 10, characterized in that: the siRNA conjugate is selected from the siRNA conjugates shown in Table 6, Table 9, Table 11, Table 12, Table 13, Table 14 or Table 15.
A pharmaceutical composition, characterized in that it comprises the siRNA according to any one of claims 1 to 9 or the siRNA conjugate according to any one of claims 10 to 14, and a pharmaceutically acceptable carrier or excipient.
The pharmaceutical composition according to claim 15, characterized in that the pharmaceutical composition is used to regulate the expression of complement C5.
Use of the siRNA according to any one of claims 1 to 9, or the siRNA conjugate according to any one of claims 10 to 14, or the pharmaceutical composition according to claim 15 or 16 for preparing a medicament for treating and/or preventing diseases related to the expression of complement C5.
The use according to claim 17 is characterized in that the diseases include paroxysmal nocturnal hemoglobinuria, atypical hemolytic uremic syndrome, age-related macular degeneration, myasthenia gravis, IgA nephritis, neuromyelitis optica and C3 glomerular disease.