Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/86—Viral vectors
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
  • C12N2710/00011—Details
  • C12N2710/10011—Adenoviridae
  • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
  • C12N2710/10322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
  • C12N2750/00011—Details
  • C12N2750/14011—Parvoviridae
  • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
  • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
  • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
  • C12N2750/00011—Details
  • C12N2750/14011—Parvoviridae
  • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
  • C12N2750/14151—Methods of production or purification of viral material
  • C12N2750/14152—Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
  • C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
  • C12N2830/003—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor tet inducible

Definitions

• the expression control system is activated by the addition or removal of a drug.
• the expression control system comprises a stimulus-responsive promoter operably linked to the helper gene, a Cre protein-responsive nucleic acid region that enables removal or inversion of at least a portion of the nucleic acid region of the helper gene or a promoter operably linked thereto, a CRISPR-Cas9 system, or an shRNA against a nucleic acid transcribed from the helper gene.
• the expression control system comprises a stimulus-responsive promoter operably linked to the helper gene, a Cre protein-responsive nucleic acid region that enables removal or inversion of at least a portion of the nucleic acid region of the helper gene or a promoter operably linked thereto, a CRISPR-Cas9 system, or an shRNA against a nucleic acid transcribed from the helper gene.
• said producer cell comprises said helper genes, ITRs, GOI, Cap genes and Rep genes in one chromosomal locus.
• AAV adeno-associated virus
• Fig. 1 shows the amount of AAV vector produced in HeLa cells and CHO cells under each condition, and the genome copy number per mL of cell culture supernatant.
• 1 shows an outline of an exemplary plasmid construct incorporating an E1A/E1B expression control system with a drug controlled switch (Cumate).
• 1 shows an outline of an exemplary plasmid structure incorporating an E1A/E1B expression control system using a drug-controlled switch (mifepristone).
• 1 shows an outline of an exemplary plasmid construct incorporating an E1A/E1B expression control system with a Cre protein controlled switch.
• the expression levels of mRNAs are shown as relative expression levels under each condition based on the expression level in HEK293 cells No. 1 using a wild-type gene.
• the production amount of AAV vectors is shown as the genome copy number per mL of cell culture supernatant.
• variants based on specific wild-type sequences such as adenovirus serotypes 1 to 52 and adeno-associated virus serotypes 1 to 12 include known variants (e.g., rhlO, DJ, DJ/8, PHP.eB, PHP.S, AAV2-retro, AAV2-QuadYF, AAV2.7m8, AAV6.2, rh.74, AAV2.5, AAV-TT, Anc80, etc.), as well as nucleic acids containing sequences having at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence identity to the original sequence.
• known variants e.g., rhlO, DJ, DJ/8, PHP.eB, PHP.S, AAV2-retro, AAV2-QuadYF, AAV2.7m8, AAV6.2, rh.74, AAV2.5, AAV-TT,
• genes include transcriptional/translation regulatory sequences such as promoters, terminators, enhancers, insulators, silencers, replication origins, and internal ribosome entry sites, as well as nucleic acid portions required for packaging into viral particles.
• gene product refers to mRNA transcribed from a gene, a polypeptide, a protein, or a non-protein-coding functional RNA encoded by a gene.
• expression of a gene refers to the production of a gene product.
• viral genes often encode multiple types of proteins of different lengths in a single nucleic acid region.
• a gene is said to be expressed when at least one type of protein that can be produced from the gene is produced.
• the resulting solution was then incubated in a block incubator with Nuclease-Free water (0.001% 2 ⁇ L of the solution was diluted 100-fold with Pluronic (registered trademark) F-68 (100X) to prepare a 2 ⁇ L solution, to which 2 ⁇ L of Nuclease-Free water, 5 ⁇ L of PowerUp (registered trademark) SYBR (registered trademark) Green Master Mix (Thermo Fisher: A25780), 0.5 ⁇ L of 10 ⁇ M CMV-F primer (CATCAATGGGCGTGGATAGC: SEQ ID NO: 7), and 0.5 ⁇ L of 10 ⁇ M CMV-R primer (GGAGTTGTTACGACATTTTGGAAA: SEQ ID NO: 6) were added, and the mixture was then measured using a QuantStudio 3 real-time PCR system Fast 96 well (Thermo When the amount of AAV particles is measured by performing qPCR using a PCR kit (Fisher: QS3-96F)
• plasmid refers to a circular DNA that exists separately from chromosomes in a cell or that exists separately from chromosomes when introduced into a cell.
• oil of replication refers to a segment of a nucleic acid sequence where replication begins when a protein that recognizes that nucleic acid sequence (such as the initiator DnaA protein) binds or when RNA is synthesized, partially unwinding the DNA double helix.
• the "homology" of a nucleic acid refers to the degree of identity between two or more nucleic acid sequences, and generally, “homology” refers to a high degree of identity or similarity.
• homology refers to a high degree of identity or similarity.
• a "corresponding" amino acid or nucleic acid refers to an amino acid or nucleotide in a polypeptide or polynucleotide molecule that has or is predicted to have the same action as a specific amino acid or nucleotide in a polypeptide or polynucleotide that is used as a reference for comparison, and in particular in an enzyme molecule, refers to an amino acid that is located at a similar position in the active site and contributes to catalytic activity in a similar manner. For example, in the case of an antisense molecule, it may be a similar portion in an ortholog that corresponds to a specific portion of the antisense molecule.
• a "corresponding" gene refers to a gene (e.g., a polynucleotide sequence or molecule) that has or is predicted to have the same function in a given species as a given gene in a species that is the basis for comparison, and when there are multiple genes with such function, refers to those that have the same evolutionary origin.
• a gene that corresponds to a given gene may be an ortholog of that gene.
• the cap of an AAV serotype 1 may correspond to the cap of an AAV serotype 2.
• a corresponding gene in a given virus can be found by searching a sequence database of that virus using the gene sequence of the virus that is the basis for the corresponding gene as a query sequence.
• the term "activity" as used herein refers to the function of a molecule in its broadest sense. Activity generally includes, but is not intended to be limiting, the biological, biochemical, physical, or chemical functions of a molecule. Activity includes, for example, enzymatic activity, the ability to interact with other molecules, and the ability to activate, promote, stabilize, inhibit, suppress, or destabilize the function of other molecules, stability, ability to localize to a particular subcellular location. Where applicable, the term also relates to the function of protein complexes in their broadest sense.
• biological activity refers to an activity that a certain factor (e.g., a polynucleotide, a protein, etc.) may have in a living body, and includes an activity that exerts various functions (e.g., a transcription promoting activity), and also includes, for example, an activity that activates or inactivates another molecule by interacting with another molecule.
• a certain factor e.g., a polynucleotide, a protein, etc.
• the biological activity includes the enzymatic activity.
• the biological activity includes the binding of the ligand to a corresponding receptor.
• Such biological activity can be measured by a technique well known in the art.
• infectious virus or virus-derived construct refers to the ability of the virus or virus-derived construct to introduce nucleic acid within the virus or virus-derived construct into a cell by attachment or membrane fusion with the cell.
• Replication capacity of a virus or virus-derived construct refers to the ability to produce infectious virus particles or virus-derived construct particles within an infected cell.
• a “purified” substance or biological factor refers to a biological factor from which at least a portion of the factors naturally associated with the biological factor have been removed. Thus, typically, the purity of the biological factor in a purified biological factor is greater (i.e., concentrated) than the state in which the biological factor is normally present.
• the term “purified” means that preferably at least 75% by weight, more preferably at least 85% by weight, even more preferably at least 95% by weight, and most preferably at least 98% by weight of the same type of biological factor is present.
• the substances used in this disclosure are preferably "purified" substances.
• pharmaceutical ingredient means any ingredient that can constitute a medicine, and examples include active ingredients (which themselves exhibit medicinal effects), additive ingredients (ingredients that are not expected to have medicinal effects themselves, but are expected to play a certain role when included in a medicine (e.g., excipients, lubricants, surfactants, etc.)).
• a pharmaceutical ingredient may be a single substance, or a combination of multiple substances or agents. It may also include any combination, such as a combination of an active ingredient and an additive ingredient, or a combination of an adjuvant and an active ingredient.
• active ingredient refers to an ingredient that exerts an intended medicinal effect, and may refer to a single ingredient or multiple ingredients.
• additive ingredient refers to any ingredient that is not expected to have a medicinal effect but plays a certain role when included in a medicine, such as pharma- ceutically acceptable carriers, stabilizers, (co)adjuvants, solubility improvers, solubilizers, diluents, excipients, buffers, binders, diluents, flavorings, and lubricants.
• the helper genes include genes selected from adenovirus E1B, E2, E4, and VA. In one embodiment, the helper genes include adenovirus E1B gene. In one embodiment, the helper genes include two or more helper genes for the production of adeno-associated virus (AAV)-derived constructs, and the helper genes may be selected from E1A, E1B, E2, E4, and VA, as necessary. In one embodiment, the helper genes include a helper gene selected from E1A and E1B, and a helper gene selected from E2, E4, and VA.
• AAV adeno-associated virus
• a nucleic acid element of an expression control system may be arranged for the portion encoding each protein.
• the E1B gene of an adenovirus can produce two proteins, E1B19K and E1B55K
• the nucleic acid element of the expression control system arranged for the E1B gene includes a nucleic acid element of the expression control system arranged for the portion encoding E1B19K, a nucleic acid element of the expression control system arranged for the portion encoding E1B55K, a combination of these, and a nucleic acid element of the expression control system arranged for the portion encoding both E1B19K and E1B55K.
• the virus-derived construct produced has structural proteins (such as capsids), which may be involved in binding to tissues or cells. Therefore, by modifying the structural proteins to modify their binding to tissues or cells (or their surface structures), the targeting of the virus-derived construct to tissues or cells can be adjusted.
• the combination of the present disclosure may include a nucleic acid containing a gene encoding a structural protein, and the structural protein may be modified.
• modifications of the structural protein to adjust tissue or cell targeting include substitution or fusion with other proteins (other viral capsids (e.g., capsids of viruses of other serotypes, VSV-G), antigen-binding regions of antibodies, ligand proteins of the subject organism (ligands for cancer antigens), etc.).
• the gene of interest may include multiple genes, making it possible to deliver highly functional nucleic acids to the subject, such as a combination of a subject's tissue (e.g., cancer tissue)-specific or time-specific promoter and a therapeutic gene (therapeutic protein coding sequence, gene therapy gene, gene cell therapy gene, etc.) operably linked thereto, or a sequence encoding a series of enzymes that enable the coordinated expression of a series of enzymes that control a metabolic cascade.
• tissue e.g., cancer tissue
• a therapeutic gene therapeutic protein coding sequence, gene therapy gene, gene cell therapy gene, etc.
• the protein encoded by the gene of interest may be a therapeutic polypeptide (e.g., replacement therapy), an immunogenic polypeptide (e.g., a pathogen polypeptide, a cancer antigen polypeptide), or the like.
• Therapeutic polypeptides include cystic fibrosis transmembrane conductance regulator (CFTR), dystrophin (mini-dystrophin and micro-dystrophin, myostatin propeptide, follistatin, activin type II soluble receptor, IGF-1, anti-inflammatory polypeptides, sarcospan, utrophin, mini-utrophin, coagulation factors (e.g., factor VIII, factor IX, factor X, etc.), erythropoietin, angiostatin, endostatin, catalase, tyrosine hydrochloride, and the like.
• CFTR cystic fibrosis transmembrane conductance regulator
• dystrophin mini-dystrophin and micro-d
• xylase superoxide dismutase, leptin, LDL receptor, lipoprotein lipase, ornithine transcarbamylase, ⁇ -globin, ⁇ -globin, spectrin, ⁇ 1-antitrypsin, adenosine deaminase, hypoxanthine guanine phosphoribosyltransferase, ⁇ -glucocerebrosidase, sphingomyelinase, lysosomal hexosaminidase A, branched-chain ketoacid dehydrogenase, RP65 protein, cytokines (e.g., ⁇ -interferon, interferon, beta-interferon, interferon-gamma, interleukin-2, interleukin-4, granulocyte-macrophage colony-stimulating factor, lymphotoxin, etc.), peptide growth factors, neurotrophic factors and hormones (e.g
• Pathogen polypeptides include cell surface proteins of pathogenic organisms such as bacteria, fungi, and parasites, and proteins expressed on the surface of viruses (e.g., spike proteins, envelope proteins, capsid proteins, etc.).
• pathogen polypeptides include orthomyxovirus immunogens (e.g., influenza virus hemagglutinin (HA), nucleoprotein), lentivirus immunogens (e.g., HIV or SIV envelope GP160 protein, matrix/capsid protein, gag, pol, env gene products), arenavirus immunogens (e.g., Lassa fever virus nucleocapsid protein, envelope glycoprotein), poxvirus immunogens (e.g., vaccinia L1 or L8 gene products), flavivirus immunogens (e.g., yellow fever virus or Japanese encephalitis virus immunogens), filovirus immunogens (e.g., HIV or SIV envelope GP160 protein, matrix/capsid protein, gag, pol, en
• Cancer antigen polypeptides include BRCA1 gene product, BRCA2 gene product, gp100, tyrosinase, GAGE-1/2, BAGE, RAGE, LAGE, NY-ESO-1, CDK-4, ⁇ -catenin, MUM-1, caspase-8, KIAA0205, HPVE, SART-1, PRAME, p15, melanoma tumor antigen, MART-1, gp100 MAGE-1, MAGE-2, MAGE-3, CEA, TRP-1, TRP-2, P-15, tyrosinase, HER-2/ These include neu gene product, CA125, LK26, FB5 (endosialin), TAG72, AFP, CA19-9, NSE, DU-PAN-2, CA50, Span-1, CA72-4, HCG, STN (sialyl Tn antigen), c-erbB-2 protein, PSA, L-CanAg, estrogen receptor, milk fat globulin, p53 tumor
• the gene of interest may be a gene for treating a specific disease (e.g., a gene for gene therapy).
• the gene to be selected for a specific disease may be appropriately selected by one skilled in the art.
• diseases include infectious diseases caused by various pathogens, cystic fibrosis, hemophilia A, hemophilia B, thalassemia, anemia, Alzheimer's disease, multiple sclerosis, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, spinal muscular atrophy, epilepsy, cancer (melanoma, adenocarcinoma, thymoma, lymphoma, sarcoma, lung cancer, liver cancer, colon cancer, leukemia, uterine cancer, breast cancer, prostate cancer, ovarian cancer, cervical cancer, bladder cancer, kidney cancer, pancreatic cancer, brain cancer, etc.), diabetes, muscular dystrophy, Gaucher disease, and other diseases.
• infectious diseases caused by various pathogens, cystic fibrosis, hemophilia
• the present disclosure provides a method for controlling the expression of the Rep gene using a cell.
• the method for controlling the expression of the Rep gene described herein can be carried out using a cell.
• the cell is a producer cell (e.g., producing an AAV-derived construct).
• the present disclosure provides a cell comprising a nucleic acid comprising a Rep gene and a nucleic acid comprising a helper gene.
• the present disclosure provides a cell comprising a nucleic acid element of the combination for controlling the expression of the Rep gene described herein.
• the present disclosure provides a method for making a cell comprising introducing at least one element of the combination for controlling the expression of the Rep gene described herein.
• producer cells include human embryonic kidney cells (produced by transfecting human fetal kidney cells with truncated adenovirus 5 DNA), 911 cells, PER.C6 cells, E1-transformed amniotic cells, E1-transformed A549 cells, GH329:HeLa cells, HEK293 cells, IT293SF cells, HEK293T, HEK293F, Vero cells, CHO cells, Sf9 cells, FreestyleTM 293-F, Expi293-FTM, Expi293 inducible, Expi293 NGT-Viral Production Cells 1.0, Viral Production Cells 2.0, Viral Production Cells 3.0, Viral Production Cells 4.0, Viral Production Cells 5.0, Viral Production Cells 6.0, Viral Production Cells 7.0, Viral Production Cells 8.0, Viral Production Cells 9.0, Viral Production Cells 10.0, Viral Production Cells 11.0, Viral Production Cells 12.0, Viral Production Cells 13.0, Viral
• the present disclosure provides a method for producing a virus-derived construct using the method for controlling the expression of Rep gene described herein, and also provides the produced virus-derived construct.
• the virus-derived construct is an AAV-derived construct.
• the virus-derived construct can be a virus vector, a virus-like particle (VLP), an oncolytic virus (including one modified to grow only in cancer cells), or a virus replicon (a self-replicating virus genome that has been deleted for virus particle production).
• the AAV-derived constructs of the present disclosure may be produced based on an AAV of a suitable serotype depending on the target tissue.
• the (serotype):(target tissue) relationship may be selected as follows; (AAV1):(muscle, liver, airway, nerve cells), (AAV2):(muscle, liver, nerve cells), (AAV3):(muscle, liver, nerve cells), (AAV4):(muscle, ependymal cells), (AAV5):(muscle, liver, nerve cells, glial cells, airway), (AAV6):(muscle, liver, airway, nerve cells), (AAV7):(muscle, liver), (AAV8):(muscle, liver), (AAV9):(muscle, liver, airway).
• AAV capsids examples include wild-type capsids, capsids with targeted mutations (AAV2i8, AAV2.5, AAV-TT, AAV9.HR, etc.), capsids with random mutations (AAV-PHP.B, etc.), and capsids designed in silico (Anc80, etc.), and in one embodiment, the AAV-derived construct of the present disclosure may contain these modified capsids.
• the present disclosure provides a virus-derived construct-containing composition comprising a population of virus-derived constructs of the present disclosure.
• the virus-derived constructs of the present disclosure and the virus-derived construct-containing composition of the present disclosure produced by the method of the present disclosure may have structural features that cannot be fully analyzed or are very difficult to analyze, such as the three-dimensional structure or surface modification of the virus-derived construct. Therefore, the characteristic of being produced by the method of the present disclosure is one of the characteristics that appropriately describe the virus-derived constructs of the present disclosure and the virus-derived construct-containing composition of the present disclosure.
• composition comprising at least one of the nucleic acids, elements of an expression control system, cells, and virus-derived constructs described herein.
• compositions may be provided in various forms (compositions).
• the composition may be in the form of, for example, an injection, a capsule, a tablet, a granule, an inhalant, etc.
• the aqueous solution for injection may be stored, for example, in a vial or a stainless steel container.
• the aqueous solution for injection may also be mixed with, for example, physiological saline, sugar (e.g., trehalose), NaCl, NaOH, etc.
• compositions of the present disclosure include a pharma- ceutically acceptable carrier or excipient.
• Such carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, including, but not limited to, peanut oil, soybean oil, mineral oil, sesame oil, and the like.
• Water is the preferred carrier when the pharmaceutical composition is administered orally.
• Saline and aqueous dextrose are the preferred carriers when the pharmaceutical composition is administered intravenously. Saline solutions, and aqueous dextrose and glycerol solutions are preferably used as liquid carriers for injectable solutions.
• Suitable excipients include light anhydrous silicic acid, crystalline cellulose, mannitol, starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, skimmed milk powder, glycerol, propylene, glycol, water, ethanol, carmellose calcium, carmellose sodium, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, polyvinyl acetal diethyl amino acetate, polyvinyl pyrrolidone, gelatin, medium chain triglyceride, polyoxyethylene hydrogenated castor oil 60, poloxamer, white sugar, carboxymethyl cellulose, corn starch, inorganic salts, etc.
• the composition can also contain a small amount of a wetting or emulsifying agent, or a pH buffer, if desired.
• These compositions can take the form of a solution, suspension, emulsion, tablet, pill, capsule, powder, sustained release formulation, etc.
• the composition can also be formulated as a suppository, using traditional binders and carriers, such as triglycerides.
• Oral formulations may contain standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, etc. Examples of suitable carriers are described in E.W. Martin, Remington's Pharmaceutical Sciences (Mark Publishing Company, Easton, U.S.A.).
• any liquid composition of the present disclosure may be about 3, about 3.5, about 4, about 4.5, about 5, about 5.5, about 6, about 6.5, about 7, about 7.5, about 8, about 8.5, about 9, about 9.5, about 10, about 10.5, about 11, or a range between any two of these values.
• compositions of the present disclosure may be provided as a pharma- ceutically acceptable salt, such as salts formed with free carboxyl groups derived from hydrochloric acid, phosphoric acid, acetic acid, oxalic acid, tartaric acid, etc., salts formed with free amine groups such as those derived from isopropylamine, triethylamine, 2-ethylaminoethanol, histidine, procaine, etc., and salts formed with sodium, potassium, ammonium, calcium, and ferric hydroxides.
• a pharma- ceutically acceptable salt such as salts formed with free carboxyl groups derived from hydrochloric acid, phosphoric acid, acetic acid, oxalic acid, tartaric acid, etc.
• salts formed with free amine groups such as those derived from isopropylamine, triethylamine, 2-ethylaminoethanol, histidine, procaine, etc.
• the composition can be formulated as a pharmaceutical composition adapted for administration to humans, according to known methods.
• a composition for administration by injection is a solution in a sterile isotonic aqueous buffer.
• the composition can also include a solubilizing agent and a local anesthetic, such as lidocaine, to ease pain at the site of the injection.
• the ingredients are supplied separately or mixed together in unit dosage form, for example as a lyophilized powder or water-free concentrate in a hermetically sealed container, such as an ampoule or sachette indicating the quantity of active agent.
• composition is to be administered by injection, it can be dispensed using an infusion bottle containing sterile pharmaceutical grade water or saline. If the composition is to be administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients can be mixed prior to administration.
• nucleic acids, elements of the expression control system, cells, or virus-derived constructs described herein, or compositions comprising them can be used in a variety of applications, including gene therapy, functional genomics, cancer vaccination and/or anti-viral vaccination.
• the subject is not particularly limited and may be a mammal (e.g., mouse, rat, hamster, rabbit, cat, dog, cow, sheep, pig, monkey, human, etc.), bird, reptile, amphibian, arthropod, fish, etc.
• a mammal e.g., mouse, rat, hamster, rabbit, cat, dog, cow, sheep, pig, monkey, human, etc.
• the dosage of the virus-derived construct or virus-derived construct-containing composition of the present disclosure is not particularly limited, but may be, for example, 1 ⁇ 10 5 , 1 ⁇ 10 6 , 1 ⁇ 10 7 , 1 ⁇ 10 8 , 1 ⁇ 10 9 , 1 ⁇ 10 10 , 1 ⁇ 10 11 , 1 ⁇ 10 12 , 1 ⁇ 10 13 , 1 ⁇ 10 14 , or 1 ⁇ 10 15 virus-derived constructs per administration, or may be within a range between any two of these values.
• the administration interval is not particularly limited, but may be, for example, once or twice per 1, 7, 14, 21, or 28 days, or once or twice per range between any two of these values.
• the dosage, administration interval, and administration method may be appropriately selected depending on the age, weight, symptoms, target organ, etc. of the patient.
• the route of administration of the nucleic acids, expression control system elements, cells, or virus-derived constructs described herein, or compositions comprising them may be, for example, intravenous, intradermal, subcutaneous, intramuscular, intraperitoneal, intrathecal, intraventricular, intraparenchymal, pulmonary, intranasal, epidural, or oral.
• the compositions of the present disclosure can be used with various delivery systems. Such systems include, for example, encapsulation in liposomes, microparticles, and microcapsules; the use of receptor-mediated endocytosis.
• Medication can be administered by a suitable route, for example, by infusion, by bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral, rectal, and intestinal mucosa), or by inhalation or nebulization, if necessary with an aerosolizing agent, and can be administered together with other agents. Administration can be systemic or local.
• Producer cells were created in which various genes were integrated into the genome using lentivirus. The integration of each of the genes described in this specification into the chromosome (genome) has been confirmed (data not shown).
• Tetracycline transactivator binds to tetracycline response element (TRE) in the presence of doxycycline (dox) to suppress the expression of downstream genes.
• dox doxycycline
• CHO cells and HeLa cells were seeded at 5 x 105 cells/well on a 6-well plate. After 24 hours of culture at 37°C and 5% CO2 , 1/1000 volume of polybrene solution (10 mg/mL) was mixed with the virus solution and added to the culture. After 24 hours, the medium was replaced, and after another 24 hours, hygromycin was added to the medium to a concentration of 200 ⁇ g/mL. After that, medium replacement and drug addition were repeated until all the cells in the control without the virus solution were killed by the drug.
• RNA extracted from the cells was reverse transcribed into cDNA and qPCR was performed.
• the primer sequences used were 5'-CCTACGGCGCTCTGGATATG-3' (SEQ ID NO: 1) and 5'-TACCCACCGTACTCGTCAATTC-3' (SEQ ID NO: 2).
• the PCR conditions were 95°C for 2 minutes, followed by 40 cycles of 95°C/15 seconds, 54°C/5 seconds, and 72°C/30 seconds.
• CHO-tTA cells and HeLa-tTA cells were seeded at 5 x 105 cells/well on a 6-well plate. After 24 hours of culture at 37°C and 5% CO2 , 1/1000 volume of polybrene solution (10 mg/mL) was mixed with the virus solution and added to the culture. After 24 hours, the medium was replaced, and after another 24 hours, puromycin was added to the medium to a concentration of 0.5 ⁇ g/mL. Thereafter, medium replacement and drug addition were repeated until all the cells in the control to which no virus solution was added were killed by the drug.
• a transfection solution was added that was a mixture of 500 ⁇ L of Opti-MEM medium containing three types of lentivirus packaging plasmids (pDNA# 1-3) and a plasmid containing GOI TRE-E1A (pDNA# 12) shown in the table below, and 500 ⁇ L of Opti-MEM medium containing 10 ⁇ L of PEIpro (registered trademark) (PolyPlus-transfection SAS). After 72 hours of culture, the supernatant was collected and filtered through a 0.45 ⁇ m filter to prepare a virus solution.
• RNA extracted from the cells was reverse transcribed into cDNA and qPCR was performed.
• the primer sequences used were 5'-atggaggcttgggagtgtttg-3' (SEQ ID NO: 3) and 5'-ACTAACTTTGCCTGGGATGAGC-3' (SEQ ID NO: 4).
• the PCR conditions were 95°C for 2 minutes, followed by 40 cycles of 95°C/15 seconds, 54°C/5 seconds, and 72°C/30 seconds.
• a transfection solution was added that was a mixture of 500 ⁇ L of Opti-MEM medium containing three types of lentivirus packaging plasmids (pDNA # 1-3) and a plasmid (pDNA # 13) containing the GOI TRE-E1B55K-IRES-E1A, and 500 ⁇ L of Opti-MEM medium containing 10 ⁇ L of PEIpro (registered trademark) (PolyPlus-transfection SAS). After 72 hours of culture, the supernatant was collected and filtered through a 0.45 ⁇ m filter to prepare a virus solution.
• AAV vector plasmids containing the E1A/E1B genes under the control of the regulatory system and other AAV vector production genes were transiently introduced into the producer cells to evaluate the effect on Rep gene expression and viral particle production.
• Plasmid #6 SYNp21_pR2C1 was treated with restriction enzymes (NotI, BamHI).
• a TRE fragment was inserted therein using InFusion.
• the TRE fragment was prepared using the following primers with the TRE gene sequence (Vector Builder) as a template: primer sequences 5'-gtgccacctgacgtcGGCCGGCCgcggccgcggtaccgagctcgactttcac-3' (SEQ ID NO: 29), 5'-TGGTCCTCCTGGATCCGCTAGCcaattcggggccgcggaggc-3' (SEQ ID NO: 30).
• the IRES fragment was prepared using the IRES gene sequence (Vector Builder) as a template with the following primers: primer sequences 5'-gcgatgaagatacagattgagcccctctcccccccccccccccccccccccccccccccccccccccccccccccccc-3' (SEQ ID NO:57), 5'-tggcagataatatgtctcatggttgtggccatattatcat-3' (SEQ ID NO:58).
• a restriction enzyme is added to this mixture to generate DNA fragments each having a unique end complementary only to a specific fragment. Then, an OGAB accumulation vector cut with the same restriction enzyme is added to the solution in an amount that matches the molar concentration of each fragment, and ligation is performed to link pairs of fragments (including fragments of the OGAB accumulation vector) having complementary ends. This is added to Bacillus subtilis competent cells, cultured, and then transformed colonies are obtained. A plasmid having the desired structure is recovered from this colony.
• Plasmid #9 SYNp116_pLV-E1 genome-PGK-PuroR was treated with a restriction enzyme (EcoRI).
• a PIX fragment was inserted therein using InFusion.
• the PIX fragment was prepared using the Ad5 genome as a template and the following primers: primer sequences 5'-gcgatgaagatacagattgaggtactgaaatgtgtgggcg-3' (SEQ ID NO: 61), 5'-CTCCCCCTACCCGGTAGAATTCagacagcaagacacttgcttgatccaaatccaaacagagtc-3' (SEQ ID NO: 62).
• the resulting plasmid was treated with restriction enzymes (BamHI, EcoRI). This fragment was ligated to the following two fragments (mPGK promoter/hygromycin resistance gene/hGH polA signal fragment and ampicillin resistance gene/pUC ori fragment) using InFusion.
• the mPGK promoter/hygromycin resistance gene/hGH polA signal fragment was prepared using the mPGK-HygromycinR-hGH gene sequence (Vector Builder) as a template and the following primers: primer sequences 5'-cttgctgtctGAATTctaggttctaccgggtagggggaggcgc-3' (SEQ ID NO: 63), 5'-gcggccgcagatctacgcgtgtcgacaaggacagggaggggaggggagcag-3' (SEQ ID NO: 64).
• the ampicillin resistance gene/pUC ori fragment was prepared using the following primers with pUC19 as a template: primer sequences 5'-tagatctgcggccgcgagcaaaggccagcaaag-3' (SEQ ID NO:65), 5'-cgccacactaGGATCCaagcttgcggccgcaggtggcacttttcgggga-3' (SEQ ID NO:66).
• the CMV promoter fragment was prepared using the CMV promoter gene sequence (Vector Builder) as a template and the following primers: primer sequences 5'-cgaaaagtgccacctgcggccgcaagctttctaggcgttacataacttacggtaa-3' (SEQ ID NO: 67), 5'-GAATTCCCTGCAGGGCTCTTCagctctgcttatatatagacctc-3' (SEQ ID NO: 68).
• the SV40 polyA signal fragment was prepared using the SV40 polyA signal gene sequence (Vector Builder) as a template and the following primers: primer sequences 5'-CCCTGCAGGGAATTCtaagatacattgatgag-3' (SEQ ID NO: 69), 5'-ggaggatccaacttgtttattgcagcttata-3' (SEQ ID NO: 70).
• the bGH polyA signal fragment was prepared using the bGH polyA signal gene sequence (Vector Builder) as a template and the following primers: primer sequences 5'-caagttggatcctccccagcatgcctgctattc-3' (SEQ ID NO: 71), 5'-ttgGCTAGCtgtacactgtgccttctagttgcc-3' (SEQ ID NO: 72).
• the CAG promoter fragment was prepared using the following primers with the CAG promoter gene sequence (Vector Builder) as a template: primer sequences 5'-caagttggatcctccccagcatgcctgctattc-3' (SEQ ID NO: 73), 5'-gctggccttttgctcgcggccgcagatctacgcgtCCTAGgctcgacattgattattgac-3' (SEQ ID NO: 74).
• the resulting plasmid was treated with a restriction enzyme (EcoRI). This fragment and the E1A fragment were ligated using InFusion.
• the E1A fragment was prepared using the following primers with plasmid #9 SYNp116_pLV-E1 genome-PGK-PuroR as a template: primer sequences 5'-GCCCTGCAGGGaattcatgagacatattatc-3' (SEQ ID NO: 75), 5'-atgtatcttaGAATTttatggcctggggcgtttac-3' (SEQ ID NO: 76). The resulting plasmid was treated with a restriction enzyme (NheI). This fragment and the E1B fragment were ligated using InFusion.
• the mPGK promoter/hygromycin resistance gene/hGH polA signal fragment was prepared using the SYNp171_E1 genome-HygR of plasmid #19 as a template and the following primers: primer sequences 5'-cttgctgtctGAATTctaggttctaccgggtaggg-3' (SEQ ID NO: 79), 5'-ccgcagatctacgcgtgtcgac-3' (SEQ ID NO: 80).
• the TRE fragment was prepared using the TRE gene sequence (Vector Builder) as a template with the following primers: primer sequences 5'-ctgtccttgtcgacacgcgtgagcaaaggccagcaaaag-3' (SEQ ID NO: 83), 5'-gataatatgtctcatgaattCagcctgcttttttgtacaac-3' (SEQ ID NO: 84).
• the TRE/E1A fragment was prepared using the following primers with SYNp172-5_TRE-E1A_TRE-E1B_HygroR of plasmid #21 as a template: primer sequences 5'-ccgcaagcttGGATCCcaactttgtatagaaaagttg-3' (SEQ ID NO:87), 5'-tattgcattctctagacacagg-3' (SEQ ID NO:88).
• a transfection solution was added that was a mixture of 500 ⁇ L of Opti-MEM medium containing three types of lentivirus packaging plasmids (pDNA # 1-3) and a plasmid (pDNA # 8) containing tTA, which is a gene of interest (GOI), as shown in the table below, and 500 ⁇ L of Opti-MEM medium containing 10 ⁇ L of PEIpro (registered trademark) (PolyPlus-transfection SAS). After 72 hours of culture, the supernatant was collected and filtered through a 0.45 ⁇ m filter to prepare a virus solution.
• PCR was performed using DNA extracted from the cells as a template.
• the primer sequences used were 5'-tctgaagactacagcgtcgc-3' (SEQ ID NO: 93) and 5'-ggtgtacaggatggaacatgaaggc-3' (SEQ ID NO: 94).
• the PCR conditions were 2 minutes of incubation at 94°C, followed by 30 cycles of 98°C/10 seconds, 60°C/5 seconds, and 68°C/20 seconds, and clones in which specific bands were amplified by electrophoresis were selected.
• the cells obtained above were transfected with a plasmid controlling the promoter of the helper gene E4orf6, and the effects on Rep gene expression and viral particle production were evaluated.
• the primer sequences used were 5'-gaaggtgctgaggtacgatgag-3' (SEQ ID NO: 11) and 5'-ggtcacatccagcatcacagg-3' (SEQ ID NO: 12), the primer sequences for E4orf6 were 5'-acctgcgcttgtggtatgatg-3' (SEQ ID NO: 95) and 5'-gtgcaaggcgctgtatccaaag-3' (SEQ ID NO: 96), and the primer sequences for Rep78/68/52/40 were 5'-atctccttcaatgcggcctc-3' (SEQ ID NO: 97) and 5'-agacggaagccgcatattgg-3' (SEQ ID NO: 98).
• nCas9 (D10A) and Cas9 were inserted therein using InFusion.
• the nCas9(D10A) fragment was prepared without template using the following primers: primer sequences 5'-ttcaggttggaccggtgccaccatgccgaagaaaaagcgcaaggtcgaagcgtccgacaaga-3' (SEQ ID NO:101), 5'-cccacagagttggtgccgatggccaggccgatgctgtacttcttgtcggacgcttcgacc-3' (SEQ ID NO:102).
• the Cas9 fragment was prepared using the Mammalian CRISPR Vector (Dual gRNA) as a template and the following primers: primer sequences 5'-gccatcggcaccaactctgtggg-3' (SEQ ID NO: 103), 5'-tcgttgctgaagatctcttgcag-3' (SEQ ID NO: 104).
• Plasmid #25 SYNp171-4_TRE-E1A_TRE-E1B_BlastR was treated with restriction enzymes (NotI and NheI) to remove the TRE-E1A-TRE fragment.
• the following four fragments (5' homology region fragment, E1A promoter fragment, nCas9 non-recognized E1A fragment, and TRE fragment) were inserted therein using overlap extension PCR and InFusion.
• the 5' homology region fragment was amplified using the HEK293 genome as a template and the following primers: primer sequence 5'-aggaacatcccccttccctcggatg-3' (SEQ ID NO: 105), primer sequence 5'-aaaggtgaggcggctccggagaa-3' (SEQ ID NO: 106).
• primer sequence 5'-cggcgcgccgcggccgcaggaacatccccttccctcggatg-3' (SEQ ID NO:107)
• primer sequence 5'-cgccacactaggatcaagtcatcaacttgttatcctggttttacag-3' (SEQ ID NO:108).
• the E1A promoter fragment was prepared using the following primers with plasmid #24 SYNp171-3_wt-E1A_TRE-E1B_BlastR as a template: primer sequence 5'-gacttgatcctagtgtggcggaagtgtgatg-3' (SEQ ID NO:109), primer sequence 5'-tcacgccgcgtgacagatgatgtgccgcattttcagtcccggtgtcggag-3' (SEQ ID NO:110).
• the TRE fragment was prepared using the following primers with plasmid #24 SYNp171-3_wt-E1A_TRE-E1B_BlastR as a template: primer sequence 5'-attgcgtgtggttaacgcctttgtttgctgaatgagttgatgtaagttttaataacaactttgtatagaaaagttgggtaccgagc-3' (SEQ ID NO: 113), primer sequence 5'-tcccaagcctccatgctagccaattcgggg-3' (SEQ ID NO: 114).
• E1B fragment was then removed by treatment with restriction enzymes (EcoNI and AgeI).
• EcoNI and AgeI restriction enzymes
• the following two fragments (nCas9-unrecognized E1B fragment and E1B 3'UTR fragment) were inserted therein using overlap extension PCR and InFusion.
• the nCas9-unrecognized E1B fragment was prepared using the following primers with SYNp171-3_wt-E1A_TRE-E1B_BlastR of plasmid #24 as a template: primer sequence 5'-ccttgggtatcctgtctgagggtaactcca-3' (SEQ ID NO: 115), primer sequence 5'-gtcggagctgccaaactcggctctggtacaggccagcaccaagtgatcgggcc-3' (SEQ ID NO: 116).
• the E1B 3'UTR fragment was prepared using the following primers with plasmid #24 SYNp171-3_wt-E1A_TRE-E1B_BlastR as a template: primer sequence 5'-gagtttggcagctccgacgaggacaccgattgaggtactgaaatgtgtgggcg-3' (SEQ ID NO: 117), primer sequence 5'-gccggttggcgcctaccggtggatgtggaatgtgt-3' (SEQ ID NO: 118). Next, it was treated with restriction enzymes (SalI and MluI). The 3' homology region fragment was inserted therein using InFusion.
• the 3' homology region fragment was amplified using the HEK293 genome as a template with the following primers: primer sequence 5'-gataaatatgtggccggggg-3' (SEQ ID NO:119), primer sequence 5'-tgaccactgaagcacagcatcacag-3' (SEQ ID NO:120).
• the amplified fragment was then prepared using the following primers as a template: primer sequence 5'-ccctgtccttgtcgaccaaagatgtcagaacaagactccccc-3' (SEQ ID NO:121), primer sequence 5'-ccttttgctcacgcgttgaccactgaagcacagcatcacag-3' (SEQ ID NO:122).
• the pHelper of SYNp34 of plasmid #5 was treated with restriction enzymes (ApaI and XbaI).
• the E2A fragment, E4orf6 fragment, and VA fragment were inserted therein using InFusion.
• the E2A fragment was prepared using the SYNp34_pHelper of plasmid #5 as a template and the following primers: primer sequence 5'-tcagcagcagccgcgggcccttg-3' (SEQ ID NO: 123), primer sequence 5'-gccgggcgaccgcaccctg-3' (SEQ ID NO: 124).
• the E4orf6 fragment was prepared using plasmid #30, pGETS161-23-006, as a template with the following primers: primer sequence 5'-agggtgcggtcgcccgggcgttttagggcggagtaacttgtatgtgttgg-3' (SEQ ID NO: 125), primer sequence 5'-ggttaactccccagcatgcctgctattctc-3' (SEQ ID NO: 126).
• the VA fragment was prepared using SYNp34_pHelper of plasmid #5 as a template with the following primers: primer sequence 5'-gcaggcatgctggggagttaacccctcctgacgcggtaggaggag-3' (SEQ ID NO:127), primer sequence 5'-tcgttgacgctctagaccgtgcaaaggagagcctg-3' (SEQ ID NO:128). #29 SYNp518_pHelper_Ad5_TRE-E4orf6 The pHelper of SYNp34 of plasmid #5 was treated with restriction enzymes (ApaI and XbaI).
• the E4orf6-polyA-VA fragment was prepared using plasmid #28 SYNp517_pHelper_Ad5_wt-E4orf6 as a template with the following primers: primer sequence 5'-atgactacgtccggcgttccatttgg-3' (SEQ ID NO: 131), primer sequence 5'-tcgttgacgctctagaccgtgcaaaaggagagcctg-3' (SEQ ID NO: 128). #30 pGETS161-23-006 WO 2023/214578 A1 seed Plasmid #14 was used. It was prepared by gene synthesis and the OGAB method.
• VA Ad5
• E2A promoter Ad5
• E2A Ad5
• ⁇ SfiI SV40 PolyA signal
• Vector Builder E4 promoter
• E4orf6 Ad5
• bGH polyA signal Vector Builder
• p40 promoter AAV1
• Cap AAV1
• hGH polyA signal Takara
• p5 promoter AAV2
• Rep2 AAV2
• HSV TK polyA signal Takara
• FIG. 16 shows an example of a plasmid structure incorporating an expression control system of a Cumate-responsive promoter for E1B and E1A.
• FIG. 17 shows an example of a plasmid structure incorporating an expression control system of a mifepristone-responsive promoter for E1B and E1A.
• Figure 18 shows an example of a plasmid structure incorporating the Cre protein expression control system for E1B and E1A. When the switch is activated, the polyA regions of E1B and E1A are removed.
• Figure 19 shows an example of a plasmid structure incorporating the Cre protein expression control system for E1B and E1A. When the switch is activated, the orientation of E1B and E1A is reversed, allowing them to function normally.
• FIG. 16 shows an example of a plasmid structure incorporating an expression control system of a Cumate-responsive promoter for E1B and E1A.
• FIG. 17 shows an example of a plasmid structure incorporating

Landscapes

• Life Sciences & Earth Sciences (AREA)
• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Genetics & Genomics (AREA)
• Organic Chemistry (AREA)
• Engineering & Computer Science (AREA)
• Biophysics (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biochemistry (AREA)
• Zoology (AREA)
• Molecular Biology (AREA)
• Wood Science & Technology (AREA)
• General Health & Medical Sciences (AREA)
• General Engineering & Computer Science (AREA)
• Virology (AREA)
• Biomedical Technology (AREA)
• Biotechnology (AREA)
• Physics & Mathematics (AREA)
• Plant Pathology (AREA)
• Gastroenterology & Hepatology (AREA)
• Microbiology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Medicinal Chemistry (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Priority Applications (2)

Applications Claiming Priority (2)

Publications (1)

Family

ID=91717751

Family Applications (1)

Country Status (3)

Cited By (5)

Citations (6)

• 2023
  • 2023-12-26 WO PCT/JP2023/046813 patent/WO2024143429A1/ja not_active Ceased
  • 2023-12-26 EP EP23912207.0A patent/EP4624584A1/en active Pending
  • 2023-12-26 JP JP2024567897A patent/JPWO2024143429A1/ja active Pending

Patent Citations (6)

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events