WO2019105403A1

WO2019105403A1 - Nucleic acid, composition and conjugate containing the same, preparation method and use thereof

Info

Publication number: WO2019105403A1
Application number: PCT/CN2018/118106
Authority: WO
Inventors: 张鸿雁; 高山; 康代武; 陈庚容; 刘涛
Original assignee: 苏州瑞博生物技术有限公司
Priority date: 2017-12-01
Filing date: 2018-11-29
Publication date: 2019-06-06
Also published as: CN110945131A; TW201925473A

Abstract

Provided are an siRNA for inhibiting the expression of a hepatitis B virus gene, a pharmaceutical composition and a conjugate comprising the siRNA. Each of the nucleotides in the siRNA is independently a modified or unmodified nucleotide, and the siRNA contains a sense strand and an antisense strand. The sense strand contains a nucleotide sequence A which is equal in length to the nucleotide sequence shown in SEQ ID NO: 1,. with no more than 3 nucleotide differences, and the antisense strand contains a nucleotide sequence B which is equal in length to the nucleotide sequence shown in SEQ ID NO: 2, with no more than 3 nucleotide differences.

Description

Nucleic acid, composition and conjugate containing the same, preparation method and use thereof

Background technique

Hepatitis B (also known as hepatitis B or hepatitis B) is a type of infectious disease that poses a serious threat to the world, especially China. Currently, two major types of hepatitis B prevention drugs are recognized as interferons and nucleoside analogues. There are many disadvantages such as drug resistance or limited use, such as interferon, which may cause adverse reactions, drug resistance of nucleoside drugs, and recurrence after drug withdrawal. Therefore, if the gene expression of the virus can be silenced from the gene level, blocking the production and replication of HBV, thereby fundamentally reducing viral metabolism and infection of liver cells, it will undoubtedly be the most ideal treatment for hepatitis B. Small interfering RNA (siRNA) can inhibit or block any gene of interest (such as a gene that causes diseases such as cancer) in a sequence-specific manner based on the mechanism of RNA interference (RNAi). The expression to achieve the purpose of treating the disease.

siRNA stabilization modification and its delivery system are two key technologies in the development of small RNA drugs.

Summary of the invention

In some embodiments, the disclosure provides a siRNA capable of inhibiting expression of an HBV gene, the siRNA comprising a sense strand and an anti-sense strand, each of the nucleotides of the siRNA being independently a modified or unmodified nucleus Glycosyl acid, wherein the sense strand contains a nucleotide sequence I, the antisense strand contains a nucleotide sequence II, and the nucleotide sequence I and the nucleotide sequence II are at least partially inverted Complementarily forming a double-stranded region, wherein the nucleotide sequence I comprises a nucleotide sequence A which is equal in length to the nucleotide sequence shown in SEQ ID NO: 1, and no more than 3 Nucleotide difference, and the nucleotide sequence II contains a nucleotide sequence B which is equal in length to the nucleotide sequence shown in SEQ ID NO: 2 and no more than 3 Nucleotide differences:

5'-CGUGUGCACUUCGCUUCAZ-3' (SEQ ID NO: 1);

5'-Z'UGAAGCGAAGUGCACACG-3' (SEQ ID NO: 2),

Where Z is A and Z' is U;

Further, the nucleotide sequence A contains a nucleotide Z _A corresponding to a position Z, and the nucleotide sequence B contains a nucleotide Z' _B whose position corresponds to Z', which is Z' _B The first nucleotide of the 5' end of the antisense strand.

In some embodiments, the present disclosure provides a pharmaceutical composition comprising an siRNA of the present disclosure and a pharmaceutically acceptable carrier.

In some embodiments, the disclosure provides an siRNA conjugate comprising an siRNA provided by the disclosure and a conjugation group conjugated to the siRNA.

In some embodiments, the disclosure provides for the preparation of a siRNA and/or pharmaceutical composition and/or siRNA conjugate of the present disclosure for the treatment and/or prevention of a pathological condition or disease caused by an infection with hepatitis B virus. Use in medicine.

In some embodiments, the present disclosure provides a method of treating and/or preventing a pathological condition or disease caused by an infection with hepatitis B virus, the method comprising combining an effective amount of a siRNA and/or a pharmaceutical combination of the present disclosure The siRNA and/or siRNA conjugate is administered to a patient in need thereof.

In some embodiments, the present disclosure provides a kit comprising the siRNA and/or pharmaceutical composition and/or siRNA conjugate of the present disclosure.

DRAWINGS

Figure 1 shows the results of semi-quantitative detection of stability of the tested siRNA conjugates in vitro Tritosome.

Figure 2 shows the results of semi-quantitative detection of the stability of the tested siRNA conjugates in human plasma in vitro.

Figure 3 shows the results of semi-quantitative detection of the stability of the tested siRNA conjugates in monkey plasma in vitro.

Figure 4 shows the results of inhibitory activity of conjugate 20 in vitro.

Figure 5 shows the IC ₅₀ and a detection result of off-target effects of the conjugate in vitro psiCHECK 4 system.

Figure 6 shows the results of inhibition of HBV mRNA expression by conjugate 4 in mice.

Figure 7 shows the results of detection of inhibition of HBsAg expression by a single administration of conjugate 4 on the M-Tg model.

Figure 8 shows the results of detection of inhibition of HBx mRNA expression by a single administration of conjugate 4 on the M-Tg model.

Detailed ways

Specific embodiments of the present disclosure are described in detail below. It is to be understood that the specific embodiments described herein are not to be construed

definition

In the present disclosure, the HBV gene refers to a DNA sequence such as the gene shown in Genbank Accession No. NC_003977.1.

In the above and below, unless otherwise specified, the capital letters C, G, U, A, T represent the base composition of the nucleotide; the lowercase letter d indicates that the nucleotide adjacent to the right side of the letter d is deoxygenated. Ribonucleotide; the lowercase letter m indicates that one nucleotide adjacent to the left side of the letter m is a methoxy-modified nucleotide; the lowercase letter f indicates that one nucleotide adjacent to the left side of the letter f is fluorinated Modified nucleotide; lowercase s indicates that the two nucleotides adjacent to the letter s are phosphorothioate-linked; P1 indicates that one nucleotide adjacent to the right of P1 is 5'- A nucleotide modified with a phosphate nucleotide or a 5'-phosphate analog, especially a vinyl phosphate modified nucleotide (indicated by VP in the following examples), 5'-phosphate nucleotide (in the following examples) The nucleotide represented by P or 5'-phosphorothioate (indicated by Ps in the following examples).

In the above and below, the fluoro-modified nucleotide refers to a nucleotide formed by replacing a hydroxyl group at the 2'-position of a ribose group of a nucleotide with a fluorine, and the non-fluorinated modified nucleotide refers to a nucleotide. A nucleotide or nucleotide analog formed by substitution of a hydroxyl group at the 2' position of a ribose group with a non-fluoro group, which means that the nucleotide can be substituted in the nucleic acid, but the structure is different from the adenine ribonucleotide a group of guanine ribonucleotides, cytosine ribonucleotides, uridine ribonucleotides or thymine deoxyribonucleotides. Such as an isonucleotide, a bridged nucleic acid (BNA) or an acyclic nucleotide. The methoxy-modified nucleotide refers to a nucleotide formed by substituting a 2'-hydroxyl group of a ribose group with a methoxy group.

In the context of this document, the terms "complementary" or "reverse complementation" are used interchangeably and have the meanings well known to those skilled in the art that in a double stranded nucleic acid molecule, the base of one strand is linked to another strand. The bases on are paired in a complementary manner. In DNA, the purine base adenine (A) is always paired with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) is always with the pyrimidine base. Cytosine (G) is paired. Each base pair includes a purine and a pyrimidine. When adenine on one strand is always paired with thymine (or uracil) on another strand, and guanine is always paired with cytosine, the two strands are considered to be complementary to each other, and from their complementary strands The sequence of the strand can be inferred from the sequence. Accordingly, "mismatch" in the art means that in a double-stranded nucleic acid, the bases at corresponding positions are not paired in a complementary form.

In the above and below, unless otherwise specified, substantially reverse complementation means that there are no more than three base mismatches between the two nucleotide sequences involved; substantially reverse complementation means two There is no more than one base mismatch between the segment nucleotide sequences; complete complementation means that there is no base mismatch between the two nucleotide sequences.

In the above and below, the "nucleotide difference" between one nucleotide sequence and another nucleotide sequence means that the base type of the nucleotide at the same position is changed in the former compared with the latter. For example, in the case where one nucleotide base is A, when the corresponding nucleotide base at the same position in the former is U, C, G or T, it is recognized as two nucleotide sequences. There is a nucleotide difference between the positions. In some embodiments, when a nucleotide at the home position is replaced with an abasic nucleotide or an equivalent thereof, a nucleotide difference is also considered to occur at that position.

In the above and below, particularly in describing the preparation method of the conjugated molecule of the present disclosure or the preparation method of the siRNA conjugate, unless otherwise specified, the nucleoside monomer means, according to the preparation to be prepared The type and sequence of nucleotides in siRNA or siRNA conjugates, modified or unmodified nucleoside phosphoramidites used in solid phase synthesis of phosphoramidite (unmodified or modified RNA phosphoramidites, sometimes RNA phosphoramidites also known as Nucleoside phosphoramidites ). The phosphoramidite solid phase synthesis is a method used in RNA synthesis well known to those skilled in the art. The nucleoside monomers used in the present disclosure are commercially available.

As used herein, a short cross ("-") that is not between two letters or between two symbols is the position used to indicate the attachment point of the substituent. For example: -C ₁ -C ₁₀ alkyl-NH ₂ is attached via a C ₁ -C ₁₀ alkyl group.

As used herein, "optional" or "optionally" means that an event or condition described hereinafter may or may not occur, and that the description includes the occurrence of an event or condition and the situation in which it does not occur. For example, "optionally substituted alkyl" includes "alkyl" and "substituted alkyl" as defined below. Those skilled in the art will appreciate that for any group containing one or more substituents, these groups are not intended to introduce any substitution or substitution pattern that is spatially impractical, synthetically infeasible, and/or inherently unstable. .

As used herein, "alkyl" refers to straight and branched chains having the indicated number of carbon atoms, typically from 1 to 20 carbon atoms, such as from 1 to 10 carbon atoms, such as from 1 to 8 Or 1 to 6 carbon atoms. For example, a C ₁ -C ₆ alkyl group contains a straight chain and a branched alkyl group of 1 to 6 carbon atoms. When naming an alkyl residue having a specific number of carbons, it is intended to cover all branched and straight-chain forms having this amount of carbon; thus, for example, "butyl" means including n-butyl, sec-butyl Base, isobutyl and tert-butyl; "propyl" includes n-propyl and isopropyl. An alkylene group is a subset of an alkyl group and refers to a residue that is the same as the alkyl group but has two points of attachment.

As used herein, "alkenyl" refers to an unsaturated branched or straight-chain alkyl group having at least one carbon-carbon double bond, which is derived from adjacent carbon atoms of the parent alkyl group. Obtained by removing one hydrogen molecule. The group can be in the cis or trans configuration of the double bond. Typical alkenyl groups include, but are not limited to, ethenyl; propenyl, such as prop-1-en-1-yl, prop-1-en-2-yl, prop-2-en-1-yl (allyl Base), prop-2-en-2-yl; butenyl group, for example, but-1-en-1-yl, but-1-en-2-yl, 2-methylprop-1-ene-1- Base, but-2-en-1-yl, but-2-en-2-yl, butan-1,3-dien-1-yl, butan-1,3-dien-2-yl and the like. In certain embodiments, an alkenyl group has 2 to 20 carbon atoms, and in other embodiments, 2 to 10, 2 to 8, or 2 to 6 carbon atoms. An alkenylene group is a subset of an alkenyl group and refers to a residue that is the same as an alkenyl group but has two points of attachment.

As used herein, "alkynyl" refers to an unsaturated branched or straight-chain alkyl group having at least one carbon-carbon triple bond which is derived from adjacent carbon atoms of the parent alkyl group. Obtained by removing two hydrogen molecules. Typical alkynyl groups include, but are not limited to, ethynyl; propynyl, such as prop-1-yn-1-yl, prop-2-yn-1-yl; butynyl, such as but-1-yne- 1-yl, but-1-yn-3-yl, but-3-yn-1-yl and the like. In certain embodiments, an alkynyl group has 2 to 20 carbon atoms, and in other embodiments, 2 to 10, 2 to 8, or 2 to 6 carbon atoms. An alkynylene group is a subset of an alkynyl group and refers to a residue that is the same as an alkynyl group but has two points of attachment.

As used herein, "alkoxy" refers to an alkyl group of the indicated number of carbon atoms attached through an oxygen bridge, for example, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, Sec-butoxy, tert-butoxy, pentyloxy, 2-pentyloxy, isopentyloxy, neopentyloxy, hexyloxy, 2-hexyloxy, 3-hexyloxy, 3-methyl Pentyloxy and the like. The alkoxy group usually has 1 to 10, 1 to 8, 1 to 6, or 1 to 4 carbon atoms attached through an oxygen bridge.

As used herein, "aryl" refers to a radical derived from an aromatic monocyclic or polycyclic hydrocarbon ring system formed by the removal of a hydrogen atom from a ring carbon atom. The aromatic monocyclic or polycyclic hydrocarbon ring system contains only hydrogen and carbon of 6 to 18 carbon atoms, wherein at least one of the rings is completely unsaturated, ie it comprises a ring according to the Hückel theory. Delocalized (4n+2) π-electron system. The aryl group includes, but is not limited to, a group such as a phenyl group, a fluorenyl group, and a naphthyl group. An arylene group is a subset of an aryl group and refers to a residue that is the same as an aryl group but has two attachment points.

As used herein, "cycloalkyl" refers to a non-aromatic carbocyclic ring, typically having from 3 to 7 cyclic carbon atoms. The ring can be saturated or have one or more carbon-carbon double bonds. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl and cyclohexenyl, as well as bridged and caged ring groups such as norbornane.

As used herein, "halogen substituent" or "halo" refers to fluoro, chloro, bromo and iodo, and the term "halogen" includes fluoro, chloro, bromo and iodo.

As used herein, "haloalkyl" refers to an alkyl group as defined above, wherein a specified number of carbon atoms are replaced by one or more, up to a maximum allowable number of halogen atoms. Examples of haloalkyl groups include, but are not limited to, trifluoromethyl, difluoromethyl, 2-fluoroethyl, and pentafluoroethyl.

"Heterocyclyl" means a stable 3- to 18-membered non-aromatic cyclic group containing from 2 to 12 carbon atoms and from 1 to 6 heteroatoms selected from the group consisting of nitrogen, oxygen and sulfur. Unless otherwise stated in the specification, a heterocyclic group is a monocyclic, bicyclic, tricyclic or tetracyclic system and may include a fused ring or bridged ring system. The heteroatoms in the heterocyclic radical may optionally be oxidized. One or more nitrogen atoms, if present, are optionally quaternized. Heterocyclyl groups are partially saturated or fully saturated. A heterocyclic group can be attached to the remainder of the molecule through any atom of the ring. Examples of such heterocyclic groups include, but are not limited to, dioxoalkyl, thienyl [1,3]disulfonyl, decahydroisoquinolinyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, heterophilic Azolidinyl, morpholinyl, octahydroindenyl, octahydroisoindolyl, 2-oxapiperazinyl, 2-oxapiperidinyl, 2-oxapyrimidinyl, oxazolidinyl, piperidine Pyridyl, piperazinyl, 4-piperidinone, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuranyl, trisulfonyl, tetrahydropyranyl, thiomorpholinyl, Thiomorpholinyl, 1-oxathiomorpholinyl and 1,1-dioxathiomorpholinyl.

"Heteroaryl" refers to a radical derived from a 3- to 18-membered aromatic ring radical comprising from 2 to 17 carbon atoms and from 1 to 6 heteroatoms selected from the group consisting of nitrogen, oxygen and sulfur. As used herein, a heteroaryl group can be a monocyclic, bicyclic, tricyclic or tetracyclic ring system in which at least one ring in the ring system is completely unsaturated, ie, according to Hückel theory, comprising a circular delocalization (4n) +2) π-electron system. Heteroaryl groups include fused ring or bridged ring systems. The heteroatoms in the heteroaryl are optionally oxidized. One or more nitrogen atoms, if present, are optionally quaternized. A heteroaryl group is attached to the remainder of the molecule through any atom in the ring. Examples of heteroaryl groups include, but are not limited to, azepandinyl, acridinyl, benzimidazolyl, benzindenyl, 1,3-benzobisoxazolyl, benzofuranyl, benzene And oxazolyl, benzo[d]thiazolyl, benzothiadiazolyl, benzo[b][1,4]bisoxazolyl, benzo[b][1,4]oxazolyl, 1 , 4-benzobisoxazolyl, benzonaphthofuranyl, benzodiazolyl, benzodioxanyl, benzopyranyl, benzopyranone, benzofuranyl, benzene And furanone, benzothienyl, benzothiophene [3,2-d]pyrimidinyl, benzotriazolyl, benzo[4,6]imidazo[1,2-a]pyridyl, carbazolyl , porphyrinyl, cyclopentyl[d]pyrimidinyl, 6,7-dihydro-5H-cyclopentyl[4,5]thiophene[2,3-d]pyrimidinyl, 5,6-dihydrobenzo [h]quinazolinyl, 5,6-dihydrobenzo[h]octanoline, 6,7-dihydro-5H-benzo[6,7]cyclohepta[1,2-c]indole Azinyl, dibenzofuranyl, dibenzothiophenyl, furyl, furanone, furan [3,2-c]pyridyl, 5,6,7,8,9,10-hexahydrocycloheptane [d]pyrimidinyl, 5,6,7,8,9,10-hexahydrooctanoic acid [d]pyridazinyl, 5,6, 7,8,9,10-Hexahydrooctanoic acid [d]pyridyl, isothiazolyl, oxazolyl, imidazolyl, fluorenyl, isodecyl, indanyl, iso-dihydroindolyl , isoquinolyl, pyridazinyl, isoxazolyl, 5,8-methyl-5,6,7,8-tetrahydroquinazolinyl, naphthyridinyl, 1,6-naphthyridinone Base, oxadiazolyl, 2-oxazepinyl, oxazolyl, oxaloyl, 5,6,6a,7,8,9,10,10a-octahydrobenzo[H]quinazolinyl , 1-phenyl-1H-pyrrolyl, phenazinyl, phenothiazine, phenoxazinyl, phthaloyl, pteridinyl, fluorenyl, pyrrolyl, pyrazolyl, pyrazolo[3 , 4-d]pyrimidinyl, pyridyl, pyrido[3,2-d]pyrimidinyl, pyrido[3,4-d]pyrimidinyl, pyrazinyl, pyrimidinyl, pyridazinyl, pyrrolyl, quin Oxazolinyl, quinoxalinyl, quinolyl, isoquinolinyl, tetrahydroquinolyl, 5,6,7,8-tetrahydroquinazolinyl, 5,6,7,8-tetrahydrobenzene And [4,5]thiophene [2,3-d]pyrimidinyl, 6,7,8,9tetrahydro-5H-cycloheptane [4,5]thiophene [2,3-d]pyrimidinyl, 5, 6,7,8-tetrahydropyrido[4,5-c]pyridazinyl, thiazolyl, thiadiazolyl , triazolyl, tetrazolyl, triazinyl, thiophene [2,3-d]pyrimidinyl, thiophene [3,2-d]pyrimidinyl, thiophene [2,3-c]pyranyl and thienyl.

Various hydroxy protecting groups can be used in the present disclosure. Generally, the protecting group renders the chemical functionality insensitive to the particular reaction conditions and can be added and removed in the functionality in the molecule without substantially damaging the remainder of the molecule. Representative hydroxy protecting groups are disclosed in Beaucage et al, Tetrahedron 1992, 48, 2223-2311, and Greeneand Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2d ed, John Wiley & Sons, New York, 1991, cited The above documents are incorporated herein in their entirety. In some embodiments, the protecting group is stable under basic conditions, but can be removed under acidic conditions. In some embodiments, non-exclusive examples of hydroxy protecting groups that may be used herein include dimethoxytrityl (DMT), monomethoxytrityl, 9-phenylxanthene-9-yl ( Pixyl) and 9-(p-methoxyphenyl)xanthene-9-yl (Mox). In some embodiments, non-exclusive examples of hydroxy protecting groups that may be used herein include Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4'-dimethoxy). Trityl) and TMTr (4,4',4"-trimethoxytrityl).

The term "subject", as used herein, refers to any animal, such as a mammal or marsupial. Subject matter of the present disclosure includes, but is not limited to, humans, non-human primates (eg, rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cows, sheep, rats, and poultry of any kind.

As used herein, "therapeutic methods," "treatment," "alleviation," or "improvement" are used interchangeably herein. These terms refer to methods of obtaining beneficial or desired results, including but not limited to therapeutic benefits. "Therapeutic benefit" means eradication or improvement of a potential disorder to be treated. In addition, the therapeutic benefit is obtained by eradicating or ameliorating one or more physiological symptoms associated with the underlying disorder, thereby observing an improvement in the patient, although the patient may still be afflicted with a potential disorder.

As used herein, "prevention" and "prevention" are used interchangeably. These terms refer to methods of obtaining beneficial or desired results including, but not limited to, prophylactic benefits. To achieve a "prophylactic benefit", the conjugate or composition can be administered to a patient at risk for a particular disease, or to a patient who reports one or more pathological symptoms of the disease, even though the diagnosis of the disease may not have been made.

siRNA

The present disclosure provides an siRNA capable of inhibiting the expression of a hepatitis B virus gene.

The siRNA of the present disclosure contains a nucleotide group as a basic structural unit, which is well known to those skilled in the art, and the nucleotide group contains a phosphate group, a ribose group, and a base, and will not be described herein.

CN102140458B discloses an siRNA that specifically inhibits the HBV gene, and various chemical modification strategies of the siRNA have been studied. The study found that different modification strategies have a very different impact on siRNA stability, biological activity and cytotoxicity. In this study, seven effective modifications were demonstrated. Compared to unmodified siRNA, one of the modified siRNAs improved blood stability while remaining substantially equivalent to unmodified siRNA. Inhibitory activity.

The siRNA of the present disclosure contains a sense strand and an antisense strand, each of the nucleotides of the siRNA being independently a modified or unmodified nucleotide, wherein the sense strand contains a nucleotide sequence I, The antisense strand comprises a nucleotide sequence II, and the nucleotide sequence I and the nucleotide sequence II are at least partially reversely complementary to form a double-stranded region, wherein the nucleotide sequence I contains a nucleoside Acid sequence A, the nucleotide sequence A is equal in length to the nucleotide sequence shown in SEQ ID NO: 1, and is not more than 3 nucleotide differences, and the nucleotide sequence II contains nucleotides Sequence B, the nucleotide sequence B is equal in length to the nucleotide sequence shown in SEQ ID NO: 2, and no more than 3 nucleotide differences:

5'-UCCGUGUGCACUUCGCUUCAZ-3' (SEQ ID NO: 1);

5'-Z'UGAAGCGAAGUGCACACG-3' (SEQ ID NO: 2),

Where Z is A and Z' is U;

In the above and hereinafter, "positional correspondence" means the same position in the nucleotide sequence from the same end of the nucleotide sequence. For example, the first nucleotide at the 3' end of nucleotide sequence A is a nucleotide that corresponds to the 1st nucleotide of the 3' end of SEQ ID NO: 1.

In some embodiments, the sense strand comprises only nucleotide sequence I, and the antisense strand comprises only nucleotide sequence II.

In some embodiments, the nucleotide sequence A differs from the nucleotide sequence set forth in SEQ ID NO: 1 by no more than 1 nucleotide difference, and/or the nucleotide sequence B and SEQ There is no more than one nucleotide difference between the nucleotide sequences shown by ID NO:2.

In some embodiments, the nucleotide difference between the nucleotide sequence B and the nucleotide sequence set forth in SEQ ID NO: 2 comprises a difference at the Z' _B position, and Z' _{B is} selected from A, C or G. In some embodiments, the nucleotide difference is a difference at the Z' _B position, Z' _{B is} selected from A, C or G, and ZA is a nucleotide complementary to Z' _B. These nucleotide differences do not significantly reduce the target gene inhibition ability of the siRNA conjugate, and these siRNA conjugates containing nucleotide differences are also within the scope of the present disclosure.

In some embodiments, the nucleotide sequence A and the nucleotide sequence B are substantially reverse complementary, substantially reverse complementary or fully reverse complementary; the substantially reverse complement refers to two cores There are no more than 3 base mismatches between the nucleotide sequences; the substantially reverse complement means that there are no more than one base mismatch between the two nucleotide sequences; complete reverse complementation It means that there is no mismatch between the two nucleotide sequences.

In some embodiments, nucleotide sequence A is the nucleotide sequence set forth in SEQ ID NO: 3, and nucleotide sequence B is the nucleotide sequence set forth in SEQ ID NO:4:

5'-CGUGUGCACUUCGCUUCAZ _A -3' (SEQ ID NO: 3);

5'-Z' _B UGAAGCGAAGUGCACACG-3' (SEQ ID NO: 4),

Wherein Z' _B is the first nucleotide at the 5' end of the antisense strand, Z _{A is} selected from A, U, G or C, and Z' _B is a nucleotide complementary to Z _A ; In an embodiment, Z _A is A, and Z′ _B is U;

And, the sense strand and the antisense strand are the same or different in length, the sense strand is 19-23 nucleotides in length, and the antisense strand is 20-26 nucleotides in length. Thus, the length ratio of the sense strand and the antisense strand of the siRNA provided by the present disclosure may be 19/20, 19/21, 19/22, 19/23, 19/24, 19/25, 19/26, 20/20, 20/21, 20/22, 20/23, 20/24, 20/25, 20/26, 21/20, 21/21, 21/22, 21/23, 21/24, 21/25, 21/ 26, 22/20, 22/21, 22/22, 22/23, 22/24, 22/25, 22/26, 23/20, 23/21, 23/22, 23/23, 23/24, 23/25 or 23/26. In some embodiments, the length ratio of the sense strand and the antisense strand of the siRNA is 19/21, 21/23 or 23/25.

In some embodiments, the sense strand and the antisense strand are of the same length, the nucleotide sequence I further comprises a nucleotide sequence III, and the nucleotide sequence II further comprises a nucleotide sequence IV, a nucleotide The sequence III and nucleotide sequence IV lengths are each independently 1-4 nucleotides; the nucleotide sequence III is ligated at the 5' end of nucleotide sequence A, which is ligated to the nucleus The 3' end of the nucleotide sequence B, the nucleotide sequence III and the nucleotide sequence IV are equal in length.

The nucleotide sequence III and the nucleotide sequence IV may or may not be complementary. To increase the stability of the siRNA, in some embodiments, the nucleotide sequence III and the nucleotide sequence IV are at least partially complementary; in some implementations In the scheme, nucleotide sequence III and nucleotide sequence IV are more than 80% base complementary, or more than 90% base complementary; in some embodiments, nucleotide sequence III and nucleotide sequence IV are substantially Reverse complementary or fully reverse complementary; said substantially reverse complement refers to the presence of no more than one base mismatch between two nucleotide sequences; complete reverse complementation refers to two nucleotide sequences There is no mismatch between them; in some embodiments, nucleotide sequence III and nucleotide sequence IV are completely reverse complementary. Thus, the siRNA sense strand and the antisense strand are of equal length and have a length ratio of 20/20, 21/21, 22/22 or 23/23. In some embodiments, the length ratio of the sense strand and the antisense strand of the siRNA is 21/21 or 23/23.

In some embodiments, the nucleotide sequence III and the nucleotide sequence IV are each 1 nucleotide in length, the nucleotide sequence III has a base C, and the nucleotide sequence IV has a base G. At this time, the length ratio of the sense strand and the antisense strand is 20/20; or, the nucleotide sequences III and IV are both 2 nucleotides in length, and the nucleoside is in the direction from the 5' end to the 3' end. The base composition of the acid sequence III is AC, and the base composition of the nucleotide sequence IV is GU; at this time, the length ratio of the sense strand to the antisense strand is 21/21; or the length of the nucleotide sequences III and IV All are 3 nucleotides. According to the direction from the 5' end to the 3' end, the nucleotide composition of nucleotide sequence III is GAC, and the base composition of nucleotide sequence IV is GUC; at this time, the sense strand and the opposite The length ratio of the sense strand is 22/22; alternatively, the lengths of the nucleotide sequences III and IV are 4 nucleotides, and the base composition of the nucleotide sequence III is in the direction from the 5' end to the 3' end. GGAC, the nucleotide composition of nucleotide sequence IV is GUCC; at this time, the length ratio of the sense strand to the antisense strand is 23/23. In some embodiments, the nucleotide sequence III and the nucleotide sequence IV are 2 nucleotides in length, and the nucleotide sequence III has a base composition of AC according to the 5' end to the 3' end. The nucleotide composition of nucleotide sequence IV is GU; at this time, the length ratio of the sense strand to the antisense strand is 21/21.

In some embodiments, nucleotide sequence III and nucleotide sequence IV are the same length and are completely reverse-complementary, thus giving the nucleotide sequence III base, and the nucleotide sequence IV base is also It is determined.

In some embodiments, the sense strand and the antisense strand are of different lengths, the nucleotide sequence II further comprises a nucleotide sequence V, and the nucleotide sequence V is 1 to 3 nucleotides in length, linked The 3' end of the antisense strand constitutes the 3' overhanging end of the antisense strand. Thus, the length ratio of the sense strand and the antisense strand of the siRNA provided by the present disclosure may be 19/20, 19/21, 19/22, 20/21, 20/22, 20/23, 21/22, 21/23. , 21/24, 22/23, 22/24, 22/25, 23/24, 23/25 or 23/26. In some embodiments, the nucleotide sequence V is 2 nucleotides in length, whereby the length ratio of the siRNA sense strand and the antisense strand provided by the present disclosure may be 19/21, 21/23 or 23 /25.

Each of the nucleotide sequences V may be any nucleotide, and the nucleotide sequence V is two consecutive thymidine deoxyribonucleotides for ease of synthesis and to save on synthesis cost ( TT) or two consecutive uracil ribonucleotides (UU); in order to increase the affinity of the siRNA antisense strand to the target mRNA, the nucleotide sequence V is complementary to the nucleotide at the corresponding position of the target mRNA. Thus, in some embodiments, the ratio of the sense strand and the antisense strand of the siRNA of the present disclosure is 19/21 or 21/23, in which case the siRNA of the present disclosure has better mRNA silencing activity.

In some embodiments, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 3, the anti-sense strand of the siRNA comprising the nucleotide sequence set forth in SEQ ID NO: 4:

5'-CGUGUGCACUUCGCUUCAZ _A -3' (SEQ ID NO: 3);

5'-Z' _B UGAAGCGAAGUGCACACG-3' (SEQ ID NO: 4);

Wherein Z' _B is the first nucleotide at the 5' end of the antisense strand, Z _{A is} selected from A, U, G or C, and Z' _B is a nucleotide complementary to Z _A .

According to some specific embodiments of the present disclosure, the siRNA of the present disclosure is siHBV1siHBV1

Justice chain: 5'-CGUGUGCACUUCGCUUCAZ-3' (SEQ ID NO: 1),

Antisense strand: 5'-Z'UGAAGCGAAGUGCACACGGU-3' (SEQ ID NO: 5),

Where Z is A and Z' is U.

As previously mentioned, the nucleotides in the siRNAs of the present disclosure are each independently a modified or unmodified nucleotide. In some embodiments, the nucleotide in the siRNA of the present disclosure is an unmodified nucleotide; in some embodiments, some or all of the nucleotides in the siRNA of the present disclosure are modified nucleotides, a nucleus These modifications on the glucoside group do not result in a significant impairment or loss of the ability of the siRNA conjugates of the present disclosure to inhibit hepatitis B virus gene expression.

In some embodiments, the siRNA of the present disclosure contains at least one modified nucleotide. In the context of the present disclosure, the term "modified nucleotide" as used herein refers to a nucleotide or nucleotide analog formed by the substitution of a hydroxyl group at the 2'-position of a ribose group of a nucleotide with another group, or a nucleoside. The base on the acid is the nucleotide of the modified base. The modified nucleotide does not result in a significant attenuation or loss of the function of the siRNA to inhibit gene expression. For example, modified nucleotides disclosed in J. K. Watts, G. F. Deleavey, and M. J. Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008, 13 (19-20): 842-55 can be selected.

In some embodiments, the sense strand of the siRNA provided by the disclosure or at least one nucleotide of the antisense strand is a modified nucleotide, and/or at least one phosphate group is a phosphate having a modifying group In other words, at least a portion of the phosphate group and/or ribose group in the sense strand and at least one single-stranded phosphate-sugar backbone of the sense strand is a phosphate group having a modifying group and/or Or a ribosyl group having a modifying group.

In some embodiments, all of the nucleotides in the sense strand and/or the antisense strand are modified nucleotides. In some embodiments, each of the sense strands of the siRNA provided by the disclosure and the antisense strand are independently fluoro-modified nucleotides or non-fluoro-modified nucleotides.

The inventors of the present disclosure have surprisingly found that the siRNAs described in the present disclosure achieve a high balance of plasma stability and gene silencing efficiency in animal experiments.

In some embodiments, the fluoro-modified nucleotide is located in nucleotide sequence A and nucleotide sequence B, and, in the direction from the 5' end to the 3' end, the nucleotide sequence A The nucleotides at positions 7, 8, and 9 are fluoro-modified nucleotides; the nucleus at positions 2, 6, 14, and 16 of the nucleotide sequence B in the direction from the 5' end to the 3' end Glycosylates are fluoro-modified nucleotides.

In some embodiments, the fluoro-modified nucleotide is located in nucleotide sequence A and nucleotide sequence B, wherein the nucleotide sequence A has no more than five fluoro-modified nucleotides, And, in the direction from the 5' end to the 3' end, the nucleotides at positions 7, 8, and 9 of the nucleotide sequence A are fluoro-modified nucleotides; the nucleotide sequence B is fluorine The number of modified nucleotides is not more than 7, and the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence B are fluoro-modified nucleotides.

In some embodiments, the nucleotides at positions 7, 8, 9 or 5, 7, 8, and 9 of the nucleotide sequence A are in the sense strand in the direction from the 5' end to the 3' end. The nucleotide is a fluoro-modified nucleotide, and the nucleotides at the rest of the sense strand are non-fluoro-modified nucleotides; in the antisense strand in the direction from the 5' end to the 3' end The nucleotide at

position

2, 6, 14, 16 or 2, 6, 8, 9, 14, 16 of the nucleotide sequence B is a fluoro-modified nucleotide in the antisense strand The nucleotides at the remaining positions are non-fluoro modified nucleotides.

In the context of the present disclosure, "fluoro-modified nucleotide" refers to a nucleotide formed by substituting a hydroxyl group at the 2'-position of a ribose group of a nucleotide with fluorine, which has a structure represented by the following formula (101). "Non-fluorinated modified nucleotide" refers to a nucleotide or nucleotide analog formed by the substitution of a hydroxyl group at the 2' position of the ribose group of a nucleotide with a non-fluoro group. In some embodiments, each non-fluoro modified nucleotide is independently selected from a nucleotide or nucleotide analog formed by the substitution of a hydroxyl group at the 2' position of the ribose group of a nucleotide with a non-fluoro group. One.

Nucleotides formed by substitution of a hydroxyl group at the 2' position of the ribose group with a non-fluoro group are well known to those skilled in the art, and these nucleotides may be selected from 2'-alkoxy-modified nucleotides, 2'- Substituted alkoxy-modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'- One of a substituted amino-modified nucleotide, 2'-deoxynucleotide.

In some embodiments, the 2'-alkoxy-modified nucleotide is a methoxy-modified nucleotide (2'-OMe) as shown in formula (102). The 2'-substituted alkoxy-modified nucleotide may, for example, be a 2'-O-methoxyethyl modified nucleotide (2'-MOE) as shown in formula (103). The 2'-amino modified nucleotide (2'-NH ₂ ) is represented by the formula (104). The 2'-deoxynucleotide (DNA) is represented by the formula (105).

A nucleotide analog refers to the ability to replace a nucleotide in a nucleic acid, but differs in structure from adenine ribonucleotides, guanine ribonucleotides, cytosine ribonucleotides, uridine ribonucleotides or thymine deoxygenation. A group of ribonucleotides. In some embodiments, the nucleotide analog can be, for example, an isonucleotide, a bridged nucleic acid (BNA) or an acyclic nucleotide.

BNA refers to a restricted or inaccessible nucleotide. The BNA may contain a five-membered ring, a six-membered ring, or a seven-membered ring with a bridge structure of "fixed" C3'-endo-glycans. The bridge is typically incorporated into the 2'-, 4'-position of the ribose to provide a 2',4'-BNA nucleotide, such as LNA, ENA, cET BNA, etc., wherein the LNA is as in formula (106). As shown, the ENA is as shown in the formula (107), and the cET BNA is as shown in the formula (108).

An acyclic nucleotide is a type of nucleotide formed by the opening of a sugar ring of a nucleotide, such as an unlocked nucleic acid (UNA) or a glycerol nucleic acid (GNA), wherein UNA is as shown in formula (109), and GNA is as in the formula ( 110) shown.

In the above formula (109) and formula (110), R is selected from H, OH or alkoxy group (O-alkyl group).

An isonucleotide refers to a compound formed by a change in the position of a base in a nucleotide on a ribose ring, for example, a base is moved from a 1'-position to a 2'-position or a 3'-position of a ribose ring. The compound is represented by the formula (111) or (112).

In the compound represented by the above formula (111)-formula (112), Base represents a base such as A, U, G, C or T; and R is selected from H, OH, F or a non-fluorine group as described above.

In some embodiments, the nucleotide analog is selected from the group consisting of an isonucleotide, LNA, ENA, cET, UNA, and GNA. In some embodiments, each non-fluoro-modified nucleotide is a methoxy-modified nucleotide, and above and below, the methoxy-modified nucleotide refers to the 2' of the ribose group. a nucleotide formed by substituting a hydroxyl group with a methoxy group.

Above and below, "fluoro-modified nucleotide", "2'-fluoro-modified nucleotide", "nucleotide of 2'-hydroxyl group of ribose group substituted by fluorine" and "2" -Fluororibosyl" has the same meaning, and both refer to a compound in which the 2'-hydroxyl group of the nucleotide is substituted by fluorine, and has a structure represented by the formula (207); "methoxy-modified nucleotide", " 2'-methoxy modified nucleotide", "nucleotide substituted with 2'-hydroxyl group of ribose group by methoxy group" and "2'-methoxyribosyl group" have the same meaning, and both refer to nucleoside A compound having a structure represented by the formula (208) formed by substituting a 2'-hydroxy group of an acid ribose group with a methoxy group.

In some embodiments, the siRNA of the present disclosure is an siRNA having a modification in the direction of the 5' end to the 3' end, in the sense strand, positions 7, 8, and 9 of the nucleotide sequence A. Or the nucleotides at positions 5, 7, 8, and 9 are fluoro-modified nucleotides, and the nucleotides at the remaining positions in the sense strand are methoxy-modified nucleotides; Wherein the nucleotides at

positions

2, 6, 14, 16 or 2, 6, 8, 9, 14, 16 of the nucleotide sequence B are fluoro-modified nucleotides, the antisense The nucleotides remaining in the chain are methoxy modified nucleotides.

In some embodiments, the siRNA of the present disclosure is an siRNA having a modification of the 5th, 7th, 8th, and 9th positions of the nucleotide sequence A in the sense strand of the siRNA in the direction from the 5' end to the 3' end. The nucleotide is a fluoro-modified nucleotide, the nucleotide at the remaining position of the sense strand of the siRNA is a methoxy-modified nucleotide, and, in the direction from the 5' end to the 3' end, the siRNA The nucleotides at positions 2, 6, 8, 9, 14 and 16 of the nucleotide sequence B in the antisense strand are fluoro-modified nucleotides, and the nucleotides at the rest of the antisense strand of the siRNA are methoxy groups. Modified nucleotide;

Alternatively, the nucleotides at positions 5, 7, 8, and 9 of the nucleotide sequence A in the sense strand of the siRNA are fluoro-modified nucleotides in the direction from the 5' end to the 3' end, and the siRNA is sensed. The nucleotides at the rest of the chain are methoxy-modified nucleotides, and, in the direction from the 5' end to the 3' end, nucleotides B, 2, 6, and 14 of the antisense strand of the siRNA And the nucleotide at position 16 is a fluoro-modified nucleotide, and the nucleotide at the remaining position of the antisense strand of the siRNA is a methoxy-modified nucleotide;

Alternatively, according to the direction from the 5' end to the 3' end, the nucleotides at positions 7, 8 and 9 of the nucleotide sequence A in the sense strand of the siRNA are -fluoro-modified nucleotides, and the sense strand of siRNA The nucleotides at the remaining positions are methoxy-modified nucleotides, and, in the direction from the 5' end to the 3' end, the second, sixth, and fourth nucleotide sequences of the antisense strand of the siRNA are The nucleotide at position 16 is a fluoro-modified nucleotide, and the nucleotide at the rest of the antisense strand of the siRNA is a methoxy-modified nucleotide.

In other words, the ribose group in the phosphate-sugar backbone of the siRNA has a modifying group, respectively: in the direction from the 5' end to the 3' end, the nucleotide sequence A of the siRNA is in the fifth, seventh, The glycosyl group at positions 8 and 9 is a 2'-fluororibosyl group, and the sugar group at the remaining position of the sense strand of the siRNA is a 2'-methoxyribosyl group, and, according to the 5' end to the 3' end In the direction, the glycosyl group at positions 2, 6, 8, 9, 14 and 16 of the nucleotide sequence B in the antisense strand of the siRNA is a 2'-fluororibosyl group, and the nucleotides at the remaining positions of the antisense strand of the siRNA The glycosyl group is a 2'-methoxyribosyl group;

Alternatively, the glycosyl group at positions 5, 7, 8 and 9 of the nucleotide sequence A in the sense strand of the siRNA is 2'-fluororibosyl, in the direction from the 5' end to the 3' end, the sense strand of siRNA The remaining position of the nucleotide has a 2'-methoxyribosyl group, and, in the direction from the 5' end to the 3' end, the nucleotide sequence B of the antisense strand of the siRNA is 2, 6, The glycosyl group at positions 14 and 16 is a 2'-fluororibose group, and the glycosyl group at the remaining position of the antisense strand of the siRNA is a 2'-methoxyribose group;

Alternatively, the glycosyl group at positions 7, 8 and 9 of the nucleotide sequence A in the sense strand of the siRNA is 2'-fluororibosyl, in the direction from the 5' end to the 3' end, and the rest of the sense strand of the siRNA The glycosyl group at the position nucleotide is a 2'-methoxyribosyl group, and the second, sixth, and fourth nucleotide sequences B in the antisense strand of the siRNA are in the direction from the 5' end to the 3' end. The glycosyl group at position 16 is a 2'-fluororibose group, and the sugar group at the rest of the antisense strand of the siRNA is a 2'-methoxyribosyl group.

In some embodiments, the siRNA provided by the present disclosure is siHBV2 or siHBV3:

siHBV2

Justice strand: 5'-CmGmUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm-3' (SEQ ID NO: 6),

Antisense strand: 5'-UmUfGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmGmUm-3' (SEQ ID NO: 7),

siHBV3

Justice strand: 5'-CmGmUmGmUfGmCfAfCfUmUmCmGmCmUmUmCmAmAm-3' (SEQ ID NO: 8),

Antisense strand: 5'-UmUfGmAmAmGfCmGfAfAmGmUmGmCfAmCfAmCmGmGmUm-3' (SEQ ID NO: 9),

Wherein, the capital letters C, G, U, and A represent the base composition of the nucleotide; the lowercase letter m indicates that the nucleotide adjacent to the left side of the letter m is a methoxy-modified nucleotide; the lowercase letter f indicates One nucleotide adjacent to the left side of the letter f is a fluoro-modified nucleotide.

The siRNA having the above modification is not only low in cost, but also makes it difficult for the ribonuclease in the blood to cleave the nucleic acid, thereby increasing the stability of the nucleic acid and making the nucleic acid more resistant to nuclease hydrolysis.

In some embodiments, at least a portion of the phosphate groups in the phosphate-sugar backbone of at least one single strand of the sense strand and the antisense strand of the siRNA provided by the disclosure are phosphate groups having a modifying group. In some embodiments, the phosphate group having a modifying group is a phosphorothioate group formed by substitution of at least one oxygen atom of a phosphodiester bond in a phosphate group with a sulfur atom; in some embodiments, The phosphate group having a modifying group is a phosphorothioate group having a structure represented by the formula (1):

This modification stabilizes the double-stranded structure of the siRNA, maintaining high specificity and high affinity for base pairing.

In some embodiments, in the siRNA provided by the present disclosure, the phosphorothioate linkage is present at at least one of the following positions: between the first and second nucleotides at either end of the sense strand or the antisense strand ; between the second and third nucleotides at either end of the sense strand or the antisense strand; or any combination of the above. In some embodiments, the phosphorothioate linkage is present at all of the above positions except for the 5' end of the sense strand. In some embodiments, the phosphorothioate linkage is present at all of the above positions except for the 3' end of the sense strand. In some embodiments, the phosphorothioate linkage is present at at least one of the following locations:

Between the first nucleotide and the second nucleotide of the 5' end of the sense strand;

Between the second nucleotide and the third nucleotide of the 5' end of the sense strand;

Between the first nucleotide and the second nucleotide of the 3' end of the sense strand;

Between the second nucleotide and the third nucleotide of the 3' end of the sense strand;

Between the first nucleotide and the second nucleotide of the 5' end of the antisense strand;

Between the second nucleotide and the third nucleotide of the 5' end of the antisense strand;

Between the first nucleotide and the second nucleotide of the 3' end of the antisense strand;

The 2' end of the 3' end of the antisense strand is between the 2nd nucleotide and the 3rd nucleotide.

In some embodiments, the siRNA provided by the present disclosure is siHBV4 or siHBV5:

siHBV4

Justice strand: 5'-CmsGmsUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm-3' (SEQ ID NO: 10),

Antisense strand: 5'-UmsUfsGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmsGmsUm-3' (SEQ ID NO: 11),

siHBV5

Justice strand: 5'-CmsGmsUmGmUfGmCfAfCfUmUmCmGmCmUmUmCmAmAm-3' (SEQ ID NO: 12),

Antisense strand: 5'-UmsUfsGmAmAmGfCmGfAfAmGmUmGmCfAmCfAmCmGmsGmsUm-3' (SEQ ID NO: 13),

Wherein, the capital letters C, G, U, and A represent the base composition of the nucleotide; the lowercase letter m indicates that the nucleotide adjacent to the left side of the letter m is a methoxy-modified nucleotide; the lowercase letter f indicates One nucleotide adjacent to the left side of the letter f is a fluoro-modified nucleotide; the lower-case letter s indicates a phosphorothioate-based linkage between the two nucleotides to the left and right of the letter.

In some embodiments, the 5' terminal nucleotide of the siRNA antisense strand is a 5'-phosphate nucleotide or a 5'-phosphate analog modified nucleotide.

Commonly used nucleotides modified with 5'-phosphate nucleotides or 5'-phosphate analogs are well known to those skilled in the art, as 5'-phosphate nucleotides may have the following structure:

Further, as shown in Anastasia Khvorova and Jonathan K. Watts, The chemical evolution of oligonucleotide therapies of clinical utility. Nature Biotechnology, 2017, 35(3): 238-48, the following four 5'-phosphate analog modified nucleosides are disclosed. acid:

Wherein R is selected from H, OH, methoxy, and fluorine; and Base represents a base selected from A, U, C, G or T.

In some embodiments, the 5'-phosphate nucleotide is a 5'-phosphate modified nucleotide represented by formula (2), and the 5'-phosphate analog modified nucleotide comprises a vinyl phosphate ( 5'-(E)-vinylphosphonate, E-VP) modified nucleotide, as shown in formula (3), or a phosphorothioate-modified nucleotide, as shown in formula (5).

In some embodiments, the siRNA provided by the present disclosure is siHBV6, siHBV7, siHBV8 or siHBV9:

siHBV6

Justice strand: 5'-CmGmUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm-3' (SEQ ID NO: 6),

Antisense strand: 5'-P1-UmUfGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmGmUm-3' (SEQ ID NO: 14),

siHBV7

Justice strand: 5'-CmGmUmGmUfGmCfAfCfUmUmCmGmCmUmUmCmAmAm-3' (SEQ ID NO: 8),

Antisense strand: 5'-P1-UmUfGmAmAmGfCmGfAfAmGmUmGmCfAmCfAmCmGmGmUm-3' (SEQ ID NO: 15),

siHBVX8

Justice strand: 5'-CmsGmsUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm-3' (SEQ ID NO: 10),

Antisense strand: 5'-P1-UmsUfsGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmsGmsUm-3' (SEQ ID NO: 16),

siHBVX9

Justice strand: 5'-CmsGmsUmGmUfGmCfAfCfUmUmCmGmCmUmUmCmAmAm-3' (SEQ ID NO: 12),

Antisense strand: 5'-P1-UmsUfsGmAmAmGfCmGfAfAmGmUmGmCfAmCfAmCmGmsGmsUm-3' (SEQ ID NO: 17),

Wherein, the capital letters C, G, U, and A represent the base composition of the nucleotide; the lowercase letter m indicates that the nucleotide adjacent to the left side of the letter m is a methoxy-modified nucleotide; the lowercase letter f indicates The nucleotide adjacent to the left side of the letter f is a fluoro-modified nucleotide; the lowercase letter s indicates a phosphorothioate linkage between the two nucleotides of the letter; the uppercase letter P1 indicates the letter to the right. One nucleotide adjacent to the side is a nucleotide modified by a 5'-phosphate nucleotide or a 5'-phosphate analog.

The inventors of the present disclosure have unexpectedly discovered that the siRNA provided by the present disclosure not only has significantly enhanced plasma and lysosomal stability, but also retains high gene inhibitory activity.

The siRNA provided by the present disclosure can be obtained by a conventional siRNA preparation method (for example, a method of solid phase synthesis and liquid phase synthesis) in the art. Among them, solid phase synthesis already has commercial customized services. A method of preparing a nucleoside monomer having a corresponding modification and introducing a modified nucleotide group can be carried out by introducing a modified nucleotide group having a corresponding modified nucleoside monomer into the siRNA described in the present disclosure. Methods of siRNA are also well known to those skilled in the art.

Pharmaceutical composition

The present disclosure provides a pharmaceutical composition comprising the siRNA as described above as an active ingredient and a pharmaceutically acceptable carrier.

The pharmaceutically acceptable carrier may be a carrier conventionally used in the field of siRNA administration, such as, but not limited to, magnetic nanoparticles (such as Fe ₃ O ₄ or Fe ₂ O ₃ -based nanoparticles), carbon nanotubes ( Carbon nanotubes), mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM), polylysine Acid (poly(L-lysine), PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly D Type or L-type lactic acid/glycolic acid copolymer (poly(D&L-lactic/glycolic acid) copolymer, PLGA), poly(2-aminoethyl ethylene phosphate) (PPEEA) and poly( One or more of poly(2-dimethylaminoethyl methacrylate) (PDMAEMA) and derivatives thereof.

In some embodiments, the pharmaceutical composition has no particular requirement for the amount of siRNA and pharmaceutically acceptable carrier, and in some embodiments, the weight ratio of siRNA to pharmaceutically acceptable carrier can be 1: ( 1-500), in some embodiments, the above weight ratio is 1: (1-50).

In some embodiments, the pharmaceutical composition may further comprise other excipients that are pharmaceutically acceptable, and the excipients may be one or more of various formulations or compounds conventionally employed in the art. For example, the pharmaceutically acceptable other excipient may include at least one of a pH buffer, a protective agent, and an osmotic pressure adjusting agent.

The pH buffer may be a trishydroxymethylaminomethane hydrochloride buffer having a pH of 7.5-8.5 and/or a phosphate buffer having a pH of 5.5-8.5, for example, a phosphoric acid having a pH of 5.5-8.5. Salt buffer.

The protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose. The protective agent may be included in an amount of from 0.01 to 30% by weight based on the total weight of the pharmaceutical composition.

The osmotic pressure adjusting agent may be sodium chloride and/or potassium chloride. The osmotic pressure adjusting agent is present in an amount such that the osmotic pressure of the pharmaceutical composition is from 200 to 700 milliosmoles per kilogram. The content of the osmotic pressure adjusting agent can be easily determined by those skilled in the art depending on the desired osmotic pressure.

In some embodiments, the pharmaceutical composition may be a liquid preparation, such as an injection solution; or may be a lyophilized powder injection, which is mixed with a liquid adjuvant when administered, and formulated into a liquid preparation. The liquid formulation can be, but is not limited to, for subcutaneous, intramuscular or intravenous administration, and can be, but is not limited to, administered to the lungs by spraying, or administered to other organ tissues (such as the liver) via the lungs by spraying. In some embodiments, the pharmaceutical composition is for intravenous administration.

In some embodiments, the pharmaceutical composition can be in the form of a liposomal formulation. In some embodiments, the pharmaceutically acceptable carrier used in the liposome formulation comprises an amine-containing transfection compound (which may also be referred to hereinafter as an organic amine), helper lipid, and/or PEGylation. Lipid. Wherein the organic amine, helper lipid, and pegylated lipid are each selected from the group consisting of amine-containing transfection compounds described in CN103380113A (incorporated herein by reference in its entirety) One or more of the accepted salts or derivatives, helper lipids, and pegylated lipids.

In some embodiments, the organic amine can be a compound of formula (201), or a pharmaceutically acceptable salt thereof, as described in CN103380113A:

among them:

X ₁₀₁ and X ₁₀₂ are each independently O, S, NA or CA, wherein A is hydrogen or a C1-C20 hydrocarbon chain;

Y and Z are each independently C=O, C=S, S=O, CH-OH or SO ₂ ;

R ₁₀₁ , R ₁₀₂ , R ₁₀₃ , R ₁₀₄ , R ₁₀₅ , R ₁₀₆ and R ₁₀₇ are each independently hydrogen, cyclic or acyclic, substituted or unsubstituted, branched or straight-chain aliphatic radical a cyclic, acyclic or acyclic, substituted or unsubstituted, branched or straight chain heteroaliphatic group, substituted or unsubstituted, branched or straight chain acyl group, substituted or not Substituted, branched or straight-chain aryl, substituted or unsubstituted, branched or straight-chain heteroaryl;

x is an integer from 1 to 10;

n is an integer from 1 to 3, m is an integer from 0 to 20, and p is 0 or 1; wherein, if m = p = 0, R ₁₀₂ is hydrogen;

And, if at least one of n or m is 2, R ₁₀₃ and the nitrogen in the formula (201) form a structure as shown in the formula (202) or the formula (203):

Wherein g, e and f are each independently an integer of from 1 to 6, "HCC" represents a hydrocarbon chain, and each *N represents a nitrogen atom in the formula (201).

In some embodiments, R ₁₀₃ is a polyamine. In other embodiments, R ₁₀₃ is a ketal. In some embodiments, each of R ₁₀₁ and R ₁₀₂ in formula (201) is independently any substituted or unsubstituted, branched or straight chain alkyl or alkenyl group, said alkane The base or alkenyl group has from 3 to about 20 carbon atoms, such as from 8 to about 18 carbon atoms, and from 0 to 4 double bonds, such as from 0 to 2 double bonds.

In some embodiments, if each of n and m independently has a value of 1 or 3, then R ₁₀₃ can be any of the following formulas (204) - (213):

Wherein, in the formula (204)-formula (213), g, e and f are each independently an integer of 1-6, each "unit", the ground represents a hydrocarbon chain, and each * shows R ₁₀₃ and in the formula ( A possible point of attachment of the nitrogen atom in 201), wherein each H at any * position can be replaced to effect attachment to the nitrogen atom in formula (201).

Among them, the compound represented by the formula (201) can be produced according to the description in CN103380113A.

In some embodiments, the organic amine is an organic amine as shown in formula (214) and/or an organic amine as shown in formula (215):

The helper lipid is a cholesterol, an analog of cholesterol, and/or a derivative of cholesterol;

The PEGylated lipid is 1,2-dipalmitamide-sn-glycero-3-phosphatidylethanolamine-N-[methoxy(polyethylene glycol)]-2000.

In some embodiments, the molar ratio between the organic amine, the helper lipid, and the PEGylated lipid is (19.7-80): (19.7-80) in the pharmaceutical composition. ): (0.3-50), for example, may be (50-70): (20-40): (3-20).

In some embodiments, the pharmaceutical composition particles formed from the siRNA of the present disclosure and the amine-containing transfection reagent described above have an average diameter of from about 30 nm to about 200 nm, typically from about 40 nm to about 135 nm, and more typically, the liposome The average diameter of the particles is from about 50 nm to about 120 nm, from about 50 nm to about 100 nm, from about 60 nm to about 90 nm, or from about 70 nm to about 90 nm, for example, the average diameter of the liposome particles is about 30, 40, 50, 60, 70. , 75, 80, 85, 90, 100, 110, 120, 130, 140, 150 or 160 nm.

In some embodiments, the weight of the siRNA and all lipids (eg, organic amines, helper lipids, and/or PEGylated lipids) in a pharmaceutical composition formed from the siRNAs of the present disclosure and the amine-containing transfection reagents described above The ratio (weight/weight ratio) is from about 1:1 to about 1:50, from about 1:1 to about 1:30, from about 1:3 to about 1:20, from about 1:4 to about 1: 18. From about 1:5 to about 1:17, from about 1:5 to about 1:15, from about 1:5 to about 1:12, from about 1:6 to about 1:12 or from about 1: In the range of 6 to about 1:10, for example, the weight ratio of the siRNA of the present disclosure to the total lipid is about 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1 : 11, 1: 12, 1: 13, 1:14, 1:15, 1:16, 1:17 or 1:18.

In some embodiments, the components of the pharmaceutical composition may be present separately upon marketing and may be in the form of a liquid formulation when used. In some embodiments, a pharmaceutical composition of the siRNA provided by the present disclosure and the above pharmaceutically acceptable carrier can be prepared according to various known methods, except that the siRNA provided by the present disclosure is substituted for the existing siRNA; In an embodiment, it can be prepared as follows:

The organic amine, the auxiliary lipid and the PEGylated lipid are suspended in the alcohol according to the above molar ratio and mixed to obtain a lipid solution; the amount of the alcohol is such that the total mass concentration of the obtained lipid solution is 2-25 mg/mL, For example, it can be 8-18 mg/mL. The alcohol is selected from a pharmaceutically acceptable alcohol, such as an alcohol that is liquid near room temperature, for example, ethanol, propylene glycol, benzyl alcohol, glycerin, polyethylene glycol 200, polyethylene glycol 300, polyethylene glycol 400. One or more of them may be, for example, ethanol.

The siRNA provided in the present disclosure was dissolved in a buffered saline solution to obtain an aqueous siRNA solution. The concentration of the buffer salt solution is 0.05-0.5M, for example, 0.1-0.2M, and the pH of the buffer salt solution is adjusted to 4.0-5.5, for example, 5.0-5.2, and the buffer solution is used in an amount such that the concentration of the siRNA does not exceed 0.6 mg. /mL, for example, may be 0.2-0.4 mg/mL. The buffer salt is selected from one or more of soluble acetate and soluble citrate, and may be, for example, sodium acetate and/or potassium acetate.

The lipid solution and the siRNA aqueous solution are mixed, and the product obtained after the mixing is incubated at 40 to 60 ° C for at least 2 minutes, for example, 5 to 30 minutes, to obtain a liposome preparation after the incubation. The volume ratio of the lipid solution to the aqueous siRNA solution is 1: (2-5), for example, 1:4.

The liposome preparation after the incubation is concentrated or diluted to remove impurities and sterilized, and the pharmaceutical composition provided by the present disclosure has the physical and chemical parameters of pH 6.5-8, encapsulation efficiency of not less than 80%, and particle size of 40-200nm, polydispersity index is not higher than 0.30, osmotic pressure is 250-400mOsm/kg; for example, physical and chemical parameters can be pH 7.2-7.6, encapsulation efficiency is not less than 90%, particle size is 60-100nm, more The dispersion index is not higher than 0.20, and the osmotic pressure is 300-400 mOsm/kg.

Among them, concentration or dilution can be carried out before, after or simultaneously with the removal of impurities. The method of removing impurities can be carried out by various methods, for example, a phase-cut flow system, a hollow fiber column, ultrafiltration under a condition of 100 K Da, and an ultrafiltration exchange solution of a phosphate buffer solution (PBS) of pH 7.4. The sterilization method can be carried out by various methods, for example, it can be sterilized by filtration on a 0.22 μm filter.

First siRNA conjugate

In one aspect, the disclosure provides an siRNA conjugate comprising the siRNA described above and a conjugating group attached to the siRNA.

In the context of the present disclosure, unless otherwise indicated, "conjugation" means that two or more chemical moieties each having a particular function are linked to each other in a covalently bonded manner; accordingly, the "conjugate" is A compound formed by covalent attachment between the various chemical moieties. Further, "referring to the individualized conjugate" means a compound formed by covalently attaching one or more chemical moieties having a specific function to an siRNA. Hereinafter, the siRNA conjugate of the present disclosure is sometimes simply referred to as "conjugate". An siRNA conjugate is understood to be a generic term for an siRNA conjugate, a first siRNA conjugate or a second siRNA conjugate, depending on the context. In the context of the present disclosure, a "conjugated molecule" is understood to mean a compound that can be conjugated to an siRNA by reaction, ultimately forming an siRNA conjugate of the present disclosure.

The present disclosure provides a first siRNA conjugate comprising the siRNA described above and a conjugate group attached to the siRNA. Generally, for a first siRNA conjugate, the conjugate group comprises a pharmaceutically acceptable at least one targeting group and an optional linker, and the siRNA, the linker and The targeting groups are linked in sequence. In one embodiment, the targeting group is from 1 to 6. In one embodiment, the targeting group is 2-4. The siRNA molecule can be non-covalently or covalently conjugated to the conjugate group, for example, can be covalently conjugated to the conjugate group. The conjugation site of the siRNA to the conjugate group may be at the 3' or 5' end of the siRNA sense strand, or at the 5' end of the antisense strand, or in the internal sequence of the siRNA. In some embodiments, the conjugation site of the siRNA to the conjugating group is at the 3' end of the siRNA sense strand.

In some embodiments, the conjugate group can be attached to a phosphate group, a 2'-position hydroxyl group or a base of a nucleotide. In some embodiments, the conjugated group can be attached to the 3'-position hydroxyl group, in which case the nucleotides are linked by a 2'-5' phosphodiester linkage. When the conjugate group is attached to the end of the siRNA strand, the conjugate group is typically attached to the phosphate group of the nucleotide; when the conjugate group is attached to the internal sequence of the siRNA, the conjugate group Usually attached to a ribose sugar ring or base. For various linkages, refer to: Muthiah Manoharan et. al. siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked through nucleosides elicit robust gene silencing in vivo in hepatocytes. ACS Chemical biology, 2015, 10(5): 1181-7.

In some embodiments, the siRNA and the conjugate group may be linked by an acid labile or reducible chemical bond, and in the acidic environment of the cell endosomes, these chemical bonds may degrade, thereby rendering the siRNA free. For non-degradable conjugation, the conjugate group can be attached to the sense strand of the siRNA to minimize the effect of conjugation on siRNA activity.

In some embodiments, the pharmaceutically acceptable targeting group refers to a ligand that can be routinely used in the field of siRNA administration, such as the various ligands described in WO2009082607A2, all of which are incorporated by reference. Into this article.

In some embodiments, the pharmaceutically acceptable targeting group can be selected from one or more of the following ligands or derivatives thereof: lipophilic molecules, such as cholesterol, bile acids, Vitamins (eg vitamin E), lipid molecules of different chain lengths; polymers such as polyethylene glycol; polypeptides such as transmembrane peptides; aptamers; antibodies; quantum dots; saccharides such as lactose, polylactose, mannose Sugar, galactose, N-acetylgalactosamine (GalNAc); folate; receptor ligands expressed by hepatocytes, such as asialoglycoprotein, asialoglycohol residues, lipoproteins (eg high density) Lipoprotein, low density lipoprotein, etc., glucagon, neurotransmitters (such as adrenaline), growth factors, transferrin and the like.

In some embodiments, each of the ligands is independently selected from a ligand capable of binding to a cell surface receptor. In some embodiments, at least one ligand is a ligand capable of binding to a hepatocyte surface receptor. In some embodiments, at least one of the ligands is a ligand capable of binding to a mammalian hepatocyte surface receptor. In some embodiments, at least one ligand is a ligand capable of binding to a human hepatocyte surface receptor. In some embodiments, at least one of the ligands is a ligand capable of binding to a hepatic surface asialoglycoprotein receptor (ASGPR). The class of these ligands is well known to those skilled in the art and generally functions to bind to specific receptors on the surface of the target cell, mediating delivery of the ligand-ligated siRNA to the target cell.

In some embodiments, the pharmaceutically acceptable targeting group can be any ligand that binds to an asialoglycoprotein receptor (ASGPR) on the surface of a mammalian hepatocyte. In one embodiment, each ligand is independently a asialoglycoprotein, such as asialouromusomoid (ASOR) or asialofibrate (ASF). In one embodiment the ligand is a sugar or a derivative of a sugar.

In some embodiments, at least one of the ligands is a sugar. In some embodiments, each ligand is a sugar. In some embodiments, at least one ligand is a monosaccharide, a polysaccharide, a modified monosaccharide, a modified polysaccharide, or a sugar derivative. In some embodiments, at least one of the ligands can be a monosaccharide, a disaccharide or a trisaccharide. In some embodiments, at least one of the ligands is a modified sugar. In some embodiments, each ligand is a modified sugar. In some embodiments, each ligand is independently selected from the group consisting of a polysaccharide, a modified polysaccharide, a monosaccharide, a modified monosaccharide, a polysaccharide derivative, or a monosaccharide derivative. In some embodiments, each or at least one ligand is selected from the group consisting of glucose and derivatives thereof, mannans and derivatives thereof, galactose and derivatives thereof, xylose and its derivatives, ribose and derivatives thereof, A group consisting of fucose and its derivatives, lactose and its derivatives, maltose and its derivatives, arabinose and its derivatives, fructose and its derivatives, and sialic acid.

In some embodiments, each of the ligands can be independently selected from the group consisting of D-mannopose, L-mannopose, D-arabinose, D-furanose, L-furanose, D- Glucose, L-glucose, D-galactose, L-galactose, α-D-furanmannose, β-D-furanmannose, α-D-mannopose, β-D-mannopyrose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-pyranose, α-D-pyridyl Galactose, β-D-galactopyranosyl, α-D-galactopyranosylose, β-D-galactofuranosamine, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N- Trifluoroacetylgalactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O-[(R)-1-carboxylate Ethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-carboxamide-2,3-di -O-methyl-D-mannopyranosyl, 2-deoxy-2-sulfonyl-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-pyran Glucose, 2, 3, 4 -Tri-O-acetyl-1-thioxo-6-O-trityl-α-D-glucopyranoside methyl ester, 4-thio-β-D-galactopyranosylose, 3,4 ,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucopyranoside ethyl ester, 2,5-anhydro-D-allosenitrile, ribose , D-ribose, D-4-thioribose, L-ribose or L-4-thioribose. Further selection of such ligands can be found, for example, in the description of CN 105378082 A, the entire disclosure of which is incorporated herein by reference.

In some embodiments, the pharmaceutically acceptable targeting group in the first siRNA conjugate can be galactose or N-acetylgalactosamine, wherein the galactose or N-acetylgalactosamine molecule can It is one price, two price, three price, and four price. It should be understood that the monovalent, divalent, trivalent, and tetravalent terms described herein refer to the formation of siRNA conjugates of siRNA molecules and conjugated groups containing galactose or N-acetylgalactosamine molecules as targeting groups, respectively. After the compound, the molar ratio of the siRNA molecule to the galactose or N-acetylgalactosamine molecule in the siRNA conjugate is 1:1, 1:2, 1:3 or 1:4. In some embodiments, the pharmaceutically acceptable targeting group is N-acetylgalactosamine. In some embodiments, when the siRNA of the present disclosure is conjugated to a conjugating group comprising N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent or tetravalent. In some embodiments, when the siRNA of the present disclosure is conjugated to a conjugating group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent.

When the siRNA described in the present disclosure is conjugated to a conjugated molecule, the conjugated molecule can be linked to the siRNA molecule via a suitable linker, and one skilled in the art can select a suitable linker depending on the particular type of targeting group. The conjugated groups, the linkers, the types of targeting groups, and the manner of attachment to siRNAs can be found in the disclosure of WO 2015006740 A2, the entire contents of which is incorporated herein by reference.

In some embodiments, when the targeting group is N-acetylgalactosamine, a suitable linker can be a structure as shown in formula (301):

among them,

k is an integer from 1 to 3;

L ^A is a chain moiety comprising an amide bond having a structure represented by formula (302), each of said L ^A having an ether bond at its two ends with one of said targeting group and said L ^C moiety, respectively connection:

L ^B is a chain moiety comprising an N-acylpyrrolidine having a structure represented by the formula (303), the chain moiety having a carbonyl group at one end thereof and being bonded to the L ^C moiety via an amide bond at the other end Has an oxy group and is linked to the siRNA via a phosphate linkage:

L ^C is a 2-4 valent linking group based on hydroxymethylaminomethane, dimethylolaminomethane or trishydroxymethylaminomethane, and the L ^{C is} via an oxygen atom to each of the L ^A moieties via an ether linkage. It is linked and is linked to the L ^B moiety via an amide bond via a nitrogen atom.

In some embodiments, when n=3, L ^C is a trimethylolaminomethane-based tetravalent linking group, attached by -(L ^A ) ₃ trishydroxymethylaminomethane-L ^B - as a linker The first siRNA conjugate formed by the N-acetylgalactosamine molecule and the siRNA molecule has the structure shown in the following formula (304):

In the formula, the double helix structure represents siRNA.

Similarly, the conjugation site of the siRNA to the conjugated molecule can be at the 3' or 5' end of the siRNA sense strand, also at the 5' end of the antisense strand, and also within the internal sequence of the siRNA.

In some embodiments, the 3' terminus of the sense strand of the siRNA of the present disclosure is covalently linked to three N-acetylgalactosamine (GalNAc) molecules via a linker-(L ^A ) ₃ trishydroxymethylaminomethane-L ^B - The first siRNA conjugate having a molar ratio of siRNA molecule to GalNAc molecule of 1:3 is obtained by conjugation, which may also be referred to as (GalNAc) ₃ -1-siRNA, and its structure is as shown in the following formula (305). :

Wherein the double helix structure represents the siRNA and the linker is ligated to the 3' end of the sense strand of the siRNA.

In some embodiments, when the targeting group is N-acetylgalactosamine, a suitable linker can be a structure as shown in formula (306):

among them,

l is an integer from 0-3;

^* indicates a site on the linker that is attached to the targeting group via an ether linkage;

^# indicates a site on the linker that is linked to the siRNA via a phosphate bond.

In some embodiments, when l=2, the first siRNA conjugate has a structure as shown in formula (307):

The above conjugates can be synthesized by methods which have been described in detail in the prior art. For example, WO 2015006740 A2 describes in detail the preparation of various conjugates. The first siRNA conjugate of the present disclosure is obtained by means well known to those skilled in the art. The preparation method of the structure represented by the formula (305) is described in WO2014025805A1, and the preparation method of the structure represented by the formula (307) is described by Rajeev et al. in ChemBioChem 2015, 16, 903-908.

Second siRNA conjugate

In some embodiments, the disclosure provides a second siRNA conjugate having the structure shown in Formula (308):

among them:

N1 is an integer selected from 1 to 3, and n3 is an integer selected from 0 to 4;

M1, m2 and m3 are independently an integer selected from 2-10;

R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ are each independently H or selected from the group consisting of C ₁ -C ₁₀ alkyl, C ₁ -C ₁₀ haloalkane a group and a C ₁ -C ₁₀ alkoxy group;

R ₃ is a group of the structure represented by the formula A59:

Wherein E ₁ is OH, SH or BH ₂ , and Nu is an siRNA disclosed;

R ₂ is a linear alkylene group having a length of from 1 to 20 carbon atoms, wherein one or more carbon atoms are optionally replaced by one or more selected from the group consisting of: C ( O), NH, O, S, CH=N, S(O) ₂ , C ₂ -C ₁₀ alkenylene, C ₂ -C ₁₀ alkynylene, C ₆ -C ₁₀ arylene, C ₃ -C _{a 18} -heterocyclylene group and a C ₅ -C ₁₀ heteroarylene group; and wherein R ₂ may optionally have a substituent of any one or more of the group consisting of C ₁ -C ₁₀ Alkyl, C ₆ -C ₁₀ aryl, C ₅ -C ₁₀ heteroaryl, C ₁ -C ₁₀ haloalkyl, -OC ₁ -C ₁₀ alkyl, -OC ₁ -C ₁₀ alkylphenyl, -C _1- C ₁₀ alkyl-OH, -OC ₁ -C ₁₀ haloalkyl, -SC ₁ -C ₁₀ alkyl, -SC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkyl-SH, - SC ₁ -C ₁₀ haloalkyl, halogen substituent, -OH, -SH, -NH ₂ , -C ₁ -C ₁₀ alkyl-NH ₂ , -N(C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), -NH(C ₁ -C ₁₀ alkyl), cyano, nitro, -CO 2 H, -C(O)O(C ₁ -C ₁₀ alkyl), -CON (C ₁ -C ₁₀ Alkyl)(C ₁ -C ₁₀ alkyl), -CONH(C ₁ -C ₁₀ alkyl), -CONH ₂ , -NHC(O)(C ₁ -C ₁₀ alkyl), -NHC(O)( Phenyl), -N (C ₁ -C ₁₀ alkyl)C(O)(C ₁ -C ₁₀ alkyl), -N(C ₁ -C ₁₀ alkyl)C(O)(phenyl), -C(O)C ₁ -C ₁₀ alkyl , -C(O)C ₁ -C ₁₀ alkylphenyl, -C(O)C ₁ -C ₁₀ haloalkyl, -OC(O)C ₁ -C ₁₀ alkyl, -SO ₂ (C ₁ - C ₁₀ alkyl), -SO ₂ (phenyl), -SO ₂ (C ₁ -C ₁₀ haloalkyl), -SO ₂ NH ₂ , -SO ₂ NH(C ₁ -C ₁₀ alkyl), -SO ₂ NH _{_{(phenyl), - NHSO 2 (C 1}} -C 10 alkyl), - NHSO ₂ (phenyl), and -NHSO ₂ (C ₁ -C ₁₀ haloalkyl).

Each L ₁ is a linear alkylene group having a length of from 1 to 70 carbon atoms, wherein one or more carbon atoms are optionally replaced by one or more selected from the group consisting of: C(O), NH, O, S, CH=N, S(O) ₂ , C ₂ -C ₁₀ alkenylene, C ₂ -C ₁₀ alkynylene, C ₆ -C ₁₀ arylene, C ₃ a -C ₁₈ -heterocyclylene group and a C ₅ -C ₁₀ heteroarylene group; and wherein L ₁ may optionally have a substituent of any one or more of the group consisting of: C ₁ - C ₁₀ alkyl, C ₆ -C ₁₀ aryl, C ₅ -C ₁₀ heteroaryl, C ₁ -C ₁₀ haloalkyl, -OC ₁ -C ₁₀ alkyl, -OC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkyl-OH, -OC ₁ -C ₁₀ haloalkyl, -SC ₁ -C ₁₀ alkyl, -SC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkyl-SH , -SC ₁ -C ₁₀ haloalkyl, halogen substituent, -OH, -SH, -NH ₂ , -C ₁ -C ₁₀ alkyl-NH ₂ , -N(C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), -NH(C ₁ -C ₁₀ alkyl), cyano, nitro, -CO ₂ H, -C(O)O(C ₁ -C ₁₀ alkyl), -CON(C _1- C ₁₀ alkyl)(C ₁ -C ₁₀ alkyl), -CONH(C ₁ -C ₁₀ alkyl), -CONH ₂ , -NHC(O)(C ₁ -C ₁₀ alkyl), -NHC (O) (phenyl), -N (C ₁ -C ₁₀ alkyl)C(O)(C ₁ -C ₁₀ alkyl), -N(C ₁ -C ₁₀ alkyl)C(O)(phenyl), -C(O)C ₁ -C ₁₀ alkyl, -C(O)C ₁ -C ₁₀ alkylphenyl, -C(O)C ₁ -C ₁₀ haloalkyl, -OC(O)C ₁ -C ₁₀ alkyl, -SO ₂ (C ₁ -C ₁₀ alkyl), -SO ₂ (phenyl), -SO ₂ (C ₁ -C ₁₀ haloalkyl), -SO ₂ NH ₂ , -SO ₂ NH(C ₁ -C ₁₀ alkyl ), - SO ₂ NH _{_{(phenyl), - NHSO 2 (C 1}} -C 10 alkyl), - NHSO ₂ (phenyl), and -NHSO ₂ (C ₁ -C ₁₀ haloalkyl).

Also, in some embodiments, L ₁ may be selected from the group consisting of A1-A26 groups or any combination thereof, wherein the structures and definitions of A1-A26 are as follows:

Wherein, j1 is an integer of 1 to 20; J2 is an integer from 1 to 20; R 'is a C ₁ -C ₁₀ alkyl group;

Ra is selected from one of the groups of the formula A27-A45:

Rb is a C ₁ -C ₁₀ alkyl group;

Represents a site where a group is attached to the rest of the molecule.

Skilled person will understand that, although for convenience, L ₁ is defined as a linear alkyl group, but it may not be a linear group or a different name, such as an amine or alkenyl group replaced the above and / or substitutions generated. For the purposes of this disclosure, the length of L ₁ is the number of atoms in the chain connecting the two attachment points. For this purpose, a ring (for example, a heterocyclylene group or a heteroarylene group) obtained by substituting a carbon atom of the linear alkylene group is counted as one atom.

M ₁ represents a targeting group whose definition and selectable range are the same as those described above. In some embodiments, each M ₁ is independently selected having one affinity ligand for the asialoglycoprotein receptor on the cell surface of mammalian liver.

When M ₁ is a ligand having affinity for the asialoglycoprotein receptor on the surface of mammalian liver cells, in some embodiments, n1 may be an integer from 1 to 3, and n3 may be an integer from 0 to 4, Ensuring that the number of M ₁ ligands in the conjugate is at least 2; in some embodiments, n1+n3 ≥ 2 such that the number of M ₁ targeting groups is at least 3 such that the M ₁ target The group is more readily bound to the hepatic surface asialoglycoprotein receptor, thereby facilitating entry of the conjugate into the cell by endocytosis. Experiments have shown that when the number of M ₁ targeting groups is more than 3, the ease of binding of the M ₁ targeting group to the hepatic surface asialoglycoprotein receptor is not obvious, and therefore, from the ease of synthesis, Considering various aspects of structure/process cost and delivery efficiency, in some embodiments, n1 is an integer from 1-2, n3 is an integer from 0-1, and n1+n3=2-3.

In some embodiments, m1, m2 and m3 are independently selected from an integer of 2-10, M ₁ may be a plurality of spaces between the position for the targeting group M ₁ and the surface of the liver targeting group asialo The binding of glycoprotein receptors, in order to make the conjugates provided by the present disclosure simpler, easier to synthesize and/or reduce cost, in some embodiments, m1, m2 and m3 are each independently an integer from 2 to 5, In some embodiments, m1 = m2 = m3.

It will be understood by those skilled in the art that when R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ are each independently H, C ₁ -C ₁₀ alkyl, C ₁ -C ₁₀ haloalkyl, and C ₁ when one kind -C ₁₀ alkoxy group is, not change the nature of the conjugates disclosed herein are object of the present disclosure may be implemented. In some embodiments, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R _{14 ,} and R ₁₅ are each independently selected from the group consisting of H, methyl, and ethyl. In some embodiments, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ are both H.

According to a second siRNA conjugate provided by the present disclosure, R ₃ is a group of the structure represented by formula A59, wherein E ₁ is OH, SH or BH ₂ , based on considerations of ease of preparation of the starting materials, in some embodiments In the case, E ₁ is OH or SH.

In some embodiments, R ₂ is selected to achieve the A59 connection N on the backbone nitrogen. In the context of the present disclosure, the "nitrogen-containing skeleton" means a chain structure in which a carbon atom to which R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ are bonded to each other is bonded to N. Thus, R ₂ can be any linking group capable of attaching the A59 group to the N on the nitrogen-containing backbone in an appropriate manner. In some embodiments, where a second siRNA conjugate is prepared by a process of solid phase synthesis, the R ₂ group needs to contain both a linkage to the N on the nitrogen-containing backbone and to the R ₃ The P-phase is connected to the attachment site. In some embodiments, N-linked sites on the R ₂ and the nitrogen in the backbone with N to form an amide bond, said connecting site on the P and P ₃ R phosphodiester linkage. In some embodiments, R ₂ can be B5, B6, B5' or B6':

among them,

A site indicating a covalent bond of a group.

The value of q ₂ may range from an integer from 1 to 10, and in some embodiments, q ₂ is an integer from 1 to 5.

The role of L ₁ is to link the M ₁ targeting group to the N on the nitrogen-containing backbone, providing a liver targeting function for the second siRNA conjugate of the present disclosure. In some embodiments, L _{1 is} selected from a combination of linkages of one or more of the groups of Formulas A1 to A26; in some embodiments, L _{1 is} selected from the group consisting of A1, A4, A5, A6, A8, A10, A11 and A13 connection combination of one or more; in some embodiments, L ₁ is selected from A1, A4, A8, A10 and A11 are connected to at least two compositions; in some embodiments, L ₁ is selected from A combination of at least two of A1, A8, and A10.

In some embodiments, L ₁ can be from 3 to 25 atoms, from 3 to 20 atoms, from 4 to 15 atoms, or from 5 to 12 atoms. In some embodiments, the length of L1 is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 , 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60 atoms .

In some embodiments, j1 is an integer from 2 to 10, and in some embodiments, j1 is an integer from 3-5. J2 is an integer from 2 to 10, and in some embodiments, j2 is an integer from 3-5. R' is a C1-C4 alkyl group, and in some embodiments, R' is one of a methyl group, an ethyl group, and an isopropyl group. Ra is one of A27, A28, A29, A30 and A31, and in some embodiments, Ra is A27 or A28. Rb is C ₁ -C ₅ alkyl group, in some embodiments, Rb is methyl, ethyl, isopropyl, and butyl of one. In some embodiments, the respective formula A1-A26 of j1, j2, R ', Ra , Rb are selected in order to achieve targeting group M ₁ on the N-linked nitrogen-containing backbone with targeting and M ₁ The spatial position between the groups is more suitable for binding of the M ₁ targeting group to the hepatic surface asialoglycoprotein receptor.

In some embodiments, the second siRNA conjugate of the present disclosure has the formula (403), (404), (405), (406), (407), (408), (409), (410), ( Structures shown in 411), (412), (413), (414), (415), (416), (417), (418), (419), (420), (421), or (422) :

In some embodiments, P in Formula A59 can be joined to any of the possible positions in the siRNA sequence represented by Nu. For example, P in Formula A59 can be ligated to any one of the siRNA sense or antisense strands of the siRNA represented by Nu. Acid; in some embodiments, P in formula A59 is attached to any one of the nucleotides of the sense strand of siRNA represented by Nu. In some embodiments, P in Formula A59 is joined to the end of the sense or antisense strand of siRNA represented by Nu; in some embodiments, P in Formula A59 is joined to the end of the sense strand of siRNA represented by Nu. The terminus of the siRNA represented by Nu refers to the siRNA sense strand represented by Nu or the first 4 nucleotides from the one end of the antisense strand. In some embodiments, P in Formula A59 is joined to the terminus of the sense or antisense strand of siRNA represented by Nu; in some embodiments, P in Formula A59 is joined to the 3' end of the sense strand of siRNA represented by Nu. In the case of the above position of the sense strand linked to the siRNA represented by Nu, after the second siRNA conjugate enters the cell, upon unwinding, a separate siRNA antisense strand can be released to block the translation of HBV mRNA. The process of protein inhibits the expression of hepatitis B virus (HBV) gene.

P in formula A59 can be attached to any possible position on the nucleotide in the siRNA represented by Nu, for example, the 5' position of the nucleotide, the 2' position of the nucleotide, the 3' position of the nucleotide or the nucleus On the base of the nucleotide. In some embodiments, P in formula A59 can be joined to the 2', 3' or 5' position of the nucleotide in the siRNA represented by Nu by forming a phosphodiester bond. In some embodiments, the P in the formula A59 is attached to an oxygen atom formed after dehydrogenation of the 3' hydroxyl group of the 3' terminal nucleotide of the siRNA sense strand represented by Nu, or the siRNA represented by the substitution of Nu in the formula A59 Hydrogen in the 2'-hydroxyl group of one nucleotide in the sense strand is linked to the nucleotide, or P in the formula A59 is substituted by Nu to represent the hydrogen in the 5' hydroxyl group of the 5' terminal nucleotide of the siRNA sense strand. Nucleotide linkage.

In the siRNA or siRNA conjugate of the present disclosure, each adjacent nucleotide is linked by a phosphodiester bond or a phosphorothioate diester bond, and a non-bridging in a phosphodiester bond or a phosphorothioate diester bond The oxygen atom or the sulfur atom has a negative charge, which may exist in the form of a hydroxyl group or a sulfhydryl group, and the hydrogen ion in the hydroxyl group or the thiol group may also be partially or completely substituted by a cation. The cation may be any cation such as one of a metal cation, an ammonium ion NH ₄ ⁺ , and an organic ammonium cation. In order to improve solubility, in one embodiment, the cation is selected from one or more of an alkali metal ion, an ammonium cation formed by a tertiary amine, and a quaternary ammonium cation. The alkali metal ion may be K ⁺ and/or Na ⁺ , and the cation formed by the tertiary amine may be an ammonium ion formed by triethylamine and/or an ammonium ion formed by N,N-diisopropylethylamine. Thus, the siRNA or the first or second siRNA conjugate of the present disclosure may exist at least partially in the form of a salt. In one embodiment, the non-bridging oxygen or sulfur atom in the phosphodiester bond or the phosphorothioate diester bond is at least partially bound to the sodium ion, the siRNA or the first or second siRNA conjugate of the present disclosure. It exists in the form of a sodium salt or a partial sodium salt.

It is well known to those skilled in the art that modified nucleotide groups can be introduced into the siRNAs described in the present disclosure by using nucleoside monomers having corresponding modifications. Methods of preparing nucleoside monomers having corresponding modifications and methods of introducing modified nucleotide groups into siRNA are also well known to those skilled in the art. All modified nucleoside monomers are either commercially available or can be prepared by known methods.

Preparation of a second siRNA conjugate

The second siRNA conjugate can be prepared using any reasonable synthetic route.

In some embodiments, the second siRNA conjugate can be prepared by a method comprising, under the conditions of solid phase synthesis of phosphoramidite, according to the nucleotide species and order of the sense strand and the antisense strand of the siRNA, respectively. The nucleoside monomers are sequentially linked in the direction of 3' to 5', and the linkage of each nucleoside monomer includes four steps of deprotection, coupling, capping, oxidation or sulfurization; the sense strand and the antisense strand of the siRNA are isolated. , annealing, wherein the siRNA represented by Nu is the siRNA of the present disclosure described above;

Moreover, the method further comprises contacting the compound represented by the formula (321) with a nucleoside monomer or a nucleotide sequence attached to the solid phase carrier in the presence of a coupling reaction condition and a coupling reagent, such that the formula (321) The compound shown is linked to the nucleotide sequence by a coupling reaction. Hereinafter, the compound represented by the formula (321) is also referred to as a conjugation molecule.

among them:

R ₄ is a moiety capable of binding to Nu representing siRNA. In some embodiments, R ₄ is a moiety capable of binding to a siRNA represented by Nu by a covalent bond. In some embodiments, R ₄ is a moiety capable of being reacted to conjugate to any functional group of siRNA represented by Nu by a phosphodiester bond;

Each S _{1 is} independently a group formed by substituting all of the active hydroxyl groups in M ₁ with a YCOO- group, wherein each Y is independently selected from the group consisting of methyl, trifluoromethyl, difluoromethyl, and fluoro One of a group, a trichloromethyl group, a dichloromethyl group, a monochloromethyl group, an ethyl group, a n-propyl group, an isopropyl group, a phenyl group, a halogenated phenyl group, and an alkylphenyl group;

n1, n3, m1, m2, m3, R 10, R 11, R 12, R 13, R 14, R 15, L 1, M ₁ are each as defined and selectable range as described above.

R ₄ is selected to N in order to achieve a nitrogen-containing backbone connection, and to provide suitable reaction sites for the synthesis of siRNA conjugate of formula (308). In some embodiments, R ₄ includes an R ₂ linking group or a protected R ₂ linking group, and a functional group capable of forming a structure represented by A59 with a siRNA by a reaction.

In some embodiments, R ₄ comprises a first functional group comprising a phosphite forming a group on the siRNA or nucleoside monomer represented by Nu and a second functional group capable of reacting with a hydroxyl group or an amino group to form a covalent bond or A solid phase carrier joined by the covalent bond. In some embodiments, the first functional group is a phosphoramidite, a hydroxyl group, or a protected hydroxyl group. In some embodiments, the second functional group is a phosphoramidite, a carboxylic acid, or a carboxylate. In some embodiments, the second functional group is a solid support that is linked to other portions of the molecule via a covalent bond, the covalent bond being formed from a hydroxyl group or an amino group. In some embodiments, the solid support is linked via a phosphate bond, a carboxylate bond, or an amide bond. In some embodiments, the solid support is a resin.

In some embodiments, the first functional group contains a hydroxyl group, -OR _k or a group represented by formula (C3); and the second functional group contains formulas (C1), (C2), (C3), (C1' ) or the structure shown in (C3'):

Wherein q ₁ is an integer from ₁ to 4, X is O or NH, M ⁺ is a cation, R _k is a hydroxy protecting group, and SPS is a solid phase carrier.

A site that indicates the covalent attachment of a group.

In some embodiments, the first functional group contains a phosphoramidite functional group, as shown by formula (C3), and the phosphoramidite group can be bonded to a hydroxyl group at any position on the nucleotide, such as a 2' hydroxyl group or The hydroxy group undergoes a coupling reaction to form a phosphite, and is oxidized or vulcanized to form a phosphodiester bond or a phosphorothioate bond represented by the formula A59, and the conjugated molecule is conjugated to the siRNA. At this time, even if the second functional group does not exist, the compound represented by the formula (321) can be conjugated to the nucleotide without affecting the acquisition of the siRNA conjugate represented by the formula (308). In this case, after obtaining the sense strand or the antisense strand of the siRNA via a solid phase synthesis such as phosphoramidite, the compound represented by the formula (321) is reacted with a hydroxyl group at the terminal nucleotide in the nucleotide sequence, The phosphodiester bond or phosphorothioate linkage is formed during subsequent oxidation or vulcanization, and the compound of formula (321) is conjugated to the siRNA.

In some embodiments, the first functional group contains a protected hydroxyl group. In some embodiments, the second functional group comprises a group reactive with a solid support that provides a conjugate molecule comprising a solid support. In some embodiments, the second functional group contains a carboxyl group, a carboxylate or a phosphoramidite, as represented by formula (C1), (C2) or (C3), when the second functional group comprises a carboxyl group or a carboxylate. When the compound represented by the formula (321) is subjected to an esterification reaction or amidation reaction with a solid phase carrier such as a hydroxyl group or an amino group on a resin to form a conjugate having a solid phase carrier linked via a carboxylate bond or an amide bond. Molecule. When the second functional group contains a phosphoramidite functional group, the compound represented by the formula (321) is coupled with a general-purpose solid phase carrier, for example, a hydroxyl group on a resin, and is oxidized to form a solid containing a phosphodiester bond. Conjugated molecule of the phase carrier. Subsequently, the nucleoside monomer is sequentially linked according to the phosphoramidite solid phase synthesis method, and the sense strand or the antisense strand of the siRNA to which the conjugated group is attached is obtained starting from the product after the above-mentioned solid phase carrier is attached. During the solid phase synthesis of phosphoramidite, the first functional group undergoes deprotection and subsequent coupling with a phosphoramidite group on the nucleoside monomer under coupling reaction conditions.

In some embodiments, the first functional group contains a hydroxyl group or a protected hydroxyl group; the second functional group contains a solid phase carrier linked by a carboxylate bond or a solid phase carrier linked by an amide bond, or a phosphate bond The attached solid support is as shown in formula (C1') or (C3'). At this time, the compound represented by the formula (321) is used as a starting point instead of the solid phase carrier, and the nucleoside monomer is sequentially linked according to the solid phase synthesis method of the phosphoramidite to obtain the sense strand or antisense of the siRNA to which the conjugated group is attached. chain. In some embodiments, the carboxylate can be represented as -, carboxylic acid ^- M ⁺ , wherein M ⁺ is a cation, such as one selected from the group consisting of a metal cation, an ammonium cation NH ₄ ⁺ , and an organoammonium cation. In one embodiment, the metal ion is selected from one of the alkali metal ions, such as K ⁺ or Na ⁺ . In order to improve solubility and allow the reaction to proceed smoothly, in some embodiments, the organic ammonium ion is an ammonium cation or a quaternary ammonium cation formed by a tertiary amine, such as an ammonium ion formed by triethylamine or N,N-di Ammonium ion formed by isopropylethylamine. In some embodiments, the carboxylate is a triethylamine carboxylate or an N,N-diisopropylethylamine carboxylate.

In some embodiments, R ₄ comprises a structure of formula (B9), (B10), (B9'), (B10'), (B11), (B12), (B11'), or (B12'):

Wherein q ₁ is an integer from ₁ to 4, q ₂ is an integer from 1 to 10, X is O or NH, M ⁺ is a cation, R _k is a hydroxy protecting group, and SPS is a solid phase carrier.

A site indicating a covalent bond of a group. In some embodiments, q ₁ is 1 or 2. In some embodiments, q ₂ is an integer from 1 to 5. In some embodiments, R ₄ contains a structure represented by formula (B9) or (B10). In some embodiments, R ₄ contains a structure represented by formula (B11) or (B12).

In some embodiments, R _k is Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4'-bismethoxytrityl), TMTr (4 One or more of 4', 4'-trimethoxybenzyl. In some embodiments, R _k may be DMTr, i.e. methoxytrityl, 4,4'-bis (4,4'-dimethoxytrityl).

The definition of L ₁ is as described above.

In some embodiments, L ₁ M ₁ are used to connect the targeting group to the N atom a nitrogen-containing backbone to provide a liver function as a second targeting siRNA conjugate. In some embodiments, L ₁ comprises any one of A1-A26 or a combination thereof.

Based on the above description, it will be readily understood by those skilled in the art that the conjugated molecule can be linked by the above first functional group and optionally the second functional group as compared to the phosphoramidite solid phase synthesis method well known in the art. A second siRNA conjugate to any possible position of the nucleotide sequence, for example, the conjugate molecule is attached to the end of the nucleotide sequence and the conjugate molecule is ligated to the end of the nucleotide sequence. Accordingly, unless otherwise stated, in the following description of the preparation of the conjugation, when referring to the reactions of "deprotection", "coupling", "cap", "oxidation", "vulcanization", etc., it should be understood that The reaction conditions and reagents involved in the known solid phase synthesis method of phosphoramidite nucleic acid are also suitable for these reactions. Exemplary reaction conditions and reagents will be described in detail later. In some embodiments, each S _{1 is} independently M ₁ . In some embodiments, each S _{1 is} independently a group formed by the protection of at least one reactive hydroxyl group of M ₁ by a hydroxy protecting group. In some embodiments, each S _{1 is} independently a group formed by any of the active hydroxyl groups present in M ₁ being protected by a hydroxy protecting group. In some embodiments, any known to those skilled hydroxy protecting groups may be used to protect the reactive hydroxyl groups of M _1. In some embodiments, the protected hydroxy group can be represented by the formula YCOO-, wherein each Y is independently selected from the group consisting of a C ₁ -C ₁₀ alkyl group and a C ₆ -C ₁₀ aryl group, the C _{The 1-} C ₁₀ alkyl group and the C ₆ -C ₁₀ aryl group are optionally substituted by one or more substituents selected from the group consisting of halogen and C ₁ -C6 alkyl groups. In some embodiments, each Y is independently selected from the group consisting of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl , monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halophenyl, and C ₁ -C ₆ alkylphenyl.

In some embodiments, each S _{1 is} independently selected from the group consisting of Formulas A46-A54:

In some embodiments, S ₁ is Formula A49 or A50.

In some embodiments, each Y is independently selected from the group consisting of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, plus One of a propyl group, an isopropyl group, a phenyl group, a halogenated phenyl group, and an alkylphenyl group; for the purpose of simplifying the conjugation molecule of the present disclosure, in some embodiments, Y is a methyl group.

As described above, the preparation method of the second siRNA conjugate further comprises the steps of synthesizing another strand of the siRNA (for example, when the above step synthesizes the siRNA sense strand to which the conjugated group is attached, The phase synthesis method synthesizes the antisense strand of siRNA, and vice versa), separates the sense strand and the antisense strand, and anneals. Specifically, in the separation step, the solid phase carrier linked to the nucleotide sequence and/or the conjugated molecule is cleaved while the necessary protecting group is removed (in this case, the compound represented by the formula (321) Each of the S ₁ groups is converted to a corresponding M ₁ targeting group), the siRNA sense strand (or antisense strand) to which the conjugated group is attached, and the corresponding antisense strand (or sense strand), the sense strand and The antisense strand is annealed to form a double stranded RNA construct, and a second siRNA conjugate is obtained.

In some embodiments, the method of preparing the second siRNA conjugate comprises the steps of: reacting a compound of formula (321) with a sense strand or an antisense strand in the presence of coupling reaction conditions and a coupling reagent Contact with the first nucleoside monomer at the 3' end, such that the compound of formula (321) is attached to the first nucleotide of the sequence, under the conditions of solid phase synthesis of phosphoramidite, according to the desired sense strand or The nucleotide sequence and sequence of the antisense strand are sequentially linked in the direction of 3' to 5' to synthesize the sense strand or the antisense strand of the siRNA; wherein the compound represented by the formula (321) is R ₄ a compound of the formula (321) having a first functional group and a second functional group, the first functional group containing a protected hydroxyl group, and the second functional group having a structure represented by the formula (C1') or (C3'), and the first nucleoside single Prior to bulk attachment, the compound of formula (321) is deprotected; the linkage of each nucleoside monomer includes a four-step reaction of deprotection, coupling, capping, oxidation or sulfuration; obtaining a sense of nucleic acid to which the conjugated molecule is attached Chain or antisense strand; in the case of solid phase synthesis of phosphoramidite, according to the antisense strand or justice The nucleotide sequence and sequence, the nucleoside monomers are sequentially linked in the direction of 3' to 5' to synthesize the antisense strand or the sense strand of the nucleic acid; the linkage of each nucleoside monomer includes deprotection, coupling, and capping , oxidation or sulfurization four-step reaction; removal of the protecting group and cutting with the solid phase carrier, separation and purification to obtain the sense and antisense strands of the nucleic acid, annealing.

In some embodiments, the method of making a second siRNA conjugate comprises the step of nucleating the 3' to 5' direction according to the nucleotide species and sequence of the sense strand or the antisense strand of the double stranded siRNA The glycosides are sequentially linked to synthesize the sense strand and the antisense strand. The linkage of each nucleoside monomer includes four steps of deprotection, coupling, capping, oxidation or sulfurization to obtain a sense strand and linkage attached to the solid support. An antisense strand on a solid support; in the presence of coupling reaction conditions and a coupling reagent, the compound of formula (321) is coupled to a sense strand attached to a solid support or to a solid support. The compound represented by the formula (321) is linked to the sense strand or the antisense strand, wherein the compound of the formula (321) is a formula in which R ₄ contains a first functional group and the first functional group is a phosphoramidite group ( 321) a compound; the protecting group is removed and cleaved with the solid phase vector, and separately isolated and purified, and the sense strand or the antisense strand of the siRNA represented by Nu is annealed, wherein the siRNA is conjugated to the sense strand or the antisense strand Group.

In some embodiments, the P in Formula A59 is linked to the 3' end of the sense strand in the siRNA, and the method of preparing the second siRNA conjugate comprises:

(1) A compound of the formula (321) is removed (wherein the compound of the formula (321) contains a first functional group and a second functional group in R ₄ , the first functional group contains a protected hydroxyl group OR _k , and the second functional group has a formula (C1) a hydroxy protecting group R _k in the compound of the structure shown by ') or (C3'); contacting the product obtained by deprotection with a nucleoside monomer in the presence of a coupling reaction condition and a coupling reagent to obtain a conjugate a nucleoside monomer that is linked to a solid support;

(2) synthesizing a sense strand of siRNA by a phosphoramidite solid phase synthesis method starting from a nucleoside monomer linked to a solid phase carrier by a conjugation molecule;

(3) synthesizing the antisense strand of siRNA by a solid phase synthesis method of phosphoramidite;

(4) The sense and antisense strands of the siRNA were isolated and annealed to obtain a second siRNA conjugate.

Wherein, in step (1), the method of removing the formula (321) R _k protecting group in the compound comprising the deprotection conditions, the formula (321) contacting the compound with a deprotecting agent. Deprotection conditions include a temperature of 0-50 ° C, in some embodiments 15-35 ° C, a reaction time of 30-300 seconds, in some embodiments 50-150 seconds, and a deprotection reagent may be selected from trifluoroacetic acid. One or more of trichloroacetic acid, dichloroacetic acid, monochloroacetic acid, in some embodiments dichloroacetic acid. The molar ratio of deprotecting agent to the compound of formula (321) is from 10:1 to 1000:1, and in some embodiments from 50:1 to 500:1.

The coupling reaction conditions and the coupling reagent may use any conditions and reagents suitable for the above coupling reaction. In some embodiments, the same conditions and reagents as for the coupling reaction in the solid phase synthesis method employed can be used.

In some embodiments, the conditions of the coupling reaction comprise a reaction temperature of from 0 to 50 °C, and in some embodiments from 15 to 35 °C. The molar ratio of the compound of the formula (321) to the nucleoside monomer is from 1:1 to 1:50, in some embodiments from 1:2 to 1:5; the molar ratio of the compound of the formula (321) to the coupling reagent may be one. 1-1:50, in some embodiments 1:3 to 1:10, reaction time 200-3000 seconds, and in some embodiments 500-1500 seconds. The coupling reagent is selected from one or more of 1H-tetrazole, 5-ethylthio 1H-tetrazole, 5-benzylthio 1H-tetrazole, and in some embodiments 5-ethion Base 1H-tetrazole. The coupling reaction can be carried out in an organic solvent selected from one or more of anhydrous acetonitrile, anhydrous DMF, anhydrous dichloromethane, and in some embodiments anhydrous acetonitrile. The organic solvent is used in an amount of from 3 to 50 L/mol, and in some embodiments from 5 to 20 L/mol, relative to the compound of the formula (321).

In the step (2), the method of solid phase synthesis of phosphoramidite nucleic acid is used to synthesize the nucleoside monomer which is ligated to the solid phase carrier by the conjugation molecule, and is synthesized in the direction of 3′-5′. The sense strand S of the two siRNA conjugates. At this point, the conjugate group is attached to the 3' end of the resulting sense strand.

Other conditions for solid phase synthesis described in steps (2) and (3) include nucleoside monomer deprotection conditions, type and amount of deprotection reagent, coupling reaction conditions, type and amount of coupling reagent, cap reaction The conditions, the type and amount of the capping reagent, the oxidation reaction conditions, the type and amount of the oxidizing reagent, the vulcanization reaction conditions, the vulcanization reagent and the amount are various reagents, amounts and conditions conventionally used in the art.

For example, in some embodiments, the solid phase synthesis described in steps (2) and (3) can use the following conditions:

Nucleoside monomer deprotection conditions include a temperature of 0-50 ° C, in some embodiments 15-35 ° C, a reaction time of 30-300 seconds, in some embodiments 50-150 seconds, a deprotection reagent can be selected One or more of trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, monochloroacetic acid, in some embodiments dichloroacetic acid. The molar ratio of the deprotecting agent to the 4,4'-dimethoxytrityl protecting group on the solid support is from 2:1 to 100:1, and in some embodiments from 3:1 to 50:1.

The coupling reaction conditions include a temperature of 0-50 ° C, in some embodiments 15-35 ° C, a molar ratio of the nucleic acid sequence attached to the nucleoside monomer on the solid support is 1:1 to 1:50, in some In embodiments: 1:5 to 1:15; the molar ratio of the nucleic acid sequence and the coupling reagent attached to the solid support is from 1:1 to 1:100, and in some embodiments from 1:50 to 1:80, The reaction time and the choice of coupling reagent are the same as described above.

The cap reaction conditions include a temperature of 0-50 ° C, in some embodiments 15-35 ° C, a reaction time of 5-500 seconds, and in some embodiments 10-100 seconds, the capping agent is selected in the same manner as previously described. The molar ratio of the total amount of capping reagent to the nucleic acid sequence attached to the solid support is from 1:100 to 100:1, and in some embodiments from 1:10 to 10:1. In the case where the capping reagent uses an equimolar amount of acetic anhydride and N-methylimidazole, the molar ratio of the nucleic acid sequence attached to the acetic anhydride, the N-methylimidazole, and the solid phase carrier is 1:1:10-10:10. : 1, in some embodiments from 1: 1: 2 to 2: 2: 1.

The oxidation reaction conditions include a temperature of 0-50 ° C, in some embodiments 15-35 ° C, a reaction time of 1-100 seconds, in some embodiments 5-50 seconds, and an oxidizing agent, in some embodiments, iodine. (In some embodiments, provided in the form of iodine water). The molar ratio of the oxidizing reagent to the nucleic acid sequence attached to the solid support in the coupling step may range from 1:1 to 100:1, and in some embodiments from 5:1 to 50:1. In some embodiments, the oxidation reaction is carried out in a mixed solvent of tetrahydrofuran:water:pyridine = 3:1:1 to 1:1:1. The sulfurization reaction conditions include a temperature of 0 to 50 ° C, in some embodiments, 15 to 35 ° C, a reaction time of 50 to 2000 seconds, and in some embodiments, 100 to 1000 seconds, and the sulfurization reagent is hydrogenated in some embodiments. Xanthogen. The molar ratio of the sulfurizing reagent to the nucleic acid sequence attached to the solid support in the coupling step may range from 10:1 to 1000:1, and in some embodiments from 10:1 to 500:1. In some embodiments, the sulfurization reaction is carried out in a mixed solvent of acetonitrile:pyridine = 1:3 to 3:1.

After joining all of the nucleoside monomers, prior to annealing, the method further comprises isolating the sense and antisense strands of the siRNA. Methods for isolation are well known to those skilled in the art and generally involve cleavage of the resulting nucleotide sequence from a solid support, removal of protecting groups on bases, phosphates and ligands, purification and desalting. .

The cleavage of the synthesized nucleotide sequence from the solid phase support and removal of the protecting group on the base, on the phosphate group and on the ligand can be carried out according to conventional cleavage and deprotection methods in siRNA synthesis. For example, the obtained nucleotide sequence linked to the solid phase carrier is contacted with concentrated aqueous ammonia; during deprotection, the protecting group YCOO- of the A46-A54 group is converted into a hydroxyl group, and the S ₁ group is converted into a corresponding one. The M ₁ group produces a conjugate of the formula (308). Wherein, the concentrated ammonia water may be 25-30% by weight of ammonia water, and the amount of concentrated ammonia water may be 0.2 ml/μmol-0.8 ml/μmol compared with the target siRNA sequence.

When at least one 2'-TBDMS protection is present on the synthesized nucleotide sequence, the method further comprises contacting the nucleotide sequence of the solid phase removal medium with triethylamine trihydrofluoride to remove the 2'-TBDMS protection. At this time, the obtained target siRNA sequence has a corresponding nucleoside of a free 2'-hydroxy group. The amount of the pure triethylamine trihydrofluorate is 0.4 ml/μmol to 1.0 ml/μmol as compared with the target siRNA sequence. Thus, the siRNA conjugate of the formula (308) can be obtained.

Methods of purification and desalting are well known to those skilled in the art. For example, the preparative ion chromatography purification column can be used to purify the nucleic acid by gradient elution with NaBr or NaCl; after product collection and combination, the reverse phase chromatography purification column can be used for desalting.

In the second siRNA conjugate thus obtained, a non-bridging oxygen atom or a sulfur atom in a phosphodiester bond or a phosphorothioate diester bond between nucleotides substantially binds to a sodium ion, and a second siRNA is conjugated. The substance is basically present in the form of a sodium salt. Other forms of the second siRNA conjugate can be obtained by replacing the sodium ion with a hydrogen ion and/or other cation using well known ion exchange methods. The cation is as previously described.

The purity and molecular weight of the nucleic acid sequence can be detected at any time during the synthesis to better control the quality of the synthesis. Such detection methods are well known to those skilled in the art. For example, nucleic acid purity can be detected by ion exchange chromatography and molecular weight can be determined by LC-MS chromatography.

Methods of annealing are also well known to those skilled in the art. For example, the synthesized sense strand (S chain) and the antisense strand (AS chain) can be simply mixed in an equimolar ratio in water for injection to 70-95 ° C, followed by cooling at room temperature to form a double bond through hydrogen bonding. Chain structure. This gives a second siRNA conjugate.

After obtaining the conjugate of the present disclosure, in some embodiments, the synthesized second siRNA conjugate can also be characterized by molecular weight detection or the like using methods such as LC/MS chromatography to determine the synthesis. The siRNA conjugate is a second siRNA conjugate designed for the target, and the sequence of the synthesized siRNA matches the sequence of the siRNA to be synthesized, for example, one of the sequences listed in Table 2.

The compound represented by the formula (321) can be obtained by the following production method: the method comprises the compound represented by the formula (313) in an organic solvent under an esterification reaction condition, and in the presence of a base and an ester-forming catalyst. The cyclic acid anhydride is contacted, ion exchanged, and the compound represented by the formula (321) is obtained:

Wherein the definitions and selectable ranges of n1, n3, m1, m2, m3, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ , R ₁₅ , L ₁ , S ₁ are as defined above;

R ₆ is a group which provides R ₄ in the formula (321). In some embodiments, R ₆ has the structure shown by formula (A61):

Wherein, R _i is possible to achieve the N-linked nitrogen-containing backbone, and R _k O connection has a connection to any free hydroxyl group, R _k is a hydroxy protecting group. At this time, it is obtained that R ₄ contains a first functional group and a second functional group as a hydroxy protecting group, and the second functional group contains a compound of the formula (321) having a structure represented by the formula (C1) or (C2).

The esterification reaction conditions include a reaction temperature of 0-100 ° C and a reaction time of 8-48 hours. In some embodiments, the esterification reaction conditions are a reaction temperature of 10-40 ° C and a reaction time of 20-30. hour.

In some embodiments, the organic solvent comprises an epoxy solvent, an ether solvent, a halogenated alkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. One or more of them. In some embodiments, the epoxy solvent is dioxane and/or tetrahydrofuran, the ether solvent is diethyl ether and/or methyl tert-butyl ether, and the halogenated alkane solvent is dichloromethane, three One or more of methyl chloride and 1,2-dichloroethane. In some embodiments, the organic solvent is dichloromethane. The organic solvent is used in an amount of from 3 to 50 L/mol, and in some embodiments from 5 to 20 L/mol, relative to the compound of the formula (313).

In some embodiments, the cyclic anhydride is one of succinic anhydride, glutaric anhydride, adipic anhydride, or pimelic anhydride, and in some embodiments is succinic anhydride. The molar ratio of the cyclic anhydride to the compound of formula (313) is from 1:1 to 10:1, and in some embodiments from 2:1 to 5:1.

The ester-forming catalyst may be any catalyst that catalyzes the esterification reaction, for example, the catalyst may be 4-dimethylaminopyridine. The molar ratio of the catalyst to the compound of formula (313) is from 1:1 to 10:1, and in some embodiments from 2:1 to 5:1.

In some embodiments, the base can be any inorganic base, organic base, or a combination thereof. In view of solubility and product stability, the base may be, for example, a tertiary amine organic base. In some embodiments, the tertiary amine organic base is triethylamine or N,N-diisopropylethylamine. The molar ratio of the tertiary amine organic base to the compound of formula (313) is from 1:1 to 20:1, and in some embodiments from 3:1 to 10:1.

The ion exchange is the conversion of a compound of formula (321) to the desired carboxylic acid or carboxylate form, and methods of ion exchange are known to those skilled in the art, and suitable ion exchange solutions and exchange conditions can be used to obtain the foregoing. The cation is a M ⁺ conjugation molecule and will not be described in detail herein. In some embodiments, the ion exchange reaction is carried out using a solution of triethylamine phosphate solution having a concentration of 0.2-0.8 M, and in some embodiments 0.4-0.6 M, relative to the formula (313) A compound, the triethylamine phosphate solution is used in an amount of from 3 to 6 L/mol, and in some embodiments from 4 to 5 L/mol.

The compound of formula (321) can be isolated from the reaction mixture using any suitable separation method. In some embodiments, the solvent can be removed by evaporation, followed by chromatographic separation of the compound of formula (321), for example, separation can be carried out using the following chromatographic conditions: (1) normal phase purified silica gel: 200-300 mesh silica gel filler, containing 1wt ‰ triethylamine in dichloromethane: methanol = 100:18-100:20 gradient elution; or (2) reversed phase purification: C18, C8 reverse phase packing, using methanol: acetonitrile = 0.1: 1-1: 0.1 Gradient elution. In some embodiments, the solvent can be removed directly to provide a crude product of the compound of formula (321) which can be used directly in the subsequent reaction.

In some embodiments, the method of preparing the compound of formula (321) further comprises the product of the above ion exchange reaction in the presence of a condensing agent and a tertiary amine organic base in an organic solvent under condensation reaction conditions. Further contacting with a solid phase carrier containing an amino group or a hydroxyl group. In this case, a compound of the formula (321) in which R ₄ contains a first functional group and a second functional group, a first functional group contains a hydroxy protecting group, and a second functional group contains a structure represented by the formula (C1′) is obtained.

The solid phase support is one of the vectors used in solid phase synthesis of siRNA, some of which are well known to those skilled in the art. For example, the solid support can be selected from a solid support containing reactive hydroxyl or amino functional groups, and in some embodiments, the solid support is an amino resin or a hydroxy resin. To facilitate subsequent solid phase synthesis of the nucleic acid, the amino or hydroxy resin, in some embodiments, has the following parameters: particle size 100-400 mesh, surface amino or hydroxyl loading of 0.2-0.5 mmol/g. The ratio of the compound represented by the formula (321) to the solid phase carrier is from 10 to 400 μmol of the compound per gram of the solid phase carrier (μmol/g). In some embodiments, the ratio of the compound represented by the formula (321) to the solid phase carrier is from 50 to 200 μmol/g.

The organic solvent may be any suitable solvent or mixed solvent known to those skilled in the art. In some embodiments, the organic solvent is acetonitrile, an epoxy solvent, an ether solvent, a halogenated alkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropyl One or more of ethylamine. In some embodiments, the epoxy solvent is dioxane and/or tetrahydrofuran, the ether solvent is diethyl ether and/or methyl tert-butyl ether, and the halogenated alkane solvent is dichloromethane, three One or more of methyl chloride and 1,2-dichloroethane. In some embodiments, the organic solvent is acetonitrile. The organic solvent is used in an amount of from 20 to 200 L/mol, and in some embodiments from 50 to 100 L/mol, relative to the compound of the formula (321).

The condensing agent may be benzotriazol-1-yl-oxytripyrrolidinyl hexafluorophosphate, 3-diethoxyphosphoryl-1,2,3-oxazolyl 4(3H)-one and / or O-benzotriazole-tetramethylurea hexafluorophosphate, in some embodiments O-benzotriazole-tetramethylurea hexafluorophosphate. The molar ratio of the condensing agent to the compound of formula (321) is from 1:1 to 20:1, and in some embodiments from 1:1 to 5:1.

In some embodiments, the tertiary amine organic base is triethylamine and/or N,N-diisopropylethylamine, in some embodiments N,N-diisopropylethylamine; The molar ratio of the tertiary amine organic base to the compound of formula (321) is from 1:1 to 20:1, and in some embodiments from 1:1 to 5:1.

In some embodiments, the method for preparing the compound of the formula (321) may further comprise contacting the obtained condensation product with a capping reagent and an acylation catalyst in an organic solvent under a cap reaction condition, and separating the compound represented by the formula (321). compound of. The capping reaction serves to remove any reactive functional groups that have not been fully reacted to avoid the formation of unnecessary by-products in subsequent reactions. The conditions for the cap reaction include a reaction temperature of 0-50 ° C, in some embodiments 15-35 ° C, a reaction time of 1-10 h, and in some embodiments 3-6 h. The capping reagent can use a capping reagent used in siRNA solid phase synthesis, and capping reagents used in siRNA solid phase synthesis are well known to those skilled in the art.

In some embodiments, the cap reagent consists of cap reagent 1 (cap1) and cap reagent 2 (cap2), wherein cap reagent A is N-methylimidazole, in some embodiments N-methylimidazole Provided as a mixed solution of pyridine/acetonitrile wherein the volume ratio of pyridine to acetonitrile is from 1:10 to 1:1, in some embodiments from 1:3 to 1:1, the total volume of pyridine and acetonitrile and N-A The volume of the imidazole is from 1:1 to 10:1, and in some embodiments from 3:1 to 7:1. The capping reagent B is acetic anhydride, and in some embodiments is provided as a solution of acetic anhydride in acetonitrile, wherein the volume of acetic anhydride and acetonitrile is from 1:1 to 1:10, and in some embodiments, 1:2- 1:6.

In some embodiments, the ratio of the volume of the pyridine/acetonitrile mixed solution of N-methylimidazole to the mass of the compound of formula (321) is from 5 ml/g to 50 ml/g, and in some embodiments, 15 ml/g- 30ml/g. The ratio of the volume of the acetic anhydride in acetonitrile solution to the mass of the compound of formula (321) is from 0.5 ml/g to 10 ml/g, and in some embodiments from 1 ml/g to 5 ml/g.

In some embodiments, the capping reagent uses an equimolar amount of acetic anhydride and N-methylimidazole. The organic solvent is one of acetonitrile, an epoxy solvent, an ether solvent, a halogenated alkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. Or a variety. In some embodiments, the organic solvent is acetonitrile. The organic solvent is used in an amount of 10 to 50 L/mol, and in some embodiments, 5 to 30 L/mol, relative to the compound of the formula (321).

The acylation catalyst may be selected from any catalyst useful for ester-forming condensation or amide condensation, such as a basic heterocyclic compound. In some embodiments, the acylation catalyst is 4-dimethylaminopyridine. The mass ratio of the catalyst to the compound of formula (321) is from 0.001:1 to 1:1, and in some embodiments from 0.01:1 to 0.1:1.

The compound of formula (321) can be isolated from the reaction mixture using any suitable separation method. In some embodiments, the compound of formula (321), which is selected from the group consisting of acetonitrile, dichloromethane, can be obtained by extensive washing with an organic solvent and filtration to remove unreacted reactants, excess capping reagents, and other impurities. Methanol, in some embodiments acetonitrile.

In some embodiments, the method for preparing a conjugate molecule of formula (321) comprises reacting a compound of formula (313) with an organic solvent, under coupling reaction conditions, and in the presence of a coupling reagent. The phosphoryl diamine is contacted to obtain a compound represented by the formula (321). In this case, a compound of the formula (321) in which R ₄ contains a first functional group and a second functional group, a first functional group contains a hydroxy protecting group, and a second functional group contains a structure represented by the formula (C3) is obtained.

In some embodiments, the coupling reaction conditions include a temperature of 0 to 50 ° C, for example, 15 to 35 ° C, and a molar ratio of the compound of the formula (313) to the phosphorous diamine may be 1:1 to 1:50, for example, The molar ratio of the compound of the formula (313) to the coupling reagent may be from 1:1 to 1:100, for example from 1:50 to 1:80; and the reaction time may be from 200 to 3000 seconds. For example, 500-1500 seconds. As the phosphoramidide, for example, bis(diisopropylamino)(2-cyanoethoxy)phosphine, which is commercially available or can be obtained by a method known in the art, can be used. The coupling reagent is selected from one or more of 1H-tetrazole, 5-ethylthio 1H-tetrazole, 5-benzylthio 1H-tetrazole, for example, 5-ethylthio 1H-tetra Azole. The coupling reaction can be carried out in an organic solvent selected from one or more of anhydrous acetonitrile, anhydrous DMF, anhydrous dichloromethane, such as anhydrous acetonitrile. In some embodiments, the organic solvent is used in an amount of from 3 to 50 L/mol, for example, from 5 to 20 L/mol, relative to the compound of formula (313). By carrying out the coupling reaction, a hydroxyl group in the compound of the formula (313) is reacted with a phosphorous diamine to form a phosphoramidite group. In some embodiments, the solvent can be removed directly to provide a crude product of the compound of formula (321) which can be used directly in the subsequent reaction.

In some embodiments, the method of preparing a compound of formula (321) further comprises the steps of: further reacting the isolated product with a hydroxyl group under coupling reaction conditions, in an organic solvent, and in the presence of a coupling reagent. The solid support is contacted. Subsequently, the compound of the formula (321) is isolated by a cap reaction and an oxidation reaction. In this case, a compound of the formula (321) having a first functional group and a second functional group in R ₄ , a hydroxy protecting group in the first functional group, and a second functional group having a structure represented by the formula (C3′) is obtained.

In some embodiments, the solid support is a solid phase support known in the art that can be used for solid phase synthesis of nucleic acids, for example, can be a commercially available universal solid support after deprotection (

UnyLinker ^TM 300 Oligonucleotide Synthesis Support, Kinovate Life Sciences, structure as shown in Equation B80):

Deprotection reactions are well known to those skilled in the art. In some embodiments, the deprotection conditions include a temperature of 0-50 ° C, such as 15-35 ° C; a reaction time of 30-300 seconds, such as 50-150 seconds. The deprotecting agent can be selected from one or more of trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, monochloroacetic acid, and in some embodiments, the deprotecting reagent is dichloroacetic acid. The molar ratio of the deprotecting agent to the -DMTr(4,4'-dimethoxytrityl) protecting group on the stationary phase is from 2:1 to 100:1, for example from 3:1 to 50:1. By performing the deprotection, a reactive free hydroxyl group is obtained on the surface of the solid phase carrier to facilitate the next coupling reaction.

The coupling reaction conditions and the choice of coupling reagent can be as described above. By carrying out the coupling reaction, the free hydroxyl group formed in the deprotection reaction reacts with the phosphoramidite group to form a phosphite linkage.

In some embodiments, the cap reaction conditions comprise a temperature of 0-50 ° C, such as 15-35 ° C, a reaction time of 5 to 500 seconds, such as 10-100 seconds, and the cap reaction is carried out in the presence of a capping agent. The selection and amount of cap reagent can be as described above.

The oxidation reaction conditions include a temperature of 0 to 50 ° C, for example, 15 to 35 ° C, a reaction time of 1 to 100 seconds, for example, 5 to 50 seconds, and an oxidizing agent such as iodine (in some embodiments, iodine) Provided in the form of water). In some embodiments, the molar ratio of oxidizing agent to phosphite groups is from 1:1 to 100:1, such as from 5:1 to 50:1. In some embodiments, the oxidation reaction is carried out in a mixed solvent of tetrahydrofuran:water:pyridine = 3:1:1 to 1:1:1.

In some embodiments, R ₆ is one of the groups of formula B7 or B8,

Where q ₂ is defined as described above,

In this case, the compound represented by the formula (313) can be obtained by the following production method: in an organic solvent, under the conditions of an amide formation reaction, and in the presence of an amide reaction condensing agent and a tertiary amine organic base, The compound shown by 314) is contacted with a compound of the formula (A-1) or a compound of the formula (A-2), followed by separation:

Wherein n1, n3, m1, m2, m3, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ , R ₁₅ , L ₁ , S ₁ , q ₂ and R _k are each defined and selected as As mentioned before.

The amide forming reaction conditions may include a reaction temperature of 0-100 ° C and a reaction time of 1-48 hours. In some embodiments, the amide forming reaction conditions are a reaction temperature of 10-40 ° C and a reaction time of 2 16 hours.

In some embodiments, the organic solvent is an alcohol solvent, an epoxy solvent, an ether solvent, a halogenated alkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diiso One or more of propyl ethylamine. The alcohol solvent is, in some embodiments, one or more of methanol, ethanol, propanol, and in some embodiments, ethanol. The epoxy-based solvent is, in some embodiments, dioxane and/or tetrahydrofuran. The ether solvent is, in some embodiments, diethyl ether and/or methyl tert-butyl ether. The halogenated alkane solvent is, in some embodiments, one or more of dichloromethane, chloroform, and 1,2-dichloroethane. In some embodiments, the organic solvent is dichloromethane. The organic solvent is used in an amount of from 3 to 50 L/mol, and in some embodiments from 3 to 20 L/mol, relative to the compound of the formula (314).

In some embodiments, the amide-forming condensing agent is benzotriazol-1-yl-oxytripyrrolidinyl hexafluorophosphate, 3-diethoxyphosphoryl-1,2,3-benzene Azole 4(3H)-one, 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride, 2-ethoxy-1-ethoxycarbonyl- 1,2-Dihydroquinoline (EEDQ) or O-benzotriazole-tetramethylurea hexafluorophosphate, in a further embodiment 3-diethoxyphosphoryl-1,2,3 - benzoxazole 4(3H)-one. The molar ratio of the amide-forming condensing agent to the compound of formula (314) may range from 1:1 to 10:1, and in some embodiments from 2.5:1 to 5:1.

In some embodiments, the tertiary amine organic base is triethylamine or N,N-diisopropylethylamine, in some embodiments N,N-diisopropylethylamine. The molar ratio of the tertiary amine organic base to the compound of formula (314) is from 3:1 to 20:1, and in some embodiments from 5:1 to 10:1.

Compounds of formula (A-1) and formula (A-2) can be prepared by any suitable means. For example, when R _k is a DMTr group, a compound of formula (A-1) can be prepared by reacting calcium glycerate with DMTrCl; similarly, 3-amino-1,2-propanediol can be first contacted with a cyclic anhydride, followed by The compound of formula (A-2) is then prepared by reaction with DMTrCl, which may be a cyclic anhydride having from 4 to 13 carbon atoms, and in some embodiments from 4 to 8. It will be readily understood by those skilled in the art that the choice of the cyclic anhydride corresponds to a different value of q ₂ in the compound of (A-2), for example, when the cyclic anhydride is succinic anhydride, q ₂ =1, When the cyclic anhydride is glutaric anhydride, q ₂ = 2, and so on.

In some variations, the compound of formula (313) can also be prepared by reacting a compound of formula (314) with the cyclic anhydride, 3-amino-1,2-propanediol, and DMTrCl in that order. Those skilled in the art will readily appreciate that these variations do not affect the structure and function of the compound of formula (313), and that such modifications are readily accomplished by those skilled in the art based on the above methods.

Similarly to the above, the compound of formula (313) can be isolated from the reaction mixture using any suitable separation method. In some embodiments, the solvent can be removed by evaporation, followed by chromatographic separation of the compound of formula (313), for example, separation can be carried out using two chromatographic conditions: (1) normal phase purified silica gel: 200-300 mesh silica gel, Using petroleum ether: ethyl acetate: dichloromethane: N,N-dimethylformamide = 1:1:1:0.5-1:1:1:0.6 gradient elution; and (2) reversed phase purification: C18 , C8 reverse phase packing, eluting with a gradient of methanol: acetonitrile = 0.1: 1-1: 0.1. In some embodiments, the solvent can be removed directly to provide a crude product of the compound of formula (313) which can be used directly in the subsequent reaction.

In some embodiments, the compound of formula (314) can be obtained by a process comprising: contacting a compound of formula (315) with a haloacetic acid in an organic solvent under deprotection conditions. And then separate:

Wherein R _{7 is} selected from the group represented by formula (330), (331), (332) or (333), and in some embodiments, the structure of R ₇ is as shown in formula (330):

n1, n3, m1, m2, m3, R 10, R 11, R 12, R 13, R 14, R 15, L 1, S ₁ and are each as defined selectable range as described above.

The haloacetic acid can be selected from one or more of the group consisting of dichloroacetic acid, trichloroacetic acid, monochloroacetic acid, and trifluoroacetic acid, and in some embodiments, dichloroacetic acid.

The deprotection reaction conditions include a reaction temperature of 0-100 ° C, a reaction time of 0.1-24 hours, in some embodiments a reaction temperature of 10-40 ° C, and a reaction time of 0.5-16 hours.

In some embodiments, the organic solvent is an epoxy solvent, an ether solvent, a halogenated alkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. One or more of them. The epoxy-based solvent is, in some embodiments, dioxane and/or tetrahydrofuran, and in some embodiments is diethyl ether and/or methyl tert-butyl ether, the halogenated alkane solvent is in some In one embodiment one or more of dichloromethane, chloroform and 1,2-dichloroethane, in some embodiments, the organic solvent is dichloromethane. The organic solvent is used in an amount of from 3 to 50 L/mol, and in some embodiments from 5 to 20 L/mol, relative to the compound of the formula (315).

The molar ratio of the haloacetic acid to the compound of formula (315) is from 5:1 to 100:1, and in some embodiments from 10:1 to 50:1.

Similarly to the above, the compound of formula (314) can be isolated from the reaction mixture using any suitable separation method. In some embodiments, the solvent can be removed by evaporation, followed by chromatographic separation of the compound of formula (314), for example, separation can be carried out using two chromatographic conditions: (1) normal phase purified silica gel: 200-300 mesh silica gel filler, Gradient elution with dichloromethane:methanol = 100:30-100:40; and (2) reverse phase purification: C18, C8 reversed phase elution eluting with a gradient of methanol: acetonitrile = 0.1:1 to 1:0.1. In some embodiments, the solvent can be removed directly to provide a crude product of the compound of formula (314) which can be used directly in the subsequent reaction.

The compound represented by the formula (315) can be obtained by the following production method: the method comprises the formula (317) in an organic solvent in the presence of an amide reaction condensing agent and a tertiary amine organic base under condensation reaction conditions. The compound shown is contacted with a compound of formula (316) and subsequently isolated:

Wherein the definitions and selectable ranges of n1, n3, m1, m2, m3, R ₇ , R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ , R ₁₅ , L ₁ , S ₁ are as defined above .

The compound of the formula (316) can be, for example, a compound disclosed in J. Am. Chem. Soc. 2014, 136, 16958-16961, or the compound of the formula (316) can be produced by a person skilled in the art by various methods, for example, Certain compounds of formula (316) are prepared by reference to the process disclosed in Example 1 of U.S. Patent No. 8,100,062, B2, the entire disclosure of which is incorporated herein in its entirety.

In some embodiments, the condensation reaction conditions comprise a reaction temperature of 0-100 ° C, a reaction time of 0.1-24 hours, in some embodiments a reaction temperature of 10-40 ° C, and a reaction time of 0.5-16 hours.

The molar ratio of the compound of formula (316) to the compound of formula (317) may range from 2:1 to 10:1, and in some embodiments from 2.5:1 to 5:1.

In some embodiments, the organic solvent is acetonitrile, an epoxy solvent, an ether solvent, a halogenated alkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropyl One or more of ethylamines, which in some embodiments are dioxane and/or tetrahydrofuran, and in some embodiments, diethyl ether and/or methyl tert-butyl The ether, the halogenated alkane solvent, in some embodiments, one or more of dichloromethane, chloroform, and 1,2-dichloroethane, in some embodiments, the organic solvent is acetonitrile . The organic solvent is used in an amount of from 3 to 50 L/mol, and in some embodiments from 5 to 20 L/mol, relative to the compound of the formula (317).

The amide-forming reaction condensing agent is benzotriazol-1-yl-oxytripyrrolidinylphosphorus hexafluorophosphate, 3-diethoxyphosphoryl-1,2,3-oxazolyl 4(3H)- Ketone (DEPBT), O-benzotriazole-tetramethylurea hexafluorophosphate or 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride In some embodiments is 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride. The molar ratio of the amide-forming reaction condensing agent to the compound of the formula (317) is from 2:1 to 10:1, and in some embodiments from 2.5:1 to 5:1.

The tertiary amine organic base is N-methylmorpholine, triethylamine or N,N-diisopropylethylamine, in some embodiments N-methylmorpholine; the tertiary amine The molar ratio of the organic base to the compound of formula (317) is from 3:1 to 20:1, and in some embodiments from 5:1 to 10:1.

Similarly to the above, the compound of formula (315) can be isolated from the reaction mixture using any suitable separation method. In some embodiments, the solvent can be removed by evaporation, followed by chromatographic separation of the compound of formula (315). For example, separation can be carried out using two chromatographic conditions: (1) normal phase purified silica gel: 200-300 mesh silica gel filler, used Gradient elution with dichloromethane:methanol = 100:5-100:7; and (2) reverse phase purification: C18, C8 reversed phase elution eluting with a gradient of methanol: acetonitrile = 0.1:1 to 1:0.1. In some embodiments, the solvent can be removed directly to provide a crude product of formula (315) which can be used directly in the subsequent reaction.

In some embodiments, a compound of formula (317) is reacted in a single reaction with a sufficient amount of a compound of formula (316) to form the desired compound of formula (315), in which case the individual S ₁ -L ₁ moieties are identical to each other. In some embodiments, may be necessary, the compound (317) with a different batch of the compound of formula (316) by the formula, i.e. a compound of L ₁ and / or S ₁ different from formula (316) reacts so that the resulting formula (315) The compound contains two or more kinds of S ₁ and/or L ₁ . For example, for 1 eq of a compound of formula (317), it may be first contacted with 2 eq of the first compound of formula (316), and the first S ₁ -L may be attached to the two terminal primary amine groups of the compound of formula (317). Part ₁ , followed by contacting it with a compound of the second formula (316) of (n3+n1-1) eq (the definitions and ranges of values for n3 and n1 are as described above), in the compound of formula (317) The second S ₁ -L ₁ moiety is attached to the (n3+n1-1) secondary amine group.

In some embodiments, the compound of formula (317) can be obtained by the following preparation method: the method comprises the compound of formula (318) and an aqueous solution of methylamine under deprotection conditions in the presence of an organic solvent. Contact, followed by separation:

Wherein, n1, n3, m1, m2 , m3, R 7, R 10, R 11, R 12, R 13, R 14, R ₁₅ are each as defined and selectable range as described above.

The deprotection reaction conditions include a reaction temperature of 0 to 150 ° C, a reaction time of 5 to 72 hours, in some embodiments, a reaction temperature of 20 to 80 ° C, and a reaction time of 10 to 30 hours.

The organic solvent is selected from the group consisting of alcohols, in some embodiments one of methanol, ethanol, and isopropanol, and in some embodiments methanol; the organic solvent is used in an amount of 1 relative to the compound of formula (318) -20 L/mol, in some embodiments from 1.5 to 10 L/mol.

The concentration of the aqueous methylamine solution may be 30-40% by mass, and the molar ratio of methylamine to the compound represented by the formula (318) may be 10:1 to 500:1, and in some embodiments, 50:1-200. : 1.

Similarly to the above, the compound of formula (317) can be isolated from the reaction mixture using any suitable separation method. In some embodiments, the solvent can be removed by evaporation, followed by chromatographic separation of the compound of formula (317). For example, separation can be carried out using two chromatographic conditions: normal phase purification of silica gel: (1) 200-300 mesh silica gel filler, used Dichloromethane:methanol:aqueous ammonia (25 wt%) = 1:1:0.05-1:1:0.25 gradient elution; and (2) reverse phase purification: C18, C8 reversed phase packing, using methanol: acetonitrile = 0.1:1 -1:0.1 gradient elution. In some embodiments, the solvent can be removed directly to provide a crude product of the compound of formula (317) which can be used directly in the subsequent reaction.

In some embodiments, the compound of formula (318) can be obtained by the following preparation method: the method comprises the compound of formula (319) and triphenyl chloride in the presence of an organic solvent under the substitution reaction conditions. Methane (TrCl), diphenylethylphenylchloromethane, phenyldiethylphenylchloromethane or triethylphenylchloromethane, in some embodiments triphenylchloromethane (TrCl) contact, followed by separation:

Wherein, n1, n3, m1, m2 , m3, R 10, R 11, R 12, R 13, R 14, R ₁₅ are each as defined and selectable range as described above.

The substitution reaction conditions may include a reaction temperature of 0-100 ° C and a reaction time of 5 to 72 hours. In some embodiments, the reaction conditions include a reaction temperature of 10 to 40 ° C and a reaction time of 10 to 30 hours.

Triphenylchloromethane (TrCl), diphenylethylphenylchloromethane, phenyldiethylphenylchloromethane or triethylphenylchloromethane are commercially available, triphenylchloromethane (TrCl), diphenyl The molar ratio of phenylphenylchloromethane, phenyldiethylphenylchloromethane or triethylphenylchloromethane to the compound of formula (319) may range from 1:1 to 10:1, and in some embodiments, 1 1-3:1.

The organic solvent may be one of an epoxy solvent, an ether solvent, a halogenated alkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine or A variety. The epoxy-based solvent is, in some embodiments, dioxane and/or tetrahydrofuran, and in some embodiments is diethyl ether and/or methyl tert-butyl ether, the halogenated alkane solvent is in some In one embodiment is one or more of dichloromethane, chloroform and 1,2-dichloroethane; in some embodiments, the organic solvent is dichloromethane. The organic solvent may be used in an amount of from 3 to 50 L/mol, and in some embodiments from 5 to 20 L/mol, relative to the compound of the formula (319).

Similarly to the above, the compound of formula (318) can be isolated from the reaction mixture using any suitable separation method. In some embodiments, the solvent can be removed by evaporation, followed by chromatographic separation of the compound of formula (318). For example, the following two chromatographic conditions can be used for separation: (1) normal phase purification silica gel: 200-300 mesh silica gel filler, used Gradient elution with methanol:dichloromethane = 0.01:1 -0.5:1; or gradient elution with methanol:dichloromethane:ethyl acetate:petroleum=0.1:1:1:1:1:1:1:1 . And (2) reverse phase purification: C18, C8 reverse phase packing, eluting with a gradient of methanol: acetonitrile = 0.1:1 to 1:0.1. In some embodiments, the solvent can be removed directly to provide a crude product of formula (318) which can be used directly in the subsequent reaction.

In some embodiments, the compound of formula (319) can be obtained by the following preparation method: the method comprises the compound of formula (320) and ethyl trifluoroacetate in an organic solvent under the substitution reaction conditions. Contact, followed by separation:

In some embodiments, the organic solvent is acetonitrile, an epoxy solvent, an ether solvent, a halogenated alkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropyl One or more of ethylamine. In some embodiments, the epoxy-based solvent is dioxane and/or tetrahydrofuran, and in some embodiments, the ether solvent is diethyl ether and/or methyl tert-butyl ether, in some embodiments The halogenated alkane solvent is one or more of dichloromethane, chloroform and 1,2-dichloroethane, and in some embodiments, the organic solvent is acetonitrile. The organic solvent is used in an amount of from 1 to 50 L/mol, and in some embodiments from 1 to 20 L/mol, relative to the compound of the formula (320).

The substitution reaction conditions may include a reaction temperature of 0-100 ° C and a reaction time of 5 to 72 hours. In some embodiments, the substitution reaction conditions include a reaction temperature of 10 to 40 ° C and a reaction time of 10 to 30. hour.

Compounds of formula (320) are either commercially available or are obtained by those skilled in the art using known methods. For example, when m1=m2=m3=3, n1=1, n3=2, and R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ , R ₁₅ are all H, the compound of formula (320) can be self- Fayesha is commercially available.

The molar ratio of the ethyl trifluoroacetate to the compound of formula (320) is from 2:1 to 10:1, and in some embodiments from 3:1 to 5:1.

Similarly to the above, the compound of formula (319) can be isolated from the reaction mixture using any suitable separation method. In some embodiments, the solvent can be removed by evaporation, followed by chromatographic separation of the compound of formula (319). For example, separation can be carried out using two chromatographic conditions: (1) normal phase purified silica gel: 200-300 mesh silica gel filler, used Gradient elution with methanol:dichloromethane = 0.01:1 -0.5:1; or gradient elution with methanol:dichloromethane:ethyl acetate:petroleum=0.1:1:1:1:1:1:1:1 And (2) reverse phase purification: C18, C8 reverse phase packing, eluting with a gradient of methanol: acetonitrile = 0.1:1 to 1:0.1. In some embodiments, the solvent can be removed directly to provide a crude product of the compound of formula (319) which can be used directly in the subsequent reaction.

The first or second siRNA conjugate of the present disclosure may also be combined with other pharmaceutically acceptable excipients, which may be one or more of various formulations or compounds conventionally employed in the art, for details. See above for a description of the pharmaceutical compositions of the present disclosure.

siRNA of the present disclosure, pharmaceutical composition containing the same, first siRNA conjugate, and second Application of siRNA conjugates

In some embodiments, the present disclosure provides siRNAs, pharmaceutical compositions, first siRNA conjugates, and second siRNA conjugates provided by the present disclosure in the preparation for treatment and/or prevention of the hepatitis B The use of a disease caused by a viral infection or a drug in a disease.

According to an embodiment of the present disclosure, the present disclosure provides a method of treating a pathological condition or disease caused by an infection of hepatitis B virus, the method comprising administering to a patient an siRNA, a pharmaceutical composition, a first one provided by the present disclosure siRNA conjugate and a second siRNA conjugate.

According to another embodiment of the present disclosure, the present disclosure provides a method of inhibiting expression of a hepatitis B virus gene in a hepatitis cell infected with chronic hepatitis B virus, the method comprising the siRNA, a pharmaceutical composition, the first provided by the present disclosure An siRNA conjugate and a second siRNA conjugate are contacted with the hepatitis B virus infected with chronic hepatitis B virus.

The pathological condition or disease caused by the infection of hepatitis B virus is selected from the group consisting of chronic liver disease, hepatitis, liver fibrosis disease, and liver proliferative disease.

By administering the siRNA and/or pharmaceutical composition of the present disclosure, the first siRNA conjugate, and the second siRNA conjugate to a patient in need thereof, the purpose of treating hepatitis B can be achieved by a mechanism of RNA interference. Thus, the siRNA and/or pharmaceutical compositions of the present disclosure, the first siRNA conjugate, and the second siRNA conjugate can be used to prevent and/or treat hepatitis B, or to prepare for the prevention and/or treatment of hepatitis B. drug.

The term "administering/administering" as used herein refers to the desired effect by at least partially positioning the siRNA or pharmaceutical composition, the first siRNA conjugate, and the second siRNA conjugate at a desired site. A method or pathway for placing an siRNA or pharmaceutical composition, a first siRNA conjugate, and a second siRNA conjugate into a patient. Routes of administration suitable for the methods of the present disclosure include topical administration and systemic administration. In general, topical administration results in delivery of more siRNA or pharmaceutical composition, first siRNA conjugate, and second siRNA conjugate to a particular site than the entire body of the patient; The siRNA or pharmaceutical composition, the first siRNA conjugate, and the second siRNA conjugate are delivered to the patient's substantially entire body. In view of the fact that the present disclosure is intended to provide means for preventing and/or treating hepatitis B, a mode of administration capable of delivering a drug to the liver is preferred.

Administration can be administered to a patient by any suitable route known in the art including, but not limited to, oral or parenteral routes, including intravenous, intramuscular, subcutaneous, transdermal, Airway administration (aerosol), pulmonary administration, nasal administration, rectal administration, and topical administration (including buccal administration and sublingual administration). The frequency of administration can be one or more times per day, every week, every two weeks, every three weeks, every month or every year.

The siRNA or pharmaceutical composition, the first siRNA conjugate, and the second siRNA conjugate of the present disclosure may be administered at a dosage conventional in the art, which may be based on various parameters, particularly a patient's Determined by age, weight and gender. Toxicity and efficacy can be determined by standard pharmaceutical procedures in cell culture or laboratory animals, such as determining LD50 (a dose that kills 50% of the population) and ED50 (in a quantitative response, a dose that causes 50% of the maximum response intensity, in a qualitative response) The middle finger causes a dose of 50% of the subjects to have a positive reaction). The dose ratio between toxicity and efficacy is the therapeutic index and can be expressed as the ratio of LD50/ED50. Preferred are siRNA or pharmaceutical compositions that exhibit a high therapeutic index, a first siRNA conjugate, and a second siRNA conjugate. The range of human doses can be derived based on data obtained from cell culture assays and animal studies.

When administering the pharmaceutical composition of the present disclosure, the first siRNA conjugate, and the second siRNA conjugate, for example, for male or female, 6-12 weeks old, body weight 18-25 g C57BL/6J or C3H/HeNCrlVr mice, based on the amount of siRNA in the pharmaceutical composition or siRNA conjugate: (i) a pharmaceutical composition for siRNA and a pharmaceutically acceptable carrier, the siRNA may be used in an amount of 0.001-50 mg /kg body weight, in a further embodiment from 0.01 to 10 mg/kg body weight, in still further embodiments from 0.05 to 5 mg/kg body weight, and in still further embodiments from 0.1 to 3 mg/kg body weight; (ii) For the first and/or second siRNA conjugate formed by the siRNA and the pharmaceutically acceptable conjugated molecule, the siRNA may be used in an amount of from 0.001 to 100 mg/kg body weight, and in further embodiments from 0.01 to 50 mg /kg body weight, in still further embodiments 0.05-20 mg/kg body weight, and in still further embodiments 0.1-10 mg/kg body weight. When the siRNA described in the present disclosure is administered, the above amounts can be preferably used.

In addition, by introducing the siRNA and/or pharmaceutical composition of the present disclosure, the first siRNA conjugate, and the second siRNA conjugate into hepatitis cells infected with chronic HBV, inhibition of infection with chronic HBV can also be achieved by the mechanism of RNA interference. The purpose of HBV gene expression in hepatitis cells. In some preferred embodiments, the cell is a HepG2.2.15 cell.

Inhibition of expression of the HBV gene in cells using the methods provided by the present disclosure, regardless of whether the provided siRNA or pharmaceutical composition or the first siRNA conjugate and the second siRNA conjugate are used, the amount of siRNA is generally such an amount: The expression of the target gene is reduced and results in an extracellular concentration of 1 pM to 1 μM, or 0.01 nM to 100 nM, or 0.05 nM to 50 nM or to about 5 nM at the surface of the target cell. The amount required to achieve this local concentration will vary with a variety of factors including the method of delivery, the site of delivery, the number of cell layers between the delivery site and the target cell or tissue, whether the delivery is local or systemic, and the like. The concentration at the delivery site can be significantly higher than the concentration at the surface of the target cell or tissue.

Kit

The present disclosure provides a kit comprising an effective amount of at least one of an siRNA of the present disclosure, a pharmaceutical composition, a first siRNA conjugate, and a second siRNA conjugate.

In some embodiments, the kits described herein can provide modified siRNA in one container. In some embodiments, the kits described herein can comprise a container that provides a pharmaceutically acceptable excipient. In some embodiments, other components such as stabilizers or preservatives and the like may also be included in the kit. In some embodiments, the kits described herein can comprise at least one additional therapeutic agent in a container other than a container that provides the modified siRNA described herein. In some embodiments, the kit can include instructions for mixing the modified siRNA with a pharmaceutically acceptable carrier and/or adjuvant or other ingredients, if any.

In the kit of the present disclosure, the modified siRNA and a pharmaceutically acceptable carrier and/or adjuvant and the modified siRNA, pharmaceutical composition, first siRNA conjugate, and/or second siRNA conjugate The compound and/or conjugate, and/or pharmaceutically acceptable adjuvant may be provided in any form, such as a liquid form, a dry form, or a lyophilized form. In some embodiments, the modified siRNA and the pharmaceutically acceptable carrier and/or adjuvant and the pharmaceutical composition and/or conjugate and optionally the pharmaceutically acceptable excipient are substantially pure and/or Sterile. In some embodiments, sterile water can be provided in a kit of the present disclosure.

The present disclosure will be further illustrated by the following examples, but the present disclosure is not limited thereby.

Beneficial effect

In some embodiments, the siRNA, pharmaceutical composition or siRNA conjugate provided by the present disclosure may have higher stability, lower toxicity, and/or higher activity in vivo. In some embodiments, the siRNA, siRNA composition or siRNA conjugate provided by the present disclosure exhibits at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95 in vivo. % inhibition of HBV gene expression. In some embodiments, the siRNA, siRNA composition or siRNA conjugate provided by the present disclosure exhibits at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95 in vivo. % inhibition of HBV gene expression in the liver. In some embodiments, the siRNA, siRNA composition or siRNA conjugate provided by the present disclosure exhibits at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95 in vivo. Inhibition rate of HBV gene expression in the liver in % of animal models. In some embodiments, the siRNA, siRNA composition or siRNA conjugate provided by the present disclosure exhibits at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95 in vivo. % HBV surface antigen expression inhibition rate. In some embodiments, the siRNA, composition or siRNA conjugate provided by the present disclosure does not exhibit a significant off-target effect. The off-target effect can be, for example, inhibition of normal expression of a gene of a non-target gene. It is believed that the off-target effect is insignificant if the binding/inhibition of off-target gene expression is less than 50%, 40%, 30%, 20% or 10% compared to the target gene effect.

In some embodiments, the siRNA conjugates provided by the present disclosure have better in vitro inhibitory activity with an inhibition rate of up to 95% at 0.1 nM.

In some embodiments, the siRNA conjugates provided by the present disclosure have better in vivo inhibitory activity with an inhibition rate of up to 93.63% at 1 mg/kg.

In some embodiments, the siRNA conjugates provided by the present disclosure also exhibit low off-target effects while having excellent target mRNA inhibitory effects.

In some embodiments, the siRNA conjugates provided by the present disclosure maintain long-term non-degradation in Tritosome, showing good stability.

In some embodiments, the siRNA conjugates provided by the present disclosure are still not degraded in human plasma up to 72 h, exhibiting excellent stability in human plasma.

In some embodiments, the siRNA conjugates provided by the present disclosure are still not degraded in cynomolgus plasma until 72 h, showing excellent stability in monkey plasma.

In some embodiments, the maximum inhibition of HBsAg by a single administration of 3 mg/kg of conjugate 4 is above 95%, and the inhibition rate of HBsAg is over 90% over a period of 56 days, at D85. The inhibition rate against HBV X mRNA was 62%.

Other features and advantages of the present disclosure will be described in detail in the detailed description which follows.

Example

The present disclosure will be described in detail below by way of examples. Unless otherwise specified, the reagents and culture media used in the following examples are commercially available, and the operations of nucleic acid electrophoresis and real-time PCR used are referred to Molecular Cloning (Cold Spring Harbor Laboratory Press (1989)). get on.

Unless otherwise stated, the reagent ratios provided below are calculated in terms of volume ratio (v/v).

Preparation Example 1: Preparation of conjugates 4, 18 and 19

In the present preparation, conjugate 4 (hereinafter, also referred to as L10-siHB1M1SVP conjugate) was synthesized, and it is planned to synthesize conjugate 18 (hereinafter, also referred to as L10-siHB1M1SP) and conjugate 19 (hereinafter, also Called L10-siHB1M1SPs). The conjugate is a conjugate formed by conjugation of L-9 conjugated molecules to siRNAs numbered siHB1M1SVP, siHB1M1SP or siHB1M1SPs, respectively. See Table 2 for the sequence of the siRNA conjugated in this conjugate.

(1-1) Synthesis of L-10 compounds

The L-10 compound was synthesized as follows:

(1-1-1) Synthesis of Conjugated Terminal Segment GAL-5

(1-1-1a) Synthesis of GAL-2

100.0 g of GAL-1 (N-acetyl-D-galactosamine hydrochloride, CAS No.: 1772-03-8, purchased from Ningbo Hongxiang Biochemical Co., Ltd., 463.8 mmol) was dissolved in 1000 ml of anhydrous pyridine under ice water bath. 540 ml of acetic anhydride (purchased from Enox Corporation, 5565.6 mmol) was added, and the reaction was stirred at room temperature for 1.5 hours. The reaction solution was poured into 10 L of ice water, filtered under reduced pressure, and the filter cake was washed with 2 L of ice water, and then acetonitrile/toluene mixed solvent (volume ratio: acetonitrile: toluene = 1:1) was completely dissolved, and the solvent was evaporated to give white. Solid product GAL-2130.0g.

(1-1-1b) Synthesis of GAL-3

GAL-2 (35.1 g, 90.0 mmol) obtained in the step (1-1-1a) was dissolved in 213 ml of anhydrous 1,2-dichloroethane, and 24.0 g of TMSOTf was added in an ice water bath under nitrogen atmosphere. (CAS No.: 27607-77-8, purchased from Macleans, 108.0 mmol), reacted overnight at room temperature.

The reaction solution was diluted with 400 ml of dichloromethane, and filtered with celite, and then 1 L of saturated aqueous sodium hydrogen carbonate solution was added, and the mixture was stirred, and the organic phase was separated. The aqueous phase was extracted twice with dichloroethane, 300 ml each time. The organic phase was washed with 300 ml of a saturated aqueous sodium hydrogencarbonate solution and 300 ml of brine, and the organic phase was separated, dried over anhydrous sodium sulfate, and evaporated to dryness to give a pale yellow viscous sugar product GAL-326.9 g.

(1-1-1c) Synthesis of GAL-4

GAL-3 (26.9 g, 81.7 mmol) obtained in the step (1-1-1b) was dissolved in 136 ml of anhydrous 1,2-dichloroethane, and dried.

30 g of molecular sieve powder, and then added 9.0 g of 5-hexen-1-ol (CAS No.: 821-41-0, available from Adamas-beta, 89.9 mmol), stirred at room temperature for 30 minutes, added under ice bath and nitrogen protection. 9.08 g of TMSOTf (40.9 mmol) was stirred at room temperature overnight. Filter removal

Molecular sieve powder, the filtrate was diluted with 300 ml of dichloromethane, filtered through celite, and then added with 500 ml of saturated aqueous sodium hydrogencarbonate solution and stirred for 10 minutes. The organic phase was separated and the aqueous phase was extracted once with 300 ml of dichloroethane. The organic phase was washed with 300 ml of a saturated aqueous solution of sodium hydrogencarbonate and brine (300 ml), and dried over anhydrous sodium sulfate. One-step oxidation reaction.

(1-1-1d) Synthesis of GAL-5

GAL-4 (14.9 g, 34.7 mmol) obtained according to the method described in the step (1-1-1c) was dissolved in a mixed solvent of 77 ml of dichloromethane and 77 ml of acetonitrile, and respectively, 103 ml of deionized water and 29.7 g of high were added. Sodium iodate (CAS No.: 7790-28-5, purchased from Aladdin, 138.8 mmol), stirred for 10 minutes in an ice water bath, and added with antimony trichloride (CAS No.: 14988-67-0, purchased from Anji Company, 238 mg, 1.145 mmol), reacted overnight at room temperature. The reaction solution was diluted with 300 ml of water and stirred, and adjusted to pH 7.5 with saturated sodium hydrogencarbonate. The organic phase was separated and discarded, and the aqueous phase was extracted three times with dichloromethane (200 ml), and the organic phase was discarded. The aqueous phase was adjusted to pH 3 with citric acid solids, and extracted twice with dichloromethane (200 ml). The organic phase was combined and dried over anhydrous sodium sulfate. . ¹ H NMR (400 MHz, DMSO) δ 12.01 (br, 1H), 7.83 (d, J = 9.2 Hz, 1H), 5.21. (d, J = 3.2 Hz, 1H), 4.96 (dd, J = 11.2, 3.2 Hz, 1H), 4.49 (d, J = 8.4 Hz, 1H), 4.07-3.95 (m, 3H), 3.92-3.85 (m, 1H), 3.74 - 3.67 (m, 1H), 3.48-3.39 (m, 1H), 2.20 (t, J = 6.8 Hz, 2H), 2.11 (s, 3H), 2.00 (s, 3H), 1.90 (s, 3H), 1.77 (s, 3H), 1.55-1.45 (m, 4H) ).

(1-1-2) Synthesis of M-11-T3:

J-0 (1.883 g, 10 mmol, commercially available from Alfa Aesar) was dissolved in 25 ml of acetonitrile, triethylamine (4.048 g, 40 mmol) was added to ice water and cooled to 0 ° C, and ethyl trifluoroacetate (5.683) was added. The reaction was carried out for 22 h at rt. MS m/z: C ₁₅ H ₂₂ F ₉ N ₄ O ₃ , [M+H]+, Theory: 477.35, Found: 477.65.

(1-1-3) Synthesis of M-11-T3-Tr:

The crude product of M-11-T3 (5.342 g, 10 mmol) was dissolved in 50 ml of dichloromethane, and TrCl (3.345 g, 12 mmol) and triethylamine (1.518 g, 15 mmol) were added to the reaction mixture, and the mixture was stirred at room temperature for 20 h. The reaction solution was washed twice with saturated sodium bicarbonate, and then washed twice with 20 ml of 20 ml of brine, and the organic phase was dried over anhydrous sodium sulfate, filtered and evaporated to dryness. M-11-T3-Tr 7.763g. MS m/z: C ₃₄ H ₃₆ F ₉ N ₄ O ₃ , [M+Na]+, Theory: 741.25, found: 741.53. The crude solid M-11-T3-Tr was used in the next step of the synthesis of M-18-Tr without purification.

(1-1-4) Synthesis of M-18-Tr:

The crude M-11-T3-Tr obtained in the step (1-1-3) (7.763 g, 10 mmol) was dissolved in 100 ml of methanol, and then 100 ml of aqueous methylamine solution (40% by mass) was added, and the reaction was stirred at 50 ° C for 23 h. The insoluble granules were removed by filtration, and the solvent was evaporated to dryness. The solvent was evaporated to drynessjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjj 50 ml each time, the organic phase was combined, dried over anhydrous sodium sulfate, filtered, and the solvent was evaporated to dryness under reduced pressure. The solvent was evaporated to dryness overnight, purified by 200-300 mesh normal phase silica gel column, petroleum ether packed column, 1 wt% The ethylamine was neutralized with silica gel and eluted with a gradient of methylene chloride:methanol:aqueous ammonia (25 wt%) = 1: 1:0.05 to 1: 1:0.25. The product eluate was collected, and the solvent was evaporated under reduced pressure. The bubble was dried to obtain a pure product M-18-Tr 2.887 g. ^{1 H NMR (400MHz, DMSO)} δ7.47-7.39 (m, 6H), 7.32-7.24 (m, 6H), 7.19-7.12 (m, 3H), 2.60-2.47 (m, 4H), 2.46-2.19 ( m, 13H), 1.70-1.55 (m, 4H), 1.40 (p, J = 6.8 Hz, 2H). _{MS m / z: C 28 H} 39 N 4, [M + H] +, theory: 431.65, found: 432.61.

(1-1-5) Synthesis of L-5-Tr:

M-18-Tr (2.02 g, 4.69 mmol) obtained in the step (1-1-4) and GAL-5 (6.93 g, 15.48 mmol) obtained in the step (1-1-1) were dissolved in 47 ml. Acetonitrile, N-methylmorpholine (3.13 g, 30.96 mmol) and 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride (DMTMM, 4.28 g) , 15.48 mmol), stirred at room temperature for 2 h. The reaction mixture was diluted with 200 ml of dichloromethane, and the organic phase was washed with 100 ml of saturated sodium hydrogen carbonate, and the organic phase was washed with anhydrous sodium sulfate. The 200-300 mesh normal phase silica gel column was purified, and the petroleum ether was packed in a column, and the silica gel was neutralized with 1 wt% of triethylamine, and the product eluate was collected by a gradient of dichloromethane:methanol=100:5-100:7. It was evaporated to dryness under reduced pressure to give a pure product, L-5-Tr, 7.49 g. ^{1 H NMR (400MHz, DMSO)} δ7.83-7.10 (m, 4H), 7.67-7.60 (m, 1H), 7.44-7.34 (m, 6H), 7.33-7.24 (m, 6H), 7.20-7.15 ( m, 3H), 5.22 (s, 3H), 4.97 (d, J = 11.3 Hz, 3H), 4.49 (d, J = 8.4 Hz, 3H), 4.06 - 3.07 (m, 9H), 3.95 - 3.83 (m , 3H), 3.77-3.64 (m, 3H), 3.45-3.35 (m, 3H), 3.12-2.87 (m, 8H), 2.30-2.15 (m, 3H), 2.11-1.98 (m, 22H), 1.95 -1.84 (m, 11H), 1.81-1.61 (m, 14H), 1.54-1.36 (m, 14H). _{MS m / z: C 85 H} 119 N 7 O 30, [M + H] +, theory: 1718.81, found: 1718.03.

(1-1-6) Synthesis of L-8:

The L-5-Tr (5.94 g, 3.456 mmol) obtained in the step (1-1-5) was dissolved in 69 ml of dichloromethane, then dichloroacetic acid (13.367 g, 103.67 mmol) was added, and reacted at room temperature for 2 h, added The reaction mixture was diluted with 100 ml of dichloromethane, and washed with a saturated aqueous solution of sodium hydrogen carbonate, and the mixture was adjusted to pH=7-8, and the aqueous phase was extracted with dichloromethane for 6 times, 30 ml each time, and the organic phase was combined and dried over anhydrous sodium sulfate. After filtration, the solvent was evaporated to dryness under reduced pressure. Purification using 200-300 mesh normal phase silica gel, neutralizing silica gel with 10 wt% triethylamine, 1 wt ‰ triethylamine equilibrium column, eluting with dichloromethane: methanol = 100:30-100:40 gradient, collecting product wash The mixture was deliquored, and the solvent was evaporated to dryness to dryness, m. ^{1 H NMR (400MHz, DMSO)} δ7.84 (d, J = 9.0Hz, 3H), 7.27-7.23 (m, 1H), 7.13-7.18 (m, 1H), 5.22 (d, J = 3.1Hz, 3H ), 4.97 (dd, J = 11.3, 3.1 Hz, 3H), 4.48 (d, J = 8.4 Hz, 3H), 4.09 - 3.98 (m, 9H), 3.88 (dd, J = 19.3, 9.3 Hz, 3H) , 3.75-3.66 (m, 3H), 3.44-3.38 (m, 3H), 3.17-3.30 (m, 4H), 3.10-2.97 (m, 4H), 2.35-2.20 (m, 6H), 2.15-2.08 ( m, 9H), 2.07-1.98 (m, 13H), 1.94-1.87 (m, 9H), 1.81-1.74 (m, 9H), 1.65-1.42 (m, 18H). _{MS m / z: C 85 H} 119 N 7 O 30, [M + H] +, theory: 1477.59, found: 1477.23.

Synthesis of (1-1-7a) A-1

DMTrCl (4,4'-bismethoxytrityl chloride, 38.12 g, 112.5 mmol) was dissolved in 450 ml of anhydrous pyridine, and DL-calcium glycerate hydrate (12.88 g, 45.0 mmol) was added at 45 After reacting for 22 h at ° C, the reaction solution was filtered, and the filter cake was rinsed with 200 ml of DCM, and the filtrate was concentrated to dryness under reduced pressure. The residue was re-dissolved with 500 ml of dichloromethane and washed with 0.5 M triethylamine phosphate (pH=7-8) 2 Then, 200 ml each time, the aqueous phase was extracted twice with dichloromethane, 200 ml each time, the organic phase was combined, dried over anhydrous sodium sulfate, filtered, and the solvent was evaporated under reduced pressure, and purified on a 200-300 mesh normal phase silica gel column. The petroleum ether: ethyl acetate: dichloromethane:methanol = 1:1:1:0.35-1:1:1:0.55 gradient elution, the product eluate was collected, and the solvent was evaporated to dryness. Washed once with 200 ml of 0.5 M triethylamine phosphate, the aqueous phase was extracted twice with dichloromethane, 200 ml each time, the organic phase was combined, dried over anhydrous sodium sulfate, filtered, evaporated, evaporated, evaporated After drying overnight, 20.7 g of a white solid product A-1 was obtained. ^{1 H NMR (400MHz, DMSO-} d6) δ7.46 (ddd, J = 6.5,2.3,1.1Hz, 1H), 7.40-7.28 (m, 7H), 6.89-6.81 (m, 4H), 4.84 (d, J=5.0 Hz, 1H), 4.36-4.24 (m, 1H), 4.29 (s, 6H), 3.92 (dd, J = 12.4, 7.0 Hz, 1H), 3.67 (dd, J = 12.3, 7.0 Hz, 1H) ), 2.52 (q, J = 6.3 Hz, 6H), 1.03 (t, J = 6.3 Hz, 9H). _{MS m / z: C 24 H} 23 O 6, [MH] -, theory: 407.15, found: 406.92.

(1-1-7b) Synthesis of L-7:

L-8 (2.262 g, 1.532 mmol) obtained in the step (1-1-6) and A-1 (2.342 g, 4.596 mmol) obtained in the step (1-1-7a) were mixed and dissolved in 16 ml. Methyl chloride, 3-diethoxyphosphoryl-1,2,3-oxazol 4(3H)-one (DEPBT) (1.375 g, 4.596 mmol), followed by diisopropylethylamine (1.188 g, 9.191 mmol), the reaction was stirred at 25 ° C for 2 h, the organic phase was washed with 10 ml of saturated sodium bicarbonate, and the aqueous phase was extracted with dichloromethane three times, 10 ml each time, and the organic phase was washed with 10 ml of brine. The mixture was extracted twice, 10 ml each time, and the organic phase was combined and dried over anhydrous sodium sulfate, filtered, evaporated, evaporated, evaporated Purification by column using 120 g of 200-300 mesh normal phase silica gel, neutralizing silica gel with 20 ml of triethylamine, and equilibrating the column with petroleum ether containing 1 wt% triethylamine as petroleum ether: ethyl acetate: dichloromethane: N, N- The product was eluted with a gradient of dimethylformamide 1:1:1:0.5-1:1:1:0.6, and the solvent was evaporated to dryness. ^{1 H NMR (400MHz, DMSO)} δ7.90-7.78 (m, 4H), 7.75-7.64 (m, 1H), 7.38-7.18 (m, 9H), 6.91-6.83 (m, 4H), 5.25-5.10 ( m, 4H), 4.97 (dd, J = 11.2, 3.2 Hz, 3H), 4.48-4.30 (m, 4H), 4.02 (s, 9H), 3.93-3.84 (m, 3H), 3.76-3.66 (m, 9H), 3.45-3.35 (m, 3H), 3.24-2.98 (m, 10H), 2.30-2.20 (m, 2H), 2.11-1.88 (m, 31H), 1.80-1.40 (m, 28H). MS m/z: C ₉₀ H ₁₂₈ N ₇ O ₃₅ , [M-DMTr]+, Theory: 1564.65, found: 1564.88.

(1-1-8) Synthesis of L-9 Conjugated Molecules:

Mixing L-7 (2.300 g, 1.26 mmol) obtained in the step (1-1-7b), succinic anhydride (0.378 g, 3.78 mmol) and 4-dimethylaminopyridine (DMAP, 0.462 g, 3.78 mmol) Dissolved in 13 ml of dichloromethane, then added diisopropylethylamine (DIEA, 0.814 g, 6.30 mmol), stirred at 25 ° C for 24 h, 5 ml of 0.5 M triethylamine phosphate was washed and the aqueous phase was extracted with dichloromethane. After 3 times, 5 ml each time, the combined organic layers were evaporated to dryness to dryness. Column purification using 60 g of 200-300 mesh normal phase silica gel, neutralization of silica gel with 1 wt% triethylamine, equilibration of the column with dichloromethane, with 1 wt of triethylamine in dichloromethane:methanol = 100:18-100: The gradient was eluted with 20 gradients, and the product eluent was collected. ¹ H NMR (400 MHz, DMSO) δ 8.58 (d, J = 4.2 Hz, 1H), 7.94 - 7.82 (m, 3H), 7.41 - 7.29 (m, 5H), 7.22 (d, J = 8.1 Hz, 5H) ), 6.89 (d, J = 8.3 Hz, 4H), 5.49-5.37 (m, 1H), 5.21 (d, J = 3.0 Hz, 3H), 4.97 (d, J = 11.1 Hz, 3H), 4.49 (d) , J = 8.2 Hz, 3H), 4.02 (s, 9H), 3.88 (dd, J = 19.4, 9.4 Hz, 3H), 3.77-3.65 (m, 9H), 3.50-3.39 (m, 6H), 3.11 2.90 (m, 5H), 2.61-2.54 (m, 4H), 2.47-2.41 (m, 2H), 2.26-2.17 (m, 2H), 2.15 - 1.95 (m, 22H), 1.92-1.84 (m, 9H) ), 1.80-1.70 (m, 10H), 1.65-1.35 (m, 17H), 1.31-1.19 (m, 4H), 0.96 (t, J = 7.1 Hz, 9H). MS m/z: C ₉₄ H ₁₃₂ N ₇ O ₃₈ , [M-DMTr]+, Theory: 166.

(1-1-9) Synthesis of L-10 compound:

In this step, an L-10 compound was prepared by attaching an L-9 conjugating molecule to a solid support.

The L-9 conjugated molecule obtained in the step (1-1-8) (0.233 g, 0.1126 mmol), O-benzotriazole-tetramethylurea hexafluorophosphate (HBTU, 0.064 g, 0.1689 mmol) Mix with diisopropylethylamine (DIEA, 0.029 g, 0.2252 mmol), dissolve in 19 ml of acetonitrile, stir at room temperature for 5 minutes, add aminomethyl resin (0.901 g, 100-200 mesh, amino loading) to the reaction solution. 400μmol/g, purchased from Nankai Hecheng Company, shaken at 25°C, rotating at 220 rpm, reacted for 15 hours, filtered, and the filter cake was rinsed twice with DCM, 30 ml each time, and acetonitrile was rinsed 3 times. Each time 30 ml, 30 ml of diethyl ether was rinsed once, and dried by vacuum oil pump for 2 h, and then the raw materials (CapA, CapB, 4-dimethylaminopyridine (DMAP) and acetonitrile) were added to the cap reaction according to the dosing ratio shown in Table 1. . Placed on a shaker at 25 ° C, rotating at 200 rpm, reacted for 5 h, the reaction solution was filtered, and the filter cake was rinsed with acetonitrile three times, 30 ml each time, suction-filtered to dryness, and dried under vacuum under vacuum to obtain L- 10 compound (ie, L-9 conjugated molecule attached to a solid support) 1.100 g, loading 90.8 μmol/g.

Table 1 cap reaction feed ratio

原料raw material	用量Dosage	规格specification	批号lot number	生产厂家Manufacturer
CapACapA	20ml20ml	————	————	————
CapBCapB	2.3ml2.3ml	————	————	————
DMAPDMAP	0.01g0.01g	分析纯Analytical purity	I1422139I1422139	AladdinAladdin
乙腈Acetonitrile	2.3ml2.3ml	光谱纯Spectral purity	O15161001O15161001	上海星可Shanghai Star

Wherein CapA and CapB are capping reagent solutions, CapA is a pyridine/acetonitrile mixed solution of 20% by volume of N-methylimidazole, and the volume ratio of pyridine to acetonitrile is 3:5; CapB is a solution of 20% by volume of acetic anhydride in acetonitrile.

(1-2) Synthetic chains of synthetic conjugates 4, 18 and 19

The sense strand sequences of conjugates 4, 18 and 19 are identical, so the preparation method is also the same.

The nucleoside monomer was ligated one by one from the 3'-5' direction by the solid phase phosphoramidite method using the L-10 compound prepared in the above procedure. Each nucleoside monomer is linked to a four-step reaction of deprotection, coupling, capping, oxidation or sulfurization. Wherein, when a phosphate linkage is used between two nucleotides, when a nucleoside monomer is attached, a four-step reaction including deprotection, coupling, capping, and oxidation is included. When a phosphorothioate is used between two nucleotides, when a nucleoside monomer is attached, a four-step reaction of protection, coupling, capping, and sulfurization is included. The synthesis conditions are given as follows:

The nucleoside monomer is provided in a 0.1 M acetonitrile solution. The deprotection reaction conditions are the same for each step, that is, the temperature is 25 ° C, the reaction time is 70 seconds, and the deprotecting reagent is dichloroacetic acid in dichloromethane (3%). v/v), the molar ratio of dichloroacetic acid to the 4,4'-dimethoxytrityl protecting group on the solid support is 5:1.

The coupling reaction conditions are the same in each step, including the temperature of 25 ° C, the molar ratio of the nucleic acid sequence and the nucleoside monomer attached to the solid phase carrier is 1:10, and the nucleic acid sequence and the coupling reagent are attached to the solid phase carrier. The ratio was 1:65, the reaction time was 600 seconds, and the coupling reagent was a solution of 5-ethylthio-1H-tetrazole in 0.5 M acetonitrile.

The cap conditions were the same for each step, including a temperature of 25 ° C and a reaction time of 15 seconds. The cap reagent solution is a mixed solution of CapA and CapB in a molar ratio of 1:1, and the molar ratio of the cap reagent to the nucleic acid sequence attached to the solid phase carrier is a nucleic acid sequence attached to the acetic anhydride: N-methylimidazole: solid phase carrier. =1:1:1.

The oxidation reaction conditions were the same for each step, including a temperature of 25 ° C, a reaction time of 15 seconds, and an oxidizing reagent of iodine water having a concentration of 0.05 M. The molar ratio of iodine to the nucleic acid sequence attached to the solid support in the coupling step was 30:1. The reaction is carried out in a mixed solvent of tetrahydrofuran:water:pyridine = 3:1:1.

The conditions of the vulcanization reaction were the same for each step, including a temperature of 25 ° C, a reaction time of 300 seconds, and a sulfurization reagent of hydrogenated xanthogen. The molar ratio of the sulfurizing reagent to the nucleic acid sequence attached to the solid support in the coupling step was 120:1. The reaction was carried out in a mixed solvent of acetonitrile:pyridine = 1:1.

The cleavage and deprotection conditions were as follows: The synthesized nucleotide sequence linked to the carrier was added to a 25 wt% aqueous ammonia solution, and the amount of ammonia water was 0.5 ml/μmol, which was reacted at 55 ° C for 16 h, the liquid was removed, and concentrated to dryness in vacuo.

Purification and Desalting: The preparative ion chromatography purification column (Source 15Q) was used to purify the nucleic acid by gradient elution with NaCl. Specifically: eluent A: 20 mM sodium phosphate (pH 8.1), solvent water/acetonitrile = 9:1 (volume ratio); eluent B: 1.5 M sodium chloride, 20 mM sodium phosphate (pH 8.1) Solvent was water/acetonitrile = 9:1 (volume ratio); elution gradient: eluent A: eluent B = 100:0-50:50 gradient elution. The product eluate was collected and combined, and subjected to desalting using a reverse phase chromatography purification column. The specific conditions include desalination using a Sephadex column, and the filler was a glucan gel G25, which was eluted with deionized water.

Detection: Purity was measured using ion exchange chromatography (IEX-HPLC), and molecular weight was analyzed using liquid chromatography-mass spectrometry (LC-MS).

For the sense strand molecular weight of conjugate 4, the theoretical value is 7485.3 and the measured value is 7484.4. The measured values are in agreement with the theoretical values, indicating that the sense strand S is conjugated to the L-9 conjugated molecule at the 3' end.

(1-3) Synthesis of antisense strands of conjugates 4, 18 and 19

Preparation of (1-3A) conjugate 4 antisense strand

Universal solid phase support (UnyLinkerTM loaded ⁾ by solid phase phosphoramidite method

Solid Supports, Kinovate Life Sciences, Inc.) initiated the cycle to synthesize the antisense strand AS of conjugate 4. Conditions for deprotection, coupling, capping, oxidation or sulfurization in solid phase synthesis, cleavage and deprotection, purification and desalting conditions are identical to synthetic sense chains.

Detection: Purity was determined by ion exchange chromatography (IEX-HPLC); molecular weight was analyzed by LC-MS with a theoretical value of 7161.7 and a measured value of 7160.9. The measured values are in agreement with the theoretical values, indicating that the antisense strand AS having the target sequence is synthesized. Among them, a vinyl phosphate modified 2'-methoxy modified uridine monomer (VP-Um) was synthesized as follows:

(1-3-1) Synthesis of VP-U-2

The VP-U-2 molecule was synthesized as follows:

2'-Methoxy-modified uridine (2'-OMe-U, 51.30 g, 91.6 mmol), tert-butyldiphenylchlorosilane (TBDPSCl, 50.35 g, 183.2 mmol), imidazole (12.47 g) , 183.2 mmol) was dissolved in 450 ml of N,N-dimethylformamide (DMF), and the reaction was stirred at room temperature for 20 h. DMF was distilled off, dissolved in 600 ml of dichloromethane and washed with 300 ml of saturated sodium hydrogen carbonate. The aqueous phase was extracted with dichloromethane (DCM) three times, 300 ml each time, and the organic phase was combined and washed with 5% oxalic acid to pH. <5. The crude VP-U-1 was obtained after evaporation of the solvent to dryness and used directly for the subsequent synthesis of VP-U-2.

The VP-U-1 crude product was dissolved in 100 ml of dichloromethane, and then stirred in an ice bath for 10 minutes, and then 450 ml of 2% p-toluenesulfonic acid solution (solvent as a solvent of 3:7 by volume) which was previously stored in a refrigerator at 4 ° C was added. - dichloromethane mixed solvent), reacted for 10 minutes. The reaction was quenched by the addition of EtOAc (EtOAc) (EtOAc) The combined aqueous phases were extracted twice with dichloromethane (200 ml), and the organic phase was combined and washed twice with 200 ml of brine and evaporated to dryness. Purification of 200-300 mesh normal phase silica gel column, petroleum ether column, eluting with petroleum ether:ethyl acetate:dichloromethane:methanol = 1:1:1:0.05-1:1:1:0.25 The eluate was evaporated to dryness under reduced pressure, and then dried by vacuum oil pump to obtain 40.0 g of pure VP-U-2. 1H NMR (400MHz, DMSO-d6) δ 7.96 (d, J = 7.8 Hz, 1H), 7.64 (dtd, J = 5.1, 4.0, 2.2 Hz, 4H), 7.41-7.30 (m, 6H), 6.79 ( d, J = 4.7 Hz, 1H), 5.73 (d, J = 7.6 Hz, 1H), 4.94 (t, J = 7.0 Hz, 1H), 4.12 (td, J = 4.6, 3.9 Hz, 1H), 4.05 ( Dd, J = 4.8, 4.0 Hz, 1H), 3.96 (t, J = 4.7 Hz, 1H), 3.68 (ddd, J = 11.8, 7.0, 4.6 Hz, 1H), 3.57-3.46 (m, 1H), 3.39 (s, 3H), 1.05 (s, 8H). MS m/z: C ₂₆ H ₃₃ N ₂ O ₆ Si, [M+H]+, Theory: 497.21.

(1-3-2) Synthesis of VP-U-4:

VP-U-2 (19.84 g, 40.0 mmol), dicyclohexylcarbodiimide (DCC, 16.48 g, 80.0 mmol), pyridine (4.20 g, 53.2 mmol), trifluoroacetic acid (6.61 g, 53.2 mmol) The mixture was dissolved in 200 ml of dimethyl sulfoxide (DMSO), and the reaction was stirred at room temperature for 20 h. Further, tetraethyl methylene diphosphate (21.44 g, 74.4 mmol) was dissolved in 120 ml of THF, cooled in an ice bath, and t-BuOK (11.36 g, 101.2 mmol) was added at an ice bath temperature, and the reaction was first carried out at an ice bath temperature. After 10 min, it was further raised to room temperature for 0.5 h, then added to the above reaction solution, and the addition was completed in about 1 h, and the reaction was carried out for 1 h at an ice bath temperature, and then raised to room temperature for 18 h. The reaction was quenched with water and the aqueous phase was extracted with dichloromethane three times, 200 ml each time. The organic phases were combined, washed once with 200 ml of brine, and evaporated to dryness. Purified by a 200-300 mesh normal phase silica gel column, packed with petroleum ether and eluted with a gradient of petroleum ether: ethyl acetate = 1:1-1:4. The product eluate was collected, and the solvent was evaporated under reduced pressure. The bubble was dried to obtain a total of 14.00 g of pure VP-U-4. 1H NMR (400MHz, DMSO-d6) δ 7.96 (d, J = 7.8 Hz, 1H), 7.64 (dtd, J = 5.1, 4.0, 2.2 Hz, 4H), 7.41-7.30 (m, 6H), 6.82 6.71 (m, 2H), 5.90 (ddd, J = 25.9, 15.0, 1.0 Hz, 1H), 5.73 (d, J = 7.6 Hz, 1H), 4.36 - 4.21 (m, 3H), 4.18 (t, J = 4.9 Hz, 1H), 4.05 (ddq, J=9.7, 8.5, 6.9 Hz, 2H), 3.87 (t, J = 4.8 Hz, 1H), 3.39 (s, 3H), 1.32 (td, J = 6.9, 0.7) Hz, 6H), 1.05 (s, 8H). MS m/z: C ₃₁ H ₄₂ N ₂ O ₈ </ RTI></RTI></RTI></RTI><RTIgt;

(1-3-3) Synthesis of VP-U-5:

VP-U-4 (14.00 g, 22.29 mmol) was dissolved in 100 ml of tetrahydrofuran, and triethylamine trihydrofluoric acid (17.96 g, 111.45 mmol) was added, and the mixture was stirred at room temperature for 20 h. The solvent was directly evaporated to dryness, then taken up in dichloromethane and then evaporated to dryness twice twice with 50 ml of dichloromethane. Purified by a 200-300 mesh normal phase silica gel column, packed with petroleum ether, and eluted with a gradient of petroleum ether:ethyl acetate:dichloromethane:methanol:1:1:1:0.05-1:1:1:0.25. The product eluate was evaporated to dryness under reduced pressure, and then evaporated to dryness to afford 6.7 g of pure VP-U-5. 1H NMR (400MHz, DMSO-d6) δ 7.96 (d, J = 7.8 Hz, 1H), 6.77 (dd, J = 15.0, 6.2 Hz, 1H), 5.99-5.82 (m, 2H), 5.73 (d, J = 7.6 Hz, 1H), 5.27 (d, J = 5.1 Hz, 1H), 5.10 (dd, J = 5.3, 4.7 Hz, 1H), 4.29 (ddq, J = 9.8, 8.6, 7.0 Hz, 2H), 4.17 (ddd, J = 6.2, 5.2, 1.0 Hz, 1H), 4.12-3.98 (m, 3H), 3.39 (s, 2H), 1.32 (td, J = 6.9, 0.6 Hz, 6H). _{MS m / z: C 15 H} 24 N 2 O 8 P, [M + H] +, theory: 391.13, found: 391.38.

(1-3-4) Synthesis of VP-U-6:

VP-U-5 (391 mg, 1.0 mmol), trifluoroacetic acid pyridinium salt (0.232 g, 1.2 mmol), N-methylimidazole (0.099 g, 1.2) was added to 10 ml of anhydrous dichloromethane under argon. Methyl) bis(diisopropylamino)(2-cyanoethoxy)phosphine (0.452 g, 1.5 mmol) was stirred at room temperature for 5 h. Evaporate the solvent to dryness, and purify by column chromatography (200-300 mesh normal phase silica gel, dichloromethane: acetonitrile (containing 0.5 wt% triethylamine) = 3:1 to 1:3 gradient elution) The solution was concentrated to remove the solvent to give 508 mg of the desired product VP-U-6. 31P NMR (161 MHz, DMSO-d6) δ 150.34, 150.29, 17.07, 15.50. _{MS m / z: C 24 H} 41 N 4 O 9 P 2, [M + H] +, theory: 591.23, found: 591.55. It is indicated that VP-U-6 is the target product VP-Um and participates in RNA strand synthesis as a nucleoside monomer.

Preparation of (1-3B) antisense strand of conjugate 18

The antisense strand of conjugate 18 differs from the antisense strand of conjugate 4 only in that the first nucleotide modification at the 5'-end is different. When the antisense strand is prepared according to the solid phase phosphoramidite method, the last nucleoside monomer to be linked is a 2'-methoxy modified uridine monomer (Um), which is then deprotected, coupled, capped, and oxidized. The step reaction ligated the CPR-I monomer (Suzhou Jima, Cat. No. 13#-2601-XX) to the 5' end of the antisense strand to form a 5'-phosphate modification.

In the synthesis, the general-purpose solid phase carrier used, deprotection, coupling, capping, oxidation or sulfurization reaction conditions, cleavage and deprotection, purification and desalting conditions are the same as the synthetic sense strand, and it is expected that a 5'-phosphate modification can be obtained. Conjugate 18 antisense strand.

Preparation of (1-3C) antisense strand of conjugate 19

The same synthetic procedure as the conjugate 18 antisense strand is used, except that when the CPR-I monomer is attached, the oxidation reaction conditions are replaced by the sulfurization reaction conditions, and it is expected that a 5'-phosphorothioate modified conjugation can be obtained. 19 antisense strand.

(1-4) Synthesis of conjugates 4, 18, 19

For conjugate 4, the S chain and the AS chain were respectively dissolved in water for injection to obtain a solution of 40 mg/mL, mixed in an equimolar ratio, heated at 50 ° C for 15 min, and cooled at room temperature to form a double-stranded structure by hydrogen bonding. . The conjugate was diluted to a concentration of 0.2 mg/mL using ultrapure water (manufactured by Milli-Q ultrapure water meter, resistivity 18.2 MΩ*cm (25 ° C)), using a LC-MS, LC-MS, Liquid Chromatography-Mass Spectrometry, purchased from Waters, Model: LCT Premier) for molecular weight testing. The measured values are in agreement with the theoretical values, indicating that the synthesized conjugate 4 is a double-stranded nucleic acid sequence with a L-9-conjugated molecule of interest.

For conjugates 18 and 19, annealing was carried out as described above, and it is expected that conjugates 18 and 19 can be synthesized. The structures of the above conjugates 4, 18 and 19 are as shown in the formula (403).

Preparation 2: Preparation of Conjugates 1-3, 5-9 and Comparative Conjugate 1

Using the same method as Preparation Example 1, it is expected that the title conjugate can be prepared, except that: 1) the siRNAs are respectively shown in Table 2 corresponding to conjugates 1-3, 5-9 and comparative Sequence of conjugate 1; 2) When the target sequence contains unmodified nucleotides, in the conditions of cleavage and deprotection, after ammonia treatment, with respect to the amount of single-stranded nucleic acid, 0.4 ml/μmol of N-A is used. The pyrrolidone lysed the product, followed by the addition of 0.3 ml/μmol triethylamine and 0.6 ml/μmol triethylamine trihydrofluoride to remove 2'-TBDMS protection on the ribose.

See Table 2 for the sequence of the siRNA conjugated in the subject conjugate.

Table 2: siRNA conjugates

Preparation 3: Preparation of P10-siHB1M1SVP (conjugate 10)

(3-1) Synthesis of P-10 compounds

The P-10 compound was synthesized as follows:

(3-1-1) Synthesis of GAL5-C4-1

To 40 ml of N,N-dimethylformamide, GAL-5 (13.43 g, 30.0 mmol) obtained by the method described in the above (1-1-1), 4-amino acid tert-butyl ester hydrochloride (5.87) was added. g, 30.0 mmol), O-benzotriazole-tetramethylurea hexafluorophosphate (13.65 g, 36.0 mmol) and diisopropylethylamine (11.63 g, 90.0 mmol), dissolved uniformly and stirred at room temperature 5 hours. To the reaction mixture, 300 ml of a saturated aqueous solution of sodium hydrogencarbonate was added, and the mixture was extracted with ethyl acetate three times, 200 ml each time, and the organic phase was combined, washed with 200 ml of brine, then the organic phase was separated and dried over anhydrous sodium sulfate. The solvent was evaporated to dryness to give 30.3 g of crude oil, GAL5-C4-1, and the next reaction was carried out directly.

(3-1-2) Synthesis of GAL5-C4-2

The crude GAL5-C4-1 obtained in the step (3-1-1) (30.3 g, 30 mmol) was dissolved in 180 ml of formic acid, and the mixture was stirred at room temperature for 16 hours. The solvent was evaporated to dryness and purified by column chromatography (200-300 m. -C4-2 total 14.84g.

(3-1-3) Synthesis of P-6:

M-18-Tr (2.02 g, 4.69 mmol) obtained by the method described in the step (1-1-4) and GAL5-C4-2 (8.24 g, obtained in the step (3-1-2), 15.48 mmol, obtained by combining two batches of the product) mixed in 47 ml of acetonitrile, then N-methylmorpholine (3.13 g, 30.96 mmol), and finally 4-(4,6-dimethoxytriazine-2- Base 4-methylmorpholine hydrochloride (DMTMM, 4.28 g, 15.48 mmol), stirred at room temperature for 2 h. The organic layer was washed with 10 ml of aq. Purification of 300 mesh normal phase silica gel column, petroleum ether packed column, neutralized silica gel with 1 wt% triethylamine, eluted with dichloromethane:methanol =100:5-100:7 gradient, collected product eluent, decompressed Evaporation to obtain a total of 8.27 g of pure P-6.

(3-1-4) Synthesis of P-7:

P-6 (6.82 g, 3.456 mmol) obtained in the above (3-1-3) was dissolved in 69 ml of dichloromethane, and then dichloroacetic acid (13.367 g, 103.67 mmol) was added and reacted at room temperature for 2 h. The reaction mixture was diluted with 100 ml of dichloromethane, and then washed with a saturated sodium hydrogencarbonate solution to adjust to pH=7-8, and the aqueous phase was extracted with dichloromethane for 6 times, 30 ml each time, and the organic phases were combined and dried over anhydrous sodium sulfate. After filtration, the solvent was evaporated to dryness under reduced pressure. Purification with 200-300 mesh normal phase silica gel, neutralization of silica gel with 10 wt% triethylamine, equilibration of the column with 1 wt of triethylamine, gradient elution with dichloromethane:methanol = 100:30-100:40, product wash The mixture was deliquored, and the solvent was evaporated to dryness vacuo. MS m/z: C ₇₈ H ₁₂₇ N ₁₀ O ₃₃ , [M+H]+, Theory: 1732.

(3-1-5) Synthesis of P-8:

P-7 (2.653 g, 1.532 mmol) and A-1 (2.342 g, 4.596 mmol) were mixed and dissolved in 16 ml of dichloromethane, and 3-diethoxyphosphoryl-1,2,3-benzoazole 4 was added. 3H)-ketone (DEPBT) (1.375 g, 4.596 mmol), then diisopropylethylamine (1.188 g, 9.191 mmol) was added, and the reaction was stirred at 25 ° C for 2 h. The organic phase was washed with 10 ml of saturated sodium bicarbonate, and the aqueous phase was extracted with dichloromethane (3 ml), 10 ml each time, and the organic phase was washed with 10 ml of brine, and the aqueous phase was extracted twice with 10 ml each time, and the organic phase was combined. After drying over anhydrous sodium sulfate, the mixture was filtered, evaporated, evaporated, evaporated, evaporated Column purification using 120 g of 200-300 mesh normal phase silica gel, neutralizing silica gel with 20 ml of triethylamine, and equilibrating the column with petroleum ether containing 1 wt% triethylamine as petroleum ether: ethyl acetate: dichloromethane: N, N The product eluted with a gradient of dimethylformamide 1:1:1:0.5-1:1:1:1, and the solvent was evaporated to dryness.

(3-1-6) Synthesis of P-9:

P-8 (490 mg, 0.231 mmol), succinic anhydride (69 mg, 0.693 mmol) and 4-dimethylaminopyridine (DMAP, 68 mg, 0.554 mmol) were dissolved in 2.3 ml of dichloromethane, then diisopropyl was added. Ethylamine (DIPEA, 149 mg, 1.155 mmol) was stirred at 25 ° C for 21 h. The reaction mixture was diluted with 50 ml of methylene chloride, and then the mixture was washed with 100 ml of 0.5 M triethylamine phosphate, and the aqueous phase was extracted three times with 10 ml of dichloromethane. Column purification using 80 g of 200-300 mesh normal phase silica gel, neutralization of silica gel with 1 wt% triethylamine, equilibration of the column with dichloromethane, with 1 wt of triethylamine in dichloromethane:methanol = 100:18-100: After 20 gradient elution, the product eluate was collected, and the solvent was evaporated under reduced pressure to give a pure P-9 conjugated molecule. MS m/z: C ₁₀₆ H ₁₅₃ N ₁₀ O ₄₁ , [M-DMTr]+, Theory: 1921.05, Found: 1920.97.

(3-1-7) Synthesis of P-10

P-10 was prepared by the same method as the step (1-1-9) in Preparation Example 1. The difference is that the P-9 conjugated molecule is substituted for the L-9 conjugated molecule to obtain a P-9 conjugated molecule attached to the solid support.

(3-2) Synthesis of P10-siHB1M1SVP Conjugate

The conjugate 10 was prepared by the same method as the steps (1-2), (1-3A), (1-4) in Preparation Example 1, except that the P-10 compound was substituted for the L-10 compound to initiate justice. Chain synthesis. It is expected that a P10-siHB1M1SVP conjugate can be obtained, which has the structure shown by the formula (404).

Preparation 4: Preparation of R5-siHB1M1 SVP conjugate (conjugate 11)

(4-1) Synthesis of R-5 compounds

The R-5 compound was synthesized as follows:

(4-1-1) Synthesis of GAL-C7-1

GAL-3 (26.4 g, 80.2 mmol) obtained according to the method described in the step (1-1-1b) was dissolved in 134 ml of anhydrous 1,2-dichloroethane, and added.

60 g of molecular sieve powder, further adding 7-octene-1-ol (11.3 g, 88.2 mmol), stirring for 10 minutes at room temperature, adding trimethylsilyl trifluoromethanesulfonate (8.9 g) under ice bath and nitrogen protection. , 40.1 mmol), and the reaction was stirred at room temperature for 24 hours. Filter removal

Molecular sieve powder, the filtrate was washed with 500 ml of a saturated aqueous solution of sodium hydrogencarbonate, and the organic phase was separated. The aqueous phase was extracted once with 100 ml of dichloromethane. The organic phase was combined and washed once with 250 ml of brine, and the organic phase was separated. After drying, the solvent was evaporated to dryness under reduced pressure to give a brown sugar-yellow product, GAL-C7-13, 3.3 g, and the next oxidation reaction was carried out without purification.

(4-1-2) Synthesis of GAL-C7-2

GAL-C7-1 (33.3 g, 72.8 mmol) obtained in the step (4-1-1) was dissolved in a mixed solvent of 160 ml of dichloromethane and 160 ml of acetonitrile, and 216 ml of water and sodium periodate solid were respectively added ( 62.3 g, 291.2 mmol), stirred for 10 minutes in an ice water bath, and the catalyst was added to ruthenium trichloride (498 mg, 2.4 mmol). The reaction solution was diluted with 200 ml of water and stirred, and saturated sodium hydrogencarbonate was added to adjust the pH to 7.5. The organic phase was separated, the aqueous phase was extracted three times with dichloromethane, the organic phase was discarded, and the aqueous phase was adjusted to pH 3 with citric acid solids. Extracted three times with dichloromethane, 200 ml each time, the organic phase was combined, dried over anhydrous sodium sulfate, and evaporated, evaporated, evaporated. Purification by 100:20 gradient elution gave a white foamy solid product GAL-C7-222.4 g. _{MS m / z: C 21 H} 32 NO 11, [M + H] +, theory: 476.50, found: 475.94.

(4-1-3) Synthesis of R-1:

M-18-Tr (2.02 g, 4.69 mmol) obtained according to the method described in the step (1-1-4) was mixed with GAL-C7-2 (7.36 g, 15.48 mmol) dissolved in 47 ml of acetonitrile, and then N was added. -Methylmorpholine (3.13 g, 30.96 mmol), and finally 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride (DMTMM, 4.28 g, 15.48) Methyl), the reaction was stirred at room temperature for 2 h. The organic layer was washed with 100 ml of aq. Purified by 300 mesh normal phase silica gel column, packed with petroleum ether, neutralized silica gel with 1 wt% triethylamine, and eluted with dichloromethane:methanol=100:5-100:7. The product eluate was collected and evaporated under reduced pressure. Dry to get the pure product R-1 7.82g.

(4-1-4) Synthesis of R-2:

R-1 (6.23 g, 3.456 mmol) was dissolved in 69 ml of dichloromethane, then dichloroacetic acid (13.367 g, 103.67 mmol) was added and allowed to react at room temperature for 2 h. The reaction mixture was diluted with 100 ml of dichloromethane, washed with saturated sodium hydrogen carbonate solution to adjust pH=7-8, and the aqueous phase was extracted with dichloromethane for 6 times, 30 ml each time, and the organic phases were combined and dried over anhydrous sodium sulfate. After filtration, the solvent was evaporated under reduced pressure to give a crude material. 200-300 mesh normal phase silica gel, neutralizing silica gel with 10 wt% triethylamine, equilibrating the column with 1 wt of triethylamine, eluting with a gradient of dichloromethane:methanol = 100:30-100:40, evaporating the solvent under reduced pressure Obtained pure product R-2 4.49g.

(4-1-5) Synthesis of R-3:

R-2 (2.391 g, 1.532 mmol) and A-1 (2.342 g, 4.596 mmol) were mixed and dissolved in 16 ml of dichloromethane, and 3-diethoxyphosphoryl-1,2,3-oxazole 4 was added. 3H)-ketone (DEPBT) (1.375 g, 4.596 mmol), then diisopropylethylamine (1.188 g, 9.191 mmol) was added, and the reaction was stirred at 25 ° C for 2 h. The organic phase was washed with 10 ml of saturated sodium bicarbonate, and the aqueous phase was extracted three times with dichloromethane (10 ml), and the organic phase was washed with 10 ml of saturated brine, and the aqueous phase was extracted twice with 10 ml of dichloromethane. The organic layer was dried over anhydrous sodium sulfate, filtered, and evaporated to dryness. Column purification using 120 g of 200-300 mesh normal phase silica gel, neutralizing silica gel with 20 ml of triethylamine, and equilibrating the column with petroleum ether containing 1 wt% triethylamine, petroleum ether: ethyl acetate: dichloromethane: N, N- The solvent was eluted with a gradient of dimethylformamide 1:1:1:0.5-1:1:1:1.

(4-1-6) Synthesis of R-4:

R-3 (795 mg, 0.4074 mmol), succinic anhydride (82 mg, 0.8148 mmol) and 4-dimethylaminopyridine (DMAP, 100 mg, 0.8148 mmol) were mixed and dissolved in 4 ml of dichloromethane, then diisopropyl B was added. The amine (DIPEA, 100 mg, 0.8148 mmol) was stirred at 25 ° C for 18 h. The reaction solution was washed with 5 ml of 0.5 M triethylamine phosphate, and the aqueous phase was extracted three times with dichloromethane (5 ml), Column purification using 30 g of 200-300 mesh normal phase silica gel, neutralization of silica gel with 1 wt% triethylamine, equilibration of the column with dichloromethane, dichloromethane containing 1 wt of triethylamine: methanol = 100:18-100:20 Gradient elution, the product eluate was collected, and the solvent was evaporated under reduced pressure to give 505 mg of purified R.

(4-1-7) Synthesis of R-5:

R-5 was prepared by the same method as the step (1-1-9) in Preparation Example 1. The difference is that the R-4 conjugated molecule replaces the L-9 conjugated molecule to give an R-4 conjugated molecule attached to a solid support.

(4-2) Synthesis of R5-siHB1M1SVP Conjugate

The conjugate 11 was prepared by the same method as the steps (1-2), (1-3A), (1-4) in Preparation Example 1, except that the R-5 compound was substituted for the L-10 compound to initiate justice. Chain synthesis. It is expected that an R5-siHB1M1SVP conjugate can be obtained, which has the structure shown in formula (407).

Preparation 5: Preparation of LA5-siHB1M1 SVP conjugate (conjugate 12)

According to the following route, it is expected that the LA-5 compound can be synthesized:

The conjugate 12 was prepared by the same method as the steps (1-2), (1-3A), (1-4) in Preparation Example 1, except that the LA-5 compound was substituted for the L-10 compound to initiate justice. Chain synthesis. It is expected that a LA5-siHB1M1SVP conjugate can be obtained, which has the structure shown by the formula (412).

Preparation 6: Preparation of LB5-siHB1M1SVP conjugate (conjugate 13)

(6-1) Synthesis of LB-5 compounds

The LB-5 compound was synthesized as follows:

(6-1-1) Synthesis of LB-1:

L-8 (5.0 g, 3.386 mmol), adipic anhydride (870 mg, 6.772 mmol) and 4-dimethylaminopyridine (DMAP, 827 mg, 6.772 mmol) obtained by the method described in the step (1-1-6). The mixture was dissolved in 130 ml of dichloromethane, and then diisopropylethylamine (DIPEA, 2.2 g, 16.931 mmol) was added, and the reaction was stirred at 25 ° C for 4 h. The reaction mixture was diluted with aq. EtOAc (3 mL). Column purification using 120 g of 200-300 mesh normal phase silica gel, neutralization of silica gel with 1 wt% triethylamine, equilibration of the column with dichloromethane, petroleum ether: ethyl acetate: dichloromethane: methanol = 1: 1: 1: 0.2 A gradient of -1:1:1:1 was eluted, and the solvent was evaporated to dryness to give purified product LB-1 4.267 g.

(6-1-2) Synthesis of LB-2:

LB-1 (4.697 g, 2.753 mmol, obtained by combining two batches of product), 3-amino-1,2-propanediol (313 mg, 3.442 mmol) obtained according to the procedure described in the step (6-1-1). , 4-(4,6-Dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride (DMTMM, 953 mg, 3.442 mmol) and N-methylmorpholine (700 mg, 6.084 mmol) Then, a mixture of 30 ml of acetonitrile and 3 ml of methanol was added, and the reaction was stirred at room temperature overnight. The solvent was evaporated to dryness, and purified by column chromatography (200-300 m. -2 3.27g.

(6-1-3) Synthesis of LB-3:

LB-2 (2.27 g, 1.353 mmol) was dissolved in 14 ml of anhydrous pyridine. Further, 4,4'-bismethoxytrityl chloride (688 mg, 2.03 mmol) was added and the reaction was stirred at room temperature overnight. Quenched with 150 mL of methanol and evaporated to dryness. Column chromatography (200-300 mesh normal phase silica gel, methylene chloride:methanol = 1:0.05-1:0.2 gradient elution) eluted.

(6-1-4) Synthesis of LB-4:

LB-3 (822 mg, 0.415 mmol), succinic anhydride (83 g, 0.83 mmol) and 4-dimethylaminopyridine (DMAP, 102 mg, 0.83 mmol) were dissolved in 4 ml of dichloromethane, then DIPEA (270 mg, 2.075) Methyl), the reaction was stirred at 25 ° C overnight. The reaction solution was washed three times with 0.5 M triethylamine phosphate, and the aqueous phase was extracted three times with dichloromethane (2 ml). Column purification using 200-300 mesh normal phase silica gel, neutralizing silica gel with 5 wt% triethylamine, equilibrating the column with petroleum ether, using dichloromethane: methanol = 100:5-100:20 gradient containing 1 wt of triethylamine Elution and evaporation of the solvent under reduced pressure gave 787 mg of purified LB-4.

(6-1-5) Synthesis of LB-5:

LB-5 was prepared by the same method as the step (1-1-9) in Preparation Example 1. The difference is that the LB-4 conjugated molecule replaces the L-9 conjugated molecule to obtain an LB-4 conjugated molecule linked to a solid support.

(6-2) Synthesis of LB5-siHB1M1SVP Conjugate

The conjugate 13 was prepared by the same method as the steps (1-2), (1-3A), (1-4) in Preparation Example 1, except that the LB-5 compound was substituted for the L-10 compound to initiate justice. Chain synthesis. It is expected that an LB5-siHB1M1SVP conjugate can be obtained, which has the structure shown by the formula (413).

Preparation 7: Synthesis of V8-siHB1M1 SVP conjugate (conjugate 14)

According to the following route, it is expected to be able to synthesize V-8 compounds:

The conjugate 14 was prepared by the same method as the steps (1-2), (1-3A), (1-4) in Preparation Example 1, except that the V-8 compound was substituted for the L-10 compound to initiate justice. Chain synthesis. It is expected that a V8-siHB1M1SVP conjugate can be obtained, which has the structure shown in formula (414).

Preparation 8: Preparation of W8-siHB1M1 SVP conjugate (conjugate 15)

(8-1) Synthesis of W-8 compounds

The W-8 compound was synthesized as follows:

(8-1-1) Synthesis of W-1:

W-0 (2.024 g, 10 mmol) was dissolved in 25 ml of acetonitrile, and then triethylamine (4.048 g, 40 mmol) was added, and the mixture was cooled to about 0 ° C in an ice water bath, and ethyl trifluoroacetate (5.683 g, 40 mmol) was added at room temperature. The reaction was carried out for 22 h. The solvent was evaporated to dryness under reduced pressure.

(8-1-2) Synthesis of W-2:

The crude product of W-1 (5.835 g, 10 mmol) was dissolved in 50 ml of dichloromethane, and TrCl (3.345 g, 12 mmol) and triethylamine (1.518 g, 15 mmol) were added to the reaction mixture, and the reaction was stirred at room temperature for 20 h. The reaction solution was washed twice with 20 ml of saturated sodium bicarbonate, and washed twice with 20 ml of brine, and the organic phase was combined and dried over anhydrous sodium sulfate, filtered and evaporated to dryness. Solid W-2 8.012 g. The next step of deprotection is carried out without treatment.

(8-1-3) Synthesis of W-3:

The crude W-2 (8.012 g, 10 mmol) was dissolved in 100 ml of methanol, then 100 ml of aqueous methylamine solution (40 wt%) was added, and the reaction was stirred at 50 ° C for 23 h. The insoluble granules were removed by filtration, and the solvent was evaporated to dryness. EtOAc was evaporated. EtOAcjjjjjjjjjjjjjj The organic phase was combined and dried over anhydrous sodium sulfate. After filtration, the solvent was evaporated to dryness under reduced pressure. The solvent was evaporated to dryness overnight on a vacuum oil pump, purified on a 200-300 mesh normal phase silica gel column, packed with petroleum ether, and neutralized with 1 wt% triethylamine. The silica gel was acidic and eluted with a gradient of methylene chloride:methanol:aqueous ammonia (25 wt%) = 1: 1:0.05 to 1: 1:0.25. The product eluate was collected, and the solvent was evaporated under reduced pressure. Product W-3 3.062g.

(8-1-4) Synthesis of W-4:

W-3 (0.675 g, 1.517 mmol) was mixed with GAL-C7-2 (2.60 g, 5.46 mmol) in 47 ml of acetonitrile, then diisopropylethylamine (1.57 g, 12.14 mmol), and finally 3- Diethoxyphosphoryl-1,2,3-oxazolyl 4(3H)-one (DEPBT, 1.816 g, 6.04 mmol) was stirred at room temperature for 2.5 h. The reaction mixture was diluted with 100 ml of methylene chloride, and the organic phase was washed with 80 ml of saturated sodium hydrogen carbonate solution, and the organic phase was washed with 80 ml of brine, and the organic phase was combined and dried over anhydrous sodium sulfate. Purification of 300 mesh normal phase silica gel column, petroleum ether packed column, neutralized silica gel with 1 wt% triethylamine, eluted with dichloromethane:methanol =100:5-100:7 gradient, collected product eluent, decompressed Evaporated to give a pure product W-4 1.610 g.

(8-1-5) Synthesis of W-5:

W-4 (1.61 g, 0.886 mmol) was dissolved in 125 ml of dichloromethane, then dichloroacetic acid (3.5 ml, 42.43 mmol) was added and allowed to react at room temperature for 1 h. The reaction liquid was neutralized by adding 150 ml of pyridine, and the solvent was evaporated to dryness under reduced vacuo. 200-300 mesh normal phase silica gel, 10 wt% triethylamine neutralized silica gel acidity, 1 wt ‰ triethylamine equilibrium column, dichloromethane: methanol = 100:30-100:40 gradient elution, collecting product eluate, minus The solvent was evaporated to dryness to give a purified material w.

(8-1-6) Synthesis of W-6:

W-5 (1.25 g, 0.793 mmol) and A-1 (1.21 g, 2.38 mmol) obtained according to the method described in the step (1-1-7a) were mixed and dissolved in 12 ml of dichloromethane, and 3-2-B was added. Oxyphosphoryl-1,2,3-oxazolyl 4(3H)-one (DEPBT, 0.712 g, 2.38 mmol), further added diisopropylethylamine (0.615 g, 4.76 mmol), stirred at 25 ° C 3h. The organic phase was washed with 80 ml of saturated sodium bicarbonate, and the aqueous phase was extracted three times with dichloromethane (3 ml), and the organic phase was combined and washed with 10 ml of brine. The solvent was evaporated to dryness, and the mixture was evaporated to dryness in vacuo to afford crude material. Column purification using 185 g of 200-300 mesh normal phase silica gel, 20 ml of triethylamine neutralized silica gel acid, and equilibrating the column with petroleum ether containing 1 wt% triethylamine as petroleum ether: ethyl acetate: dichloromethane: N, N- The product was eluted with a gradient of dimethylformamide 1:1:1:0.1-1:1:0.7, and the solvent was evaporated to dryness.

(8-1-7) Synthesis of W-7:

W-6 (1.238 g, 0.63 mmol), succinic anhydride (0.189 g, 1.89 mmol) and 4-dimethylaminopyridine (DMAP, 0.231 g, 1.89 mmol) were dissolved in 7 ml of dichloromethane, then DIEA was added ( 0.407 g, 3.15 mmol), and the reaction was stirred at 25 ° C for 24 h. The reaction mixture was washed with 5 ml of 0.5 M triethylamine. Column purification using 30 g of 200-300 mesh normal phase silica gel, neutralization of silica gel with 1 wt% triethylamine, equilibration of the column with dichloromethane, with 1 wt of triethylamine in dichloromethane:methanol = 100:18-100:20 Gradient elution, the product eluate was collected, and the solvent was evaporated to dryness to give the purified product W. _{MS m / z: C 101 H} 146 N 7 O 38, [M-DMTr] +, theory: 1763.92, found: 1763.21.

(8-1-8) Synthesis of W-8:

W-8 was prepared by the same method as the step (1-1-9) in Preparation Example 1. The difference is that the W-9 conjugated molecule replaces the L-9 conjugated molecule to obtain a W-7 conjugated molecule attached to a solid support.

(8-2) Synthesis of W8-siHB1M1SVP Conjugate

The conjugate 15 was prepared by the same method as the steps (1-2), (1-3A), (1-4) in Preparation Example 1, except that the W-8 compound was substituted for the L-10 compound to initiate justice. Chain synthesis. It is expected that a W8-siHB1M1SVP conjugate can be obtained, which has the structure shown in formula (415).

Preparation 9: Preparation of X8-siHB1M1 SVP conjugate (conjugate 16)

According to the following route, it is expected to be able to synthesize X-8 compounds:

The conjugate 16 was prepared by the same method as the steps (1-2), (1-3A), (1-4) in Preparation Example 1, except that the X-8 compound was substituted for the L-10 compound to initiate justice. Chain synthesis. It is expected that an X8-siHB1M1SVP conjugate can be obtained, which has the structure shown by the formula (421).

Preparation 10: Preparation of Z5-siHB1M1 SVP conjugate (conjugate 17)

(10-1) Synthesis of Z-5 compounds

The Z-5 compound was synthesized as follows:

(10-1-1) Synthesis of Z-1:

W-3 (1.50 g, 3.37 mmol) obtained according to the method described in the step (8-1-3) and GAL5-C4-2 (7.18 g) obtained according to the method described in the step (3-1-2). , 13.48 mmol) was dissolved in 34 ml of dichloromethane, then diisopropylethylamine (3.48 g, 26.96 mmol) was added, and finally 3-diethoxyphosphoryl-1,2,3-benzoxazole 4 (3H) was added. The ketone (DEPBT, 4.04 g, 13.48 mmol) was stirred at room temperature for 4.5 h. The reaction mixture was diluted with 100 ml of methylene chloride, and the organic phase was washed with 80 ml of saturated sodium hydrogen carbonate solution, and the organic phase was washed with 80 ml of brine, and the organic phase was combined and dried over anhydrous sodium sulfate. Purified by a 300-mesh normal phase silica gel column, packed with petroleum ether, neutralized silica gel with 1 wt% triethylamine, and eluted with a gradient of dichloromethane:methanol = 30:1 to 15:1. Evaporation to give pure product Z-1 3.97 g. MS m/z: C ₉₈ H ₁₄₃ N ₁₀ O ₃₃ , [M+H]+, Theory: 1987.98, Found: 1987.90.

(10-1-2) Synthesis of Z-2:

Z-1 (3.97 g, 2.00 mmol) was dissolved in 250 ml of dichloromethane, then dichloroacetic acid (10.941 g, 84.85 mmol) was added and allowed to react at room temperature for 1 h. The reaction solution was neutralized by the addition of pyridine to neutrality, and the solvent was evaporated to dryness under reduced vacuo. 220g 200-300 mesh normal phase silica gel packed column, 10% pyridine neutralized silica gel acid, 1 pyridine pyridine equilibrium column, dichloromethane: methanol = 10:1-2:1 gradient elution, product eluate was collected, decompression The solvent was evaporated to give a pure product, Z-2, 3.49 g. MS m/z: C ₇₉ H ₁₂₉ N ₁₀ O ₃₃ , [M+H]+, Theory: 1746.94, found: 1746.90.

(10-1-3) Synthesis of Z-3:

Z-2 (3.49 g, 2.0 mmol) and A-1 (3.06 g, 6.0 mmol) obtained by the method described in the step (1-1-7a) were mixed and dissolved in 30 ml of dichloromethane, and 3-2-B was added. Oxyphosphoryl-1,2,3-oxazolyl 4(3H)-one (DEPBT, 1.80 g, 6.0 mmol), further added diisopropylethylamine (1.55 g, 12.0 mmol), stirred at 25 ° C 3h. The reaction mixture was diluted with 100 ml of methylene chloride. The organic phase was washed twice with saturated sodium bicarbonate twice, 30 ml each time, and the aqueous phase was extracted with 10 methylene chloride. The organic phase was combined and washed with 50 ml of saturated brine. After drying, the solvent was evaporated to dryness under reduced pressure, and then evaporated to dryness with vacuo. Column purification using 200 g of 200-300 mesh normal phase silica gel, 20 ml of triethylamine neutralized silica gel acid, equilibrated with petroleum ether containing 1 wt% triethylamine, gradient elution with dichloromethane: methanol = 25:1-15:1 The product eluate was collected, and the solvent was evaporated to dryness under reduced pressure to yield purified product. _{MS m / z: C 103 H} 151 N 10 O 38, [M + H] +, theory: 2136.02, found: 2136.20.

(10-1-4) Synthesis of Z-4:

Z-3 (2.10 g, 0.983 mmol) was dissolved in 14.8 ml of dichloromethane containing DIEA (0.635 g, 4.915 mmol), and 4-dimethylaminopyridine (DMAP, 240 mg, 1.966 mmol) was added and stirred for clarification. Succinic anhydride (197 mg, 1.966 mmol) was stirred at 25 ° C for 18 h. The reaction mixture was diluted with 50 ml of dichloromethane, and the organic layer was washed with EtOAc EtOAc EtOAc. Column purification using 188 g of 200-300 mesh normal phase silica gel, neutralization of silica gel with 1 wt% triethylamine, equilibration of the column with dichloromethane, with 1 wt of triethylamine in dichloromethane:methanol = 10:1-3:1 Gradient elution, the product eluate was collected, and the solvent was evaporated to dryness to give a purified product. _{MS m / z: C 107 H} 155 N 10 O 41, [M + H] +, theory: 1935.07, found: 1935.29.

(10-1-5) Synthesis of Z-5

Z-5 was prepared by the same method as the step (1-1-9) in Preparation Example 1. The difference is that the Z-4 conjugated molecule replaces the L-9 conjugated molecule to obtain a Z-4 conjugated molecule attached to a solid support.

(10-2) Synthesis of Z5-siHB1M1SVP Conjugate

The conjugate 17 was prepared by the same method as the steps (1-2), (1-3A), (1-4) in Preparation Example 1, except that the Z-5 compound was substituted for the L-10 compound to initiate justice. Chain synthesis. It is expected that a Z5-siHB1M1SVP conjugate can be obtained, which has the structure shown by the formula (422).

Preparation 11: Preparation of conjugate 20

In the present preparation, conjugate 20 (hereinafter also referred to as FIN-siHB1M1SVP conjugate) was synthesized. See Table 2 for the sequence of the siRNA conjugated in this conjugate.

(11-1) Synthesis of FIN-2 Conjugated Molecules

The FIN-2 conjugated molecule was synthesized according to the preparation method described in Rajeev et al., ChemBioChem 2015, 16, 903-908 according to the following route:

(11-1-1) Synthesis of PRO-10

(11-1-1a) Synthesis of PRO-7

2.93 g of PRO-6 (L-hydroxyproline, CAS No.: 51-35-4, available from Ange, 22.4 mmol) was dissolved in 22.5 ml of 1,4-dioxane (1,4-dioxane). Ring, CAS No.: 123-91-1), add 34 ml of 10% (w/w) aqueous solution of Na ₂ CO ₃ to a suspension state, and 6.95 g of Fmoc-Cl (chloroformic acid-9-fluorenyl) Ester, CAS No.: 28920-43-6, purchased from Anheji Company, 26.8 mmol) dissolved in 34 ml of 1,4-dioxane, added to the above suspension in an ice bath, and naturally raised to room temperature overnight. . The reaction solution was poured into 150 ml of ice water, extracted with methyl t-butyl ether three times, 100 ml each time, the organic phase was discarded, the aqueous phase was adjusted to pH ≤ 5 with concentrated HCl, and extracted twice with 100 ml of ethyl acetate. The organic layer was dried over anhydrous sodium sulfate (MgSO4). ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 7.91 (t, J = 7.2 Hz, 2H), 7.67 (d, J = 7.5 Hz, 2H), 7.48-7.39 (m, 2H), 7.38-7.27 ( m, 2H), 5.17 (s, 1H), 4.27 (s, 2H), 4.23-4.11 (m, 2H), 3.55-3.41 (m, 3H), 2.31-2.10 (m, 1H), 2.08-1.88 ( m, 1H). HRMS (ESI) m / z theoretical _{_{_{C 20 H 19 NO 5 [MH}}} ] - 352.1190, found 352.1033.

(11-1-1b) Synthesis of PRO-8

7.83 g of PRO-7 (22.2 mmol) was dissolved in 80 ml of THF (CAS number: 109-99-9), heated to 65 ° C in an oil bath, and 36.6 ml of 2 mol/L BH ₃ -Me ₂ S was added under reflux. The THF solution (CAS No. 13292-87-0, purchased from Belling Company, 73.2 mmol) was refluxed for 3 hours. The reaction mixture was poured out, and the residual solid was dissolved with methanol. Methanol was added to the reaction mixture, and the mixture was stirred for 30 minutes. The solvent was evaporated under reduced pressure and purified with petroleum ether. ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 7.91 (t, J = 6.7 Hz, 2H), 7.67 (d, J = 7.2 Hz, 2H), 7.49-7.39 (m, 2H), 7.38-7.26 ( m, 2H), 5.18 (dd, J = 6.1, 3.8 Hz, 1H), 4.28 (s, 2H), 4.23-4.13 (m, 2H), 3.55-3.38 (m, 2H), 2.32-2.11 (m, 1H), 2.08-1.89 (m, 1H). HRMS (ESI) m / z theoretical _{_{_{C 20 H 21 NO 4 [M}}} + Na] + 362.1368, found 362.1012.

(11-1-1c) Synthesis of PRO-9

7.1 g of PRO-8 (21 mmol) was dissolved in 100 ml of pyridine, and 14.2 g of DMTr-Cl (4,4'-bismethoxytrityl chloride, 42 mmol) was added, and the reaction was stirred at room temperature for 5 hours. The solvent was evaporated under reduced pressure. the crude product was dissolved in ethyl acetate and then filtered to remove salty impurities. The solvent was evaporated under reduced pressure and purified on silica gel column. The silica gel column was basified with pyridine and then dissolved in DCM to dissolve the crude product, first containing 1% (v) /v) dimethyl pyridine was eluted with EtOAc (EtOAc) eluted eluted eluted eluted eluted eluted eluted eluted eluted eluted Theory C ₄₁ H ₃₉ NO ₆ [M+Na] ⁺ 664.2675, found 664.2348; C18 RP-HPLC (batch JJS 160324-1) purity 94.20%.

(11-1-1d) Synthesis of PRO-10

8.2 g of PRO-9 (12.8 mmol) was dissolved in 64 ml of DMF (N,N-dimethylformamide), 40 ml of piperidine (384 mmol) was added, and the reaction was stirred at room temperature for 30 minutes. The reaction solution was poured into 300 ml of ice water, and extracted with ethyl acetate three times, 150 ml each time, and the organic phase was combined, washed with 200 ml of brine, and the organic phase was dried over anhydrous sodium sulfate. The column was pre- basified with pyridine, and the crude product was dissolved in DCM. The Fmoc was eluted with DCM containing 1% (v/v) pyridine, and then the product was eluted with ethyl acetate. The white solid product PRO-10 4.65 g was obtained. ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 7.40 (d, J = 7.2 Hz, 2H), 7.35-7.18 (m, 7H), 6.93 - 6.84 (m, 4H), 4.56 (d, J = 3.9 Hz, 1H), 4.12 (s, 1H), 3.74 (s, 6H), 3.46-3.37 (m, 1H), 2.88 (ddd, J = 18.5, 10.0, 5.5 Hz, 2H), 2.75 (dd, J = 8.7, 5.8 Hz, 1H), 2.62 (dd, J = 11.0, 2.7 Hz, 1H), 1.74-1.65 (m, 1H), 1.40 (ddd, J = 12.9, 8.5, 5.9 Hz, 1H); HRMS (ESI) m/z theory C ₂₆ H ₂₉ NO ₄ [M+Na] ⁺ 442.1994, found 442.1999; C18 RP-HPLC (batch JJS 160329-1) purity 97.07%.

(11-1-2) Synthesis of FIN-1

GAL-5 (4.5 g, 10 mmol) obtained according to the method described in (1-1-1) was dissolved in 40 ml of DMF, and 3.9 g of DIPEA (N,N-diisopropylethylamine, CAS number: 7087-68-5, purchased from Aladdin, 30mmol) and 3.8g HBTU (benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate, CAS No.:94790-37 -2, commercially available from Aladdin, 11 mmol), stirred at room temperature for 10 minutes, and PRO-10 (4.2 g, 10 mmol) obtained in the step (11-1-1d) was dissolved in 40 ml of DMF, and then added to the above reaction. The mixture was dried over anhydrous sodium sulfate and stirred at room temperature for 2 hr. The reaction mixture was poured into 120 ml of ice water, and extracted with EtOAc (EtOAc) EtOAc. The solvent was purified by silica gel column chromatography, and the silica gel column was basified with pyridine, and then applied to a solution of 1% by volume of triethylamine and 1% by volume of methanol in dichloromethane (DCM). The solvent was evaporated to give a pale-yellow solid product FIN-1 6.5 g. ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 7.83 (d, J = 9.2 Hz, 1H), 7.32 (t, J = 6.6 Hz, 4H), 7.20 (td, J = 8.9, 3.5 Hz, 5H) , 6.93-6.84 (m, 4H), 5.21 (d, J = 3.2 Hz, 1H), 5.04-4.90 (m, 2H), 4.49 (s, 1H), 4.40 (d, J = 4.4 Hz, 0.8H) , 4.31 (d, J = 5.0 Hz, 0.2H), 4.15 (s, 1H), 4.03 (s, 3H), 3.93 (s, 1H), 3.74 (s, 7H), 3.59 (dt, J = 12.0, 6.0 Hz, 1H), 3.50-3.40 (m, 1H), 3.39-3.25 (m, 3H), 3.13 (dd, J = 8.9, 5.2 Hz, 1H), 3.00 (dq, J = 9.3, 5.3, 4.3 Hz) , 1H), 2.22 (s, 2H), 2.07 (s, 3H), 1.99 (s, 3H), 1.90 (s, 4H), 1.74 (s, 3H), 1.50 (s, 3H), 1.36 (s, 1H). The purity of C18 RP-HPLC (batch LJ160422) was 95.45%.

(11-1-3) Synthesis of FIN-2

FIN-1 (3.0 g, 3.53 mmol) obtained in the step (11-1-2) was azeotropically dehydrated with acetonitrile, dried under reduced pressure, dissolved in 10 ml of DMF, and 2. Isopropylamino)(2-cyanoethoxy)phosphine, available from Adamas Company, trade number 11356B, 7.06 mmol), 346 mg tetrazolium (CAS number: 288-94-8, purchased from Aladdin, 4.94 mmol) The reaction was stirred at room temperature, and 10 ml of DMF was added thereto, and the reaction was further stirred for 1 hour. The solvent was evaporated under reduced pressure and purified by silica gel column chromatography. EtOAc EtOAc EtOAc EtOAc 4.5g. The crude product was dissolved in 50% by volume aqueous acetonitrile until completely dissolved, using C-18, 330 g,

The sample was purified by a medium pressure purification column, and the column was first basified with 1% by volume of pyridine in acetonitrile, and the product peak was collected by gradient elution, and the solvent was evaporated under reduced pressure to give a white powder product, FIN-2 conjugated molecule, 2.2 g. ³¹ p NMR (162 MHz, CDCl ₃ ) δ 148.04, 147.94, 147.62, 147.19, phosphoric acid purity 92%; C18 RP-HPLC purity 90.54%.

(11-2) FIN-2 conjugated molecule linked to a solid support

Using the nucleic acid solid phase synthesis method, the FIN-2 conjugated molecule obtained in the step (11-1-3) is connected to the universal solid phase carrier (UnyLinkerTM loaded ⁾ through three cycles.

Solid Supports) to achieve attachment of the conjugate group (FIN_FIN_FIN) to the 3' end of the RNA sense strand.

The above-described ligation is carried out in accordance with the preparation method described in Rajeev et al., ChemBioChem 2015, 16, 903-908. Specifically, first, starting from the above-mentioned universal solid phase carrier, the hydroxyl protecting group on the solid phase carrier is removed, and Coupling conditions and coupling reagents are coupled to the FIN-2 conjugated molecule in the presence of a coupling reagent, and after the cap reaction and the oxidation reaction, a FIN conjugated molecule attached to the solid phase carrier is obtained; and the attachment to the solid phase carrier is removed. The hydroxy protecting group DMTr on the FIN conjugated molecule is coupled to the FIN-2 conjugated molecule for capping reaction and oxidation reaction, and the above-mentioned deprotection-coupling-cap-oxidation step is repeated once again. One FIN-2 conjugated molecule, the conjugated group (FIN_FIN_FIN) attached to the solid support was obtained.

In the above reaction, the deprotection, coupling, capping, oxidation reaction conditions, solvent and reagent amount are the same as those of the nucleic acid solid phase synthesis method described in the above step (1-2).

(11-3) Synthesis of Conjugate 20

The title conjugate was prepared by the same method as the steps (1-2), (1-3A), (1-4) in Preparation Example 1, except that: 1) obtained by the step (11-2) The compound initiates sense strand synthesis; 2) the conjugated siRNA has the sequence corresponding to conjugate 20 shown in Table 2.

Molecular weight detection was carried out using a LC-MS (Liquid Chromatography-Mass Spectrometry, available from Waters, Model: LCT Premier). As a result, the measured values were in agreement with the theoretical values, thereby confirming that the synthesized conjugate was a target-designed compound, and its structure was as shown in the formula (307).

After the preparation of the conjugate of the present disclosure described above is completed, it is lyophilized as a solid powder for storage by standard means. In use, it can be used, for example, by reconstituting it with water for injection to a solution of the desired concentration.

Experimental Example 1 This experiment illustrates the stability of the siRNA conjugates of the present disclosure.

(Experimental Example 1-1) Stability of siRNA conjugates in lysosomal lysates in vitro

Test sample preparation by lysosomal lysate preparation: Conjugate 4 (provided as a 0.9% sodium chloride aqueous solution having a siRNA concentration of 20 μM in an amount of 6 μl per group) and 27.2 μL of an aqueous solution of sodium citrate (pH 5.0), respectively. 4.08 μL of deionized water and 2.72 μL of Tritosomes (commercially available from Xenotech, Inc., R0610LT, lot number 1610069, final concentration 0.2 mU/μL) were mixed. Incubate at 37 ° C. 5 μl samples were taken at 0h, 5min, 15min, 30min, 1h, 2h, 4h, 8h, respectively, and then added to 15μL of 9M urea for denaturation, followed by 4μl of 6× loading buffer (Solebao, Item No. 20160830), immediately The reaction was terminated by freezing in a -80 ° C refrigerator. 0 hours indicates the time at which the sample to be tested is mixed with the lysosomal lysate and immediately removed.

Reference sample preparation without lysosomal lysate preparation: Take 1.5 μl of equimolar amount of conjugate 4 (20 μM) and 7.5 μL of sodium citrate aqueous solution (pH 5.0), mix with 1 μL of deionized water, and add 30 μL of 9M. The urea solution was denatured, then 8 μL of 6× loading buffer was added and mixed, and immediately frozen in a -80 ° C refrigerator to terminate the reaction. The reference sample is labeled Con in the electropherogram.

A 16% by weight non-denaturing polyacrylamide gel was prepared. 20 μl of each of the above test sample and reference sample was applied to the gel, and after electrophoresis for 10 min under a constant current of 20 mA, electrophoresis was continued for 30 min under a constant current of 40 mA. After the end of the electrophoresis, the gel was placed on a shaker and stained with Gelred dye (BioTium, Cat. No. 13G1203) for 10 min. The gel was observed and photographed, and the results are shown in Fig. 1.

Figure 1 shows the results of semi-quantitative detection of the stability of the tested siRNA conjugates in vitro lysosomes. The results show that the conjugate of the present disclosure can be maintained in lysosomes for a long time without degradation, showing good stability.

(Experimental Example 1-2) Stability of siRNA conjugate in human plasma

Conjugate 4 (provided as a 0.9% sodium chloride aqueous solution having a siRNA concentration of 20 μM, 12 μl) and Comparative Sequence 1 (20 μM, 12 μl) were mixed with 108 μL of 90% human plasma (Human plasma, PBS diluted), respectively. Incubate at 37 ° C. 10 μL of the sample was taken at 0, 2, 4, 6, 8, 24, 48, and 72 hours, and immediately frozen in liquid nitrogen, and frozen in a refrigerator at -80 °C. After sampling at each time point, the above frozen samples were diluted 5 times with 1×PBS (pH 7.4), and 10 μL of each sample was taken for use. Meanwhile, an equimolar amount of siRNA (2 μM, 2 μl) or siRNA conjugate (siRNA concentration: 2 μM, 2 μl) was mixed with 8 μl of 1×PBS (pH 7.4) to prepare 10 μL of the sample which was not treated with human plasma. Recorded as Con.

A 20% by weight non-denaturing polyacrylamide gel was prepared, and all samples of each of the above-mentioned spare samples were mixed with 4 μL of loading buffer (20 mM EDTA, 36% by weight glycerol, 0.06% by weight aqueous solution of bromophenol blue). Then, the sample was applied to the above gel, and electrophoresed under a constant current of 80 mA for 60 minutes. After completion of electrophoresis, the cells were stained with 1×Sybr Gold dye (Invitrogen, Cat. 11494) for 15 minutes, and the results were as shown in Fig. 2 .

Comparison sequence 1:

Justice chain: CCUUGAGGCAUACUUCAAA (SEQ ID NO: 29)

Antisense strand: UUUGAAGUAUGCCUCAAGGUU (SEQ ID NO: 30)

Figure 2 shows the results of semi-quantitative detection of the stability of the tested conjugates in human plasma in vitro.

As can be seen from the results of Figure 2, the conjugates of the present disclosure did not degrade in human plasma up to 72 h, showing excellent stability in human plasma.

(Experimental Example 1-3) Stability of siRNA conjugates in monkey plasma

In a separate experiment, the stability of conjugate 4 in monkey plasma (Monkey plasma, purchased from Hongquan Bio, HQ70082, PBS) was tested in the same manner as in Experimental Example 1-2, and the results are shown in FIG. .

Figure 3 shows the results of semi-quantitative detection of the stability of the tested conjugates in monkey plasma in vitro.

As can be seen from the results of Figure 3, the siRNA conjugates of the present disclosure did not degrade in cynomolgus monkey plasma until 72 h, showing excellent stability in monkey plasma.

Experimental Example 2 This experimental example demonstrates the inhibitory activity of the siRNA conjugate of the present disclosure in vitro (in vitro)

(Experimental Example 2-1) Target activity in the in vitro psiCHECK system

The HEK293A cells used in this experimental example were provided by the Nucleic Acid Technology Laboratory of the Institute of Molecular Medicine, Peking University, using 20% fetal bovine serum (FBS, Hyclone) and 0.2% by volume of scleromycin double antibody (Penicillin- The cells were cultured in DMEM complete medium (Hyclone) of Streptomycin, Gibco, Invitrogen, and cultured at 37 ° C in an incubator containing 5% CO ₂ /95% air.

This experimental example examined the on-target activity of conjugate 20 in the in vitro psiCHECK system, ie, the conjugate 20 targeted complete match target sequence was determined (the nucleotide sequence thereof and the conjugate) The full length nucleotide sequence of the antisense strand is fully complementary).

According to Kumico Ui-Tei et. al., Functional dissection of siRNA sequence by systematic DNA substitution: modified siRNA with a DNA seed arm is a powerful tool for mammalian gene silencing with significantly reduced off-target effect. Nucleic Acids Research, 2008.36 (7 a method described in 2136-2151, constructing a detection plasmid, co-transfected with the siRNA conjugate to be evaluated into HEK293A cells, and reacting the expression level of the double luciferase reporter gene to reflect the target of the siRNA conjugate Activity and off-target effects. Specific steps are as follows:

[1] Constructing a detection plasmid

Using psiCHECK ^{^TM} -2 (Promega ^TM) plasmid constructs in the target plasmid, the plasmid comprising a target sequence, all 21 nucleotides of the sequence of the antisense strand of the target sequence with a test conjugate is fully complementary. The target sequence is cloned into plasmid psiCHECK ^TM -2 Xho I / Not I site.

[2] Transfection

In 96 well plates, in accordance with Lipofectamine ^TM 2000 (Invitrogen Corp.) instructions for use, respectively, cotransfection plasmids and said siRNA conjugate, wherein 10 ng of plasmid were transfected per well, using Lipofectamine ^TM 2000 0.2μL. The final concentration of the conjugate (calculated as the concentration of siRNA) was 0.1 nM, 0.05 nM, and 0.01 nM, in order. Each group was treated with no conjugate as a control. 3 duplicate wells per group.

NC is a universal negative control B01001 with no homology between the gene and the gene sequence of the gene.

[3] Detection

After 24 hours of co-transfection, the dual luciferase reporter gene assay kit (Promega, cat. E2940) was used to lyse HEK293A cells according to the instructions for use to detect the double luciferase reporter gene. The expression level. The Renilla luciferase protein level was normalized to the firefly luciferase protein level. The result is shown in Figure 4.

The results indicate that the conjugate 20 has a good in vitro inhibitory activity.

Experimental Example 2-2 Determination of IC ₅₀ and off-target detection in an in vitro psiCHECK system

This experimental example examines the IC ₅₀ and off-target effects of conjugate 4 in the in vitro psiCHECK system.

According to Kumico Ui-Tei et. al., Functional dissection of siRNA sequence by systematic DNA substitution: modified siRNA with a DNA seed arm is a powerful tool for mammalian gene silencing with significantly reduced off-target effect. Nucleic Acids Research, 2008.36 (7 , the method described in 2136-2151, constructs a detection plasmid, co-transfected with the conjugate to be tested into HEK293A cells, and reacts the target activity and off-target of the conjugate by the expression level of the double luciferase reporter gene. effect. Specific steps are as follows:

[1] Constructing a detection plasmid

Using psiCHECK ^{^TM} -2 (Promega ^TM) plasmid construct four recombinant plasmids, which represents the target plasmid GSCM, PSCM, GSSM, PSSM off target plasmid represents:

(1) GSCM, comprising a target sequence which is fully complementary to all 21 nucleotide sequences of the antisense strand in conjugate 4;

(2) PSCM, which contains a target sequence which is identical to all 21 nucleotide sequences of the antisense strand in conjugate 4;

(3) GSSM, comprising a target sequence which is fully complementary to the 1-8 nucleotide sequence of the 5' end of the antisense strand of the siRNA to be tested, and the remaining part of the target sequence is antisense to the siRNA to be tested. The 5' end of the chain corresponds to the nucleotide sequence of 9-21, and the sequence is completely non-complementary, that is, the nucleotide at any position of the 9-21 position of the 5' end of the antisense strand in the siRNA to be tested is G, When C, A or U, the nucleotides at the corresponding positions of the target sequence are T, A, C or G, respectively.

(4) PSSM, which contains a target sequence which is fully complementary to the nucleotide sequence of 1-8 from the 5' end of the sense strand in the siRNA to be tested, and the remainder of the target sequence and the sense strand 5 in the siRNA to be tested. 'The nucleotide sequences corresponding to positions 9-19 are corresponding, and the sequences are completely non-complementary, that is, the nucleotides at any position 9-9 of the 5' end of the sense strand in the siRNA to be tested are G, C, A. Or U, the nucleotides at the corresponding positions of the target sequence are T, A, C or G, respectively. In order to be as long as the GSSM target sequence, nucleotides A and C are sequentially added to the 3' end of the target sequence.

The target sequence is cloned into plasmid psiCHECK ^TM -2 Xho I / Not I site.

[2] Transfection

In 96 well plates, in accordance with Lipofectamine ^TM 2000 (Invitrogen Corp.) instructions for use, respectively, cotransfection conjugate and each of these plasmids, in which 10 ng of plasmid were transfected per well, using Lipofectamine ^TM 2000 0.2μL, siRNA conjugation The final concentration (in terms of siRNA) was started from 0.1 nM and diluted to 0.0001 nM. One plasmid corresponds to 11 groups of siRNA concentrations, and each group had 3 replicate wells.

[3] Detection

After HEK293A cells were cultured for 24 hours, the cells were lysed according to the instruction manual using a Dual luciferase reporter gene assay kit (Promega, cat. E2940) to detect the expression level of the double fluorescent reporter gene. Each specific concentration of the conjugate test group was treated with the conjugate-free treatment group as a control. The Renilla luciferase protein level (Ren) was normalized to the firefly luciferase protein level (Fir).

Based on the activity results measured with different siRNA concentrations, the Graphpad 5.0 software log (inhibitor) vs. response-Variable slope function was used to fit the dose-response curve, and the IC _{50 of} the siRNA-targeted GSCM was calculated from the dose-response curve. The value is calculated as follows:

In the formula:

Y is the expression level of residual mRNA,

X is the logarithm of the concentration of transfected siRNA,

Bot is the Y value at the bottom of the steady state period.

Top is the Y value at the top of the steady state period.

LogIC ₅₀ is the X value when Y is halfway between the bottom and the top, and HillSlope is the slope of the curve. The result is shown in Figure 5.

As is apparent from Fig. 5, the conjugate 4 exhibited an excellent target mRNA inhibitory effect while exhibiting a low off-target effect.

Experimental Example 3 This experimental example illustrates the inhibition of HBV mRNA expression by the conjugate of the present disclosure in mice.

In this experimental example, the inhibition efficiency of HBV mRNA expression in conjugate 4 in HBV transgenic mouse C57BL/6J-Tg(Alb1HBV)44Bri/J was examined.

C57BL/6J-Tg(Alb1HBV)44Bri/J mice were purchased from the Department of Laboratory Animal Science of Peking University Medical School, and the serum HBsAg was detected using the hepatitis B virus surface antigen diagnostic kit (ELISA) (Shanghai Kehua Bio). The mice with S/COV>10 were randomly divided into groups (all females), and 4 mice in each group were numbered respectively, and the saline NS control group was added. All animals were dosed according to body weight, administered in a single dose by subcutaneous injection, and conjugate 4 was administered at different doses of 1 mg/kg and 0.1 ml/kg, respectively (0.2 mg/ml and 0.9% chlorine at 0.02 mg/ml). Provided as an aqueous sodium solution), the administration volume is 5 ml/kg. The animals were sacrificed on the 7th day after the administration, and the liver was collected and stored with RNA later (Sigma Aldrich); the liver tissue was homogenized with a tissue homogenizer, and total RNA was extracted by Trizol according to the standard procedure of total RNA extraction.

Expression using real time PCR detection of HBV mRNA in liver tissue, and in particular: the use ImProm-II ^TM reverse transcription kit (Promega Corporation) according to its specification the extracted total RNA as the cDNA reverse transcription, followed by quantitative PCR The kit (Beijing Kangwei Century Biotechnology Co., Ltd.) was used to detect the inhibition efficiency of siRNA on HBV mRNA expression in liver tissue. In the real-time PCR method, HBV and β-actin were detected using a β-actin gene as an internal reference gene, and a primer against HBV and a primer against β-actin.

See Table 3 for the sequence of the detection primers.

Table 3 detects the sequence of the primers

In the real-time PCR method, the expression level of HBV mRNA is expressed by the remaining amount of HBV X gene expression, and is calculated as follows:

Remaining amount of HBV X gene expression = (copy number of HBV X gene in test group / copy number of β-actin in test group) / (copy number of HBV X gene in control group / copy number of β-actin in control group) × 100%, The figure indicates the amount of HBV X/β-actin mRNA expression.

The conjugate inhibition rate of mRNA was then calculated according to the following formula:

The inhibition rate of the conjugate to mRNA = (the remaining amount of 1-HBV X gene expression) × 100%,

Among them, the control group was a control group of mice administered with NS in the experiment, and each test group was a group of mice administered with different siRNA conjugates. The results are shown in Figure 6.

As can be seen from the results of FIG. 6, the above-described conjugate of the present disclosure inhibited the target mRNA by 93.63% at a dose of 1 mg/kg; at a lower concentration (0.1 mg/kg), It still has an inhibition rate of 77.05%, and both show good inhibition effects.

Experimental Example 4 This experiment demonstrates the inhibitory effect of the siRNA conjugates of the present disclosure on HBsAg and HBV mRNA in a single administration on the M-Tg model.

HBV transgenic (M-TgHBV) mice (purchased from the Animal Department of Shanghai Public Health Center) were randomly divided into three groups according to the serum HBsAg content (6 in each group, all male), which were respectively saline (NS) control group. Conjugates 41 mg/kg and 3 mg/kg groups. All animals were dosed according to body weight, and the administration volume was 10 ml/kg, subcutaneous administration. Blood was taken from the orbital venous plexus of mice before administration (denoted as D0) and on days 7, 14, 21, 28, 42, 56, 70, and 85 after administration, and serum HBsAg levels were measured at each time point.

The eyelids take about 0.5 ml of blood each time, and the serum after centrifugation is not less than 200 μl. Serum HBsAg levels were measured using the HBsAg CLIA kit (Antu Bio, CL0310).

Standardized serum HBsAg levels = (HssAg content in the test group after administration / HBsAg content in the test group before administration) x 100%.

HBsAg inhibition rate = (1 - HBsAg content after administration / HBsAg content before administration) amount sAg%.

Among them, the HBsAg content is expressed by how many equivalents (UI) of HBsAg are contained per milliliter (ml) of serum.

The expression level of HBV mRNA was measured in the same manner as in Experimental Example 3.

Figure 7 and Figure 8 below show the results of the above-described test siRNA conjugate assay for inhibition of HBsAg and HBV X mRNA expression by a single administration on the M-Tg model.

From the results of Fig. 7 and Fig. 8, it can be seen that the maximum inhibition rate of HBsAg by conjugate 4 of 3 mg/kg for a single administration is above 95%, and the inhibition rate of HBsAg is over 56 days. More than 90%, the inhibition rate of HBV X mRNA in D85 was 62%.

Experimental data

Said that the data analysis using Graphpad prism5.0 statistical analysis software. First, the data is normally distributed and tested for homogeneity of variance. Consistent with normal distribution (p>0.20) and variance (p>0.10): multiple comparisons were performed using LSS method with one-way analysis of variance for multiple comparisons, p<0.05 considered statistically significant; non-conforming to normal distribution or variance Inconsistent: Kruskal-Wallis H method with nonparametric test was used to compare between groups. If the Kruskal-wallis H test results were significant (p<0.05), then the data was subjected to rank conversion, and then the two groups were compared, p< 0.05 was considered statistically significant. Significant differences are indicated by * in the figure.

The embodiments of the present disclosure have been described in detail above, but the present disclosure is not limited to the specific details in the above embodiments, and various simple modifications can be made to the technical solutions of the present disclosure within the scope of the technical idea of the present disclosure. It is within the scope of protection of the present disclosure.

It should be further noted that the specific technical features described in the above specific embodiments may be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present disclosure will not be further described in various possible combinations.

In addition, any combination of various embodiments of the present disclosure may be made as long as it does not deviate from the idea of the present disclosure, and it should also be regarded as the disclosure of the present disclosure.

Incorporated by reference

All publications, patents, and patent applications mentioned in this specification are hereby incorporated by reference in their entirety in their entirety herein The same level.

Claims

An siRNA comprising a sense strand and an antisense strand, each of the nucleotides of the siRNA being independently a modified or unmodified nucleotide, wherein the sense strand comprises a nucleotide sequence I, the antisense strand contains a nucleotide sequence II, and the nucleotide sequence I and the nucleotide sequence II at least partially complement each other to form a double-stranded region, wherein the nucleotide sequence I contains a nucleus a nucleotide sequence A, the nucleotide sequence A is equal in length to the nucleotide sequence shown in SEQ ID NO: 1, and no more than 3 nucleotide differences, and the nucleotide sequence II contains a nucleoside Acid sequence B, the nucleotide sequence B is equal in length to the nucleotide sequence shown in SEQ ID NO: 2, and no more than 3 nucleotide differences:

5'-CGUGUGCACUUCGCUUCAZ-3' (SEQ ID NO: 1);

5'-Z'UGAAGCGAAGUGCACACG-3' (SEQ ID NO: 2),

Where Z is A and Z' is U,

The nucleotide sequence A comprises a nucleotide Z A corresponding to a position Z, and the nucleotide sequence B comprises a nucleotide Z' B at a position corresponding to Z', wherein the Z' B is The first nucleotide of the 5' end of the antisense strand.
The siRNA according to claim 1, wherein the nucleotide sequence A has no more than one nucleotide difference between the nucleotide sequence shown by SEQ ID NO: 1, and/or the nucleoside There is no more than one nucleotide difference between the acid sequence B and the nucleotide sequence shown in SEQ ID NO: 2.
The siRNA according to claim 1 or 2, wherein the nucleotide difference between the nucleotide sequence B and the nucleotide sequence shown by SEQ ID NO: 2 includes a difference at the Z' B position, and Z' B is selected from A, C or G.
The siRNA according to claim 3, wherein Z A is a nucleotide complementary to Z' B.
The siRNA according to any one of claims 1 to 4, wherein the nucleotide sequence I and the nucleotide sequence II are substantially reverse complementary, substantially reverse complementary or completely reverse complementary; Substantially reverse complementation means that there are no more than three base mismatches between two nucleotide sequences; said substantially reverse complement means that there is no more than one between two nucleotide sequences Base mismatch; complete reverse complementation means that there is no mismatch between the two nucleotide sequences.
The siRNA according to any one of claims 1 to 5, wherein the nucleotide sequence A is the nucleotide sequence shown in SEQ ID NO: 3, and the nucleotide sequence B is represented by SEQ ID NO: Nucleotide sequence:

5'-CGUGUGCACUUCGCUUCAZ A -3' (SEQ ID NO: 3);

5'-Z' B UGAAGCGAAGUGCACACG-3' (SEQ ID NO: 4),

Wherein Z' B is the first nucleotide at the 5' end of the antisense strand, Z A is selected from A, U, G or C, and Z' B is a nucleotide complementary to Z A .
The siRNA according to claim 6, wherein Z A is A and Z' B is U.
The siRNA according to any one of claims 1 to 7, wherein the nucleotide sequence I further comprises a nucleotide sequence III, and the nucleotide sequence II further comprises a nucleotide sequence IV, a nucleotide The lengths of the sequence III and the nucleotide sequence IV are each independently 1-4 nucleotides, the nucleotide sequence III is ligated at the 5' end of the nucleotide sequence A, and the nucleotide sequence IV is ligated to the nucleoside At the 3' end of the acid sequence B, the nucleotide sequence III and the nucleotide sequence IV are equal in length and substantially reverse complementary or completely reverse complementary; the substantially reverse complementation refers to two nucleosides There is no more than one base mismatch between the acid sequences; complete reverse complementation means that there is no mismatch between the two nucleotide sequences.
The siRNA according to claim 8, wherein the nucleotide sequences III and IV are each 1 nucleotide in length, and the nucleotide sequence III has a base C;

Alternatively, the nucleotide sequences III and IV are both 2 nucleotides in length, and the nucleotide sequence III is sequentially AC in the direction from the 5' end to the 3' end;

Alternatively, the nucleotide sequences III and IV are each 3 nucleotides in length, and the nucleotide sequence III bases are sequentially GAC in the direction from the 5' end to the 3' end;

Alternatively, the nucleotide sequences III and IV are each 4 nucleotides in length, and the nucleotide sequence III has a base of GGAC in the order of the 5' end to the 3' end.
The siRNA according to any one of claims 1 to 9, wherein said nucleotide sequence II further comprises a nucleotide sequence V, and the nucleotide sequence V is 1 to 3 nucleotides in length, which is ligated in said antisense The 3' end of the strand constitutes the 3' hanging end of the antisense strand.
The siRNA according to claim 10, wherein the nucleotide sequence V is 2 nucleotides in length.
The siRNA according to claim 10 or 11, wherein the nucleotide sequence V is two consecutive thymidine deoxyribonucleotides or two consecutive uracil ribonucleotides, or the nucleotides Sequence V is complementary to the nucleotide at the corresponding position of the target mRNA.
The siRNA according to any one of claims 1 to 12, wherein the sense strand of the siRNA contains the nucleotide sequence shown as SEQ ID NO: 3, and the antisense strand contains SEQ ID NO: 4 The nucleotide sequence shown:

5'-CGUGUGCACUUCGCUUCAZ A -3' (SEQ ID NO: 3);

5'-Z' B UGAAGCGAAGUGCACACGGU-3' (SEQ ID NO: 4);

Wherein Z' B is the first nucleotide at the 5' end of the antisense strand, Z A is selected from A, U, G or C, and Z' B is a nucleotide complementary to Z A .
The siRNA according to any one of claims 1 to 13, wherein the siRNA is siHBV1:

siHBV1

Justice chain: 5'-CGUGUGCACUUCGCUUCAZ-3' (SEQ ID NO: 1),

Antisense strand: 5'-Z'UGAAGCGAAGUGCACACGGU-3' (SEQ ID NO: 5),

Where Z is A and Z' is U.
The siRNA according to any one of claims 1 to 14, wherein at least one of the sense strand or the antisense strand is a modified nucleotide, and/or at least one phosphate group is A phosphate group having a modifying group.
The siRNA according to any one of claims 1 to 15, wherein each of the sense strand and the antisense strand is independently a fluoro-modified nucleotide or a non-fluoro-modified Nucleotide.
The siRNA according to claim 16, wherein the fluoro-modified nucleotide is located in nucleotide sequence A and nucleotide sequence B, and the core is in a direction from the 5' end to the 3' end. The nucleotides at positions 7, 8, and 9 of the nucleotide sequence A are fluoro-modified nucleotides; the second, sixth, and fourth nucleotide sequences B are in the direction from the 5' end to the 3' end. The nucleotide at position 16 is a fluoro-modified nucleotide.
The siRNA according to claim 17, wherein in the sense strand, at the 7th, 8th, 9th or 5th, 7th, and 8th positions of the nucleotide sequence A, in the direction from the 5' end to the 3' end The nucleotide at position 9 is a fluoro-modified nucleotide, and the nucleotides at the rest of the sense strand are non-fluoro-modified nucleotides; in the direction from the 5' end to the 3' end, In the antisense strand, the nucleotides at positions 2, 6, 14, 16 or 2, 6, 8, 9, 14, and 16 of the nucleotide sequence B are fluoro-modified nucleotides. The nucleotides remaining in the antisense strand are non-fluoro-modified nucleotides.
The siRNA according to any one of claims 16 to 18, wherein each non-fluorinated modified nucleotide is independently selected from the group consisting of a hydroxyl group at the 2' position of a ribose group of a nucleotide substituted by a non-fluoro group. One of a nucleotide or nucleotide analog.
The siRNA according to claim 19, wherein the nucleotide formed by substituting a hydroxyl group at the 2' position of the ribose group of the nucleotide with a non-fluoro group is selected from a 2'-alkoxy-modified nucleotide, 2'- Substituted alkoxy-modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'- One of a substituted amino-modified nucleotide, 2'-deoxynucleotide; the nucleotide analog is selected from the group consisting of an isonucleotide, LNA, ENA, cET, UNA, and GNA.
The siRNA according to claim 20, wherein each of the non-fluorine-modified nucleotides is a methoxy-modified nucleotide, and the methoxy-modified nucleotide is a 2'-hydroxyl group of a ribose group. A nucleotide formed by substitution with a methoxy group.
The siRNA according to claim 21, wherein the nucleotides at positions 5, 7, 8, and 9 of the nucleotide sequence A in the sense strand of the siRNA are fluorinated in the direction from the 5' end to the 3' end. The modified nucleotide, the nucleotide at the rest of the sense strand of the siRNA is a methoxy-modified nucleotide, and the nucleotide in the antisense strand of the siRNA is in the direction from the 5' end to the 3' end The nucleotides at positions 2, 6, 8, 9, 14 and 16 of the sequence B are fluoro-modified nucleotides, and the nucleotides at the remaining positions of the antisense strand of the siRNA are methoxy-modified nucleotides;

Alternatively, the nucleotides at positions 5, 7, 8, and 9 of the nucleotide sequence A in the sense strand of the siRNA are fluoro-modified nucleotides in the direction from the 5' end to the 3' end, and the siRNA is sensed. The nucleotides at the rest of the chain are methoxy-modified nucleotides, and, in the direction from the 5' end to the 3' end, nucleotides B, 2, 6, and 14 of the antisense strand of the siRNA And the nucleotide at position 16 is a fluoro-modified nucleotide, and the nucleotide at the remaining position of the antisense strand of the siRNA is a methoxy-modified nucleotide;

Alternatively, the nucleotides at positions 7, 8 and 9 of the nucleotide sequence A in the sense strand of the siRNA are fluoro-modified nucleotides in the direction from the 5' end to the 3' end, and the sense strand of the siRNA The nucleotides at the remaining positions are methoxy-modified nucleotides, and, in the direction from the 5' end to the 3' end, the second, sixth, 14 and 16 of the nucleotide sequence B in the antisense strand of the siRNA The nucleotide at the position is a fluoro-modified nucleotide, and the nucleotide at the rest of the antisense strand of the siRNA is a methoxy-modified nucleotide.
The siRNA according to claim 22, wherein the siRNA is siHBV2 or siHBV3:

siHBV2

Justice strand: 5'-CmGmUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm-3' (SEQ ID NO: 6),

Antisense strand: 5'-UmUfGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmGmUm-3' (SEQ ID NO: 7),

siHBV3

Justice strand: 5'-CmGmUmGmUfGmCfAfCfUmUmCmGmCmUmUmCmAmAm-3' (SEQ ID NO: 8),

Antisense strand: 5'-UmUfGmAmAmGfCmGfAfAmGmUmGmCfAmCfAmCmGmGmUm-3' (SEQ ID NO: 9),

Wherein, the capital letters C, G, U, and A represent the base composition of the nucleotide; the lowercase letter m indicates that the nucleotide adjacent to the left side of the letter m is a methoxy-modified nucleotide; the lowercase letter f indicates One nucleotide adjacent to the left side of the letter f is a fluoro-modified nucleotide.
The siRNA according to claim 15, wherein the phosphate group having a modifying group is a phosphorothioate group formed by substituting at least one oxygen atom of a phosphodiester bond in a phosphate group with a sulfur atom.
The siRNA according to claim 15 or 24, wherein the phosphate group having a modifying group is a phosphorothioate group having a structure represented by the formula (1):
The siRNA according to claim 25, wherein, in the siRNA, a phosphorothioate group linkage exists in at least one of the group consisting of:

Between the first nucleotide and the second nucleotide of the 5' end of the sense strand;

Between the second nucleotide and the third nucleotide of the 5' end of the sense strand;

Between the first nucleotide and the second nucleotide of the 3' end of the sense strand;

Between the second nucleotide and the third nucleotide of the 3' end of the sense strand;

Between the first nucleotide and the second nucleotide of the 5' end of the antisense strand;

Between the second nucleotide and the third nucleotide of the 5' end of the antisense strand;

Between the first nucleotide and the second nucleotide of the 3' end of the antisense strand;

The 2' end of the 3' end of the antisense strand is between the 2nd nucleotide and the 3rd nucleotide.
The siRNA according to claim 26, wherein the siRNA is siHBV4 or siHBV5:

siHBV4

Justice strand: 5'-CmsGmsUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm-3' (SEQ ID NO: 10),

Antisense strand: 5'-UmsUfsGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmsGmsUm-3' (SEQ ID NO: 11),

siHBV5

Justice strand: 5'-CmsGmsUmGmUfGmCfAfCfUmUmCmGmCmUmUmCmAmAm-3' (SEQ ID NO: 12),

Antisense strand: 5'-UmsUfsGmAmAmGfCmGfAfAmGmUmGmCfAmCfAmCmGmsGmsUm-3' (SEQ ID NO: 13),

Wherein, the capital letters C, G, U, and A represent the base composition of the nucleotide; the lowercase letter m indicates that the nucleotide adjacent to the left side of the letter m is a methoxy-modified nucleotide; the lowercase letter f indicates One nucleotide adjacent to the left side of the letter f is a fluoro-modified nucleotide; the lower-case letter s indicates a phosphorothioate-based linkage between the two nucleotides to the left and right of the letter.
The siRNA according to any one of claims 1 to 27, wherein the 5' terminal nucleotide of the antisense strand is a 5'-phosphate nucleotide or a 5'-phosphate analog modified nucleotide.
The siRNA according to claim 28, wherein the 5'-phosphate nucleotide is a nucleotide having a structure represented by the formula (2), and the nucleotide modified by the 5'-phosphate analog is selected from A nucleotide having a structure as shown in any one of the formulas (3) to (6):

Wherein R is selected from H, OH, methoxy or fluorine; Base represents a base selected from A, U, C, G or T.
The siRNA according to claim 28 or 29, wherein the siRNA is siHBV6, siHBV7, siHBV8 or siHBV9:

siHBV6

Justice strand: 5'-CmGmUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm-3' (SEQ ID NO: 6),

Antisense strand: 5'-P1-UmUfGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmGmUm-3' (SEQ ID NO: 14),

siHBV7

Justice strand: 5'-CmGmUmGmUfGmCfAfCfUmUmCmGmCmUmUmCmAmAm-3' (SEQ ID NO: 8),

Antisense strand: 5'-P1-UmUfGmAmAmGfCmGfAfAmGmUmGmCfAmCfAmCmGmGmUm-3' (SEQ ID NO: 15),

siHBVX8

Justice strand: 5'-CmsGmsUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm-3' (SEQ ID NO: 10),

Antisense strand: 5'-P1-UmsUfsGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmsGmsUm-3' (SEQ ID NO: 16),

siHBVX9

Justice strand: 5'-CmsGmsUmGmUfGmCfAfCfUmUmCmGmCmUmUmCmAmAm-3' (SEQ ID NO: 12),

Antisense strand: 5'-P1-UmsUfsGmAmAmGfCmGfAfAmGmUmGmCfAmCfAmCmGmsGmsUm-3' (SEQ ID NO: 17),

Wherein, the capital letters C, G, U, and A represent the base composition of the nucleotide; the lowercase letter m indicates that the nucleotide adjacent to the left side of the letter m is a methoxy-modified nucleotide; the lowercase letter f indicates The nucleotide adjacent to the left side of the letter f is a fluoro-modified nucleotide; the lowercase letter s indicates a phosphorothioate linkage between the two nucleotides of the letter; the uppercase letter P1 indicates the letter to the right. One nucleotide adjacent to the side is a nucleotide modified by a 5'-phosphate nucleotide or a 5'-phosphate analog.
A pharmaceutical composition comprising the siRNA of any one of claims 1-30 and a pharmaceutically acceptable carrier.
The pharmaceutical composition according to claim 31, wherein the weight ratio of said siRNA to a pharmaceutically acceptable carrier is 1: (1 - 500).
The siRNA according to claim 31 or 32, wherein the weight ratio of the siRNA to the pharmaceutically acceptable carrier is 1: (1-50).
The pharmaceutical composition according to any one of claims 31 to 33, wherein the pharmaceutically acceptable carrier contains an organic amine, a helper lipid, and a pegylated lipid; wherein the organic amine is as a compound of the formula (201) and/or a pharmaceutically acceptable salt thereof:

among them:

X 101 and X 102 are each independently O, S, NA or CA, wherein A is hydrogen or a C1-C20 hydrocarbon chain;

Y and Z are each independently C=O, C=S, S=O, CH-OH or SO 2 ;

R 101 , R 102 , R 103 , R 104 , R 105 , R 106 and R 107 are each independently hydrogen, cyclic or acyclic, substituted or unsubstituted, branched or straight-chain aliphatic radical a cyclic, acyclic or acyclic, substituted or unsubstituted, branched or straight chain heteroaliphatic group, substituted or unsubstituted, branched or straight chain acyl group, substituted or not Substituted, branched or straight-chain aryl, substituted or unsubstituted, branched or straight-chain heteroaryl;

x is an integer from 1 to 10;

n is an integer from 1 to 3, m is an integer from 0 to 20, and p is 0 or 1; wherein, if m = p = 0, R 102 is hydrogen;

And, if at least one of n or m is 2, R 103 and the nitrogen in the formula (201) form a structure as shown in the formula (202) or the formula (203):

Wherein g, e and f are each independently an integer of from 1 to 6, "HCC" represents a hydrocarbon chain, and each *N represents a nitrogen atom in the formula (201).
The pharmaceutical composition according to claim 34, wherein the organic amine is an organic amine represented by the formula (214) and/or an organic amine represented by the formula (215):

The helper lipid is a cholesterol, an analog of cholesterol, and/or a derivative of cholesterol;

The PEGylated lipid is 1,2-dipalmitamide-sn-glycero-3-phosphatidylethanolamine-N-[methoxy(polyethylene glycol)]-2000.
The pharmaceutical composition according to claim 34 or 35, wherein a molar ratio between the organic amine, the auxiliary lipid and the PEGylated lipid is (19.7-80): (19.7) -80): (0.3-50).
The pharmaceutical composition according to claim 36, wherein a molar ratio between the organic amine, the helper lipid and the PEGylated lipid is (50-70): (20-40) ): (3-20).
An siRNA conjugate comprising the siRNA of any one of claims 1-30 and a conjugation group conjugated to the siRNA.
The siRNA conjugate according to claim 38, wherein the conjugate group comprises a pharmaceutically acceptable targeting group and a linker, and wherein the siRNA, the linker and the targeting group are in turn Covalent or non-covalent connection.
The siRNA conjugate according to claim 39, wherein the linker has a structure as shown in formula (301):

Where k is an integer from 1 to 3;

L A is a chain moiety comprising an amide bond having a structure represented by formula (302), each of said L A having an ether bond at its two ends with one of said targeting group and said L C moiety, respectively connection:

L B is a chain moiety comprising an N-acylpyrrolidine having a structure represented by the formula (303), the chain moiety having a carbonyl group at one end thereof and being bonded to the L C moiety via an amide bond at the other end Has an oxygen atom and is linked to the siRNA via a phosphate bond:

L C is a 2-4 valent linking group based on hydroxymethylaminomethane, dimethylolaminomethane or trishydroxymethylaminomethane, and the L C is via an oxygen atom to each of the L A moieties via an ether linkage. It is linked and is linked to the L B moiety via an amide bond via a nitrogen atom.
The siRNA conjugate according to any one of claims 38 to 40, wherein the siRNA conjugate has a structure as shown in formula (305):

Among them, the double helix structure represents the siRNA.
The siRNA conjugate according to claim 39, wherein the linker has the structure shown by formula (306):

Where l is an integer from 0-3;

* indicates a site on the linker to which the targeting group is attached via an ether linkage;

# indicates a site on the linker to which the siRNA is linked by a phosphate bond.
The siRNA conjugate according to any one of claims 38, 39 and 42, wherein the siRNA conjugate has a structure as shown in formula (307):

Among them, the double helix structure represents the siRNA.
The siRNA conjugate according to any one of claims 39-43, wherein the linker is ligated to the 3' end of the sense strand of the siRNA.
The siRNA conjugate according to claim 38, wherein the conjugate has the structure represented by formula (308):

among them,

N1 is an integer selected from 1 to 3, and n3 is an integer selected from 0 to 4;

M1, m2 and m3 are independently an integer selected from 2-10;

R 10 , R 11 , R 12 , R 13 , R 14 and R 15 are each independently H or selected from the group consisting of C 1 -C 10 alkyl, C 1 -C 10 haloalkane a group and a C 1 -C 10 alkoxy group;

R 3 is a group of the structure represented by the formula A59:

Wherein E 1 is OH, SH or BH 2 and Nu is an siRNA;

R 2 is a linear alkylene group having a length of from 1 to 20 carbon atoms, wherein one or more carbon atoms are optionally replaced by one or more selected from the group consisting of: C ( O), NH, O, S, CH=N, S(O) 2 , C 2 -C 10 alkenylene, C 2 -C 10 alkynylene, C 6 -C 10 arylene, C 3 -C a 18 -heterocyclylene group and a C 5 -C 10 heteroarylene group; and wherein R 2 may optionally have a substituent of any one or more of the group consisting of C 1 -C 10 alkyl, C 6 -C 10 aryl, C 5 -C 10 heteroaryl, C 1 -C 10 haloalkyl, -OC 1 -C 10 alkyl, -OC 1 -C 10 alkylphenyl, - C 1 -C 10 alkyl-OH, -OC 1 -C 10 haloalkyl, -SC 1 -C 10 alkyl, -SC 1 -C 10 alkylphenyl, -C 1 -C 10 alkyl-SH, -SC 1 -C 10 haloalkyl, halogen substituent, -OH, -SH, -NH 2 , -C 1 -C 10 alkyl-NH 2 , -N(C 1 -C 10 alkyl) (C 1 - C 10 alkyl), -NH(C 1 -C 10 alkyl), cyano, nitro, -CO 2 H, -C(O)O(C 1 -C 10 alkyl), -CON(C 1 -C 10 alkyl)(C 1 -C 10 alkyl), -CONH(C 1 -C 10 alkyl), -CONH 2 , -NHC(O)(C 1 -C 10 alkyl), -NHC( O) (phenyl), -N (C 1 -C 10 alkyl)C(O)(C 1 -C 10 alkyl), -N(C 1 -C 10 alkyl)C(O)(phenyl), -C(O)C 1 -C 10 alkyl, -C(O)C 1 -C 10 alkylphenyl, -C(O)C 1 -C 10 haloalkyl, -OC(O)C 1 -C 10 alkyl, -SO 2 ( C 1 -C 10 alkyl), -SO 2 (phenyl), -SO 2 (C 1 -C 10 haloalkyl), -SO 2 NH 2 , -SO 2 NH(C 1 -C 10 alkyl), -SO 2 NH (phenyl), - NHSO 2 (C 1 -C 10 alkyl), - NHSO 2 (phenyl), and -NHSO 2 (C 1 -C 10 haloalkyl);

Each L 1 is a linear alkylene group having a length of from 1 to 70 carbon atoms, wherein one or more carbon atoms are optionally replaced by one or more selected from the group consisting of: C(O), NH, O, S, CH=N, S(O) 2 , C 2 -C 10 alkenylene, C 2 -C 10 alkynylene, C 6 -C 10 arylene, C 3 a -C 18 -heterocyclylene group and a C 5 -C 10 heteroarylene group; and wherein L 1 may optionally have a substituent of any one or more of the group consisting of: C 1 - C 10 alkyl, C 6 -C 10 aryl, C 5 -C 10 heteroaryl, C 1 -C 10 haloalkyl, -OC 1 -C 10 alkyl, -OC 1 -C 10 alkylphenyl, -C 1 -C 10 alkyl-OH, -OC 1 -C 10 haloalkyl, -SC 1 -C 10 alkyl, -SC 1 -C 10 alkylphenyl, -C 1 -C 10 alkyl-SH , -SC 1 -C 10 haloalkyl, halogen substituent, -OH, -SH, -NH 2 , -C 1 -C 10 alkyl-NH 2 , -N(C 1 -C 10 alkyl) (C 1 -C 10 alkyl), -NH(C 1 -C 10 alkyl), cyano, nitro, -CO 2 H, -C(O)O(C 1 -C 10 alkyl), -CON(C 1- C 10 alkyl)(C 1 -C 10 alkyl), -CONH(C 1 -C 10 alkyl), -CONH 2 , -NHC(O)(C 1 -C 10 alkyl), -NHC (O) (phenyl), -N (C 1 -C 10 alkyl)C(O)(C 1 -C 10 alkyl), -N(C 1 -C 10 alkyl)C(O)(phenyl), -C(O)C 1 -C 10 alkyl, -C(O)C 1 -C 10 alkylphenyl, -C(O)C 1 -C 10 haloalkyl, -OC(O)C 1 -C 10 alkyl, -SO 2 (C 1 -C 10 alkyl), -SO 2 (phenyl), -SO 2 (C 1 -C 10 haloalkyl), -SO 2 NH 2 , -SO 2 NH(C 1 -C 10 alkyl ), - SO 2 NH (phenyl), - NHSO 2 (C 1 -C 10 alkyl), - NHSO 2 (phenyl), and -NHSO 2 (C 1 -C 10 haloalkyl); and

a site that indicates that the group is attached to the rest of the molecule;

M 1 represents a targeting group.
The siRNA conjugate according to claim 45, wherein each L 1 is independently selected from the group consisting of one or more of the groups of formulas A1 to A26:

Where j1 is an integer from 1 to 20; j2 is an integer from 1 to 20;

R' is a C 1 -C 10 alkyl group;

Ra is selected from the group consisting of the group A27-A45 or any combination thereof:

Rb is a C 1 -C 10 alkyl group.
The siRNA conjugate according to claim 46, wherein L 1 is selected from the group consisting of a combination of one or more of A1, A4, A5, A6, A8, A10, A11, A13.
The siRNA conjugate according to claim 47, wherein L 1 is selected from the group consisting of at least two of A1, A4, A8, A10 and A11.
The siRNA conjugate according to claim 48, wherein L 1 is selected from the group consisting of at least two of A1, A8, and A10.
The siRNA conjugate according to any one of claims 45 to 49, wherein L 1 has a length of 3 to 25 atoms.
The siRNA conjugate according to claim 55, wherein L 1 has a length of 4 to 15 atoms.
The siRNA conjugate according to any one of claims 46 to 51, wherein j1 is an integer of from 2 to 10, j2 is an integer of from 2 to 10, R' is a C1-C4 alkyl group, and Ra is A27. one kind of A28, A29, A30 and A31 are, Rb is a C 1 -C 5 alkyl group.
The siRNA conjugate according to claim 52, wherein j1 is an integer of 3-5, j2 is an integer of 3-5, R' is one of a methyl group, an ethyl group and an isopropyl group, and Ra is A27. Or A28, Rb is one of a methyl group, an ethyl group, an isopropyl group and a butyl group.
The siRNA conjugate according to any one of claims 45 to 53, wherein n1 is an integer of 1-2, n3 is an integer of 0-1, and n1+n3=2-3.
The siRNA conjugate according to any one of claims 45-54, wherein m1, m2 and m3 are each independently an integer from 2 to 5.
The siRNA conjugate according to any one of claims 45-55, wherein m1 = m2 = m3.
The siRNA conjugate according to any one of claims 45-56, wherein R 10 , R 11 , R 12 , R 13 , R 14 and R 15 are independently H, methyl or ethyl.
The siRNA conjugate according to any one of claims 45 to 57, wherein R 2 has both a linking site linked to N on the nitrogen-containing backbone and a linking site linked to P in R 3 .
The siRNA conjugate according to any one of claims 45-58, wherein the site on the R 2 that is bonded to the N on the nitrogen-containing backbone forms an amide bond with N, and the P on the R 3 The site of attachment forms a phosphate bond with P.
The siRNA conjugate according to any one of claims 45-59, wherein R 2 is selected from B5, B6, B5' or B6':

among them,
A site indicating that the group is attached to the rest of the molecule, and q 2 is an integer from 1 to 10.
The siRNA conjugate according to claim 60, wherein q 2 is an integer from 1 to 5.
The siRNA conjugate according to any one of claims 39-61, wherein each of said targeting groups is independently a ligand that is affinity to an asialoglycoprotein receptor on the surface of a mammalian hepatocyte .
The siRNA conjugate according to claim 62, wherein each of said targeting groups is independently a asialoglycoprotein or a sugar.
The siRNA conjugate according to claim 63, wherein each of said targeting groups is independently selected from the group consisting of D-mannopose, L-mannopose, D-arabinose, D-furanose, L-furanose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-furanmannose, β-D-furanmannose, α-D-mannopose, β -D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-pyridyl Fructose, α-D-galactopyranoside, β-D-galactopyranosylose, α-D-galactopyranosylose, β-D-galactopyranosylose, glucosamine, sialic acid, galactosamine, N- Acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O- [(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-methyl Amido-2,3-di-O-methyl-D-mannopyranosyl, 2-deoxy-2-sulfonyl-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-sulfur generation-β-D- Pyranoglucose, 2,3,4-tri-O-acetyl-1-thioxo-6-O-tritylmethyl-α-D-glucopyranoside methyl ester, 4-thio-β-D -galactopyranoside, 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucopyranoside ethyl ester, 2,5-dehydration -D-one of naloxonitrile, ribose, D-ribose, D-4-thioribose, L-ribose, L-4-thioribose.
The siRNA conjugate according to claim 64, wherein at least one or each of said targeting groups is galactose or N-acetylgalactosamine.
The siRNA conjugate according to any one of claims 45 to 65, wherein the conjugate has the formulas (403), (404), (405), (406), (407), (408), (409), (410), (411), (412), (413), (414), (415), (416), (417), (418), (419), (420), (421 Or the structure shown in (422):
The siRNA conjugate according to any one of claims 45 to 66, wherein P in the formula A59 is linked to the end of the siRNA sense strand or the antisense strand, the terminus referring to the sense strand or antisense The first 4 nucleotides from the end of the chain.
The siRNA conjugate according to claim 67, wherein P in the formula A59 is linked to the terminus of the siRNA sense strand or the antisense strand.
The siRNA conjugate according to claim 68, wherein P in the formula A59 is linked to the 3' end of the siRNA sense strand.
The siRNA conjugate according to any one of claims 45 to 69, wherein P in the formula A59 is linked to the 2', 3' position of the nucleotide in the siRNA by formation of a phosphodiester bond or 5' position.
The siRNA according to any one of claims 1 to 30, the pharmaceutical composition according to any one of claims 31 to 37 and/or the siRNA conjugate according to any one of claims 38 to 70 in the preparation Use in a medicament for treating and/or preventing a pathological condition or disease caused by an infection of hepatitis B virus.
The use according to claim 71, wherein the pathological condition or disease caused by the infection of hepatitis B virus is selected from the group consisting of chronic liver disease, hepatitis, liver fibrosis disease, and liver proliferative disease.
A method for treating and/or preventing a pathological condition or disease caused by an infection of hepatitis B virus, wherein the method comprises administering an effective amount of the siRNA according to any one of claims 1 to 30, claim 31 The pharmaceutical composition of any of the above-mentioned items and/or the siRNA conjugate of any one of claims 38-70 is administered to a patient in need thereof.
A kit comprising the siRNA according to any one of claims 1 to 30, the pharmaceutical composition according to any one of claims 31 to 37, and/or any one of claims 38 to 70. The siRNA conjugate described.