WO2024154155A1

WO2024154155A1 - Composition, system and method for dna amplification of mycobacterium tuberculosis complex

Info

Publication number: WO2024154155A1
Application number: PCT/IN2024/050054
Authority: WO
Inventors: Avinash Ramani; Agragesh RAMANI; Pavan Kumar BAPATLA KESAVA; Bhavani GUNASEKARAN; Geetha Kannan; Tejeswini KATILA
Original assignee: Acrannolife Genomics Pvt. Ltd.
Priority date: 2023-01-20
Filing date: 2024-01-19
Publication date: 2024-07-25

Abstract

The present invention discloses a composition for amplification of specific DNA sequences of Mycobacterium tuberculosis complex from different biological samples. The present invention also discloses a system for rapid and accurate detection of Mycobacterium tuberculosis complex from different biological samples using naked eye, comprising means for DNA extraction, DNA amplification, DNA visualization. The present invention also discloses a method for rapid and accurate detection of Mycobacterium tuberculosis complex from different biological samples using naked eye, comprising DNA extraction, DNA amplification and DNA visualization.

Description

COMPOSITION, SYSTEM AND METHOD FOR DNA AMPLIFICATION OF MYCOBACTERIUM TUBERCULOSIS COMPLEX

Field of Invention

The present invention pertains to the field of microbiology and biotechnology. Specifically, the present invention discloses a composition for amplification of specific DNA sequences of Mycobacterium tuberculosis complex from different biological samples. The present invention also discloses a system for rapid and accurate detection of Mycobacterium tuberculosis complex from different biological samples using the naked eye, comprising means for DNA extraction, DNA amplification, and DNA visualization. The present invention also discloses a method for rapid and accurate detection of Mycobacterium tuberculosis complex from different biological samples using the naked eye, comprising DNA extraction, DNA amplification, and DNA visualization.

Background of the Invention

Tuberculosis (TB) is a contagious infectious disease caused by bacteria that mainly affects the lungs but can also affect any other organ including bone, brain, and spine. About one-quarter of the world's population has TB infection, which means people have been infected by TB bacteria but are not (yet) ill with the disease and cannot transmit it. People infected with TB bacteria have a 5-10% lifetime risk of falling ill with TB. Those with compromised immune systems, such as people living with HIV, malnutrition, or diabetes, or people who use tobacco, have a higher risk of falling ill. According to WHO, a total of 1.5 million people died from TB in 2020 (including 214000 people with HIV). Worldwide, TB is the thirteenth leading cause of death and the second leading infectious killer after COVID-19 (above HIV/AIDS). Eight countries account for two-thirds of the total, with India leading the count, followed by China, Indonesia, the Philippines, Pakistan, Nigeria, Bangladesh and South Africa. As per the Global TB Report 2021, the estimated incidence of all forms of TB in India for the year 2020 was 188 per 100,000 population (129-257 per 100,000 population). TB in humans or other animals is caused by the Mycobacterium tuberculosis complex (MTC or MTBC), which is a group of genetically related Mycobacterium species that can cause tuberculosis. The MTBC comprises Mycobacterium tuberculosis, Mycobacterium africanum, Mycobacterium orygis, Mycobacterium bovis and the Bacillus Calmette-Guerin strain, Mycobacterium microti, Mycobacterium canetti, Mycobacterium caprae, Mycobacterium pinnipedii, Mycobacterium suricattae, Mycobacterium mungi. Mycobacterium tuberculosis complex (MTC) constitutes a remarkably genetically homogeneous group characterized by 99.9% similarity at the nucleotide level and identical 16S rRNA sequences but they differ widely in terms of their host tropisms, phenotypes, and pathogenicity. Members of the MTC can be distinguished from all other bacteria by the presence of 63 conserved signature indels (CSIs) present in diverse proteins that are exclusively shared by these pathogens. Early detection of TB is a critical need to minimize treatment time and avoid potential transmission. The WHO has approved the loop-mediated isothermal amplification assay (LAMP) for tuberculosis (TB) detection as a substitute for smear microscopy in peripheral settings. Unlike other molecular tests like PCR, which uses temperature-dependent mechanisms to amplify DNA fragments, the LAMP assay operates in an isothermal or constant temperature environment. However, there is still a need for a simple and rapid molecular test to identify tuberculosis (TB) in resource-limited settings with high sensitivity and specificity. The present invention thus addresses this limitation and provides a composition for the amplification of specific gene sequences of Mycobacterium tuberculosis complex, which facilitates expedited detection of Mycobacterium tuberculosis complex in resource-limited settings.

Objectives of the Invention:

To provide a composition for amplifying specific pathogenic genes of Mycobacterium tuberculosis complex.

To provide a system for the rapid and accurate detection of Mycobacterium tuberculosis complex from different biological samples for the detection of TB in a cost-effective manner, with the naked eye.

To provide a method for the rapid and accurate detection of Mycobacterium tuberculosis complex from different biological samples cost-effectively using the naked eye with high sensitivity and specificity.

Summary of the Invention

The present invention discloses a composition for amplification of DNA sequences of Mycobacterium tuberculosis complex from different biological samples comprising Bst DNA polymerase, Nucleotides, Buffer, oligonucleotide primers which could bind to specific genes IS6110 (genbank id XI 7348.1), rpoB (genbank id Rv0667) and gyrB (genbank id Rv0005) of Mycobacterium tuberculosis complex and enhancer.

The present invention also discloses a system for rapid and accurate detection of Mycobacterium tuberculosis complex from different biological samples using naked eye in limited resource settings, comprising means for DNA extraction which rapidly extracts the DNA from biological sample in 6 minutes, means for DNA amplification using the composition for amplification of DNA sequences of Mycobacterium tuberculosis complex from different biological samples, means for qualitative detection of amplified DNA comprising pH sensitive indicator dye system and means for automated recordal and reporting of amplified DNA.

Yet another aspect of the invention pertains to a method for rapid and accurate detection of Mycobacterium tuberculosis complex from different biological samples using naked eye with high sensitivity (greater than 97%) and specificity (greater than 99.9%) in limited resource settings, comprising DNA extraction, DNA amplification using the composition for amplification of DNA sequences of Mycobacterium tuberculosis complex from different biological samples, DNA visualization or detection and reporting of amplified DNA.

Brief Description of the Figures:

The novel features and characteristics of the disclosure are set forth in the appended claims. The disclosure itself, however, as well as a preferred mode of use, further objectives, and advantages thereof, will best be understood by reference to the following detailed description of an illustrative embodiment when read in conjunction with the accompanying figures. One or more embodiments are now described, by way of example only, with reference to the accompanying figures wherein like reference numerals represent like elements and in which: Figure 1: Flow chart depicting the steps involved in designing primers for amplification of specific gene sequences of Mycobacterium tuberculosis complex which are employed in TB- LAMP Assay.

Figure 2: Block of conductor metal or plastic with one or more holes (96 holes) holding tube wells of 0. 1 to 2 ml volume in each of said holes.

Figure 3: Block diagram depicting the system for rapid and accurate detection of Mycobacterium tuberculosis complex.

Figure 4: Side view of the system for rapid and accurate detection of Mycobacterium tuberculosis complex from different biological samples.

Figure 5: Top view of the system with the light source for rapid and accurate detection of Mycobacterium tuberculosis complex from different biological samples.

Figure 6: Top view of the system without the light source for rapid and accurate detection of Mycobacterium tuberculosis complex from different biological samples.

Detailed description of Invention:

Unless otherwise defined, all terms used in the disclosure, including technical and scientific terms, have the meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. By means of further guidance, term definitions are included for better understanding of the present disclosure.

As used herein, the singular forms ‘a’, ‘an’ and ‘the’ include both singular and plural referents unless the context clearly dictates otherwise.

The term ‘comprising’, ‘comprises’ or ‘comprised of as used herein are synonymous with ‘including’, ‘includes’, ‘containing’ or ‘contains’ and are inclusive or open-ended and do not exclude additional, non-recited members, elements or method steps.

The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints.

The term ‘about’ as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, is meant to encompass variations of ±10% or less, preferably ±5% or less, more preferably ±1% or less and still more preferably ±0.1% or less of and from the specified value, insofar such variations are appropriate to perform the present disclosure. It is to be understood that the value to which the modifier ‘about’ refers is itself also specifically, and preferably disclosed.

Reference throughout this specification to ‘some embodiments’, ‘one embodiment’, or ‘an embodiment’ means that a particular feature, structure, or characteristic described in connection with the embodiment may be included in at least one embodiment of the present disclosure, thus, the appearances of the phrases ‘in some embodiments’, ‘in one embodiment’ or ‘in an embodiment’ in various places throughout this specification may not necessarily all refer to the same embodiment. It is appreciated that certain features of the disclosure, which are for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the disclosure, which are, for brevity described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination.

The term “sensitivity” as used herein refers to the ability of a test to correctly classify an individual as 'diseased'. It is calculated by the formula (true positive, (a)) / (true positive ± false negative (a±c)). It reflects the probability of being tested positive when the disease is present. The term “specificity” as used herein refers to the ability of a test to correctly classify an individual as disease-free. It is calculated by the formula (true negative(d)) / (true negative ± false positive(d±b)). It reflects the probability of being tested negative when the disease is absent.

The term “positive predictive value” as used herein refers to the percentage of patients with a positive test who actually have the disease. It is calculated by the formula (true positive(a)) / (true positive + false positive(a+b)). Reflects the probability of a patient having a disease when the test result is positive.

The term “negative predictive value” as used herein refers to the percentage of patients with a negative test who do not have the disease. It is calculated by the formula (true negative(d)) / (false negative + true negative(c+d)). Reflects the probability of the patient not having the disease when the test is negative.

The afore-recited parameters are best illustrated using the following conventional Table- 1, which summarizes the comparison of test results obtained from a novel assay with the test results obtained from benchmark standard assay(s) used for the same purpose.

Table- 1 : Computation of parameters associated with accuracy determination of new test/assay

The term “accuracy” as used herein refers to the extent to which a test measures what it is supposed to measure.

An aspect of the invention pertains to a composition for amplification of DNA sequences of Mycobacterium tuberculosis complex from different biological samples comprising a master mix, a primer mix comprising forward and reverse oligonucleotide primers for binding to specific genes consisting o IS6110 (genbank id X17348.1, SEQ.ID.NO.18), rpoB (genbank id Rv0667, SEQ.ID.NO. 19) and gyrB (genbank id Rv0005, SEQ.ID.NO.20) of Mycobacterium tuberculosis complex and enhancer; wherein the master mix is in a range between 70% -75% v/v, the primer mix is in a range between 19% - 25% v/v, the enhancer is in a range between 5% - 6% v/v of the composition.

In several embodiments of the composition, the oligonucleotide primers which could bind to specific genes IS6110, rpoB and gyrB of Mycobacterium tuberculosis complex are 16-38 nucleotides in length, which are able to “prime” DNA synthesis by a template-dependent DNA polymerase, i.e., the 3'-end of the, e.g., oligonucleotide provides a free 3'-OH group where to further “nucleotides” may be attached by a template-dependent DNA polymerase establishing 3' to 5' phosphodiester linkage whereby deoxy nucleoside triphosphates are used and whereby pyrophosphate is released.

In an embodiment of the composition, the primer mix comprises: forward oligonucleotide primers consisting of SEQ.ID.Nos: 1, 3 which bind to IS6110 of SEQ.ID.NO.18; reverse oligonucleotide primers consisting of SEQ.ID.Nos: 2, 4, 5 which bind to IS6110 of

SEQ.ID.NO.18; forward oligonucleotide primers consisting of SEQ.ID.Nos: 6, 8, 10 which bind to rpoB of SEQ.ID.NO.19; reverse oligonucleotide primers consisting of SEQ.ID.Nos: 7,9,11 which bind to rpoB of SEQ.ID.NO.19; forward oligonucleotide primers consisting of SEQ.ID.Nos: 12,14,16 which bind to gyrB of SEQ.ID.NO.20; reverse oligonucleotide primers consisting of SEQ.ID.Nos: 13,15,17 which bind to gyrB of SEQ.ID.NO.20.

The sequences corresponding to oligonucleotide primers, represented by SEQ.ID.Nos 1-17 are provided in Table-2.

Table-2: List of Oligonucleotide Primers.

In an embodiment of the composition, the primer mix comprises forward and reverse oligonucleotide primers for binding to IS6110 (genbank id X17348.1, SEQ.ID.NO.18), rpoB (genbank id Rv0667, SEQ.ID.NO.19), gyrB (genbank id Rv0005, SEQ.ID.NO.20) of Mycobacterium tuberculosis complex in the ratio of 45:50:5 v/v.

In an embodiment of the composition, the master mix comprises DNA polymerase, preferably Bst polymerase, deoxynucleotide triphosphates (dNTPs), and reaction buffer.

In an embodiment of the composition, the reaction buffer comprises Tris-Hydrochloride, Ammonium sulfate, Potassium Chloride, Magnesium Sulfate, Tween 20.

In various embodiments of the composition, the reaction buffer comprises 10-40 mM of Tris- Hydrochloride, 5-25 mM of Ammonium sulfate, 25-75 mM of Potassium chloride, 0.5-5 mM Magnesium Sulfate and 0.01-1% Tween® 20

In an embodiment of the composition, the deoxynucleotide triphosphates (dNTPs), consist of deoxyadenosine triphosphate, dATP; deoxythymidine triphosphate, dTTP; deoxycytosine triphosphate, dCTP; and deoxyguanosine triphosphate, dGTP in equal proportion.

In an embodiment of the composition, the composition can amplify the DNA sequences of Mycobacterium tuberculosis complex, wherein the Mycobacterium tuberculosis complex is one of genetically related Mycobacterium species that cause tuberculosis, comprising Mycobacterium tuberculosis, Mycobacterium africanum, Mycobacterium orygis, Mycobacterium bovis, Mycobacterium microti, Mycobacterium canetti, Mycobacterium caprae, Mycobacterium pinnipedii, Mycobacterium suricattae, Mycobacterium mungi or a combination thereof.

In an embodiment of the composition, the enhancer comprises Guanidine Hydrochloride.

In various embodiments of the composition, the 10-40 mM of Guanidine Hydrochloride is employed as enhancer.

In various embodiments of the composition, the biological sample comprises human sputum samples Synovial aspirate, Plural fluid, Gastric fluid, Ascitic fluid, or human tissue samples comprising Lymph node biopsies.

Another aspect of the invention relates to a method for identification of Mycobacterium tuberculosis complex from different biological samples using the naked eye, comprising: (a) extraction of DNA from different biological samples; (b) amplification of said extracted DNA by mixing the extracted DNA with the composition for amplification of DNA sequences of Mycobacterium tuberculosis complex to form a reaction mixture and incubating the reaction mixture at 65°C for 35-45 minutes; wherein the composition for amplification of DNA sequences of Mycobacterium tuberculosis complex comprises a master mix, a primer mix comprising forward and reverse oligonucleotide primers for binding to specific genes consisting of IS6110 (genbank id X17348.1, SEQ.ID.NO.18 ), rpoB (genbank id Rv0667, SEQ.ID.NO.19) and gyrB (genbank id Rv0005, SEQ.ID.NO.20) of Mycobacterium tuberculosis complex and enhancer; wherein the master mix is in a range between 70% -75% v/v, the primer mix is in a range between 19%-25% v/v, the enhancer is in a range between 5% - 6% v/v; (c) cooling the reaction mixture to 25°C to 28°C; (d) visualization of amplified DNA using pH-sensitive indicator dye comprising phenol red wherein the yellow color indicates a positive result, while the pink color indicates a negative result for Mycobacterium tuberculosis complex.

In an embodiment of the method for identification of Mycobacterium tuberculosis complex from different biological samples using the naked eye, the primer mix comprises: forward oligonucleotide primers consisting of SEQ.ID.Nos.: 1, 3 which bind to IS6110 of SEQ.ID.NO.18; reverse oligonucleotide primers consisting of SEQ.ID.Nos.: 2, 4, 5 which bind to IS6110 of SEQ.ID.NO.18; forward oligonucleotide primers consisting of SEQ.ID.Nos.: 6, 8, 10 which bind to rpoB of SEQ.ID.NO. 19; reverse oligonucleotide primers consisting of SEQ.ID.Nos.: 7,9,11 which bind to rpoB of SEQ.ID.NO. 19; forward oligonucleotide primers consisting of SEQ.ID.Nos.: 12,14,16 which bind to gyrB of SEQ.ID.NO.20; reverse oligonucleotide primers consisting of SEQ.ID.Nos.: 13,15,17 which bind to gyrB of SEQ.ID.NO.20.

In an embodiment of the method for identification of Mycobacterium tuberculosis complex from different biological samples using the naked eye, the primer mix comprises forward and reverse oligonucleotide primers for binding to IS6110 (genbank id X17348.1, SEQ.ID.NO.18), rpoB (genbank id Rv0667, SEQ.ID.NO. 19), gyrB (genbank id Rv0005, SEQ.ID.NO.20) of Mycobacterium tuberculosis complex in a ratio of 45:50:5 v/v.

In an embodiment of the method for identification of Mycobacterium tuberculosis complex from different biological samples using the naked eye, wherein the extraction of DNA comprises: a) incubation of the biological sample with lysis buffer at a temperature ranging from 95 to 100°C for 3 to 7 minutes to obtain a lysed sample (A); b) incubation of the lysed sample (A) at room temperature for 2-4 minutes to obtain a lysed sample (B); c) extraction of DNA using DNA capture strips (DCS) by dipping the DCS into the lysed sample (B) one or more times at least for 5-10 seconds and subsequently dipping the DCS in wash buffer for one or more times to obtain DCS with DNA; d) elution of DNA by dipping the DCS with DNA into an elution buffer for at least 15 times followed by bending and compression of the DCS with DNA to release the bound DNA into the elution buffer, which is used immediately or stored at -20°C for later usage.

In an embodiment of the method for identification of Mycobacterium tuberculosis complex from different biological samples using the naked eye, the biological sample is optionally decontaminated using N-acetyl-l-cysteine-NaOH decontamination method.

In an embodiment of the method for identification of Mycobacterium tuberculosis complex from different biological samples using the naked eye, the lysis buffer comprises Tris- Hydrochloride, Sodium Chloride, Tween 20; the wash buffer comprises Tris-Hydrochloride; and the elution buffer comprises nuclease free water.

In an embodiment of the method for identification of Mycobacterium tuberculosis complex from different biological samples using the naked eye, the master mix comprises DNA polymerase, preferably Bst Polymerase, deoxynucleotide triphosphates (dNTPs) consisting of deoxyadenosine triphosphate, dATP; deoxythymidine triphosphate, dTTP; deoxycytosine triphosphate, dCTP; and deoxyguanosine triphosphate, dGTP in equal proportion, and reaction buffer comprising Tris-Hydrochloride, Ammonium sulfate, Potassium Chloride, Magnesium Sulfate, Tween 20.

In an embodiment of the method for identification of Mycobacterium tuberculosis complex from different biological samples using the naked eye, the enhancer comprises Guanidine Hydrochloride.

In an embodiment of the method for identification of Mycobacterium tuberculosis complex from different biological samples using the naked eye, the method can identify Mycobacterium tuberculosis complex, wherein the Mycobacterium tuberculosis complex is one of genetically related Mycobacterium species that cause tuberculosis, comprising Mycobacterium tuberculosis, Mycobacterium africanum, Mycobacterium orygis, Mycobacterium bovis, Mycobacterium microti, Mycobacterium canetti, Mycobacterium caprae, Mycobacterium pinnipedii, Mycobacterium suricattae, Mycobacterium mungi or a combination thereof.

In an embodiment of the method for identification of Mycobacterium tuberculosis complex from different biological samples using the naked eye, the method detects Mycobacterium tuberculosis complex from different biological samples rapidly and accurately using naked eye with high sensitivity (greater than 97%) and specificity (greater than 99.9%) in limited resource settings. Yet another aspect of the invention pertains to a kit for detection of Mycobacterium tuberculosis complex from different biological samples comprising: a) DNA extraction kit comprising lysis Buffer, DNA capture strips, wash buffer, and elution buffer; b) DNA amplification kit comprising master Mix comprising Bst DNA polymerase, deoxynucleotide triphosphates (dNTPs), reaction buffer, primer mix comprising forward and reverse oligonucleotide primers of SEQ.ID. Nos.l to 17 and enhancer; c) one or more tube wells; d) pH-sensitive indicator dye comprising Phenol Red.

In various embodiments, the kit for detection of Mycobacterium tuberculosis complex additionally comprises 0.1ml/0.2ml sterile PCR tube wells/strips, sterile barrier tips, micropipettes, minicentrifuge, microcentrifuge (for DNA extraction), vortex mixer, thermal cycler or equivalent water bath or dry bath or heat block, positive control DNA as positive control template, and nuclease free water as negative control template.

Yet another aspect of the invention discloses a system for the detection of Mycobacterium tuberculosis complex from different biological samples using the naked eye in limited resource settings, comprising: a) a means for extraction of DNA from biological sample; b) a means for DNA amplification; c) a means for qualitative detection of amplified DNA comprising pH sensitive indicator dye system; and d) a means for automated recordal and reporting of amplified DNA.

In an embodiment of the system for the detection of Mycobacterium tuberculosis complex from different biological samples using the naked eye in limited resource settings, the means for DNA extraction extracts the DNA from the biological sample and comprises a metal block (1) made for heat conduction comprising Aluminum having one or more holes for housing tube wells (2); wherein the block is heated by a heater (3) such as solar-powered battery-operated hot bath or mica heater, whose temperature is controlled by electronic means such as microcontroller; wherein the tube wells have a capacity of 0.5 ml to 2 ml volume, preferably 1.5 ml and are meant for housing the components for DNA extraction such as the reagents such as lysis buffer, DNA capture strips, wash buffer, and elution buffer.

In an embodiment of the system for the detection of Mycobacterium tuberculosis complex from different biological samples using the naked eye in limited resource settings, the means for DNA amplification comprises a metal block (4) made for heat conduction, comprising Aluminum having one or more holes for housing tube wells (5) wherein the block is heated by a heater (6) such as a solar-powered battery-operated hot bath or mica heater, whose temperature is controlled by electronic means such as microcontrollers, wherein the tube wells (5) have a capacity of 0.1 ml to 1 ml volume, preferably 0.2 ml and are meant for housing the components for amplification of DNA sequences of Mycobacterium tuberculosis complex from different biological samples comprising Bst DNA polymerase, deoxynucleotide triphosphates (dNTPs), reaction buffer, forward and reverse oligonucleotide primers of SEQ.ID. Nos. l to 17 and enhancer.

In an embodiment of the system for the detection of Mycobacterium tuberculosis complex from different biological samples using the naked eye in limited resource settings, the means for the qualitative detection of amplified DNA, comprises a block (7) made of plastic having one or more holes for housing tube wells (8) wherein said tube wells (8) comprise pH-sensitive indicator dye system to qualitatively detect the amplified DNA.

In an embodiment of the system for the detection of Mycobacterium tuberculosis complex from different biological samples using the naked eye in limited resource settings, the means for automated recordal of amplified DNA comprises a camera (9), flash LEDs (10), and memory cards which are controlled by electronic means such as a microcontroller; wherein the means for automated reporting of amplified DNA comprises thermal reporter (11) controlled by electronic means such as microcontroller.

In an embodiment of the system for the detection of Mycobacterium tuberculosis complex from different biological samples using the naked eye in limited resource settings, the system extracts the DNA from the biological sample in 6 minutes and detects the presence of Mycobacterium tuberculosis complex DNA in the biological sample in 45 minutes.

Descriptions of well-known/conventional methods/steps and techniques are omitted so as to not unnecessarily obscure the embodiments herein. Further, the disclosure herein provides examples illustrating the above-described embodiments, and to illustrate the embodiments of the present disclosure, certain aspects have been employed. The examples used herein for such illustration are intended merely to facilitate an understanding of ways in which the embodiments may be practiced and to further enable those of skill in the art to practice the embodiments. Accordingly, the following examples should not be construed as limiting the scope of the embodiments herein.

Examples:

Materials:

Sputum samples and tissue samples such as Synovial aspirate, Plural fluid, Gastric fluid, Ascitic fluid, and Lymph node biopsies were obtained from human healthy volunteers and patients from Intermediate Reference Laboratory State TB Training And Demonstration Centre, Government Hospital for Chest Diseases Gorimedu, Puducherry-605006, India. All the chemical reagents are obtained from commercial sources such as Sigma-Aldrich, India and Merck, India. Enzymes are sourced from New England Biolabs, USA and Oligonucleotides are obtained from Sigma-Aldrich, India.

Example 1: Bioinformatics Analysis:

1.1 Identification of genes and their specific regions to be amplified for rapid selective and sensitive detection of Mycobacterium tuberculosis complex.

All the available sequences for Mycobacterium tuberculosis complex (about 10 different species) and approximately 30 available NTM (Non-tuberculosis Mycobacterium) genome sequences were retrieved from public domain databases like NCBI. All these sequences were analyzed using in silico tools such as Multiple sequence alignment (MSA) tools for predicting potential target genes as well as specific regions within each of said target genes for primer design to differentiate MTBC and NTM. Six potential genes of MTBC such as IS6110, rpoB, katG, gyrB, 16SrRNA and ku) were shortlisted, whose amplification has been predicted to facilitate rapid and specific detection of MTBC and its demarcation from NTM.

1.2 Method for design of LAMP primer sequences useful for amplification of specific sequences of Mycobacterium tuberculosis complex

All the shortlisted gene sequences (six in number) were analyzed using extensive bioinformatics tools comprising MSA (Multiple sequence alignment) tools to predict the potential target regions of these sequences such as highly conserved regions of these sequences among the various species of MTBC, that could be amplified to specifically detect MTBC and also to distinguish them from NTM. LAMP (Loop-Mediated Isothermal Amplification) primers were designed for all the identified potential target regions of said six potential target genes using in-silico tools and validated for their specificity in amplification of respective genes. These primers were analyzed through LAMP reaction using synthetic control and narrowed down to three potential primer sets for each gene to respectively amplify (IS6110, rpoB, gyrB) for MTBC detection. These primer sets were multiplexed to analyze their specificity and sensitivity and found satisfactory. The primer sets employed for amplifying specific target region of IS6110, rpoB, gyrB genes for MTBC detection are listed below: SEQ.ID.NO.1 Lorward primer for amplifying IS6110

CGCCGCCAACTACGGT

SEQ.ID.NO.2 Reverse primer for amplifying IS6110

CGGCGCTGGACGAGAT

SEQ.ID. NO.3 Lorward primer for amplifying IS6110 GCATCTGGCCACCTCGATGCTACGGTGCCCGCAAAGT

SEQ.ID. NO.4 Reverse primer for amplifying IS6110

ACGGCTGATGACCAAACTCGGCGGCTGTGGCCGGATCA

SEQ.ID.NO.5 Reverse primer for amplifying IS6110

CAAAGCCCGCAGGACCA

SEQ.ID.NO.6 Forward primer for amplifying rpoB

GACGCTGGAGAAGGACAAC

SEQ.ID.NO.7 Reverse primer for amplifying rpoB

TGGGCTCGCCGACATG

SEQ.ID.NO.8 Forward primer for amplifying rpoB

TCTTTGGTCGGGGGCTCGCGACGAGGCGCTGTTGGAC

SEQ.ID.NO.9 Reverse primer for amplifying rpoB

TTCAAGGAGAAGCGCTACGACCAGCCCGAGCTTCTTGTTG

SEQ.ID.NO.IO Forward primer for amplifying rpoB

CGCAGCTTGCGGTAGAT

SEQ.ID.NO.il Reverse primer for amplifying rpoB

CCCGCGTCGGTCGCTATAA

SEQ.ID. NO.12 Forward primer for amplifying gyrB

TGTGCAGAAGGTCTGTAACG

SEQ.ID. NO.13 Reverse primer for amplifying gyrB

CCGTGGAACGGCAATCG

SEQ.ID. NO.14 Forward primer for amplifying gyrB

GGCTTGCGCCGAGGACACAGAACAGCTGACCCACTGGT

SEQ.ID. NO.15 Reverse primer for amplifying gyrB

CGTATCGCGGCACGTAAGGCGGGCAATCCACCGATGTC

SEQ.ID. NO.16 Forward primer for amplifying gyrB TTCGCGTCGGTGGGGTT

SEQ.ID. NO.17 Reverse primer for amplifying gyrB

AGAGTTGGTGCGGCGTAAGA

Example 2: Method for identification of Mycobacterium tuberculosis complex from different biological samples:

2.1 Extraction of DNA from biological samples:

The expectorated sputum from healthy human volunteers is collected in separate labeled containers with minimal saliva content. The sputum can be employed for further analysis directly without subjecting it to decontamination (raw sputum samples) or can be employed after decontamination using N-acetyl-l-cysteine-NaOH decontamination method. 100 pl of raw sputum sample or decontaminated sputum sample was added directly to the lysis buffer (-200 pl) and vortexed thoroughly to obtain a homogenous solution in microcentrifuge tubes. The Lysis buffer comprises Tris-Hydrochloride, Sodium Chloride, Tween 20. Said microcentrifuge tubes were incubated at 98°C for 5 minutes in a preheated dry bath or water bath and allowed to stand at room temperature for 2 minutes to cool down to obtain the lysed sample. DNA capture strips (DCS) were then inserted into said lysed sample, particularly the uncovered end of the DCS, which is the binding zone of DCS dipped into the lysed sample at least five times for five seconds, to ensure the thorough soaking of binding zone of DCS in the lysate. Subsequently, the DCS is dipped into the wash buffer kept in another microcentrifuge tube atleast for five times. The DCS is then gently wiped to remove the excess wash buffer. Wash buffer comprises Tris-Hydrochloride. The wash buffer is then discarded and the DCS is retained for elution of DNA using an elution buffer. The elution buffer comprises nuclease- free water. The DCS is dipped into 50 pl of elution buffer at least fifteen times so that the DCS is bent and compressed to release the bound DNA into said elution buffer. The eluate contained the genomic DNA of MTBC which can be used immediately or stored at -20°C for later usage .

2.2 Amplification of Extracted DNA using LAMP Assay kit for detection of MTBC:

The extracted DNA was amplified by following the protocol of the LAMP Assay kit. The PCR tubes containing the respective extracted sputum DNA samples from various subjects, NTC negative template control (NTC) and positive template control (PTC) are labeled appropriately following the set protocol. All the reagents of the LAMP Assay kit including the TB Master Mix, the MTBC Primer Mix, the Enhancer, Positive Control DNA, Nuclease Free water, were thawed to room temperature with gentle swirling. The TB master mix comprises Bst Polymerase, deoxynucleotide triphosphates (dNTPs) consisting of deoxyadenosine triphosphate, dATP; deoxythymidine triphosphate, dTTP; deoxycytosine triphosphate, dCTP; and deoxyguanosine triphosphate, dGTP in equal proportion, and reaction buffer comprising 10-40mM of Tris-Hydrochloride, 5-25mM of Ammonium sulfate, 25-75 mM of Potassium Chloride, 0.5-5 mM of Magnesium Sulfate, 0.01-1% of Tween 20. The primer mix comprises forward and reverse oligonucleotide primers of SEQ ID .NO. 1-5 for binding to IS6110 (SEQ.ID.NO.18), forward and reverse oligonucleotide primers of SEQ ID .NO. 6-11 for binding to rpoB (SEQ.ID.NO.19), forward and reverse oligonucleotide primers of SEQ ID .NO. 12-17 for binding to gyrB (SEQ.ID.NO.20) of Mycobacterium tuberculosis complex in the ratio of 45:50:5 v/v. The Enhancer comprises Guanidine Hydrochloride. The reaction mixture was prepared in the same order as given in Table 3.

Table-3: Reaction Mixture Composition.

The reaction mixture was prepared without a sample for the required number of reactions (DNA samples, PTC and NTC). 6.8 pl of the reaction mixture was added to the PCR tubes/strips containing 3 ,2pl of nuclease-free water, 3 ,2pl of DNA samples, or 3.2 pl of positive control DNA in the respective negative template control tubes, DNA sample tubes and the positive template control tubes. The tubes were vortexed to collect the reaction mixture at the bottom of the tubes. All the tubes in pink color were only taken for further processing. A color change to yellow or orange upon the addition of the sample indicates that the input sample is incompatible with the assay and so these tubes were discarded. The tubes with the reaction mixture and in pink colour were incubated in the thermal cycler/water bath/dry bath at 65 °C for 40 minutes and subsequently, the tubes were cooled to room temperature. The color changes occurring in each of the tubes were then recorded. The results were considered valid if the NTC reaction mixture turned pink in color and the PTC reaction mixture turned yellow. The yellow color indicates a positive result indicating the presence of MTBC in the sample while the pink color indicates a negative result for MTBC. However, if the PTC reaction mixture turns pink or the NTC reaction mixture turns yellow or orange-yellow, then the results were considered invalid and the tests were repeated.

2.3 Sensitivity and Specificity of LAMP Assay employing a primer mix comprising forward and reverse oligonucleotide primers for binding to IS6110, rpoB and syrB.

Sputum and tissue culture samples from human volunteers (n=887) were obtained and DNA was extracted from said samples following the procedure as described in Example 2.1. The extracted DNA was amplified using the LAMP Assay kit as described in Example 2.2 for the detection of MTBC. The results obtained by LAMP Assay kit were compared with the actual results obtained by standard benchmark methods such as MGIT (Mycobacteria Growth Indicator Tube) culture test, LPA (Line Probe Assay) test, or CBNAAT (Cartridge based nucleic acid amplification test) tests method to compute the sensitivity, specificity, positive predictive value, negative predictive value, and accuracy of the results obtained by the LAMP Assay kit, which are depicted in Table-4.

Table-4: Sensitivity and Specificity of LAMP -Assay performed with primer mix comprising forward and reverse oligonucleotide primers for binding to IS6110, rpoB and gyrB

2.4 Sensitivity and Specificity of LAMP Assay employing a primer mix comprising forward and reverse oligonucleotide primers for binding to IS6110, ryoB and rB with and without enhancer.

Sputum and tissue culture samples from human volunteers (n=130) were obtained and DNA was extracted from said samples following the procedure as described in Example 2.1. The extracted DNA was amplified using the LAMP Assay kit as described in Example 2.2 for the detection of MTBC with or without the enhancer in the reaction mixture. The results obtained by the LAMP Assay kit were compared with the actual results obtained by standard benchmark methods such as MGIT (Mycobacteria Growth Indicator Tube) culture test, LPA (Line Probe Assay) test, or CBNAAT (Cartridge based nucleic acid amplification test) tests to compute the sensitivity, specificity, positive predictive value, negative predictive value, and accuracy of the results obtained by the LAMP Assay kit, which are depicted in Table-5.

Table-5: Sensitivity and Specificity of LAMP -Assay performed with primer mix comprising forward and reverse oligonucleotide primers for binding to IS6110, rpoB and gyrB with and without enhancer.

2.5 Sensitivity and Specificity of LAMP Assay employing a primer mix comprising forward and reverse oligonucleotide primers for binding to IS6110 and rpoB.

Sputum and tissue culture samples from human volunteers (n=130) were obtained and DNA was extracted from said samples following the procedure as described in Example 2.1. The extracted DNA was amplified using the LAMP Assay kit as described in Example 2.2 for the detection of MTBC except that the MTBC primer mix of the reaction mixture employed in the LAMP Assay kit comprises forward and reverse oligonucleotide primers for binding to IS6110 and rpoB and the Assay was carried out with or without the enhancer in the reaction mixture. The results obtained by the LAMP Assay kit were compared with the actual results obtained by standard benchmark methods such as MGIT (Mycobacteria Growth Indicator Tube) culture test, LPA (Line Probe Assay) test, or CBNAAT (Cartridge based nucleic acid amplification test) tests to compute the sensitivity, specificity, positive predictive value, negative predictive value, and accuracy of the results obtained by the LAMP Assay kit, which are depicted in Table-6.

Table-6: Sensitivity and Specificity of LAMP -Assay performed with primer mix comprising forward and reverse oligonucleotide primers for binding to IS6110 and rpoB.

2.6 Sensitivity and Specificity of LAMP Assay employing a primer mix comprising forward and reverse oligonucleotide primers for binding to IS6110 and gyrB.

Sputum and tissue culture samples from human volunteers (n=130) were obtained and DNA was extracted from said samples following the procedure as described in Example 2.1. The extracted DNA was amplified using the LAMP Assay kit as described in Example 2.2 for the detection of MTBC except that the MTBC primer mix of the reaction mixture employed in the LAMP Assay kit comprises forward and reverse oligonucleotide primers for binding to IS6110 and gyrB and the Assay was carried out with or without the enhancer in the reaction mixture. The results obtained by the LAMP Assay kit were compared with the actual results obtained by standard benchmark methods such as MGIT (Mycobacteria Growth Indicator Tube) culture test, LPA (Line Probe Assay) test, or CBNAAT (Cartridge based nucleic acid amplification test) tests to compute the sensitivity, specificity, positive predictive value, negative predictive value, and accuracy of the results obtained by the LAMP Assay kit, which are depicted in Table-7.

Table-7: Sensitivity and Specificity of LAMP -Assay performed with primer mix comprising forward and reverse oligonucleotide primers for binding to IS6110 and gyrB.

2.7 Sensitivity and Specificity of LAMP Assay employing a primer mix comprising forward and reverse oligonucleotide primers for binding to rpoB and gyrB.

Sputum and tissue culture samples from human volunteers (n=130) were obtained and DNA was extracted from said samples following the procedure as described in Example 2.1. The extracted DNA was amplified using the LAMP Assay kit as described in Example 2.2 for the detection of MTBC except that the MTBC primer mix of the reaction mixture employed in the LAMP Assay kit comprises forward and reverse oligonucleotide primers for binding to rpoB and gyrB and the Assay was carried out with or without the enhancer in the reaction mixture. The results obtained by the LAMP Assay kit were compared with the actual results obtained by standard benchmark methods such as MGIT (Mycobacteria Growth Indicator Tube) culture test, LPA (Line Probe Assay) test, or CBNAAT (Cartridge based nucleic acid amplification test) tests to compute the sensitivity, specificity, positive predictive value, negative predictive value, and accuracy of the results obtained by the LAMP Assay kit, which are depicted in Table-8.

Table-8: Sensitivity and Specificity of LAMP -Assay performed with primer mix comprising forward and reverse oligonucleotide primers for binding to rpoB and gyrB.

Advantages

• The composition facilitates the amplification of specific genes of MTBC in resourcelimited settings.

• The system facilitates rapid and accurate detection of Mycobacterium tuberculosis complex from different biological samples with the naked eye in cost cost-effective manner in resource-limited settings.

• The method enables rapid and accurate detection of Mycobacterium tuberculosis complex from different biological samples using the naked eye with high sensitivity (greater than 97%) and specificity (greater than 99.9%) in resource-limited settings.

• The time taken to perform the method is approximately 45 to 50 minutes which is 2-4 fold less than the time taken by the standard methods such as Smear Microscopy, Loopamp, TruNat, CBNaat, routinely employed for the detection of Mycobacterium tuberculosis complex from different biological samples.

Claims

The claims:

1. A composition for amplification of DNA sequences of Mycobacterium tuberculosis complex from different biological samples comprising a master mix, a primer mix comprising forward and reverse oligonucleotide primers for binding to specific genes consisting of IS6110 (genbank id X17348.1, SEQ.ID.NO.18), rpoB (genbank id Rv0667, SEQ.ID.NO.19) and gyrB (genbank id Rv0005, SEQ.ID.NO.20) of Mycobacterium tuberculosis complex and enhancer; wherein the master mix is in a range between 70% -75% v/v, the primer mix is in a range between 19% - 25% v/v, the enhancer is in a range between 5% - 6% v/v of the composition.

2. The composition of claim 1, wherein the primer mix comprises: forward oligonucleotide primers consisting of SEQ.ID.Nos: 1, 3 which bind to IS6110 of SEQ.ID.NO. 18 ; reverse oligonucleotide primers consisting of SEQ.ID.Nos: 2, 4, 5 which bind to IS6110 of SEQ.ID.NO. 18; forward oligonucleotide primers consisting of SEQ.ID.Nos: 6, 8, 10 which bind to rpoB o/SEQ.ID.NO.19; reverse oligonucleotide primers consisting of SEQ.ID.Nos: 7,9,11 which bind to rpoB o/SEQ.ID.NO.19; forward oligonucleotide primers consisting of SEQ.ID.Nos: 12,14,16 which bind to gyrB o/SEQ.ID.NO.20; reverse oligonucleotide primers consisting of SEQ.ID.Nos: 13,15,17 which bind to gyrB o/SEQ.ID.NO.20.

3. The composition of claim 1, wherein the primer mix comprises forward and reverse oligonucleotide primers for binding to IS6110 (genbank id X17348.1, SEQ.ID.NO.18), rpoB (genbank id Rv0667, SEQ.ID.NO.19), gyrB (genbank id Rv0005, SEQ.ID.NO.20) of Mycobacterium tuberculosis complex in the ratio of 45:50:5 v/v.

4. The composition of claim 1, wherein the master mix comprises DNA polymerase, preferably Bst polymerase, deoxynucleotide triphosphates (dNTPs), and reaction buffer.

5. The composition of claim 4, wherein the reaction buffer comprises Tris-Hydrochloride, Ammonium sulfate, Potassium Chloride, Magnesium Sulfate, Tween 20.

6. The composition of claim 4, wherein the deoxynucleotide triphosphates (dNTPs), consist of deoxyadenosine triphosphate, dATP; deoxythymidine triphosphate, dTTP; deoxycytosine triphosphate, dCTP; and deoxyguanosine triphosphate, dGTP in equal proportion.

7. The composition of claim 1, wherein the Mycobacterium tuberculosis complex is one of genetically related Mycobacterium species that cause tuberculosis, comprising Mycobacterium tuberculosis, Mycobacterium africanum, Mycobacterium orygis, Mycobacterium bovis, Mycobacterium microti, Mycobacterium canetti, Mycobacterium caprae, Mycobacterium pinnipedii, Mycobacterium suricattae, Mycobacterium mungi or a combination thereof

8. The composition of claim 1, wherein the enhancer comprises Guanidine Hydrochloride.

9. The composition of claim 1, wherein the biological sample comprises human sputum samples or human tissue samples.

10. A method for identification of Mycobacterium tuberculosis complex from different biological samples using the naked eye, comprising:

• extraction of DNA from biological samples;

• amplification of said extracted DNA by mixing the extracted DNA with the composition for amplification of DNA sequences of Mycobacterium tuberculosis complex to form a reaction mixture and incubating the reaction mixture at 65°C for 35-45 minutes; wherein the composition for amplification of DNA sequences of Mycobacterium tuberculosis complex comprises a master mix, a primer mix comprising forward and reverse oligonucleotide primers for binding to specific genes consisting of IS6110 (genbank id X17348.1, SEQ.ID.NO.18 ), rpoB (genbank id Rv0667, SEQ.ID.NO.19) and gyrB (genbank id Rv0005, SEQ.ID.NO.20) of Mycobacterium tuberculosis complex and enhancer; wherein the master mix is in a range between 70% -75% v/v, the primer mix is in a range between 19% -25% v/v, the enhancer is in a range between 5% - 6% v/v;

• cooling the reaction mixture to 25°C to 28°C;

• visualization of amplified DNA using pH sensitive indicator dye comprising Phenol Red wherein the yellow color indicates a positive result, while the pink color indicates a negative result for Mycobacterium tuberculosis complex.

11. The method of claim 10, wherein the primer mix comprises: forward oligonucleotide primers consisting of SEQ.ID.Nos.: 1, 3 which bind to IS6110 of SEQ.ID.NO. 18 ; reverse oligonucleotide primers consisting of SEQ.ID.Nos.: 2, 4, 5 which bind to IS611 O of SEQ.ID.NO.18; forward oligonucleotide primers consisting of SEQ.ID.Nos.: 6, 8, 10 which bind to rpo5 o/SEQ.ID.NO.19; reverse oligonucleotide primers consisting of SEQ.ID.Nos.: 7,9,11 for amplifying rpoB o/SEQ.ID.NO.19; forward oligonucleotide primers consisting of SEQ.ID.Nos.: 12,14,16 for amplifying gyrB o/SEQ.ID.NO.20; reverse oligonucleotide primers consisting of SEQ.ID.Nos.: 13,15,17 for amplifying gyrB o/SEQ.ID.NO.20.

12. The method of claim 10, wherein the primer mix comprises forward and reverse oligonucleotide primers for binding to IS6110 (genbank id X17348.1, SEQ.ID.NO. 18), rpoB (genbank id Rv0667, SEQ.ID.NO.19), gyrB (genbank id Rv0005, SEQ.ID.NO.20) of Mycobacterium tuberculosis complex in a ratio of 45:50:5 v/v.

13. The method of claim 10, wherein the extraction of DNA comprises: a) incubation of the biological sample with lysis buffer at a temperature ranging from 95 to 100°C for 3 to 7 minutes to obtain a lysed sample (A); b) incubation of the lysed sample (A) at room temperature for 2-4 minutes to obtain a lysed sample (B); c) extraction of DNA using DNA capture strips (DCS) by dipping the DCS into the lysed sample (B) one or more times at least for 5-10 seconds and subsequently dipping the DCS in wash buffer for one or more times to obtain DCS with DNA; d) elution of DNA by dipping the DCS with DNA into an elution buffer for at least 15 times followed by bending and compression of the DCS with DNA to release the bound DNA into the elution buffer, which is used immediately or stored at -20°C for later usage.

14. The method of claim 13, wherein the biological sample is optionally decontaminated using N-acetyl-l-cysteine-NaOH decontamination method.

15. The method of claim 13, wherein the lysis buffer comprises Tris-Hydrochloride, Sodium Chloride, Tween 20; wash buffer comprises Tris-Hydrochloride; and elution buffer comprises Nuclease free water.

16. The method of claim 10, wherein the master mix comprises DNA polymerase, preferably Bst Polymerase, deoxynucleotide triphosphates (dNTPs) consisting of deoxyadenosine triphosphate, dATP; deoxythymidine triphosphate, dTTP; deoxycytosine triphosphate, dCTP; and deoxyguanosine triphosphate, dGTP in equal proportion, and reaction buffer comprising Tris-Hydrochloride, Ammonium sulfate, Potassium Chloride, Magnesium Sulfate, Tween 20.

17. The method of claim 10, wherein the enhancer comprises Guanidine Hydrochloride.

18. The method of claim 10, wherein the Mycobacterium tuberculosis complex is one of genetically related Mycobacterium species that cause tuberculosis, comprising Mycobacterium tuberculosis, Mycobacterium africanum, Mycobacterium orygis, Mycobacterium bovis, Mycobacterium microti, Mycobacterium canetti, Mycobacterium caprae, Mycobacterium pinnipedii, Mycobacterium suricattae, Mycobacterium mungi or a combination thereof.

19. A kit for detection of Mycobacterium tuberculosis complex from different biological samples comprising: a) DNA extraction kit comprising lysis Buffer, DNA capture strips, wash buffer, and elution buffer; b) DNA amplification kit comprising master Mix comprising Bst DNA polymerase, deoxynucleotide triphosphates (dNTPs), reaction buffer, primer mix comprising forward and reverse oligonucleotide primers of SEQ.ID. Nos. 1 to 17 and enhancer; c) one or more tube wells; d) pH-sensitive indicator dye comprising Phenol Red.

20. A system for detection of Mycobacterium tuberculosis complex from different biological samples using naked eye in limited resource settings, comprising: a) a means for extraction of DNA from biological sample; b) a means for DNA amplification; c) a means for qualitative detection of amplified DNA comprising pH sensitive indicator dye system; and d) a means for automated recordal and reporting of amplified DNA.

21. The system of claim 20, wherein the means for DNA extraction extracts the DNA from the biological sample and comprises a metal block (1) made for heat conduction comprising Aluminum having one or more holes for housing tube wells (2); wherein the block is heated by a heater (3) such as solar-powered battery-operated hot bath or mica heater, whose temperature is controlled by electronic means such as microcontroller; wherein the tube wells have a capacity of 0.5 ml to 2 ml volume, preferably 1.5 ml and are meant for housing the components for DNA extraction such as the reagents such as lysis buffer, DNA capture strips, wash buffer, and elution buffer.

22. The system of claim 20, wherein the means for DNA amplification comprises a metal block (4) made for heat conduction, comprising Aluminum having one or more holes for housing tube wells (5) wherein the block is heated by a heater (6) such as solar- powered battery-operated hot bath or mica heater, whose temperature is controlled by electronic means such as microcontrollers, wherein the tube wells (5) have a capacity of 0. 1 ml to 1 ml volume, preferably 0.2 ml and are meant for housing the components for amplification of DNA sequences of Mycobacterium tuberculosis complex from different biological samples comprising Bst DNA polymerase, deoxynucleotide triphosphates (dNTPs), reaction buffer, forward and reverse oligonucleotide primers of SEQ.ID. Nos. l to 17 and enhancer.

23. The system of claim 20, wherein the means for qualitative detection of amplified DNA, comprises a block (7) made of plastic having one or more holes for housing tube wells (8) wherein said tube wells (8) comprise pH-sensitive indicator dye system to qualitatively detect the amplified DNA.

24. The system of claim 20, wherein the means for automated recordal of amplified DNA comprises a camera (9), flash LEDs (10), and memory cards which are controlled by electronic means such as a microcontroller; wherein the means for automated reporting of amplified DNA comprises thermal reporter (11) controlled by electronic means such as microcontroller.

25. The system of claim 20, wherein the system extracts the DNA from the biological sample in 6 minutes and detects the presence of Mycobacterium tuberculosis complex DNA in the biological sample in 45 minutes.