WO2024123700A1 - Histone deacetylase inhibitors - Google Patents
Histone deacetylase inhibitors Download PDFInfo
- Publication number
- WO2024123700A1 WO2024123700A1 PCT/US2023/082358 US2023082358W WO2024123700A1 WO 2024123700 A1 WO2024123700 A1 WO 2024123700A1 US 2023082358 W US2023082358 W US 2023082358W WO 2024123700 A1 WO2024123700 A1 WO 2024123700A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- compound
- fold
- alkyl
- pharmaceutically acceptable
- acceptable salt
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
- A61K31/403—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
- A61K31/404—Indoles, e.g. pindolol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C259/00—Compounds containing carboxyl groups, an oxygen atom of a carboxyl group being replaced by a nitrogen atom, this nitrogen atom being further bound to an oxygen atom and not being part of nitro or nitroso groups
- C07C259/04—Compounds containing carboxyl groups, an oxygen atom of a carboxyl group being replaced by a nitrogen atom, this nitrogen atom being further bound to an oxygen atom and not being part of nitro or nitroso groups without replacement of the other oxygen atom of the carboxyl group, e.g. hydroxamic acids
- C07C259/10—Compounds containing carboxyl groups, an oxygen atom of a carboxyl group being replaced by a nitrogen atom, this nitrogen atom being further bound to an oxygen atom and not being part of nitro or nitroso groups without replacement of the other oxygen atom of the carboxyl group, e.g. hydroxamic acids having carbon atoms of hydroxamic groups bound to carbon atoms of six-membered aromatic rings
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
- C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
- C07D209/04—Indoles; Hydrogenated indoles
- C07D209/08—Indoles; Hydrogenated indoles with only hydrogen atoms or radicals containing only hydrogen and carbon atoms, directly attached to carbon atoms of the hetero ring
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
- C07D209/56—Ring systems containing three or more rings
- C07D209/80—[b, c]- or [b, d]-condensed
- C07D209/90—Benzo [c, d] indoles; Hydrogenated benzo [c, d] indoles
- C07D209/92—Naphthostyrils
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D215/00—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems
- C07D215/02—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom
- C07D215/04—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with only hydrogen atoms or radicals containing only hydrogen and carbon atoms, directly attached to the ring carbon atoms
- C07D215/06—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with only hydrogen atoms or radicals containing only hydrogen and carbon atoms, directly attached to the ring carbon atoms having only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, attached to the ring nitrogen atom
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D215/00—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems
- C07D215/02—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom
- C07D215/16—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
- C07D215/38—Nitrogen atoms
- C07D215/40—Nitrogen atoms attached in position 8
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D215/00—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems
- C07D215/02—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom
- C07D215/16—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
- C07D215/48—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D217/00—Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems
- C07D217/02—Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems with only hydrogen atoms or radicals containing only carbon and hydrogen atoms, directly attached to carbon atoms of the nitrogen-containing ring; Alkylene-bis-isoquinolines
- C07D217/04—Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems with only hydrogen atoms or radicals containing only carbon and hydrogen atoms, directly attached to carbon atoms of the nitrogen-containing ring; Alkylene-bis-isoquinolines with hydrocarbon or substituted hydrocarbon radicals attached to the ring nitrogen atom
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D223/00—Heterocyclic compounds containing seven-membered rings having one nitrogen atom as the only ring hetero atom
- C07D223/14—Heterocyclic compounds containing seven-membered rings having one nitrogen atom as the only ring hetero atom condensed with carbocyclic rings or ring systems
- C07D223/16—Benzazepines; Hydrogenated benzazepines
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D225/00—Heterocyclic compounds containing rings of more than seven members having one nitrogen atom as the only ring hetero atom
- C07D225/04—Heterocyclic compounds containing rings of more than seven members having one nitrogen atom as the only ring hetero atom condensed with carbocyclic rings or ring systems
- C07D225/06—Heterocyclic compounds containing rings of more than seven members having one nitrogen atom as the only ring hetero atom condensed with carbocyclic rings or ring systems condensed with one six-membered ring
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D235/00—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, condensed with other rings
- C07D235/02—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, condensed with other rings condensed with carbocyclic rings or ring systems
- C07D235/04—Benzimidazoles; Hydrogenated benzimidazoles
- C07D235/06—Benzimidazoles; Hydrogenated benzimidazoles with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached in position 2
- C07D235/08—Radicals containing only hydrogen and carbon atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D239/00—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings
- C07D239/70—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings condensed with carbocyclic rings or ring systems
- C07D239/72—Quinazolines; Hydrogenated quinazolines
- C07D239/95—Quinazolines; Hydrogenated quinazolines with hetero atoms directly attached in positions 2 and 4
- C07D239/96—Two oxygen atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
- C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
- C07D471/04—Ortho-condensed systems
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C2601/00—Systems containing only non-condensed rings
- C07C2601/02—Systems containing only non-condensed rings with a three-membered ring
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C2603/00—Systems containing at least three condensed rings
- C07C2603/56—Ring systems containing bridged rings
- C07C2603/58—Ring systems containing bridged rings containing three rings
- C07C2603/70—Ring systems containing bridged rings containing three rings containing only six-membered rings
- C07C2603/74—Adamantanes
Definitions
- HISTONE DEACETYLASE INHIBITORS CLAIM OF PRIORITY This application claims the benefit of U.S. Patent Application Serial No. 63/385,999, filed on December 5, 2022. The entire contents of the foregoing is hereby incorporated by reference.
- TECHNICAL FIELD This disclosure relates to the fields of chemistry, biology, and medicine, and more specifically to certain compounds that are inhibitors of histone deacetylases (HDACs), as well as compositions thereof and methods of using such compounds to treat diseases, such as those described herein.
- HDACs histone deacetylases
- Histone deacetylases are a class of amide hydrolases that catalyze a variety of substrates, including histones and other proteins. Eleven zinc-dependent HDACs have been found in mammals, including class I (HDAC1, HDAC2, HDAC3, HDAC8), class IIa (HDAC4, HDAC5, HDAC7, HDAC9), class IIb (HDAC6, HDAC10), and class IV (HDAC11). Each of these isoforms has distinct functions in epigenetic regulation. Among them, HDAC11 is the most recently identified member of the class IV HDAC. HDAC11 has higher expression levels in the brain than other HDACs and it has been implicated in various neurologic diseases including neurodegenerative disorders and neuropathic pain.
- Some embodiments provide a pharmaceutical composition comprising a compound of Formula (I), or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable excipients. Some embodiments provide a method of treating an HDAC-associated disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- FIG. 1 shows the discovery of PB94 via structure-activity (SAR) investigation of 4a and lead optimization to identify lead compound PB94.
- FIG. 2A and FIG. 2B show the HDAC selectivity profile of 4a and PB94, respectively, and demonstrate that the selectivity for HDAC6 and HDAC11 are transposed. Dose-response curves for HDAC1-11 are included for reference.
- FIG. 3A shows molecular docking results of 4a and FIG. 3B shows molecular docking results of PB94; docking studies used zHDAC6 crystal complex (PDB entry 6THV).
- FIG. 4A shows PB94 docked into the homology model of HDAC11 (cartoon representation), which was constructed based on human HDAC2 (PDB: 7KBH) crystal structure using the Modeler 9.14.
- FIG. 4B shows detailed binding interactions between PB94 and HDAC11.
- FIG.5A shows in vitro BioMAP phenotypic activity profile of PB94 at 0.37 ⁇ M and 1.1 ⁇ M, and 3.3 ⁇ M in the Diversity PLUS Panel.
- the X-axis lists the quantitative protein- based biomarker readouts measured in each system.
- the grey region around the Y-axis represents the 95% significance envelope generated from historical vehicle controls.
- Biomarker activities are annotated when two or more consecutive concentrations change in the same direction relative to vehicle controls, are outside of the significance envelope, and have at least one concentration with an effect size > 20% (
- Antiproliferative effects are indicated by a thick grey arrow.
- FIG. 5B shows reference benchmark overlay of PB94 (3.3 ⁇ M) and vorinostat (3.3 ⁇ M).
- FIG. 5C shows top database search result for PB94 (3.3 ⁇ M) is parthenolide (1.2 ⁇ M).
- FIG. 5D shows PB94 is antiproliferative to human primary endothelial cells (3.3 ⁇ M), T cells (3.3 ⁇ M), B cells (3.3 ⁇ M), and coronary artery smooth muscle cells (3.3 ⁇ M) (grey arrows).
- FIG. 6 shows mechanism HeatMAP analysis for PB94. HeatMAP analysis of the 148 biomarker readouts (rows) within the Diversity PLUS Panel by PB94 in comparison to 19 consensus mechanism class profiles (columns).
- FIG. 7 shows mechanism of action by which PB94 affects neuroinflammatory events was characterized by a focus on IL-10 using mouse microglia BV2 cells.
- FIG. 9A and FIG. 9B show the time-activity curves of [ 11 C]PB94 in mice brain regions of interest, including cortex, cerebellum, brain stem, thalamus, hypothalamus, striatum, hippocampus, and amygdala.
- FIG.10 shows the biodistribution of [ 11 C]PB94 in peripheral organs in mice at five different time points (1, 5, 15, 30, and 60 min).
- FIG. 11B shows mechanical paw withdrawal thresholds significantly decreased in the surgery paw compared with the contralateral paw in CCI mice.
- FIG.13C shows mouse body weight change during the treatment.
- FIG. 14A shows representative Western blot images indicating PB94 increases endogenous fatty acylation levels of SHMT2 in HEK293T cells at the concentration of 20 ⁇ M.
- FIG.14B shows PB94 (20 ⁇ M) and reference compound TD034 (5 ⁇ M) significantly increase endogenous fatty acylation levels of SHMT2 in HEK293T cells.
- Signal intensity was quantified by ImageJ, and the signal of the control group (DMSO) without inhibitor treatment was set as 1.0. *p value ⁇ 0.1; **p value ⁇ 0.05; ***p value ⁇ 0.01.
- FIG. 15 shows representative Iba1 staining of Sham, PB94 + CCI, vehicle + CCI. Images were taken at 4 ⁇ (scale bar represents 500 ⁇ m); Iba1 + cells in the boxed regions of S1HL and VPL were analyzed. (Scale bar represents 50 ⁇ m).
- FIG.17 shows the design and discovery of selective HDAC6 inhibitor PB131.
- FIG.18A shows the chemical structure of PB131 and its inhibitory activities against HDAC1–11.
- FIG. 18B shows the interactions between PB131 and HDAC6 (PDB code: 6THV). Zn 2+ is shown as a gray sphere, and hydrogen bonds as dotted lines; key amino acid residues that create the specific pocket in HDAC6 are represented as a stick and labeled as shown.
- FIG.18C shows the surface poses of PB131 in the HDAC6 hydrophobic cavity.
- FIG. 19A and 19B show the radiosynthesis of [ 18 F]8b and [ 18 F]PB131.
- Molar activity 108 GBq/ ⁇ mol (EOB).
- FIG. 20A shows representative baseline PET/CT image and FIG. 20B shows blocking (pretreated with 3.0 mg/kg 8b) mice brain PET/CT images (summed from 0 to 60 min) after [ 18 F]8b injection via tail vein.
- FIG. 20C shows time–activity curves of [ 18 F]8b in the mice whole brain.
- FIG. 21A shows representative baseline mice brain PET/CT image
- FIG. 21C shows mice brain PET/CT image after blocking (pretreated with 3.0 mg/kg Tubastatin A and PB131, respectively, (summed from 0 to 60 min) after [ 18 F]PB131 injection via tail vein.
- FIG. 21 D shows time–activity curves of [ 18 F]PB131 in the mice whole brain.
- FIG.22A shows the biodistribution of [ 18 F]PB131 in mice whole body at different time points post-injection.
- FIG.23 shows the anti-inflammatory activity study of PB131.
- FIG. 24 shows the anti-inflammatory activity study of PB131 (normalized protein level) The bars above each cytokine correspond to concentration in the same order from left to right as shown for IL-12P-70.
- FIG.25 shows future chemical optimization and iterative lead optimization process.
- FIG.26 shows representative HDAC-11 enzymatic assay results.
- FIG. 27 shows no significant binding of CNS targets (PDSP) and metalloenzymes (MMP enzymes), Cerep/Eurofins at 10 ⁇ m PB94.
- FIG. 28B shows body weights after dosing with PB94 or vehicle (CON).
- FIG. 30A shows optical imaging using amyloid beta plaque probe ADLumin-1 indicate treatment of 5XFAD model mice with HDAC11 inhibitor PB94 could reduce amyloid beta plaques in the brain.
- FIG.30B shows analysis of 3D6-stained plaque burden in hemispheres of animals and analysis of plasma immune proteins led to the identification of CXCL1 as key protein as a function of PB94.
- FIG.31 shows in vitro intracerebral hemorrhage (ICH) study with treated mice.
- ICH in vitro intracerebral hemorrhage
- FIG.32A shows neuroinflammation reduction by PB94 through PET imaging using 11 CPBR28 to measure TSPO level in mice brain.
- FIG. 32B shows standardized uptake value (SUV) for the two study arms. Bars of each arm in the brain regions are the same from left to right as indicated in the thalmus.
- FIG. 33 shows PB94-associated improved cognitive function by behavior tests in 5XFAD mice.
- FIG. 34 shows PB94 treatment can reduce tau in the brain as evidenced by optical imaging using tau tangles probe ADLumin-1.
- FIG. 35 shows PB94-associated improved cognitive function by behavior tests in P301S mice.
- FIG 36 shows HDACi reduces the ratios of the phosphorylated tau compared to total tau proteins in P301S mice.
- FIG.38 shows an AAV1/2 expression system was used to drive the overexpression of mutant A53T human a-synuclein (aSyn) in the SNpc of rats, which results in ⁇ 60% loss of ipsilateral dopaminergic neurons after 21 days. Injection of empty AAV1/2 into contralateral SNpc provides a vector-matched, within-animal control.
- Characteristics of this model include ipsilateral loss of dopamine cells identified with tyrosine hydroxylase staining as shown in FIG. 38A, robust ipsilateral phosphorylation of aSyn at serine 129, a pathological feature of PD-associated A53T toxicity as shown in FIG. 38B, and the formation of proteinase K-resistant aggregates of aSyn as shown in FIG.38C.
- FIG. 40 shows dopamine transporter concentration was measured b C11-Altopane PET imaging before and after PB94 treatment.
- the right striatum showed more severe dopamine loss at baseline.
- FIG. 41 shows The HPLC chromatogram of [ 11 C]PB94 and unlabeled PB94.
- the subtle difference in retention times between [ 11 C]PB94 and unlabeled PB94 is due to the different dictators.
- the chemical structures and formulae set forth herein are constructed according to the standard rules of chemical valency known in the chemical arts.
- Compounds described herein can comprise one or more asymmetric centers or double bonds, and thus can exist in various isomeric forms, e.g., enantiomers, diastereomers, racemates, geometric isomers, stereoisomeric forms that may be defined, in terms of absolute stereochemistry, as (R)- or (S)-.
- the compounds described herein can be in the form of an individual enantiomer, diastereomer or geometric isomer, or can be in the form of a mixture of stereoisomers, including racemic mixtures and mixtures enriched in one or more stereoisomer.
- Isomers can be isolated from mixtures by methods known to those skilled in the art, including chiral high pressure liquid chromatography (HPLC) and the formation and crystallization of chiral salts; or preferred isomers can be prepared by asymmetric syntheses. See, for example, Jacques et al., Enantiomers, Racemates and Resolutions (Wiley Interscience, New York, 1981); Wilen et al., Tetrahedron 33:2725 (1977); Eliel, Stereochemistry of Carbon Compounds (McGraw– Hill, NY, 1962); and Wilen, Tables of Resolving Agents and Optical Resolutions p. 268 (E.L. Eliel, Ed., Univ. of Notre Dame Press, Notre Dame, IN 1972).
- the present disclosure includes compounds in racemic and optically pure forms.
- the compounds described herein contain olefinic bonds or other centers of geometric asymmetry, and unless specified otherwise, it is intended that the compounds include both E and Z geometric isomers.
- the disclosure additionally encompasses compounds described herein as individual isomers substantially free of other isomers, and alternatively, as mixtures of various isomers. When a range of values is listed, it is intended to encompass each value and sub– range within the range.
- C1-C6 alkyl is intended to encompass, C1, C2, C3, C4, C5, C6, C1-C6, C1-C5, C1-C4, C1-C3, C1-C2, C2-C6, C2-C5, C2-C4, C2-C3, C3-C6, C3-C5, C3-C4, C4-C6, C4-C5, and C5-C6 alkyl.
- alkyl refers to a radical of a straight-chain or branched saturated hydrocarbon. In some embodiments, an alkyl group has, for example, 1 to 6 carbon atoms (“C1-C6 alkyl”).
- C1-C6 alkyl groups include methyl (C1), ethyl (C2), n–propyl (C3), isopropyl (C3), n–butyl (C4), tert–butyl (C4), sec–butyl (C4), iso–butyl (C4), n–pentyl (C5), 3–pentanyl (C5), amyl (C5), neopentyl (C5), 3–methyl–2–butanyl (C5), tertiary amyl (C5), and n–hexyl (C6).
- alkyl abbreviations include Me (–CH 3 ), Et (–CH 2 CH 3 ), iPr (–CH(CH 3 ) 2 ), nPr (–CH 2 CH 2 CH 3 ), nBu (—CH 2 CH 2 CH 2 CH 3 ), or i–Bu (– CH 2 CH(CH 3 ) 2 ).
- Alkenyl refers to a radical of a straight-chain or branched hydrocarbon containing at least one double bond. In some embodiments, an alkenyl group has, for example, 1 to 6 carbon atoms (“C1-C6 alkenyl”). Examples of C1-C6 alkenyl groups include vinyl, allyl, and 2-methylprop-1-en-1-yl.
- Halo or “halogen,” independently or as part of another substituent, means a fluorine (F), chlorine (Cl), bromine (Br), or iodine (I) atom.
- halide by itself or as part of another substituent, refers to a fluoride, chloride, bromide, or iodide atom.
- the halo group is fluorine.
- the halo group is chloride.
- the halo group is bromide.
- Haloalkyl refers to an alkyl group as described herein (e.g., a C1-C6 alkyl group) in which one or more of the hydrogen atoms are replaced by a halogen (e.g., mono- haloalkyl, di-haloalkyl and tri-haloalkyl).
- halogen e.g., mono- haloalkyl, di-haloalkyl and tri-haloalkyl.
- Such groups include but are not limited to, chloromethyl, fluoromethyl, difluoromethyl, trifluoromethyl, chloro-fluoroalkyl, chloro- difluoroalkyl, and 2-fluoroisobutyl.
- Alkoxy refers to an alkyl group as described herein (e.g., a C1-C6 alkyl group), which is attached to a molecule via oxygen atom. This includes moieties where the alkyl part may be linear or branched, such as methoxy, ethoxy, n-propoxy, iso- propoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy and n-hexoxy.
- Haloalkoxy refers to an alkoxy group as described herein (e.g., a C1-C6 alkoxy group), in which one or more of the hydrogen atoms are replaced by a halogen (e.g., mono- haloalkoxy, di-haloalkoxy and tri-haloalkoxy).
- halogen e.g., mono- haloalkoxy, di-haloalkoxy and tri-haloalkoxy.
- Such groups include but are not limited to, chloromethoxy, fluoromethoxy, difluoromethoxy, trifluoromethoxy, chloro-fluoroalkoxy, chloro-difluoroalkoxy, and 2-fluoroisobutoxy.
- an aryl group has ten ring carbon atoms (“C10 aryl”; e.g., naphthyl such as 1–naphthyl and 2–naphthyl). In some embodiments, an aryl group has fourteen ring carbon atoms (“C14 aryl”; e.g., anthracyl). An aryl group may be described as, e.g., a C6-C10 aryl.
- Aryl groups include, but are not limited to, phenyl, naphthyl, indenyl, and tetrahydronaphthyl.
- arylene refers to a divalent aryl linking group having 6 to 14 ring carbon atoms.
- arylene group include phenylene and naphthylene.
- Heteroaryl refers to a radical of a 5–14 membered monocyclic, bicyclic or tricyclic 4n+2 aromatic ring system (e.g., having 6, 10 or 14 ⁇ electrons shared in a cyclic array) having ring carbon atoms and 1–4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen and sulfur (“6–10 membered heteroaryl”).
- Heteroaryl bicyclic ring systems can include one or more heteroatoms in one, two or three rings. “Heteroaryl” also includes ring systems wherein the heteroaryl ring, as defined above, is fused with one or more aryl groups wherein the point of attachment is either on the aryl or heteroaryl ring, and in such instances, the number of ring members designates the number of ring members in the fused (aryl/heteroaryl) ring system.
- Bicyclic or tricylic heteroaryl groups wherein one ring does not contain a heteroatom e.g., indolyl, quinolinyl, carbazolyl, and the like
- the point of attachment can be on either ring, i.e., either the ring bearing a heteroatom (e.g., 2–indolyl) or the ring that does not contain a heteroatom (e.g., 5–indolyl).
- a heteroaryl group may be described as, e.g., a 6-10-membered heteroaryl, wherein the term “membered” refers to the non-hydrogen ring atoms within the moiety.
- heteroarylene refers to a divalent heteroaryl linking group having 5 to 14 ring atoms.
- heteroarylene group include indolylene, pyridinylene, and quinolinylene.
- a heteroaryl group is a 6–10 membered aromatic ring system having ring carbon atoms and 1–4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“6– 10 membered heteroaryl”).
- a heteroaryl group is a 5–8 membered aromatic ring system having ring carbon atoms and 1–4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5–8 membered heteroaryl”).
- a heteroaryl group is a 5–6 membered aromatic ring system having ring carbon atoms and 1–4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5–6 membered heteroaryl”).
- the 5–6 membered heteroaryl has 1–3 ring heteroatoms selected from nitrogen, oxygen, and sulfur.
- the 5–6 membered heteroaryl has 1–2 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5– 6 membered heteroaryl has 1 ring heteroatom selected from nitrogen, oxygen, and sulfur. In certain embodiments, the heteroaryl group is unsubstituted 5–14 membered heteroaryl. In certain embodiments, the heteroaryl group is substituted 5–14 membered heteroaryl. Exemplary 5–membered heteroaryl groups containing one heteroatom include, without limitation, pyrrolyl, furanyl and thiophenyl.
- Exemplary 5–membered heteroaryl groups containing two heteroatoms include, without limitation, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl.
- Exemplary 5–membered heteroaryl groups containing three heteroatoms include, without limitation, triazolyl, oxadiazolyl, and thiadiazolyl.
- Exemplary 5–membered heteroaryl groups containing four heteroatoms include, without limitation, tetrazolyl.
- Exemplary 6–membered heteroaryl groups containing one heteroatom include, without limitation, pyridinyl.
- Exemplary 6–membered heteroaryl groups containing two heteroatoms include, without limitation, pyridazinyl, pyrimidinyl, and pyrazinyl.
- Exemplary 6–membered heteroaryl groups containing three or four heteroatoms include, without limitation, triazinyl and tetrazinyl, respectively.
- Exemplary 7–membered heteroaryl groups containing one heteroatom include, without limitation, azepinyl, oxepinyl, and thiepinyl.
- Exemplary 5,6–bicyclic heteroaryl groups include, without limitation, indolyl, isoindolyl, indazolyl, benzotriazolyl, benzothiophenyl, isobenzothiophenyl, benzofuranyl, benzoisofuranyl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzoxadiazolyl, benzthiazolyl, benzisothiazolyl, benzthiadiazolyl, indolizinyl, and purinyl.
- Exemplary 6,6–bicyclic heteroaryl groups include, without limitation, naphthyridinyl, pteridinyl, quinolinyl, isoquinolinyl, cinnolinyl, quinoxalinyl, phthalazinyl, and quinazolinyl.
- Cycloalkyl refers to a radical of a saturated or partially unsaturated cyclic hydrocarbon group having from 3 to 10 ring carbon atoms (“C3-C10 cycloalkyl”) and zero heteroatoms in the non–aromatic ring system.
- a cycloalkyl group has, for example, 3 to 6 ring carbon atoms (“C3-C6 cycloalkyl”).
- Exemplary C3-C6 cycloalkyl groups include, without limitation, cyclopropyl (C3), cyclopropenyl (C3), cyclobutyl (C4), cyclobutenyl (C4), cyclopentyl (C5), cyclopentenyl (C5), cyclohexyl (C6), cyclohexenyl (C6), cyclohexadienyl (C6), and the like.
- Cycloalkyl also includes ring systems wherein the cycloalkyl ring, as defined above, is fused with one or more aryl groups wherein the point of attachment is on the cycloalkyl ring, and in such instances, the number of carbons continue to designate the number of carbons in the cycloalkyl ring system. “Cycloalkyl” also includes bridged ring systems, e.g, bicyclo[1.1.1]pentanyl, bicyclo[3.2.1]octanyl, adamantanyl, and the like.
- cycloalkylene refers to a divalent cycloalkyl linking group having 3 to 10 ring carbon carbons.
- cycloalkylene groups include cyclopropylene and cyclohexylene.
- Heterocyclyl refers to a radical of a 4-12 membered saturated or partially unsaturated ring system having ring carbon atoms and 1 to 4 ring heteroatomic groups, wherein each heteroatomic group is independently selected from nitrogen, oxygen, sulfur and oxidized forms of sulfur (for example, S, S(O) and S(O) 2 ), boron, phosphorus, and silicon (“3–12 membered heterocyclyl”).
- heterocyclyl groups that contain one or more nitrogen atoms, the point of attachment can be a carbon, nitrogen, phosphorus, or silicon atom, as valency permits.
- a heterocyclyl group can either be monocyclic (“monocyclic heterocyclyl”) or a fused, bridged, or spiro ring system such as a bicyclic system (“bicyclic heterocyclyl”).
- Heterocyclyl bicyclic ring systems can include one or more heteroatoms in one or both rings.
- Heterocyclyl also includes ring systems wherein the heterocyclyl ring, as defined above, is fused with one or more cycloalkyl groups wherein the point of attachment is either on the cycloalkyl or heterocyclyl ring, or ring systems wherein the heterocyclyl ring, as defined above, is fused with one or more aryl or heteroaryl groups, wherein the point of attachment is on the heterocyclyl ring, and in such instances, the number of ring members continue to designate the number of ring members in the heterocyclyl ring system.
- a heterocyclyl group may be described as, e.g., a 4-7-membered heterocyclyl, wherein the term “membered” refers to the non-hydrogen ring atoms, i.e., carbon, nitrogen, oxygen, and sulfur and oxidized forms of sulfur (for example, S, S(O) and S(O) 2 ), within the moiety.
- the term “heterocyclylene”, employed alone or in combination with other terms refers to a divalent heterocyclyl linking group having 4 to 12 ring atoms. Examples of heterocyclylene groups include piperazinylene, tetrahydrofuranylene, and pyrrolidinylene.
- Exemplary 4–membered heterocyclyl groups containing one heteroatom include, without limitation, azetidinyl, oxetanyl and thietanyl.
- Exemplary 5–membered heterocyclyl groups containing one heteroatom include, without limitation, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothiophenyl, dihydrothiophenyl, pyrrolidinyl, dihydropyrrolyl and pyrrolyl–2,5–dione.
- Exemplary 5–membered heterocyclyl groups containing two heteroatoms include, without limitation, dioxolanyl, oxasulfuranyl, disulfuranyl, and oxazolidin–2–one.
- Exemplary 5–membered heterocyclyl groups containing three heteroatoms include, without limitation, triazolinyl, oxadiazolinyl, and thiadiazolinyl.
- Exemplary 6–membered heterocyclyl groups containing one heteroatom include, without limitation, piperidinyl, tetrahydropyranyl, dihydropyridinyl, and thianyl.
- Exemplary 6–membered heterocyclyl groups containing two heteroatoms include, without limitation, piperazinyl, morpholinyl, dithianyl, dioxanyl. Exemplary 6–membered heterocyclyl groups containing two heteroatoms include, without limitation, triazinanyl. Exemplary 7–membered heterocyclyl groups containing one heteroatom include, without limitation, azepanyl, oxepanyl and thiepanyl. Exemplary 8–membered heterocyclyl groups containing one heteroatom include, without limitation, azocanyl, oxecanyl and thiocanyl.
- Exemplary 5–membered heterocyclyl groups fused to a C6 aryl ring include, without limitation, indolinyl, isoindolinyl, dihydrobenzofuranyl, dihydrobenzothienyl, benzoxazolinonyl, and the like.
- Exemplary 6– membered heterocyclyl groups fused to an aryl ring include, without limitation, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and the like.
- “Hydroxy” or “hydroxyl” refers to the radical -OH. Whenever a group is described as being “optionally substituted”, that group may be unsubstituted or substituted with one or more of the indicated substituents. Likewise, when a group is described as being “substituted” the substituent(s) may be selected from one or more the indicated substituents. If no substituents are indicated, it is meant that the indicated “optionally substituted” or “substituted” group may be substituted with one or more individually and independently selected group(s) that are stable and chemically acceptable for the group being substituted.
- Non-limiting examples of optional substituents are halogen, cyano, hydroxyl, nitro, sulfhydryl, amino, acyl, alkyl, hydroxyalkyl, aminoalkyl, haloalkyl, alkenyl, alkynyl, alkoxy, alkenoxy, alkynoxy, haloalkoxy, haloalkenoxy, haloalkynoxy, cycloalkyl, halocycloalkyl, cycloalkoxy, aryl, aryloxy, arylalkoxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclyloxy, aralkyl, cycloalkylalkyl, cycloalkylalkoxy, heteroaralkyl, alkoxyalkyl, heterocyclylalkyl, O- carbamyl, N-carbamyl, alkoxycarbonyl, C-amido, N-amido, alkyl phosphine
- one or more of the nitrogen atoms of a disclosed compound if present are oxidized to the corresponding N-oxide.
- pharmaceutically acceptable salts is meant to include salts that are prepared with relatively nontoxic acids or bases, depending on the particular substituents found on the compounds described herein.
- pharmaceutically acceptable salts are obtained by reacting a compound having acidic group described herein with a base to form a salt such as an ammonium salt, an alkali metal salt, such as a sodium or a potassium salt, an alkaline earth metal salt, such as a calcium or a magnesium salt, a salt of organic bases such as dicyclohexylamine, N-methyl-D-glucamine, tris(hydroxymethyl)methylamine, and salts with amino acids such as arginine, lysine, and the like, or by other methods previously determined.
- a salt such as an ammonium salt, an alkali metal salt, such as a sodium or a potassium salt, an alkaline earth metal salt, such as a calcium or a magnesium salt, a salt of organic bases such as dicyclohexylamine, N-methyl-D-glucamine, tris(hydroxymethyl)methylamine, and salts with amino acids such as arginine, lysine, and the like, or by other methods previously determined.
- Examples of a salt that the compounds described herein form with a base include the following: salts thereof with inorganic bases such as sodium, potassium, magnesium, calcium, and aluminum; salts thereof with organic bases such as methylamine, ethylamine and ethanolamine; salts thereof with basic amino acids such as lysine and ornithine; and ammonium salt.
- pharmaceutically acceptable excipients refers to a carrier or an adjuvant that may be administered to a patient, together with a compound of the present disclosure, or a pharmaceutically acceptable salt, solvate, salt of the solvate or prodrug thereof, and which does not destroy the pharmacological activity thereof and is nontoxic when administered in doses sufficient to deliver a therapeutic amount of the compound.
- tautomer refers to compounds whose structures differ markedly in arrangement of atoms, but which exist in easy and rapid equilibrium, and it is to be understood that compounds provided herein may be depicted as different tautomers, and when compounds have tautomeric forms, all tautomeric forms are intended to be within the scope of the invention, and the naming of the compounds does not exclude any tautomer.
- An example of a tautomeric forms includes the following example: It will be apparent to one skilled in the art that certain compounds of this disclosure may exist in tautomeric forms, all such tautomeric forms of the compounds being within the scope of the disclosure.
- Compounds provided herein may also contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute such compounds. That is, an atom, in particular when mentioned in relation to a compound according to Formula (I), comprises all isotopes and isotopic mixtures of that atom, either naturally occurring or synthetically produced, either with natural abundance or in an isotopically enriched form.
- the compounds provided herein therefore also comprise compounds with one or more isotopes of one or more atoms, and mixtures thereof, including radioactive compounds, wherein one or more non-radioactive atoms has been replaced by one of its radioactive enriched isotopes.
- Radiolabeled compounds are useful as additional agents, e.g., therapeutic agents, research reagents, e.g., assay reagents, and diagnostic agents, e.g., in vivo imaging agents. All isotopic variations of the compounds provided herein, whether radioactive or not, are intended to be encompassed within the scope of the present invention.
- the compounds described herein (and pharmaceutically acceptable salts thereof) are isotopically labeled. In some embodiments, the compounds described herein (and pharmaceutically acceptable salts thereof) are isotopically labeled for PET imaging. In some embodiments, the compounds described herein (and pharmaceutically acceptable salts thereof) are isotopically labeled with 11 C. “Treating” or “treatment” refers to reducing the symptoms or arresting or inhibiting further development of the disease (in whole or in part). “Treating” or “treatment” includes any effect, e.g., lessening, reducing, modulating, or eliminating, that results in the improvement of the disease and the like.
- HDAC histone deacetylase
- An “effective amount” is an amount sufficient to accomplish a stated purpose (e.g. achieve the effect for which it is administered, treat a disease, reduce protein activity, reduce or increase protein levels, or reduce one or more symptoms of a disease).
- an “effective amount” is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which could also be referred to as a “therapeutically effective amount.”
- the term “inhibition”, “inhibit”, “inhibiting” and the like in reference to a protein-inhibitor (e.g., antagonist) interaction means negatively affecting (e.g., decreasing) the activity or function of the protein relative to the activity or function of the protein in the absence of the inhibitor.
- inhibition refers to reduction in the progression of a disease and/or symptoms of disease.
- inhibition refers to a reduction in the activity of a signal transduction pathway or signaling pathway.
- inhibition includes, at least in part, partially or totally blocking stimulation, decreasing, preventing, or delaying activation, or inactivating, desensitizing, or down-regulating signal transduction or enzymatic activity or the amount of a protein.
- inhibition refers to a decrease in the activity of HDAC- 11 or HDAC-6.
- a “subject,” as used herein, refers to a living organism suffering from or prone to a disease that can be treated by administration of a compound or pharmaceutical composition, as provided herein. Non-limiting examples include mammals such as humans. In some embodiments, a subject is human. In some embodiments, the subject is a pediatric subject (e.g., a subject 21 years of age or less).
- HDAC histone deacetylase
- HDAC-11 histone deacetylase
- HDAC-associated disease refers to diseases associated with epigenetic regulation of histone and other protein substrates.
- Non-limiting examples of HDAC-associated diseases include cancer, neurological diseases, metabolic/endocrine disorders, inflammatory diseases, immunological disorders, cardiovascular diseases, and pulmonary diseases.
- HDAC-11 diseases associated with HDAC-11 specifically include Hodgkin lymphoma, neuroblastoma, various other cancers (hepatocellular, prostate, ovarian, pituitary, pancreatic, and myeloma), hepatic steatosis (fatty liver disease), insulin resistance, hypercholesterolemia, multiple sclerosis, schizophrenia, frontotemporal dementia (FTD), age-related macular degeneration, and fragile X tremor ataxia syndrome (FXTAS).
- FDD frontotemporal dementia
- FXTAS fragile X tremor ataxia syndrome
- HDAC11 could have potential roles in memory and learning and recovery from traumatic brain injuries. Modulation of HDAC-11 levels after drug and alcohol intake also implicate use in drug addiction disorders.
- Q is a bond or -NH-
- R 1 is -OH, -C1-C4 haloalkyl, and -NH(C1-C4 alkyl)
- R 2 is halogen, -OH, C1-C6 alkyl, and C1-C6 alkoxy
- R 3 is hydrogen, C1-C6 alkenyl, and C1-C6 alkyl optionally substituted with C3- C6 cycloalkyl
- R 4 is C1-C4 alkyl, phenyl, 9-15 membered heteroaryl, 9-15 membered heterocycl
- R 1 is -NH(C1-C4 alkyl).
- R 2 is halogen.
- R 2 is -OH.
- R 2 is C1-C6 alkyl.
- R 2 is C1-C6 alkoxy.
- R 3 is hydrogen.
- R 3 is C1-C6 alkenyl.
- R 3 is C1-C6 alkyl optionally substituted with C3-C6 cycloalkyl.
- R 4 is C1-C4 alkyl optionally substituted with 1-2 R 4a .
- R 4 is phenyl optionally substituted with 1-2 R 4a .
- R 4 is 9-15 membered heteroaryl optionally substituted with 1-2 R 4a . In some embodiments, R 4 is 9-15 membered heterocyclyl optionally substituted with 1-2 R 4a . In some embodiments, R 3 and R 4 taken together with the nitrogen to which each is bound join to form a 9-13 membered heterocyclyl or 9-10 membered heteroaryl, each optionally substituted with R 5 . In some embodiments, R 3 and R 4 taken together with the nitrogen to which each is bound join to form a 9-13 membered heterocyclyl optionally substituted with R 5 .
- R 3 and R 4 taken together with the nitrogen to which each is bound join to form an unsubstituted 9-13 membered heterocyclyl. In some embodiments, R 3 and R 4 taken together with the nitrogen to which each is bound join to form a 9-10 membered heteroaryl optionally substituted with R 5 . In some embodiments, the 9-10 membered heteroaryl is selected from indolyl, azaindolyl, quinazolinedionyl, and benzimidazoly.
- the 9-10 membered heteroaryl is selected from the group consisting of indolyl, pyrrolo[2,3-b]pyridinyl, benzo[d]imidazolyl, and quinazoline-2,4- dione.
- the 9-10 membered heteroaryl is indolyl substituted with R 5 .
- the 9-10 membered heteroaryl is pyrrolo[2,3-b]pyridinyl substituted with R 5 .
- the 9-10 membered heteroaryl is benzo[d]imidazolyl substituted with R 5 .
- the 9-10 membered heteroaryl is quinazoline-2,4-dione substituted with R 5 .
- at least one R 4a is halogen.
- at least one R 4a is C1-C6 alkyl.
- at least one R 4a is C1-C6 alkoxy.
- at least one R 4a is C6-C10 cycloalkyl.
- at least one R 4a is oxo.
- one of R 5c and R 5d is hydrogen and the other one of R 5c and R 5d is C1-C6 alkyl substituted with oxo and/or C6-C10 cycloalkyl. In some embodiments, one of R 5c and R 5d is hydrogen and the other one of R 5c and R 5d is C1-C6 alkenyl substituted with oxo and/or C6-C10 cycloalkyl. In some embodiments, one of R 5e and R 5f is hydrogen and the other one of R 5e and R 5f is C1-C6 alkyl substituted with oxo and/or C6-C10 cycloalkyl.
- one of R 5a , R 5b , R 5c , R 5d , R 5e and R 5f is C1-C6 alkyl substituted with oxo and/or adamantly. In some embodiments, one of R 5a , R 5b , R 5c , R 5d , R 5e and R 5f is C1-C6 alkenyl substituted with oxo and/or adamantly. In some embodiments, n is 0. In some embodiments, n is 1. In some embodiments, Formula (I) is (I-a): or a pharmaceutically acceptable salt thereof.
- Formula (I) is (I-b): or a pharmaceutically acceptable salt thereof, wherein ring A is 9-13 membered heterocyclyl optionally substituted with R 5 .
- Formula (I) is (I-c): or a pharmaceutically acceptable salt thereof.
- Formula (I) is (I-d): or a pharmaceutically acceptable salt thereof.
- Formula (I) is (I-e): or a pharmaceutically acceptable salt thereof, wherein ring B is 9-10 membered heteroaryl optionally substituted with R 5 .
- Formula (I) is (I-f): or a pharmaceutically acceptable salt thereof, wherein X is CH or N.
- Formula (I) is (I-g): or a pharmaceutically acceptable salt thereof.
- Formula (I) is (I-h): or a pharmaceutically acceptable salt thereof.
- the compound of Formula (I), or a pharmaceutically acceptable salt thereof is selected from the compounds in Table 1A, or a pharmaceutically acceptable salt thereof.
- the compound of Formula (I), or a pharmaceutically acceptable salt thereof is selected from the compounds in Table 1B, or a pharmaceutically acceptable salt thereof.
- the compound of Formula (I), or a pharmaceutically acceptable salt thereof is selected from the compounds in Table 1A, or a pharmaceutically acceptable salt thereof, wherein the compound is isotopically labeled. In some embodiments, the compound is isotopically labeled with 11 C.
- the compound of Formula (I), or a pharmaceutically acceptable salt thereof is selected from the compounds in Table 1B, or a pharmaceutically acceptable salt thereof, wherein the compound is isotopically labeled. In some embodiments, the compound is isotopically labeled with 11 C. In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is PB94, or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is PB94. In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is [ 11 C]PB94, or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is [ 11 C]PB94.
- Some embodiments provide a pharmaceutical composition comprising a compound of Formula (I), or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable excipients.
- Some embodiments provide a pharmaceutical composition comprising a compound described in Table 1A, or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable excipients. Some embodiments provide a pharmaceutical composition comprising a compound described in Table 1B, or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable excipients.
- Some embodiments provide a method of treating an HDAC-associated disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating an HDAC-associated disease in a subject, comprising (a) determining that the subject has an HDAC-associated disease, and (b) administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating an HDAC-associated disease in a subject previously identified or diagnosed as having an HDAC-associated disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating an HDAC-associated disease in a subject previously determined to have an HDAC-associated disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating an HDAC-associated disease in a subject suspected of having an HDAC-associated disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating an HDAC-associated disease in a subject with a clinical record indicating a diagnosis of an HDAC-associated disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating an HDAC-associated disease in a subject at risk of developing an HDAC-associated disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- the HDAC-associated disease is an HDAC-11-associated disease. In some embodiments, the HDAC-associated disease is an HDAC-6-associated disease.
- the HDAC-associated disease is cancer.
- the cancer is a solid tumor.
- the cancer is a blood cancer.
- the cancer is a leukemia, lymphoma, or myeloma.
- the cancer is a leukemia.
- the cancer is a lymphoma.
- the cancer is a myeloma.
- the cancer is selected from the group consisting of: Hodgkin’s lymphoma, non-Hodgkin’s lymphoma, neuroblastoma, hepatocellular carcinoma, prostate cancer, ovarian cancer, pituitary cancer, pancreatic cancer, multiple myeloma, lung cancer (including SCLC and NSCLC), cutaneous T-cell lymphoma (CTCL), breast cancer, myelodysplastic syndromes, chronic myelomonocytic leukemia (CMML), diffuse large B-cell lymphoma (DLBCL), gastric cancer, and esophageal squamous cell carcinoma (ESCC).
- the HDAC-associated disease is pain.
- the pain is selected from the group consisting of: neuropathic pain, acute pain, chronic pain, nociceptive pain, and radicular pain.
- the pain is neuropathic pain.
- the pain is acute pain.
- the pain is chronic pain.
- the pain is nociceptive pain.
- the pain is radicular pain.
- the HDAC-associated disease is a neurodegenerative disorder.
- the neurodegenerative disorder is selected from the group consisting of: multiple sclerosis, frontotemporal dementia (FTD), Alzheimer’s disease ataxia, Huntington’s disease, Parkinson’s disease, motor neuron disease, multiple system atrophy, progressive supranuclear palsy, dementia with Lewy bodies and amyotrophic lateral sclerosis (ALS).
- FDD frontotemporal dementia
- Alzheimer’s disease ataxia Huntington’s disease
- Parkinson’s disease motor neuron disease
- multiple system atrophy progressive supranuclear palsy
- dementia with Lewy bodies amyotrophic lateral sclerosis
- the HDAC-associated disease is selected from the group consisting of: neuropathic pain, Hodgkin’s lymphoma, neuroblastoma, hepatocellular carcinoma, prostate cancer, ovarian cancer, pituitary cancer, pancreatic cancer, multiple myeloma, hepatic steatosis (e.g., non-alcoholic fatty liver disease (NAFLD) or non- alcoholic steatohepatitis (NASH)), insulin resistance, hypercholesterolemia, multiple sclerosis, schizophrenia, frontotemporal dementia (FTD), age-related macular degeneration, and fragile X tremor ataxia syndrome (FXTAS).
- NAFLD non-alcoholic fatty liver disease
- NASH non-alcoholic alcoholic steatohepatitis
- FXTAS fragile X tremor ataxia syndrome
- the HDAC-associated disease is selected from the group consisting of: Hodgkin’s lymphoma, neuroblastoma, hepatocellular carcinoma, prostate cancer, ovarian cancer, pituitary cancer, pancreatic cancer, and multiple myeloma.
- the HDAC-associated disease is Hodgkin’s lymphoma.
- the HDAC-associated disease is neuroblastoma.
- the HDAC-associated disease is hepatocellular carcinoma.
- the HDAC-associated disease is prostate cancer.
- the HDAC-associated disease is ovarian cancer.
- the HDAC-associated disease is pituitary cancer.
- the HDAC-associated disease is pancreatic cancer. In some embodiments, the HDAC-associated disease is multiple myeloma. In some embodiments, the HDAC-associated disease is hepatic steatosis. In some embodiments, the hepatic steatosis is NAFLD. In some embodiments, the hepatic steatosis is NASH. In some embodiments, the HDAC-associated disease is insulin resistance. In some embodiments, the HDAC-associated disease is hypercholesterolemia. In some embodiments, the HDAC-associated disease schizophrenia. In some embodiments, the HDAC-associated disease is multiple sclerosis. In some embodiments, the HDAC-associated disease is frontotemporal dementia (FTD).
- FTD frontotemporal dementia
- the HDAC-associated disease is neuropathic pain. In some embodiments, the HDAC-associated disease is age-related macular degeneration. In some embodiments, the HDAC-associated disease is fragile X tremor ataxia syndrome (FXTAS).
- FXTAS fragile X tremor ataxia syndrome
- Some embodiments provide a method of treating multiple sclerosis in a subject, comprising (a) determining that the subject has multiple sclerosis, and (b) administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating multiple sclerosis in a subject previously identified or diagnosed as having multiple sclerosis, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating multiple sclerosis in a subject previously determined to have multiple sclerosis, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating multiple sclerosis in a subject suspected of having multiple sclerosis, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating multiple sclerosis in a subject with a clinical record indicating a diagnosis of multiple sclerosis, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating multiple sclerosis in a subject at risk of developing multiple sclerosis, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating frontotemporal dementia (FTD) in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating frontotemporal dementia (FTD) in a subject, comprising (a) determining that the subject has frontotemporal dementia (FTD), and (b) administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating frontotemporal dementia (FTD) in a subject previously identified or diagnosed as having frontotemporal dementia (FTD), comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating frontotemporal dementia (FTD) in a subject previously determined to have frontotemporal dementia (FTD), comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating frontotemporal dementia (FTD) in a subject suspected of having frontotemporal dementia (FTD), comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating frontotemporal dementia (FTD) in a subject with a clinical record indicating a diagnosis of frontotemporal dementia (FTD), comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating frontotemporal dementia (FTD) in a subject at risk of developing frontotemporal dementia (FTD), comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating neuropathic pain in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating neuropathic pain in a subject, comprising (a) determining that the subject has neuropathic pain, and (b) administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating neuropathic pain in a subject previously identified or diagnosed as having neuropathic pain, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating neuropathic pain in a subject previously determined to have neuropathic pain, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating neuropathic pain in a subject suspected of having neuropathic pain, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating neuropathic pain in a subject with a clinical record indicating a diagnosis of neuropathic pain, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating neuropathic pain in a subject at risk of developing neuropathic pain, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating cancer in a subject, comprising (a) determining that the subject has cancer, and (b) administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating cancer in a subject previously identified or diagnosed as having cancer, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating cancer in a subject previously determined to have cancer, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating cancer in a subject suspected of having cancer, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating cancer in a subject with a clinical record indicating a diagnosis of cancer, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating cancer in a subject at risk of developing cancer, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating a neurodegenerative disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating a neurodegenerative disease in a subject, comprising (a) determining that the subject has a neurodegenerative disease, and (b) administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating a neurodegenerative disease in a subject previously identified or diagnosed as having a neurodegenerative disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating a neurodegenerative disease in a subject previously determined to have a neurodegenerative disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating a neurodegenerative disease in a subject suspected of having a neurodegenerative disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating a neurodegenerative disease in a subject with a clinical record indicating a diagnosis of a neurodegenerative disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of treating a neurodegenerative disease in a subject at risk of developing a neurodegenerative disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
- Some embodiments provide a method of inhibiting HDAC activity in a cell comprising an HDAC protein, comprising contacting the cell with an effective amount of a compound of Formula (I).
- the cell is a human cell.
- the cell is a neural cell.
- the cell is a human neural cell.
- the contacting occurs in vitro.
- the contacting occurs in vivo.
- the contacting occurs in vivo in the central nervous system (CNS) of a subject.
- CNS central nervous system
- the compound of Formula (I), or a pharmaceutically acceptable salt thereof, used in the methods described herein is selected from the compounds in Table 1A, or a pharmaceutically acceptable salt thereof.
- the compound of Formula (I), or a pharmaceutically acceptable salt thereof, used in the methods described herein is selected from the compounds in Table 1B, or a pharmaceutically acceptable salt thereof.
- the compound of Formula (I), or a pharmaceutically acceptable salt thereof, used in the methods described herein is PB94, or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, used in the methods described herein, is PB94.
- the compounds described herein are selective for HDAC11 over other HDACs, such as HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9 and/or HDAC10, as measured in an assay described herein or other similar assays to measure HDAC11 inhibitory activity or designed to test similar activity and/or binding.
- An HDAC11 inhibitor as described herein can be about 2-fold to about 10,000-fold, or more, selective for HDAC11, for example, about 2-fold, about 10- fold, about 50-fold, about 100-fold, about 200 fold, about 300-fold, about 400-fold, about 500-fold, about 600-fold, about 700-fold, about 800-fold, about 900-fold, about 1,000-fold, about 1,500-fold, about 2,000-fold, about 2,500-fold, about 3,000-fold, about 3,500-fold, about 4,000-fold, about 4,500-fold, about 5,000-fold, about 5,500-fold, about 6,000-fold, about 6,500-fold, about 7,000-fold, about 7,500-fold, about 8,000-fold, about 8,500-fold, about 9,000-fold, about 9,500-fold, or about 10,000-fold selective for HDAC11.
- the compounds described herein are selective for HDAC6 over other HDACs, such as HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC7, HDAC8, HDAC9, HDAC10, and/or HDAC11, as measured in an assay described herein or other similar assays to measure HDAC6 inhibitory activity or designed to test similar activity and/or binding.
- HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC7, HDAC8, HDAC9, HDAC10, and/or HDAC11 as measured in an assay described herein or other similar assays to measure HDAC6 inhibitory activity or designed to test similar activity and/or binding.
- an HDAC6 inhibitor is selective for HDAC6 by about 2-fold to about 20- fold, about 5-fold to about 50-fold, about 10-fold to about 100-fold, about 20-fold to about 200-fold, about 50-fold to about 500-fold, about 100-fold to about 1,000 fold, about 200- fold to about 2,000-fold, about 300-fold to about 3,000-fold, about 400-fold to about 4,000 fold, about 500-fold to about 5,000-fold, about 600-fold to about 6,000-fold, about 700- fold to about 7,000 fold, about 800-fold to about 8,000-fold, about 900-fold to about 9,000- fold, or about 1,000-fold to about 10,000 fold.
- the compounds described herein are selective for HDAC6 and HDAC11 over other HDACs, such as HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC7, HDAC8, HDAC9, and/or HDAC10, as measured in an assay described herein or other similar assays to measure HDAC6 and HDAC11 inhibitory activity or designed to test similar activity and/or binding.
- HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC7, HDAC8, HDAC9, and/or HDAC10 as measured in an assay described herein or other similar assays to measure HDAC6 and HDAC11 inhibitory activity or designed to test similar activity and/or binding.
- an HDAC6 and HDAC11 inhibitor is selective for HDAC6 and HDAC11 by about 2-fold to about 20-fold, about 5- fold to about 50-fold, about 10-fold to about 100-fold, about 20-fold to about 200-fold, about 50-fold to about 500-fold, about 100-fold to about 1,000 fold, about 200-fold to about 2,000-fold, about 300-fold to about 3,000-fold, about 400-fold to about 4,000 fold, about 500-fold to about 5,000-fold, about 600-fold to about 6,000-fold, about 700-fold to about 7,000 fold, about 800-fold to about 8,000-fold, about 900-fold to about 9,000-fold, or about 1,000-fold to about 10,000 fold.
- a number of embodiments of the present disclosure have been described.
- Mass spectrometry data were recorded on an Agilent 6310 ion trap mass spectrometer (ESI source) connected to an Agilent 1200 series HPLC with a quaternary pump, vacuum degasser, diode-array detector, and autosampler.
- [ 11 C]CH 4 was obtained by the reduction of [ 11 C]CO 2 in the presence of Ni/hydrogen at 350 °C and recirculated through an oven containing I2 to produce [ 11 C]CH 3 I via a radical reaction.
- Scheme 1 Synthetic routes of analogues 4a-j ⁇
- the desired fraction [ 11 C]3g
- SPE solid-phase exchange
- N-heterobicyclic substituted benzyl esters (7a-e) were prepared by reacting methyl 4-(bromomethyl) benzoate (1) with corresponding commercially available heterobicyclic amines in the presence of a base. The resulting methyl esters were converted to corresponding hydroxamic acid (8a-8e) by treating aqueous NH 2 OH/NaOH solution at room temperature.
- HDAC11 As the crystal structure of HDAC11 was not available, a Swiss-Model was used to construct an HDAC11 homology model based on human HDAC2 (PDB: 7KBH) crystal structure and carried out a molecular docking study. As depicted in FIGs.4A and 4B, PB94 exhibited a favorable conformation in the binding pocket of HDAC11. The hydroxamate group of PB94 interacts with Zn 2+ and forms a hydrogen bond.
- the benzyl linker and residue Tyr87 form a ⁇ - ⁇ stacking interaction, and the indole-adamantane group occupies the lateral pocket of the HDAC11 structure.
- the zHDAC6 crystal structure was obtained from Protein Data Bank (6THV, www.rcsb.org).
- PB94 was docked with the binding pocket of HDAC6 and HDAC11 using AutoDock Vina (v 1.1.2).
- the plots of protein-ligand interaction between PB94 and zHDAC6 as well as PB94 and HDAC11 were generated using PyMOL.
- Example 20 Binding selectivity evaluation and in vitro phenotypic activity profile of PB94 The off-target binding of PB94 was evaluated in a panel of 46 targets (National Institute on Mental Health-Psychoactive Drug Screening Program (PDSP)) and observed no significant off-target binding at 10 ⁇ M (details presented below).
- PDSP National Institute on Mental Health-Psychoactive Drug Screening Program
- PB94 did not exhibit any cytotoxic effects at tested concentrations (0.37 ⁇ M – 3.3 ⁇ M) but exhibited antiproliferative activity to human primary endothelial cells, T cells, B cells, and coronary artery smooth muscle cells at 3.3 ⁇ M (grey arrows, FIG. 5D).
- a comparative analysis of the biological activities of known bioactive agents in the BioMAP reference database was used to predict the safety, efficacy, and function of PB94.
- Example 21 Western blot analysis
- the tissues lysates were obtained by homogenization in cold RIPA buffer (89900, Thermo Fisher) containing proteinase inhibitor (05892970001, Roche) with a PRO200 homogenizer. Supernatants were collected and total protein concentrations were measured by using a BCA Protein Assay Kit (23227, Thermo Scientific). Equal amounts of protein (50 ⁇ g) were used for electrophoresis on 4- 20% Criterion TGX stain-free precast gels (5678095, Bio-Rad) and electrophoretically transferred onto PVDF membranes (1620264, Millipore).
- the membranes were blocked in 3% BSA 0.5 hour at room temperature and then probed with antibody against HDAC-11 (1:1000, 09-827, Millipore) and GAPDH (1:10000, ab8245, Abcam) overnight at 4°C.
- the blots were then incubated for 1 hour with anti-rabbit (1:5000, #7074, Cell Signaling Technology) secondary antibodies at room temperature. Signal was visualized using ECL Solution and Imager (Bio-Rad). Densitometry of protein bands was analyzed by image J. For the quantification of the protein, the band intensities were normalized by GAPDH as the internal reference. Subsequently, normalized band intensities were divided by the average of the sham group to determine normalized fold change vs. the sham group.
- Example 22 HDAC 1-11 enzyme inhibition assays
- the HDAC inhibition assay of target compounds were carried out at Nanosyn (Santa Clara CA, United States) using the electrophoretic mobility shift assay.
- Full-length human recombinant HDAC proteins were expressed in the baculoviral system and purified by affinity chromatography.
- the peptide substrates were used: FAM-RHKK(Ac)-NH 2 for HDAC3, HDAC6, and HDAC8; FITC-H3K27(Ac)-NH 2 for HDAC1, HDAC2, and HDAC10; and FAM-RHKK (tri-fluor-Ac)-NH 2 for HDAC4, HDAC5, HDAC7, HDAC9, and HDAC11.
- Test compounds were diluted in 100% DMSO using 3-fold dilution steps. The final compound concentration in the assay ranged from 10 ⁇ M to 0.056 nM.
- Compound, enzymes (Table 3), and substrate were combined in reaction buffer (100 mM N-2-hydroxyethylpiperazine-N ⁇ -2-ethanesulfonic acid [HEPES; pH 7.5], 25 mM KCl, 0.1% bovine serum albumin, 0.01% Triton X-100) at 25°C and quenched by the addition of termination buffer (100 mM HEPES [pH7.5], 0.01% Triton X-100, 0.05% sodium dodecyl sulfate).
- reaction buffer 100 mM N-2-hydroxyethylpiperazine-N ⁇ -2-ethanesulfonic acid [HEPES; pH 7.5], 25 mM KCl, 0.1% bovine serum albumin, 0.01% Triton X-100
- termination buffer 100 mM H
- Example 23 Defatty acylation of SHMT2 assays
- SHMT2 was identified as a defatty-acylation substrate of HDAC11 in cells.
- HEK293T cells were treated with PB94 to test whether it could upregulate the fatty acylation level of SHMT2 via HDAC11 inhibition.
- HEK293T was incubated with Alk14 (an alkyne-tagged myristic acid analog) and PB94 at different concentrations for 3 hours. Then, the Alk14- labeled SHMT2 was conjugated with biotin using click chemistry, pulled down with streptavidin, and measured by Western blot.
- HDAC11 inhibitor TD034, was used as the reference compound.
- PB94 significantly increased the fatty acylation level of SHMT2 at the concentration of 20 ⁇ M (FIG. 14), indicating it has HDAC11 inhibitory activity in cells.
- SDS lysis buffer 50 mM triethanolamine, 150 mM NaCl, 4% SDS, pH 7.4
- HEPES buffer 50 mM HEPES, 150 mM NaCl, 1% NP-40, pH 7.4
- magnetic streptavidin beads 10 ⁇ g were suspended in HEPES buffer (100 ⁇ L), after which Biotin-N 3 (5 ⁇ L, 5 mM in DMF) was added.
- the mixture was shaken at 37 °C for 30 minutes, then the supernatant was removed, and the beads were washed with HEPES buffer (1 x 100 ⁇ L). The mixture was shaken for 1 h at 37°C, and the supernatant was removed.
- HDAC11 protein level increased in neuropathic pain
- the primary somatosensory cortex has been previously identified as a key brain region implicated in pain processing.
- HDAC11 expression was assessed in the primary somatosensory cortex after CCI injury by qPCR. Notably, HDAC11 protein significantly increased in the cortex compared with sham mice 14 days after surgery (FIG. 11A). HDAC6 expression levels were less effected by CCI injury.
- Procedure using qPCR analysis A one-step real-time PCR was performed using iTaqTM Universal SYBR® Green One-Step Kit (BioRad 1725150) in a Thermofisher 7500 fast thermocycler.
- the primer sequences are as follows: GAPDH: CATCACTGCCACCCAGAAGACTG ((forward) and ATGCCAGTGAGCTTCCCGTTCAG (reverse); HDAC11: ATGGGGCAAGGTGATCAACT (forward) and AGGACCACTTCAGCTCGTTG (reverse).
- GAPDH CATCACTGCCACCCAGAAGACTG
- ATGCCAGTGAGCTTCCCGTTCAG reverse
- HDAC11 ATGGGGCAAGGTGATCAACT
- AGGACCACTTCAGCTCGTTG reverse
- Mouse brain tissue was harvested one week after sham or CCI surgery, followed by RNA isolation using Trizol. Melting curve and Ct value used for quantification. Gapdh was used as the internal control for normalization for each sample.
- Example 25 Example 25.
- PET/CT imaging in rodents To investigate the pharmacokinetics of PB94 in vivo, radiolabeled PB94 was used for PET imaging studies using [ 11 C]PB94 in rodents.
- [ 11 C]PB94 was prepared through a two-step reaction using 3g as the precursor (FIG. 8).
- CT computed tomography
- the representative PET/CT images focused on the mice brain (coronal, sagittal, and axial, summed from 0 to 60 minutes) and time-activity curves (TACs) of eight brain regions of interest are shown in FIG.
- [ 11 C]PB94 exhibited significant blood-brain-barrier (BBB) penetration and fast brain uptake, with the maximum %ID/cc (percent injected dose per cc tissue) of 2.8 in the whole brain at the first few minutes post-injection.
- Regional brain analysis was carried out using the FUSION module (Ma-Benveniste-Mirrione) in PMOD (PMOD 4.003, PMOD Technologies Ltd., Zurich, Switzerland). Heterologous distribution of radioactivity was observed in eight ROIs, indicating the heterologous expression level of HDAC11 in brain regions. Of note, relatively high radioactivity uptake was found in the striatum, cortex, and amygdala, while the cerebellum and brain stem showed lower radioactivity uptake.
- mice that underwent CCI to assess the development of nociceptive behavior.
- the hind paw mechanical withdrawal thresholds ipsilateral to the injury side decreased after surgery and remained at low levels from day 3 to day 14.
- no significant change in mechanical pain thresholds was observed in the contralateral paw.
- mice were treated with PB94 at different doses, and mechanical withdrawal thresholds were examined. Single-dose injection of PB94 was able to increase mechanical withdrawal thresholds (FIG.
- PWTs of CCI mice were measured every 30 min during a 3-hour period after PB94 administration.
- Example 28 Hindpaw withdrawal latency Mice were placed on a preheated glass platform (28 - 29°C) and clear Plexiglas cubicles to acclimate to the testing room 30 minutes daily for 3 consecutive days before the testing. A radiant heat source emitted from underneath the glass and focused on the middle of the hindpaws of mice. Paw withdrawal latency was defined as the time (seconds) from the initiation of heat exposure to the hind paw withdrawal.
- a cut-off time was set at 20 seconds to avoid tissue damage.
- Example 29 Examination of analgesic effect of PB94 by Iba-1 staining To interrogate potential mechanisms that are linked to the analgesic effect of PB94, brain samples of mice received 14 days of PB94 treatment were stained for Iba-1, a microglia marker. Microglia-mediated neuroinflammation has been shown to be critical for the development of neuropathic pain, including pain in the CCI model.
- mice were transcranial perfused with ice-cold PBS followed by 4% paraformaldehyde. Extracted mouse brains were stored at 4°C with 4% PFA fixation for two days.
- brains were sliced at 40 ⁇ m in thickness using a Leica vibratome (VT 1000s).
- the desired slices were bathed in a blocking buffer containing 0.03% Tween-20 and 5% BSA for 1h at room temperature.
- the primary antibody (Iba1; 1:1000; Wako) in PBS was incubated at 4°C overnight.
- the slices were incubated with the second antibody of anti-rabbit Alexa488 (1:2000; Invitrogen) for one hour at room temperature.
- images were taken at 4x and 20 ⁇ magnification for analysis. Images were analyzed using ImageJ (NIH open-source software).
- Example 30 Example 30.
- CYP inhibition assay of PB94 Phenacetin, acetaminophen, (+)-N-3-Benaylnirvanol, ⁇ -Naphthoflavone, diclofenac, sulfaphenazole, dextrorphan tartrate, quinidine, testosterone, 6- hydroxytestosterone, ketoconazole were purchased from Sigma (St. Louis, MO, USA). 4- Hydroxydiclofenac, s-mephenytoin, 4- hydroxymephenytoin, dextromethorphan, ticlopidine were purchased from TRC (Toronto, Canada).
- incubation mixtures contained pooled human liver microsome (0.5 mg/mL), 3.0 mM MgCl 2 , specific substrate of each isoform, and probe inhibitor or test compound (10 and 0 ⁇ M) in 0.1 M potassium phosphate buffer (total volume 0.1 mL).
- the final concentrations of substrates and inhibitors are listed in the table above.
- Final concentration of organic solvent is less than 1% (v/v). The mixture was pre- incubated for 10 min at 37 °C. Then, 1 mM NADPH was added to initiate reaction.
- incubation mixtures contained pooled human liver microsome (0.1 mg/mL), 3.0 mM MgCl 2 , specific substrate of each isoform, and probe inhibitor or test compound (10 and 0 ⁇ M) in 0.1 M potassium phosphate buffer (total volume 0.1 mL). The final concentrations of substrates and inhibitors are listed in the table above. Final concentration of organic solvent is less than 1% (v/v). The mixture was pre-incubated for 10 min at 37 °C.
- IP intraperitoneal
- PB94 Hepatocyte stability Test compound PB94 was weighed and dissolved in 100% DMSO to get 10 mM stock solution. The stock solution was diluted to 500 ⁇ M with mixture of methanol and H 2 O (1:1). The final concentrations of DMSO and methanol were equal or less than 0.1%. Stock solutions of testosterone and 7-ethoxycoumarin were prepared at a concentration of 10 mM in 100% DMSO, respectively.
- the stock solution for each compound was diluted into 500 ⁇ M or 100 ⁇ M with mixture of methanol and H 2 O (1:1) .
- the final concentrations of DMSO and methanol were equal or less than 0.1%.
- Hepatocytes incubations were conducted in duplicate in 96-well plates. Each well contains 50 ⁇ L of williams E medium containing 1*glutamax and 1 million/mL hepatocytes and test compound (5 ⁇ M) or positive control compound (5 ⁇ M or 1 ⁇ M). Reactions in appropriate wells as designed were terminated at various time points (0, 15, 30, 60, 120 min) by adding 200 ⁇ L of ice-cold acetonitrile containing internal standard.
- Each well contains 40 ⁇ L of 0.1 M potassium phosphate buffer (pH 7.4), 4.125 mM MgCl 2 , 0.625 mg/mL liver microsomes, and test compound (1.25 ⁇ M) or positive control.
- 10 ⁇ L of 5.0 mM NADPH in 0.1 M potassium phosphate buffer was added to initiate the enzymatic reaction.
- the final component concentrations are 0.1 M potassium phosphate buffer (pH 7.4), 1.0 mM. NADPH, 3.3 mM MgCl 2 , 0.5 mg/mL liver microsomes, and test compound (1.0 ⁇ M) or positive control (1.0 ⁇ M).
- Reactions were terminated at various time points (0, 5, 10, 20, 40 min) by adding 200 ⁇ L of ice-cold acetonitrile containing internal standard.
- a parallel incubation was performed using 0.1 M potassium phosphate buffer (pH 7.4) instead of NADPH as the negative control, and reactions was terminated at 40 min after incubation at 37°C.
- Samples were analyzed by HPLC- MS/MS and peak areas were recorded for each analyte. The peak area ratio of test compound to internal standard will be plotted as a percentage of the relevant zero time point control (%Remained) for each reaction.
- the rate of metabolism (k) is the slope of the linear regression from log percentage remaining versus incubation time.
- the in vitro T1/2 is calculated as -0.693/k.
- Example 34 Acute toxicity assays To investigate the safety profile of PB94, acute toxicity was evaluated in mice. The results showed that there is no observed adverse effect after treating the BP94 at 200 mg/kg.
- the biochemical analysis showed that BP94 administration didn’t change the important kidney and liver function indexes, such as uric acid and alanine aminotransferase, as well as electrolytes including Na + , K + , Cl-.
- the blood analysis showed that BP94 administration didn’t change the blood count indexes, including red blood cells, white blood cells, and blood platelets (FIG.28A). And there are no significant differences in body weight between control (FIG.28B).
- mice Male and female mice (Balb/c) (around 20 g, 5 weeks old) were procured from HFK Biotechnology Company (Beijing, China) with Animal Quarantine Conformity Certificates. Mice were maintained at around 20 °C and 55% humidity, with a 12 h light/dark cycle and ad libitum food/water. The acute toxicity assays on animals were performed in conformity with the ARRIVE guidelines which were approved by the Institutional Animal Care and Treatment Committee of West China Hospital (Permit Number: 20230105003).
- mice received an intraperitoneal dose of BP94 at 200 mg/kg.
- the control group was given the solvent.
- the body weight of the mice was recorded every three days. After a fortnight, the mice were euthanized. Blood samples were taken for both biochemical and routine blood examinations. Additionally, primary organs such as the heart, liver, spleen, lungs, and kidneys were harvested for H&E staining.
- Example 35 In Vitro ADME Evaluation and In Vivo Pharmacokinetic Profiling of PB94 In vitro ADME assessments were carried out to evaluate the drug-like profiles of PB94. Data shown in Table 8 indicate that PB94 possesses good metabolic stability in human liver microsomal and mouse plasma, with half-lives (t1/2) of 54.6 min and 133.8 min, respectively.
- cytochrome P450 enzymes CYPs 1A2, 2C19, and 2D6 at 10 ⁇ M of PB94.
- the pharmacokinetic (PK) profiles of PB94 were assessed by administrating 10 mg/kg PB94 intravenously (i.v) and orally (p.o) in mice. Results show that PB94 had suitable PK properties with a half-life of 5.3 hours by p.o. administration. Of note, PB94 showed less favorable bioavailability when by oral administration (11.2 %).
- PB94 showed less favorable bioavailability when by oral administration (11.2 %).
- to evaluate the brain permeability of PB94 in vivo brain/plasma pharmacokinetic studies were performed by IP administrating PB94 at 1mg/kg in C57BL/6 mice. As a result, PB94 exhibited good brain permeability, with brain/plasma ratios of 2.3 at 30 min and 2.2 at 4 h post-injection. Table 8. ADME/PK studies of PB94 ⁇
- Example 37 Cell-based Assay of PB94 Using Mouse Microglia BV2 Cells HDAC11 is characterized by immune regulatory functions involving regulation of IL-10.
- a mechanistic study was performed in order to evaluate whether PB94 may affect neuroinflammatory events with a focus on IL-10 using mouse microglia BV2 cells.
- Mouse microglia BV2 cells were induced by the well-characterized and previously reported immune-stimulating molecule lipopolysaccharides (LPS), alone or in combination with PB94, to assess inflammatory changes as a function of PB94.
- LPS immune-stimulating molecule lipopolysaccharides
- PB94 significantly reduced IL-10 expression in LPS (10 ng/ml) treated cells (FIG.7), indicating the inflammation regulatory activity of PB94.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Epidemiology (AREA)
- Hospice & Palliative Care (AREA)
- Psychiatry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
This disclosure relates to certain compounds that are inhibitors of histone deacetylases (HDACs), as well as compositions thereof and methods of using such compounds to treat diseases, such as those described herein.
Description
HISTONE DEACETYLASE INHIBITORS CLAIM OF PRIORITY This application claims the benefit of U.S. Patent Application Serial No. 63/385,999, filed on December 5, 2022. The entire contents of the foregoing is hereby incorporated by reference. TECHNICAL FIELD This disclosure relates to the fields of chemistry, biology, and medicine, and more specifically to certain compounds that are inhibitors of histone deacetylases (HDACs), as well as compositions thereof and methods of using such compounds to treat diseases, such as those described herein. BACKGROUND Histone lysine residue acetylation/deacetylation represents an important epigenetic modification that affects gene expression without DNA sequence modification. Histone deacetylases (HDACs) are a class of amide hydrolases that catalyze a variety of substrates, including histones and other proteins. Eleven zinc-dependent HDACs have been found in mammals, including class I (HDAC1, HDAC2, HDAC3, HDAC8), class IIa (HDAC4, HDAC5, HDAC7, HDAC9), class IIb (HDAC6, HDAC10), and class IV (HDAC11). Each of these isoforms has distinct functions in epigenetic regulation. Among them, HDAC11 is the most recently identified member of the class IV HDAC. HDAC11 has higher expression levels in the brain than other HDACs and it has been implicated in various neurologic diseases including neurodegenerative disorders and neuropathic pain. SUMMARY Some embodiments provide a compound of Formula (I):
or a pharmaceutically acceptable salt thereof, wherein: Q is a bond or -NH-; L is -NH(C=O)(C1-C4 alkyl)-*, -O-(C1-C6 alkyl)-*, -(C=O)-, and -(C1-C4 alkyl)-, wherein “*” indicates the point of attachment to N; R1 is -OH, -C1-C4 haloalkyl, and -NH(C1-C4 alkyl); R2 is halogen, -OH, C1-C6 alkyl, and C1-C6 alkoxy; R3 is hydrogen, C1-C6 alkenyl, and C1-C6 alkyl optionally substituted with C3- C6 cycloalkyl; R4 is C1-C4 alkyl, phenyl, 9-15 membered heteroaryl, 9-15 membered heterocyclyl, each optionally substituted with 1-2 R4a; or R3 and R4 taken together with the nitrogen to which each is bound join to form a 9-13 membered heterocyclyl or 9-10 membered heteroaryl, each optionally substituted with R5; each R4a is halogen, C1-C6 alkyl, C1-C6 alkoxy, C6-C10 cycloalkyl, oxo, and - (C=O)NH(C1-C4 alkyl optionally substituted with C6-C10 cycloalkyl); R5 is -(C=O)NR5aR5b, -NR5cR5d, -(CH2)NR5eR5f, and C1-C4 alkyl optionally substituted with C6-C10 cycloalkyl; R5a, R5b, R5c, R5d, R5e and R5f are each hydrogen, C1-C6 alkyl and C1-C6 alkenyl, each optionally substituted with oxo and/or C6-C10 cycloalkyl; and n is 0 or 1. Some embodiments provide a pharmaceutical composition comprising a compound of Formula (I), or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable excipients. Some embodiments provide a method of treating an HDAC-associated disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. The details of one or more embodiments of the disclosure are set forth in the accompanying drawings and the description below. Other features, objects, and
advantages of the disclosure will be apparent from the description and drawings, and from the claims. DESCRIPTION OF DRAWINGS FIG. 1 shows the discovery of PB94 via structure-activity (SAR) investigation of 4a and lead optimization to identify lead compound PB94. FIG. 2A and FIG. 2B show the HDAC selectivity profile of 4a and PB94, respectively, and demonstrate that the selectivity for HDAC6 and HDAC11 are transposed. Dose-response curves for HDAC1-11 are included for reference. FIG. 3A shows molecular docking results of 4a and FIG. 3B shows molecular docking results of PB94; docking studies used zHDAC6 crystal complex (PDB entry 6THV). Zn ion is shown as a sphere and hydrogen bonds as dotted lines; key amino acid residues that create the specific pocket in HDAC6 are represented as a stick and labeled as shown. FIG. 4A shows PB94 docked into the homology model of HDAC11 (cartoon representation), which was constructed based on human HDAC2 (PDB: 7KBH) crystal structure using the Modeler 9.14. FIG. 4B shows detailed binding interactions between PB94 and HDAC11. FIG.5A shows in vitro BioMAP phenotypic activity profile of PB94 at 0.37 μM and 1.1 μM, and 3.3 μM in the Diversity PLUS Panel. The X-axis lists the quantitative protein- based biomarker readouts measured in each system. The Y-axis represents a log-transformed ratio of the biomarker readouts for the drug-treated sample (n = 1) over vehicle controls (n ≥ 6). The grey region around the Y-axis represents the 95% significance envelope generated from historical vehicle controls. Biomarker activities are annotated when two or more consecutive concentrations change in the same direction relative to vehicle controls, are outside of the significance envelope, and have at least one concentration with an effect size > 20% (|log10 ratio| > 0.1). Antiproliferative effects are indicated by a thick grey arrow. FIG. 5B shows reference benchmark overlay of PB94 (3.3 μM) and vorinostat (3.3 μM). FIG. 5C shows top database search result for PB94 (3.3 μM) is parthenolide (1.2 μM). Overlay of the top similarity match from an unsupervised search of the BioMAP reference database of
>4,500 agents with PB94. Common biomarker readouts are annotated when the readout for both profiles is outside of the significance envelope with an effect size > 20% (|log10 ratio| > 0.1). FIG. 5D shows PB94 is antiproliferative to human primary endothelial cells (3.3 μM), T cells (3.3 μM), B cells (3.3 μM), and coronary artery smooth muscle cells (3.3 μM) (grey arrows). FIG. 6 shows mechanism HeatMAP analysis for PB94. HeatMAP analysis of the 148 biomarker readouts (rows) within the Diversity PLUS Panel by PB94 in comparison to 19 consensus mechanism class profiles (columns). FIG. 7 shows mechanism of action by which PB94 affects neuroinflammatory events was characterized by a focus on IL-10 using mouse microglia BV2 cells. BV2 cells were utilized to assess inflammatory changes induced by LPS. Cells were treated with LPS (10 ng/ml) alone or in combination with 500 or 1000 nM PB94 for 24 hrs. The medium was then applied to MSD-cytokine assay to measure levels of IL-10. mean ± SEM; t-test; n = 4 for each group. FIG. 8A shows radiosynthesis of [11C]PB94: reagents and conditions: 1) K2CO3, DMF, 100 °C, 3.0 minutes RCY: 24-19% (non-decay-corrected, n = 3); 2) 0.6M NaOH, NH2OH (50 wt. % in H2O), MeOH/THF (1:1), 10 minutes. RCY: 66-70% (non-decay- corrected). Molar activity: 122 GBq/μmol (EOB). FIG. 8B shows representative mice PET/CT images of [11C]PB94 focus on the mice brain (coronal, sagittal, and axial, summed from 0 to 60 minutes), and mice body PET/CT images at 5-, 15-, 30-, and 60-minutes post- injection in mice (n = 4 for each time point). FIG. 9A and FIG. 9B show the time-activity curves of [11C]PB94 in mice brain regions of interest, including cortex, cerebellum, brain stem, thalamus, hypothalamus, striatum, hippocampus, and amygdala. FIG.10 shows the biodistribution of [11C]PB94 in peripheral organs in mice at five different time points (1, 5, 15, 30, and 60 min). The bars above each organ correspond to time points in the same order from left to right as shown for the liver. FIG.11A shows Western blot qPCR analysis indicated HDAC11 (40 kDa) protein level was increased in the cortex at 14 days after Controlled Cortical Impact (CCI; sham vs. CCI, n = 3, unpaired t-test). FIG. 11B shows mechanical paw withdrawal thresholds
significantly decreased in the surgery paw compared with the contralateral paw in CCI mice. FIG. 12 shows the dose-response of PB94 on nociceptive behavior in mice at 14 days after CCI surgery. P values indicate the difference in the threshold between 10 mg/kg group vs. CCI group (n = 8, two-way ANOVA followed by Bonferroni post hoc analyses). FIG. 13A shows the von Frey test. P values indicate the difference in the latency between CCI + PB94 group vs. sham group (n = 8, two-way ANOVA followed by Bonferroni post hoc analyses). FIG. 13B shows the Hargreaves test. P values indicate the difference in the threshold between the CCI + PB94 group vs. sham group (n = 8, two-way ANOVA followed by Bonferroni post hoc analyses). FIG.13C shows mouse body weight change during the treatment. FIG. 14A shows representative Western blot images indicating PB94 increases endogenous fatty acylation levels of SHMT2 in HEK293T cells at the concentration of 20 μM. FIG.14B shows PB94 (20 μM) and reference compound TD034 (5 μM) significantly increase endogenous fatty acylation levels of SHMT2 in HEK293T cells. Signal intensity was quantified by ImageJ, and the signal of the control group (DMSO) without inhibitor treatment was set as 1.0. *p value < 0.1; **p value < 0.05; ***p value <0.01. FIG. 15 shows representative Iba1 staining of Sham, PB94 + CCI, vehicle + CCI. Images were taken at 4× (scale bar represents 500 μm); Iba1 + cells in the boxed regions of S1HL and VPL were analyzed. (Scale bar represents 50 μm). FIG.16 shows S1HL and VPL microglia counts significantly increased in mice that underwent CCI surgery. p values indicate the difference in the microglia counts between CCI + Vehicle, CCI + PB94 (n = 3, Unpaired t test). Data are represented as mean ± SEM. *p < 0.05. FIG.17 shows the design and discovery of selective HDAC6 inhibitor PB131. FIG.18A shows the chemical structure of PB131 and its inhibitory activities against HDAC1–11. FIG. 18B shows the interactions between PB131 and HDAC6 (PDB code: 6THV). Zn2+ is shown as a gray sphere, and hydrogen bonds as dotted lines; key amino acid residues that create the specific pocket in HDAC6 are represented as a stick and labeled as shown. FIG.18C shows the surface poses of PB131 in the HDAC6 hydrophobic cavity.
FIG. 19A and 19B show the radiosynthesis of [18F]8b and [18F]PB131. Reagents and conditions: (i) K222/[18F]KF, DMSO, 150 °C, 20 min. RCY: 9%-12% (non-decay- corrected, n = 3); (ii) 0.6 M NaOH, NH2OH (50% (w/w) in H2O), MeOH/THF (1:1), 10 min. RCY: 58%-62% (non-decay-corrected, n = 3). Molar activity: 108 GBq/μmol (EOB). (iii) K222/[18F]KF, Cu2(OTf)2(py)4, DMF, 120 °C, 20 min. RCY: 11%-14% (non-decay- corrected, n = 3). Molar activity: 114 GBq/μmol (EOB). FIG. 20A shows representative baseline PET/CT image and FIG. 20B shows blocking (pretreated with 3.0 mg/kg 8b) mice brain PET/CT images (summed from 0 to 60 min) after [18F]8b injection via tail vein. FIG. 20C shows time–activity curves of [18F]8b in the mice whole brain. FIG. 21A shows representative baseline mice brain PET/CT image, and FIG. 21B and FIG. 21C shows mice brain PET/CT image after blocking (pretreated with 3.0 mg/kg Tubastatin A and PB131, respectively, (summed from 0 to 60 min) after [18F]PB131 injection via tail vein. FIG. 21 D shows time–activity curves of [18F]PB131 in the mice whole brain. FIG.22A shows the biodistribution of [18F]PB131 in mice whole body at different time points post-injection. FIG. 22B shows the radioactivity accumulation of [18F]PB131 in organs of interest at different time points. The bars above each organ correspond to time points in the same order from left to right as shown for the spleen. The data were expressed as mean ± SD, n = 4. FIG.23 shows the anti-inflammatory activity study of PB131. The bars above each cytokine correspond to concentration in the same order from left to right as shown for IL- 12P-70. FIG. 24 shows the anti-inflammatory activity study of PB131 (normalized protein level) The bars above each cytokine correspond to concentration in the same order from left to right as shown for IL-12P-70. FIG.25 shows future chemical optimization and iterative lead optimization process. FIG.26 shows representative HDAC-11 enzymatic assay results. FIG. 27 shows no significant binding of CNS targets (PDSP) and metalloenzymes (MMP enzymes), Cerep/Eurofins at 10 μm PB94.
FIG. 28A shows preliminary acute toxicity results of PB94 in mice at 200 mg/kg (I.P.), n=5 for male and female. FIG. 28B shows body weights after dosing with PB94 or vehicle (CON). FIG. 29 shows preliminary acute toxicity results by tissue type of PB94 in mice at 200 mg/kg (I.P.), n=5 for male and female. CON is vehicle. FIG. 30A shows optical imaging using amyloid beta plaque probe ADLumin-1 indicate treatment of 5XFAD model mice with HDAC11 inhibitor PB94 could reduce amyloid beta plaques in the brain. FIG.30B shows analysis of 3D6-stained plaque burden in hemispheres of animals and analysis of plasma immune proteins led to the identification of CXCL1 as key protein as a function of PB94. FIG.31 shows in vitro intracerebral hemorrhage (ICH) study with treated mice. FIG.32A shows neuroinflammation reduction by PB94 through PET imaging using 11CPBR28 to measure TSPO level in mice brain. FIG. 32B shows standardized uptake value (SUV) for the two study arms. Bars of each arm in the brain regions are the same from left to right as indicated in the thalmus. FIG. 33 shows PB94-associated improved cognitive function by behavior tests in 5XFAD mice. FIG. 34 shows PB94 treatment can reduce tau in the brain as evidenced by optical imaging using tau tangles probe ADLumin-1. FIG. 35 shows PB94-associated improved cognitive function by behavior tests in P301S mice. FIG 36 shows HDACi reduces the ratios of the phosphorylated tau compared to total tau proteins in P301S mice. FIG. 37A and FIG. 37B show HDACi reduces inmmunostaining signal of astrocytes and microglia but increases synaptophysin in the dentate gyrus of P301S mice. Representative images at 4X showing GFAP, IBA-1, and synaptophysin immunoreactivity in hippocampus and dentate gyrus. FIG.38 shows an AAV1/2 expression system was used to drive the overexpression of mutant A53T human a-synuclein (aSyn) in the SNpc of rats, which results in ~60% loss of ipsilateral dopaminergic neurons after 21 days. Injection of empty AAV1/2 into contralateral SNpc provides a vector-matched, within-animal control. Characteristics of
this model include ipsilateral loss of dopamine cells identified with tyrosine hydroxylase staining as shown in FIG. 38A, robust ipsilateral phosphorylation of aSyn at serine 129, a pathological feature of PD-associated A53T toxicity as shown in FIG. 38B, and the formation of proteinase K-resistant aggregates of aSyn as shown in FIG.38C. FIG. 39 shows PB94 was used for treatment of AAV-A53T-aSyn rats (i.p. daily treatment for 3 weeks at 20 mg/kg, n=2). The aSyn aggregates measured in vivo by C11- SY08 PET imaging were reduced by treatment. FIG. 40 shows dopamine transporter concentration was measured b C11-Altopane PET imaging before and after PB94 treatment. The right striatum showed more severe dopamine loss at baseline. PB94 increased DAT concentration in both right SN and right striatum (n=2). FIG. 41 shows The HPLC chromatogram of [11C]PB94 and unlabeled PB94. The subtle difference in retention times between [11C]PB94 and unlabeled PB94 is due to the different dictators. Analytic HPLC condition: Agilent Eclipse plus C18, 3.5 μm, 4.6×100 mm, flow rate = 1.0 mL/min, mobile phase = 0.1% formic acid in water / 0.1% formic acid in acetonitrile, gradient method. DETAILED DESCRIPTION Definitions To facilitate understanding of the disclosure set forth herein, a number of additional terms are defined below. Generally, the nomenclature used herein and the laboratory procedures in organic chemistry, medicinal chemistry, and pharmacology described herein are those well-known and commonly employed in 5 the art. Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Each of the patents, applications, published applications, and other publications that are mentioned throughout the specification and the attached appendices are incorporated herein by reference in their entireties. Definitions Definitions of specific functional groups and chemical terms are described in more detail below. The chemical elements are identified in accordance with the Periodic Table
of the Elements, CAS version, Handbook of Chemistry and Physics, 75th Ed., inside cover, and specific functional groups are generally defined as described therein. Additionally, general principles of organic chemistry, as well as specific functional moieties and reactivity, are described in Thomas Sorrell, Organic Chemistry, University Science Books, Sausalito, 1999; Smith and March, March’s Advanced Organic Chemistry, 5th Edition, John Wiley & Sons, Inc., New York, 2001; Larock, Comprehensive Organic Transformations, VCH Publishers, Inc., New York, 1989; and Carruthers, Some Modern Methods of Organic Synthesis, 3rd Edition, Cambridge University Press, Cambridge, 1987. The abbreviations used herein have their conventional meaning within the chemical and biological arts. The chemical structures and formulae set forth herein are constructed according to the standard rules of chemical valency known in the chemical arts. Compounds described herein can comprise one or more asymmetric centers or double bonds, and thus can exist in various isomeric forms, e.g., enantiomers, diastereomers, racemates, geometric isomers, stereoisomeric forms that may be defined, in terms of absolute stereochemistry, as (R)- or (S)-. For example, the compounds described herein can be in the form of an individual enantiomer, diastereomer or geometric isomer, or can be in the form of a mixture of stereoisomers, including racemic mixtures and mixtures enriched in one or more stereoisomer. Isomers can be isolated from mixtures by methods known to those skilled in the art, including chiral high pressure liquid chromatography (HPLC) and the formation and crystallization of chiral salts; or preferred isomers can be prepared by asymmetric syntheses. See, for example, Jacques et al., Enantiomers, Racemates and Resolutions (Wiley Interscience, New York, 1981); Wilen et al., Tetrahedron 33:2725 (1977); Eliel, Stereochemistry of Carbon Compounds (McGraw– Hill, NY, 1962); and Wilen, Tables of Resolving Agents and Optical Resolutions p. 268 (E.L. Eliel, Ed., Univ. of Notre Dame Press, Notre Dame, IN 1972). The present disclosure includes compounds in racemic and optically pure forms. When the compounds described herein contain olefinic bonds or other centers of geometric asymmetry, and unless specified otherwise, it is intended that the compounds include both E and Z geometric isomers. The disclosure additionally encompasses compounds described herein as individual isomers substantially free of other isomers, and alternatively, as mixtures of various isomers.
When a range of values is listed, it is intended to encompass each value and sub– range within the range. For example “C1-C6 alkyl” is intended to encompass, C1, C2, C3, C4, C5, C6, C1-C6, C1-C5, C1-C4, C1-C3, C1-C2, C2-C6, C2-C5, C2-C4, C2-C3, C3-C6, C3-C5, C3-C4, C4-C6, C4-C5, and C5-C6 alkyl. The following terms are intended to have the meanings presented therewith below and are useful in understanding the description and intended scope of the present disclosure. “Alkyl” refers to a radical of a straight-chain or branched saturated hydrocarbon. In some embodiments, an alkyl group has, for example, 1 to 6 carbon atoms (“C1-C6 alkyl”). Examples of C1-C6 alkyl groups include methyl (C1), ethyl (C2), n–propyl (C3), isopropyl (C3), n–butyl (C4), tert–butyl (C4), sec–butyl (C4), iso–butyl (C4), n–pentyl (C5), 3–pentanyl (C5), amyl (C5), neopentyl (C5), 3–methyl–2–butanyl (C5), tertiary amyl (C5), and n–hexyl (C6). Common alkyl abbreviations include Me (–CH3), Et (–CH2CH3), iPr (–CH(CH3)2), nPr (–CH2CH2CH3), nBu (–CH2CH2CH2CH3), or i–Bu (– CH2CH(CH3)2). “Alkenyl” refers to a radical of a straight-chain or branched hydrocarbon containing at least one double bond. In some embodiments, an alkenyl group has, for example, 1 to 6 carbon atoms (“C1-C6 alkenyl”). Examples of C1-C6 alkenyl groups include vinyl, allyl, and 2-methylprop-1-en-1-yl. “Halo” or “halogen,” independently or as part of another substituent, means a fluorine (F), chlorine (Cl), bromine (Br), or iodine (I) atom. The term “halide” by itself or as part of another substituent, refers to a fluoride, chloride, bromide, or iodide atom. In certain embodiments, the halo group is fluorine. In certain embodiments, the halo group is chloride. In certain embodiments, the halo group is bromide. “Haloalkyl” refers to an alkyl group as described herein (e.g., a C1-C6 alkyl group) in which one or more of the hydrogen atoms are replaced by a halogen (e.g., mono- haloalkyl, di-haloalkyl and tri-haloalkyl). Such groups include but are not limited to, chloromethyl, fluoromethyl, difluoromethyl, trifluoromethyl, chloro-fluoroalkyl, chloro- difluoroalkyl, and 2-fluoroisobutyl. “Alkoxy” or “alkoxyl” refers to an alkyl group as described herein (e.g., a C1-C6 alkyl group), which is attached to a molecule via oxygen atom. This includes moieties
where the alkyl part may be linear or branched, such as methoxy, ethoxy, n-propoxy, iso- propoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy and n-hexoxy. “Haloalkoxy” refers to an alkoxy group as described herein (e.g., a C1-C6 alkoxy group), in which one or more of the hydrogen atoms are replaced by a halogen (e.g., mono- haloalkoxy, di-haloalkoxy and tri-haloalkoxy). Such groups include but are not limited to, chloromethoxy, fluoromethoxy, difluoromethoxy, trifluoromethoxy, chloro-fluoroalkoxy, chloro-difluoroalkoxy, and 2-fluoroisobutoxy. “Oxo” refers to -(C=O)-. In some embodiments, an alkyl group is substituted with oxo. For example, an ethyl group (-CH2CH3) substituted with oxo is –(C=O)CH3. “Aryl” refers to a radical of a monocyclic or polycyclic (e.g., bicyclic or tricyclic) 4n+2 aromatic ring system (e.g., having 6, 10, or 14 π electrons shared in a cyclic array) having 6–14 ring carbon atoms and zero heteroatoms provided in the aromatic ring system (“C6-C14 aryl”). In some embodiments, an aryl group has six ring carbon atoms (“C6 aryl”; e.g., phenyl). In some embodiments, an aryl group has ten ring carbon atoms (“C10 aryl”; e.g., naphthyl such as 1–naphthyl and 2–naphthyl). In some embodiments, an aryl group has fourteen ring carbon atoms (“C14 aryl”; e.g., anthracyl). An aryl group may be described as, e.g., a C6-C10 aryl. Aryl groups include, but are not limited to, phenyl, naphthyl, indenyl, and tetrahydronaphthyl. As used herein, the term “arylene”, employed alone or in combination with other terms, refers to a divalent aryl linking group having 6 to 14 ring carbon atoms. Examples of arylene group include phenylene and naphthylene. “Heteroaryl” refers to a radical of a 5–14 membered monocyclic, bicyclic or tricyclic 4n+2 aromatic ring system (e.g., having 6, 10 or 14 π electrons shared in a cyclic array) having ring carbon atoms and 1–4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen and sulfur (“6–10 membered heteroaryl”). In heteroaryl groups that contain one or more nitrogen atoms, the point of attachment can be a carbon or nitrogen atom, as valency permits. Heteroaryl bicyclic ring systems can include one or more heteroatoms in one, two or three rings. “Heteroaryl” also includes ring systems wherein the heteroaryl ring, as defined above, is fused with one or more aryl groups wherein the point of attachment is either on the aryl or heteroaryl ring, and in such instances, the number of ring members designates the number of ring members in the fused (aryl/heteroaryl) ring system. Bicyclic
or tricylic heteroaryl groups wherein one ring does not contain a heteroatom (e.g., indolyl, quinolinyl, carbazolyl, and the like) the point of attachment can be on either ring, i.e., either the ring bearing a heteroatom (e.g., 2–indolyl) or the ring that does not contain a heteroatom (e.g., 5–indolyl). A heteroaryl group may be described as, e.g., a 6-10-membered heteroaryl, wherein the term “membered” refers to the non-hydrogen ring atoms within the moiety. As used herein, the term “heteroarylene”, employed alone or in combination with other terms, refers to a divalent heteroaryl linking group having 5 to 14 ring atoms. Examples of heteroarylene group include indolylene, pyridinylene, and quinolinylene. In some embodiments, a heteroaryl group is a 6–10 membered aromatic ring system having ring carbon atoms and 1–4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“6– 10 membered heteroaryl”). In some embodiments, a heteroaryl group is a 5–8 membered aromatic ring system having ring carbon atoms and 1–4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5–8 membered heteroaryl”). In some embodiments, a heteroaryl group is a 5–6 membered aromatic ring system having ring carbon atoms and 1–4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5–6 membered heteroaryl”). In some embodiments, the 5–6 membered heteroaryl has 1–3 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5–6 membered heteroaryl has 1–2 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5– 6 membered heteroaryl has 1 ring heteroatom selected from nitrogen, oxygen, and sulfur. In certain embodiments, the heteroaryl group is unsubstituted 5–14 membered heteroaryl. In certain embodiments, the heteroaryl group is substituted 5–14 membered heteroaryl. Exemplary 5–membered heteroaryl groups containing one heteroatom include, without limitation, pyrrolyl, furanyl and thiophenyl. Exemplary 5–membered heteroaryl groups containing two heteroatoms include, without limitation, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl. Exemplary 5–membered heteroaryl groups containing three heteroatoms include, without limitation, triazolyl, oxadiazolyl, and thiadiazolyl. Exemplary 5–membered heteroaryl groups containing four heteroatoms include, without limitation, tetrazolyl. Exemplary 6–membered heteroaryl groups
containing one heteroatom include, without limitation, pyridinyl. Exemplary 6–membered heteroaryl groups containing two heteroatoms include, without limitation, pyridazinyl, pyrimidinyl, and pyrazinyl. Exemplary 6–membered heteroaryl groups containing three or four heteroatoms include, without limitation, triazinyl and tetrazinyl, respectively. Exemplary 7–membered heteroaryl groups containing one heteroatom include, without limitation, azepinyl, oxepinyl, and thiepinyl. Exemplary 5,6–bicyclic heteroaryl groups include, without limitation, indolyl, isoindolyl, indazolyl, benzotriazolyl, benzothiophenyl, isobenzothiophenyl, benzofuranyl, benzoisofuranyl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzoxadiazolyl, benzthiazolyl, benzisothiazolyl, benzthiadiazolyl, indolizinyl, and purinyl. Exemplary 6,6–bicyclic heteroaryl groups include, without limitation, naphthyridinyl, pteridinyl, quinolinyl, isoquinolinyl, cinnolinyl, quinoxalinyl, phthalazinyl, and quinazolinyl. “Cycloalkyl” refers to a radical of a saturated or partially unsaturated cyclic hydrocarbon group having from 3 to 10 ring carbon atoms (“C3-C10 cycloalkyl”) and zero heteroatoms in the non–aromatic ring system. In some embodiments, a cycloalkyl group has, for example, 3 to 6 ring carbon atoms (“C3-C6 cycloalkyl”). Exemplary C3-C6 cycloalkyl groups include, without limitation, cyclopropyl (C3), cyclopropenyl (C3), cyclobutyl (C4), cyclobutenyl (C4), cyclopentyl (C5), cyclopentenyl (C5), cyclohexyl (C6), cyclohexenyl (C6), cyclohexadienyl (C6), and the like. “Cycloalkyl” also includes ring systems wherein the cycloalkyl ring, as defined above, is fused with one or more aryl groups wherein the point of attachment is on the cycloalkyl ring, and in such instances, the number of carbons continue to designate the number of carbons in the cycloalkyl ring system. “Cycloalkyl” also includes bridged ring systems, e.g, bicyclo[1.1.1]pentanyl, bicyclo[3.2.1]octanyl, adamantanyl, and the like. As used herein, the term “cycloalkylene”, employed alone or in combination with other terms, refers to a divalent cycloalkyl linking group having 3 to 10 ring carbon carbons. Examples of cycloalkylene groups include cyclopropylene and cyclohexylene. “Heterocyclyl” refers to a radical of a 4-12 membered saturated or partially unsaturated ring system having ring carbon atoms and 1 to 4 ring heteroatomic groups, wherein each heteroatomic group is independently selected from nitrogen, oxygen, sulfur and oxidized forms of sulfur (for example, S, S(O) and S(O)2), boron, phosphorus, and
silicon (“3–12 membered heterocyclyl”). In heterocyclyl groups that contain one or more nitrogen atoms, the point of attachment can be a carbon, nitrogen, phosphorus, or silicon atom, as valency permits. A heterocyclyl group can either be monocyclic (“monocyclic heterocyclyl”) or a fused, bridged, or spiro ring system such as a bicyclic system (“bicyclic heterocyclyl”). Heterocyclyl bicyclic ring systems can include one or more heteroatoms in one or both rings. “Heterocyclyl” also includes ring systems wherein the heterocyclyl ring, as defined above, is fused with one or more cycloalkyl groups wherein the point of attachment is either on the cycloalkyl or heterocyclyl ring, or ring systems wherein the heterocyclyl ring, as defined above, is fused with one or more aryl or heteroaryl groups, wherein the point of attachment is on the heterocyclyl ring, and in such instances, the number of ring members continue to designate the number of ring members in the heterocyclyl ring system. A heterocyclyl group may be described as, e.g., a 4-7-membered heterocyclyl, wherein the term “membered” refers to the non-hydrogen ring atoms, i.e., carbon, nitrogen, oxygen, and sulfur and oxidized forms of sulfur (for example, S, S(O) and S(O)2), within the moiety. As used herein, the term “heterocyclylene”, employed alone or in combination with other terms, refers to a divalent heterocyclyl linking group having 4 to 12 ring atoms. Examples of heterocyclylene groups include piperazinylene, tetrahydrofuranylene, and pyrrolidinylene. Exemplary 4–membered heterocyclyl groups containing one heteroatom include, without limitation, azetidinyl, oxetanyl and thietanyl. Exemplary 5–membered heterocyclyl groups containing one heteroatom include, without limitation, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothiophenyl, dihydrothiophenyl, pyrrolidinyl, dihydropyrrolyl and pyrrolyl–2,5–dione. Exemplary 5–membered heterocyclyl groups containing two heteroatoms include, without limitation, dioxolanyl, oxasulfuranyl, disulfuranyl, and oxazolidin–2–one. Exemplary 5–membered heterocyclyl groups containing three heteroatoms include, without limitation, triazolinyl, oxadiazolinyl, and thiadiazolinyl. Exemplary 6–membered heterocyclyl groups containing one heteroatom include, without limitation, piperidinyl, tetrahydropyranyl, dihydropyridinyl, and thianyl. Exemplary 6–membered heterocyclyl groups containing two heteroatoms include, without limitation, piperazinyl, morpholinyl, dithianyl, dioxanyl. Exemplary 6–membered heterocyclyl groups containing two heteroatoms include, without limitation, triazinanyl.
Exemplary 7–membered heterocyclyl groups containing one heteroatom include, without limitation, azepanyl, oxepanyl and thiepanyl. Exemplary 8–membered heterocyclyl groups containing one heteroatom include, without limitation, azocanyl, oxecanyl and thiocanyl. Exemplary 5–membered heterocyclyl groups fused to a C6 aryl ring (also referred to herein as a 5,6–bicyclic heterocyclic ring) include, without limitation, indolinyl, isoindolinyl, dihydrobenzofuranyl, dihydrobenzothienyl, benzoxazolinonyl, and the like. Exemplary 6– membered heterocyclyl groups fused to an aryl ring (also referred to herein as a 6,6– bicyclic heterocyclic ring) include, without limitation, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and the like. “Hydroxy” or “hydroxyl” refers to the radical -OH. Whenever a group is described as being “optionally substituted”, that group may be unsubstituted or substituted with one or more of the indicated substituents. Likewise, when a group is described as being “substituted” the substituent(s) may be selected from one or more the indicated substituents. If no substituents are indicated, it is meant that the indicated “optionally substituted” or “substituted” group may be substituted with one or more individually and independently selected group(s) that are stable and chemically acceptable for the group being substituted. Non-limiting examples of optional substituents are halogen, cyano, hydroxyl, nitro, sulfhydryl, amino, acyl, alkyl, hydroxyalkyl, aminoalkyl, haloalkyl, alkenyl, alkynyl, alkoxy, alkenoxy, alkynoxy, haloalkoxy, haloalkenoxy, haloalkynoxy, cycloalkyl, halocycloalkyl, cycloalkoxy, aryl, aryloxy, arylalkoxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclyloxy, aralkyl, cycloalkylalkyl, cycloalkylalkoxy, heteroaralkyl, alkoxyalkyl, heterocyclylalkyl, O- carbamyl, N-carbamyl, alkoxycarbonyl, C-amido, N-amido, alkyl phosphine oxide, SF5, S-sulfonamido, N-sulfonamido, C-carboxy, sulfoxide, and sulfone. In some embodiments one or more of the nitrogen atoms of a disclosed compound if present are oxidized to the corresponding N-oxide. The term "pharmaceutically acceptable salts" is meant to include salts that are prepared with relatively nontoxic acids or bases, depending on the particular substituents found on the compounds described herein. In some instances, pharmaceutically acceptable salts are obtained by reacting a compound having acidic group described herein with a base to form a salt such as an ammonium salt, an alkali metal salt, such as a sodium or a
potassium salt, an alkaline earth metal salt, such as a calcium or a magnesium salt, a salt of organic bases such as dicyclohexylamine, N-methyl-D-glucamine, tris(hydroxymethyl)methylamine, and salts with amino acids such as arginine, lysine, and the like, or by other methods previously determined. The pharmacologically acceptable salts not specifically limited as far as it can be used in medicaments. Examples of a salt that the compounds described herein form with a base include the following: salts thereof with inorganic bases such as sodium, potassium, magnesium, calcium, and aluminum; salts thereof with organic bases such as methylamine, ethylamine and ethanolamine; salts thereof with basic amino acids such as lysine and ornithine; and ammonium salt. The term “pharmaceutically acceptable excipients” refers to a carrier or an adjuvant that may be administered to a patient, together with a compound of the present disclosure, or a pharmaceutically acceptable salt, solvate, salt of the solvate or prodrug thereof, and which does not destroy the pharmacological activity thereof and is nontoxic when administered in doses sufficient to deliver a therapeutic amount of the compound. The term “tautomer” as used herein refers to compounds whose structures differ markedly in arrangement of atoms, but which exist in easy and rapid equilibrium, and it is to be understood that compounds provided herein may be depicted as different tautomers, and when compounds have tautomeric forms, all tautomeric forms are intended to be within the scope of the invention, and the naming of the compounds does not exclude any tautomer. An example of a tautomeric forms includes the following example: It will be apparent to one skilled in the art that certain compounds of this disclosure may exist in tautomeric forms, all such tautomeric forms of the compounds being within the scope of the disclosure. Compounds provided herein may also contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute such compounds. That is, an atom, in particular when mentioned in relation to a compound according to Formula (I), comprises all isotopes and isotopic mixtures of that atom, either naturally occurring or synthetically produced, either with natural abundance or in an isotopically enriched form. For example, when hydrogen is mentioned, it is understood to refer to 1H, 2H, 3H or mixtures thereof; when carbon is mentioned, it is understood to refer to 11C, 12C, 13C, 14C or mixtures thereof; when nitrogen is mentioned, it is understood to refer to 13N, 14N, 15N or mixtures thereof;
when oxygen is mentioned, it is understood to refer to 14O, 15O, 16O, 17O, 18O or mixtures thereof; and when fluoro is mentioned, it is understood to refer to 18F, 19F or mixtures thereof; unless expressly noted otherwise. For example, in deuteroalkyl and deuteroalkoxy groups, where one or more hydrogen atoms are specifically replaced with deuterium (2H). As some of the aforementioned isotopes are radioactive, the compounds provided herein therefore also comprise compounds with one or more isotopes of one or more atoms, and mixtures thereof, including radioactive compounds, wherein one or more non-radioactive atoms has been replaced by one of its radioactive enriched isotopes. Radiolabeled compounds are useful as additional agents, e.g., therapeutic agents, research reagents, e.g., assay reagents, and diagnostic agents, e.g., in vivo imaging agents. All isotopic variations of the compounds provided herein, whether radioactive or not, are intended to be encompassed within the scope of the present invention. In some embodiments, the compounds described herein (and pharmaceutically acceptable salts thereof) are isotopically labeled. In some embodiments, the compounds described herein (and pharmaceutically acceptable salts thereof) are isotopically labeled for PET imaging. In some embodiments, the compounds described herein (and pharmaceutically acceptable salts thereof) are isotopically labeled with 11C. “Treating” or “treatment” refers to reducing the symptoms or arresting or inhibiting further development of the disease (in whole or in part). “Treating” or “treatment” includes any effect, e.g., lessening, reducing, modulating, or eliminating, that results in the improvement of the disease and the like. For example, certain methods herein treat a histone deacetylase (HDAC)-associated disease by decreasing or reducing the progression, re-occurrence, or symptoms of the HDAC-associated disease. An “effective amount” is an amount sufficient to accomplish a stated purpose (e.g. achieve the effect for which it is administered, treat a disease, reduce protein activity, reduce or increase protein levels, or reduce one or more symptoms of a disease). An example of an “effective amount” is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which could also be referred to as a “therapeutically effective amount.” As defined herein, the term “inhibition”, “inhibit”, “inhibiting” and the like in reference to a protein-inhibitor (e.g., antagonist) interaction means negatively affecting
(e.g., decreasing) the activity or function of the protein relative to the activity or function of the protein in the absence of the inhibitor. In some embodiments, inhibition refers to reduction in the progression of a disease and/or symptoms of disease. In some embodiments, inhibition refers to a reduction in the activity of a signal transduction pathway or signaling pathway. Thus, inhibition includes, at least in part, partially or totally blocking stimulation, decreasing, preventing, or delaying activation, or inactivating, desensitizing, or down-regulating signal transduction or enzymatic activity or the amount of a protein. In some embodiments, inhibition refers to a decrease in the activity of HDAC- 11 or HDAC-6. A “subject,” as used herein, refers to a living organism suffering from or prone to a disease that can be treated by administration of a compound or pharmaceutical composition, as provided herein. Non-limiting examples include mammals such as humans. In some embodiments, a subject is human. In some embodiments, the subject is a pediatric subject (e.g., a subject 21 years of age or less). “HDAC”, as used herein, means histone deacetylase, and the number following, e.g., HDAC-11, refers to isoform 11. The term “HDAC-associated disease” as used herein refers to diseases associated with epigenetic regulation of histone and other protein substrates. Non-limiting examples of HDAC-associated diseases include cancer, neurological diseases, metabolic/endocrine disorders, inflammatory diseases, immunological disorders, cardiovascular diseases, and pulmonary diseases. Diseases associated with HDAC-11 specifically include Hodgkin lymphoma, neuroblastoma, various other cancers (hepatocellular, prostate, ovarian, pituitary, pancreatic, and myeloma), hepatic steatosis (fatty liver disease), insulin resistance, hypercholesterolemia, multiple sclerosis, schizophrenia, frontotemporal dementia (FTD), age-related macular degeneration, and fragile X tremor ataxia syndrome (FXTAS). Based on the high expression of HDAC11 in neurons, and specifically in the hippocampus, HDAC11 could have potential roles in memory and learning and recovery from traumatic brain injuries. Modulation of HDAC-11 levels after drug and alcohol intake also implicate use in drug addiction disorders.
Compounds Some embodiments provide a compound of Formula (I):
or a pharmaceutically acceptable salt thereof, wherein: Q is a bond or -NH-; L is -NH(C=O)(C1-C4 alkyl)-*, -O-(C1-C6 alkyl)-*, -(C=O)-, and -(C1-C4 alkyl)-, wherein “*” indicates the point of attachment to N; R1 is -OH, -C1-C4 haloalkyl, and -NH(C1-C4 alkyl); R2 is halogen, -OH, C1-C6 alkyl, and C1-C6 alkoxy; R3 is hydrogen, C1-C6 alkenyl, and C1-C6 alkyl optionally substituted with C3- C6 cycloalkyl; R4 is C1-C4 alkyl, phenyl, 9-15 membered heteroaryl, 9-15 membered heterocyclyl, each optionally substituted with 1-2 R4a; or R3 and R4 taken together with the nitrogen to which each is bound join to form a 9-13 membered heterocyclyl or 9-10 membered heteroaryl, each optionally substituted with R5; each R4a is halogen, C1-C6 alkyl, C1-C6 alkoxy, C6-C10 cycloalkyl, oxo, and - (C=O)NH(C1-C4 alkyl optionally substituted with C6-C10 cycloalkyl); R5 is -(C=O)NR5aR5b, -NR5cR5d, -(CH2)NR5eR5f, and C1-C4 alkyl optionally substituted with C6-C10 cycloalkyl; R5a, R5b, R5c, R5d, R5e and R5f are each hydrogen, C1-C6 alkyl and C1-C6 alkenyl, each optionally substituted with oxo and/or C6-C10 cycloalkyl; and n is 0 or 1. In some embodiments, Q is a bond. In some embodiments, Q is -NH-. In some embodiments, L is -NH(C=O)(C1-C4 alkyl)-*, wherein “*” indicates the point of attachment to N.
In some embodiments, L is -O-(C1-C6 alkyl)-*, wherein “*” indicates the point of attachment to N. In some embodiments, L is -(C=O)-. In some embodiments, L is -(C1-C4 alkyl)-. In some embodiments, R1 is -OH. In some embodiments, R1 is -C1-C4 haloalkyl. In some embodiments, R1 is -NH(C1-C4 alkyl). In some embodiments, R2 is halogen. In some embodiments, R2 is -OH. In some embodiments, R2 is C1-C6 alkyl. In some embodiments, R2 is C1-C6 alkoxy. In some embodiments, R3 is hydrogen. In some embodiments, R3 is C1-C6 alkenyl. In some embodiments, R3 is C1-C6 alkyl optionally substituted with C3-C6 cycloalkyl. In some embodiments, R4 is C1-C4 alkyl optionally substituted with 1-2 R4a. In some embodiments, R4 is phenyl optionally substituted with 1-2 R4a. In some embodiments, R4 is 9-15 membered heteroaryl optionally substituted with 1-2 R4a. In some embodiments, R4 is 9-15 membered heterocyclyl optionally substituted with 1-2 R4a. In some embodiments, R3 and R4 taken together with the nitrogen to which each is bound join to form a 9-13 membered heterocyclyl or 9-10 membered heteroaryl, each optionally substituted with R5. In some embodiments, R3 and R4 taken together with the nitrogen to which each is bound join to form a 9-13 membered heterocyclyl optionally substituted with R5. In some embodiments, R3 and R4 taken together with the nitrogen to which each is bound join to form an unsubstituted 9-13 membered heterocyclyl. In some embodiments, R3 and R4 taken together with the nitrogen to which each is bound join to form a 9-10 membered heteroaryl optionally substituted with R5.
In some embodiments, the 9-10 membered heteroaryl is selected from indolyl, azaindolyl, quinazolinedionyl, and benzimidazoly. In some embodiments, the 9-10 membered heteroaryl is selected from the group consisting of indolyl, pyrrolo[2,3-b]pyridinyl, benzo[d]imidazolyl, and quinazoline-2,4- dione. In some embodiments, the 9-10 membered heteroaryl is indolyl substituted with R5. In some embodiments, the 9-10 membered heteroaryl is pyrrolo[2,3-b]pyridinyl substituted with R5. In some embodiments, the 9-10 membered heteroaryl is benzo[d]imidazolyl substituted with R5. In some embodiments, the 9-10 membered heteroaryl is quinazoline-2,4-dione substituted with R5. In some embodiments, at least one R4a is halogen. In some embodiments, at least one R4a is C1-C6 alkyl. In some embodiments, at least one R4a is C1-C6 alkoxy. In some embodiments, at least one R4a is C6-C10 cycloalkyl. In some embodiments, at least one R4a is oxo. In some embodiments, at least one R4a is -(C=O)NH(C1-C4 alkyl optionally substituted with C6-C10 cycloalkyl). In some embodiments, R5 is -(C=O)NR5aR5b. In some embodiments, R5 is -NR5cR5d. In some embodiments, R5 is -(CH2)NR5eR5f. In some embodiments, R5 is C1-C4 alkyl optionally substituted with C6-C10 cycloalkyl. In some embodiments, one of R5a and R5b is hydrogen and the other one of R5a and R5b is C1-C6 alkyl substituted with oxo and/or C6-C10 cycloalkyl. In some embodiments, one of R5c and R5d is hydrogen and the other one of R5c and R5d is C1-C6 alkyl substituted with oxo and/or C6-C10 cycloalkyl. In some embodiments, one of R5c and R5d is hydrogen and the other one of R5c and R5d is C1-C6 alkenyl substituted with oxo and/or C6-C10 cycloalkyl.
In some embodiments, one of R5e and R5f is hydrogen and the other one of R5e and R5f is C1-C6 alkyl substituted with oxo and/or C6-C10 cycloalkyl. In some embodiments, one of R5a, R5b, R5c, R5d, R5e and R5f is C1-C6 alkyl substituted with oxo and/or adamantly. In some embodiments, one of R5a, R5b, R5c, R5d, R5e and R5f is C1-C6 alkenyl substituted with oxo and/or adamantly. In some embodiments, n is 0. In some embodiments, n is 1. In some embodiments, Formula (I) is (I-a):
or a pharmaceutically acceptable salt thereof. In some embodiments, Formula (I) is (I-b):
or a pharmaceutically acceptable salt thereof, wherein ring A is 9-13 membered heterocyclyl optionally substituted with R5. In some embodiments, Formula (I) is (I-c):
or a pharmaceutically acceptable salt thereof. In some embodiments, Formula (I) is (I-d):
or a pharmaceutically acceptable salt thereof.
In some embodiments, Formula (I) is (I-e):
or a pharmaceutically acceptable salt thereof, wherein ring B is 9-10 membered heteroaryl optionally substituted with R5.
In some embodiments, Formula (I) is (I-f):
or a pharmaceutically acceptable salt thereof, wherein X is CH or N.
In some embodiments, Formula (I) is (I-h):
or a pharmaceutically acceptable salt thereof.
In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is selected from the compounds in Table 1A, or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is selected from the compounds in Table 1B, or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is selected from the compounds in Table 1A, or a pharmaceutically acceptable salt thereof, wherein the compound is isotopically labeled. In some embodiments, the compound is isotopically labeled with 11C. In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is selected from the compounds in Table 1B, or a pharmaceutically acceptable salt thereof, wherein the compound is isotopically labeled. In some embodiments, the compound is isotopically labeled with 11C. In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is PB94, or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is PB94. In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is [11C]PB94, or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is [11C]PB94.
Pharmaceutical Compositions
Some embodiments provide a pharmaceutical composition comprising a compound of Formula (I), or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable excipients.
Some embodiments provide a pharmaceutical composition comprising a compound described in Table 1A, or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable excipients. Some embodiments provide a pharmaceutical composition comprising a compound described in Table 1B, or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable excipients.
Methods of Treatment
Some embodiments provide a method of treating an HDAC-associated disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
Some embodiments provide a method of treating an HDAC-associated disease in a subject, comprising (a) determining that the subject has an HDAC-associated disease, and (b) administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
Some embodiments provide a method of treating an HDAC-associated disease in a subject previously identified or diagnosed as having an HDAC-associated disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
Some embodiments provide a method of treating an HDAC-associated disease in a subject previously determined to have an HDAC-associated disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
Some embodiments provide a method of treating an HDAC-associated disease in a subject suspected of having an HDAC-associated disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
Some embodiments provide a method of treating an HDAC-associated disease in a subject with a clinical record indicating a diagnosis of an HDAC-associated disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
Some embodiments provide a method of treating an HDAC-associated disease in a subject at risk of developing an HDAC-associated disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. In some embodiments, the HDAC-associated disease is an HDAC-11-associated disease. In some embodiments, the HDAC-associated disease is an HDAC-6-associated disease. In some embodiments, the HDAC-associated disease is cancer. In some embodiments, the cancer is a solid tumor. In some embodiments, the cancer is a blood cancer. In some embodiments, the cancer is a leukemia, lymphoma, or myeloma. In some embodiments, the cancer is a leukemia. In some embodiments, the cancer is a lymphoma. In some embodiments, the cancer is a myeloma. In some embodiments, the cancer is selected from the group consisting of: Hodgkin’s lymphoma, non-Hodgkin’s lymphoma, neuroblastoma, hepatocellular carcinoma, prostate cancer, ovarian cancer, pituitary cancer, pancreatic cancer, multiple myeloma, lung cancer (including SCLC and NSCLC), cutaneous T-cell lymphoma (CTCL), breast cancer, myelodysplastic syndromes, chronic myelomonocytic leukemia (CMML), diffuse large B-cell lymphoma (DLBCL), gastric cancer, and esophageal squamous cell carcinoma (ESCC). In some embodiments, the HDAC-associated disease is pain. In some embodiments, the pain is selected from the group consisting of: neuropathic pain, acute pain, chronic pain, nociceptive pain, and radicular pain. In some embodiments, the pain is neuropathic pain. In some embodiments, the pain is acute pain. In some embodiments, the pain is chronic pain. In some embodiments, the pain is nociceptive pain. In some embodiments, the pain is radicular pain. In some embodiments, the HDAC-associated disease is a neurodegenerative disorder. In some embodiments, the neurodegenerative disorder is selected from the group consisting of: multiple sclerosis, frontotemporal dementia (FTD), Alzheimer’s disease ataxia, Huntington’s disease, Parkinson’s disease, motor neuron disease, multiple system
atrophy, progressive supranuclear palsy, dementia with Lewy bodies and amyotrophic lateral sclerosis (ALS). In some embodiments, the HDAC-associated disease is selected from the group consisting of: neuropathic pain, Hodgkin’s lymphoma, neuroblastoma, hepatocellular carcinoma, prostate cancer, ovarian cancer, pituitary cancer, pancreatic cancer, multiple myeloma, hepatic steatosis (e.g., non-alcoholic fatty liver disease (NAFLD) or non- alcoholic steatohepatitis (NASH)), insulin resistance, hypercholesterolemia, multiple sclerosis, schizophrenia, frontotemporal dementia (FTD), age-related macular degeneration, and fragile X tremor ataxia syndrome (FXTAS). In some embodiments, the HDAC-associated disease is selected from the group consisting of: Hodgkin’s lymphoma, neuroblastoma, hepatocellular carcinoma, prostate cancer, ovarian cancer, pituitary cancer, pancreatic cancer, and multiple myeloma. In some embodiments, the HDAC-associated disease is Hodgkin’s lymphoma. In some embodiments, the HDAC-associated disease is neuroblastoma. In some embodiments, the HDAC-associated disease is hepatocellular carcinoma. In some embodiments, the HDAC-associated disease is prostate cancer. In some embodiments, the HDAC-associated disease is ovarian cancer. In some embodiments, the HDAC-associated disease is pituitary cancer. In some embodiments, the HDAC-associated disease is pancreatic cancer. In some embodiments, the HDAC-associated disease is multiple myeloma. In some embodiments, the HDAC-associated disease is hepatic steatosis. In some embodiments, the hepatic steatosis is NAFLD. In some embodiments, the hepatic steatosis is NASH. In some embodiments, the HDAC-associated disease is insulin resistance. In some embodiments, the HDAC-associated disease is hypercholesterolemia. In some embodiments, the HDAC-associated disease schizophrenia. In some embodiments, the HDAC-associated disease is multiple sclerosis. In some embodiments, the HDAC-associated disease is frontotemporal dementia (FTD). In some embodiments, the HDAC-associated disease is neuropathic pain.
In some embodiments, the HDAC-associated disease is age-related macular degeneration. In some embodiments, the HDAC-associated disease is fragile X tremor ataxia syndrome (FXTAS). Some embodiments provide a method of treating multiple sclerosis in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating multiple sclerosis in a subject, comprising (a) determining that the subject has multiple sclerosis, and (b) administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating multiple sclerosis in a subject previously identified or diagnosed as having multiple sclerosis, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating multiple sclerosis in a subject previously determined to have multiple sclerosis, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating multiple sclerosis in a subject suspected of having multiple sclerosis, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating multiple sclerosis in a subject with a clinical record indicating a diagnosis of multiple sclerosis, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
Some embodiments provide a method of treating multiple sclerosis in a subject at risk of developing multiple sclerosis, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating frontotemporal dementia (FTD) in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating frontotemporal dementia (FTD) in a subject, comprising (a) determining that the subject has frontotemporal dementia (FTD), and (b) administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating frontotemporal dementia (FTD) in a subject previously identified or diagnosed as having frontotemporal dementia (FTD), comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating frontotemporal dementia (FTD) in a subject previously determined to have frontotemporal dementia (FTD), comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating frontotemporal dementia (FTD) in a subject suspected of having frontotemporal dementia (FTD), comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating frontotemporal dementia (FTD) in a subject with a clinical record indicating a diagnosis of frontotemporal dementia (FTD), comprising administering to the subject a therapeutically effective amount of a compound
of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating frontotemporal dementia (FTD) in a subject at risk of developing frontotemporal dementia (FTD), comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating neuropathic pain in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating neuropathic pain in a subject, comprising (a) determining that the subject has neuropathic pain, and (b) administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating neuropathic pain in a subject previously identified or diagnosed as having neuropathic pain, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating neuropathic pain in a subject previously determined to have neuropathic pain, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating neuropathic pain in a subject suspected of having neuropathic pain, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating neuropathic pain in a subject with a clinical record indicating a diagnosis of neuropathic pain, comprising administering to
the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating neuropathic pain in a subject at risk of developing neuropathic pain, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating cancer in a subject, comprising (a) determining that the subject has cancer, and (b) administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating cancer in a subject previously identified or diagnosed as having cancer, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating cancer in a subject previously determined to have cancer, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating cancer in a subject suspected of having cancer, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating cancer in a subject with a clinical record indicating a diagnosis of cancer, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
Some embodiments provide a method of treating cancer in a subject at risk of developing cancer, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating a neurodegenerative disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating a neurodegenerative disease in a subject, comprising (a) determining that the subject has a neurodegenerative disease, and (b) administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating a neurodegenerative disease in a subject previously identified or diagnosed as having a neurodegenerative disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating a neurodegenerative disease in a subject previously determined to have a neurodegenerative disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating a neurodegenerative disease in a subject suspected of having a neurodegenerative disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating a neurodegenerative disease in a subject with a clinical record indicating a diagnosis of a neurodegenerative disease, comprising administering to the subject a therapeutically effective amount of a compound
of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
Some embodiments provide a method of treating a neurodegenerative disease in a subject at risk of developing a neurodegenerative disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
Some embodiments provide a method of inhibiting HDAC activity in a cell comprising an HDAC protein, comprising contacting the cell with an effective amount of a compound of Formula (I). In some embodiments, the cell is a human cell. In some embodiments, the cell is a neural cell. In some embodiments, the cell is a human neural cell. In some embodiments, the contacting occurs in vitro. In some embodiments, the contacting occurs in vivo. In some embodiments, the contacting occurs in vivo in the central nervous system (CNS) of a subject.
In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, used in the methods described herein, is selected from the compounds in Table 1A, or a pharmaceutically acceptable salt thereof.
In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, used in the methods described herein, is selected from the compounds in Table 1B, or a pharmaceutically acceptable salt thereof.
In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, used in the methods described herein, is PB94, or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, used in the methods described herein, is PB94.
In some embodiments, the compounds described herein are selective for HDAC11 over other HDACs, such as HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9 and/or HDAC10, as measured in an assay described herein or other similar assays to measure HDAC11 inhibitory activity or designed to test similar activity and/or binding. An HDAC11 inhibitor as described herein can be about 2-fold to about 10,000-fold, or more, selective for HDAC11, for example, about 2-fold, about 10-
fold, about 50-fold, about 100-fold, about 200 fold, about 300-fold, about 400-fold, about 500-fold, about 600-fold, about 700-fold, about 800-fold, about 900-fold, about 1,000-fold, about 1,500-fold, about 2,000-fold, about 2,500-fold, about 3,000-fold, about 3,500-fold, about 4,000-fold, about 4,500-fold, about 5,000-fold, about 5,500-fold, about 6,000-fold, about 6,500-fold, about 7,000-fold, about 7,500-fold, about 8,000-fold, about 8,500-fold, about 9,000-fold, about 9,500-fold, or about 10,000-fold selective for HDAC11. In some embodiments, an HDAC11 inhibitor is selective for HDAC11 by about 2-fold to about 20- fold, about 5-fold to about 50-fold, about 10-fold to about 100-fold, about 20-fold to about 200-fold, about 50-fold to about 500-fold, about 100-fold to about 1,000 fold, about 200- fold to about 2,000-fold, about 300-fold to about 3,000-fold, about 400-fold to about 4,000 fold, about 500-fold to about 5,000-fold, about 600-fold to about 6,000-fold, about 700- fold to about 7,000 fold, about 800-fold to about 8,000-fold, about 900-fold to about 9,000- fold, or about 1,000-fold to about 10,000 fold. In some embodiments, the compounds described herein are selective for HDAC6 over other HDACs, such as HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC7, HDAC8, HDAC9, HDAC10, and/or HDAC11, as measured in an assay described herein or other similar assays to measure HDAC6 inhibitory activity or designed to test similar activity and/or binding. An HDAC6 inhibitor as described herein can be about 2-fold to about 10,000-fold, or more, selective for HDAC6, for example, about 2-fold, about 10- fold, about 50-fold, about 100-fold, about 200 fold, about 300-fold, about 400-fold, about 500-fold, about 600-fold, about 700-fold, about 800-fold, about 900-fold, about 1,000-fold, about 1,500-fold, about 2,000-fold, about 2,500-fold, about 3,000-fold, about 3,500-fold, about 4,000-fold, about 4,500-fold, about 5,000-fold, about 5,500-fold, about 6,000-fold, about 6,500-fold, about 7,000-fold, about 7,500-fold, about 8,000-fold, about 8,500-fold, about 9,000-fold, about 9,500-fold, or about 10,000-fold selective for HDAC6. In some embodiments, an HDAC6 inhibitor is selective for HDAC6 by about 2-fold to about 20- fold, about 5-fold to about 50-fold, about 10-fold to about 100-fold, about 20-fold to about 200-fold, about 50-fold to about 500-fold, about 100-fold to about 1,000 fold, about 200- fold to about 2,000-fold, about 300-fold to about 3,000-fold, about 400-fold to about 4,000 fold, about 500-fold to about 5,000-fold, about 600-fold to about 6,000-fold, about 700- fold to about 7,000 fold, about 800-fold to about 8,000-fold, about 900-fold to about 9,000-
fold, or about 1,000-fold to about 10,000 fold. In some embodiments, the compounds described herein are selective for HDAC6 and HDAC11 over other HDACs, such as HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC7, HDAC8, HDAC9, and/or HDAC10, as measured in an assay described herein or other similar assays to measure HDAC6 and HDAC11 inhibitory activity or designed to test similar activity and/or binding. An HDAC6 and HDAC11 inhibitor as described herein can be about 2-fold to about 10,000-fold, or more, selective for HDAC6 and HDAC11, for example, about 2-fold, about 10-fold, about 50-fold, about 100-fold, about 200 fold, about 300-fold, about 400-fold, about 500-fold, about 600-fold, about 700-fold, about 800-fold, about 900-fold, about 1,000-fold, about 1,500-fold, about 2,000-fold, about 2,500-fold, about 3,000-fold, about 3,500-fold, about 4,000-fold, about 4,500-fold, about 5,000-fold, about 5,500-fold, about 6,000-fold, about 6,500-fold, about 7,000-fold, about 7,500-fold, about 8,000-fold, about 8,500-fold, about 9,000-fold, about 9,500-fold, or about 10,000- fold selective for HDAC6 and HDAC11. In some embodiments, an HDAC6 and HDAC11 inhibitor is selective for HDAC6 and HDAC11 by about 2-fold to about 20-fold, about 5- fold to about 50-fold, about 10-fold to about 100-fold, about 20-fold to about 200-fold, about 50-fold to about 500-fold, about 100-fold to about 1,000 fold, about 200-fold to about 2,000-fold, about 300-fold to about 3,000-fold, about 400-fold to about 4,000 fold, about 500-fold to about 5,000-fold, about 600-fold to about 6,000-fold, about 700-fold to about 7,000 fold, about 800-fold to about 8,000-fold, about 900-fold to about 9,000-fold, or about 1,000-fold to about 10,000 fold. A number of embodiments of the present disclosure have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the disclosure. Accordingly, other embodiments are within the scope of the following claims. EXAMPLES All commercially available chemical reagents and solvents were ordered from commercial suppliers in ACS–grade purity or higher and directly used without further purification. Tubastatin A was purchased from MedChemExpress. NMR spectra were collected in a JEOL JNM-ECZ500R Spectrometer at room temperature (500 MHz (1H),
471 MHz (19F), and 126 MHz (13C)). Chemical shifts were given in δ values (ppm), using tetramethylsilane (TMS) as the internal standard. Mass spectrometry data were recorded on an Agilent 6310 ion trap mass spectrometer (ESI source) connected to an Agilent 1200 series HPLC with a quaternary pump, vacuum degasser, diode-array detector, and autosampler. Analytical HPLC was carried out on an Agilent 1200 series under the following conditions: : column (Agilent C18, 1.8 μm, 2.1×100 mm), mobile phase = 0.1% TFA in water / 0.1% TFA in acetonitrile at a flow rate of 1.0 mL/min for 11 min, gradient method. The purities of all tested compounds were >95%, as determined by analytical HPLC. All animal studies were carried out at Massachusetts General Hospital (PHS Assurance of Compliance No. A3596–01). The Subcommittee on Research Animal Care (SRAC) serves as the Institutional Animal Care and Use Committee (IACUC) for the Massachusetts General Hospital (MGH). SRAC reviewed and approved all procedures detailed herein. [11C]CO2 (1.2 Ci) was obtained via the 14N (p, α) 11C reaction on nitrogen with 2.5% oxygen, with 11 MeV protons (Siemens Eclipse cyclotron, Siemens Healthcare GmbH, Erlangen, Germany), and trapped on molecular sieves in a TRACERlab FX-MeI synthesizer (General Electric, GE Healthcare, Boston, MA, USA). [11C]CH4 was obtained by the reduction of [11C]CO2 in the presence of Ni/hydrogen at 350 °C and recirculated through an oven containing I2 to produce [11C]CH3I via a radical reaction. Scheme 1. Synthetic routes of analogues 4a-jĮ
N-(((3r,5r,7r)-adamantan-1-yl)methyl)-1H-indole-5-carboxamide (2). To a mixture of 1H-indole-5-carboxylic acid (1, 1 g, 6.2 mmol) and EDCI (1.02 g, 6.2 mmol) in dichloromethane (30 mL) was added adamantan-1-ylmethanamine (1.4 g, 1.4 mmol). The mixture was stirred at room temperature for 6-8 hours, and the reaction was monitored by TLC. After the complete consumption of compound 1, the residue was concentrated under vacuum and extracted with EtOAc (3× 30 mL). The combined organic layers were washed with H2O (2× 30 mL) and brine (15 mL), dried over sodium sulfate, filtered, and concentrated under a vacuum. The crude product was purified via Combi-Flash column chromatography (EtOAc/hexane = 0-100%) to afford compound 2 in 62% yield.1H NMR (500 MHz, Chloroform-d) δ 8.44 (s, 1H), 8.08 (d, J = 1.7 Hz, 1H), 7.65 (dd, J = 8.6, 1.7 Hz, 1H), 7.41 (d, J = 8.5 Hz, 1H), 7.27 (t, J = 2.7 Hz, 1H), 6.62 (t, J = 2.7 Hz, 1H), 6.20 (t, J = 6.5 Hz, 1H), 3.19 (d, J = 6.1 Hz, 2H), 1.21 – 1.97 (m, 3H), 1.72 (dt, J = 12.5, 3.2 Hz, 3H), 1.67 – 1.63 (m, 3H), 1.58 (br s, 6H). MS (ESI+): 309.2 (M + H)+ General procedure for the synthesis of compounds 3a-j. To a mixture of 2 (100 mg, 0.32 mmol) and NaH (15.5 mg, 0.64 mmol) in THF (5 mL) was added the corresponding benzoic bromine derivative (0.38 mmol). The mixture
was stirred at room temperature overnight. After the complete consumption of compound 2, the residue was concentrated under vacuum and extracted with EtOAc (3× 30 mL), and the combined organic layers were washed with H2O (2× 30 mL) and brine (15 mL), dried over sodium sulfate, filtered, and concentrated under vacuum. The crude product was purified via Combi-Flash column chromatography (EtOAc/hexane = 0-100%) to afford compounds 3a-j. Methyl 4-((5-((((3r,5r,7r)-adamantan-1-yl)methyl)carbamoyl)-1H-indol-1- yl)methyl)benzoate (3a). White solid; Yield: 57.1%. 1H NMR (500 MHz, Chloroform-d) δ 1H NMR (500 MHz, Chloroform-d) δ 8.10 (s, 1H), 7.72 (d, J = 8.0 Hz, 1H), 7.65 (dd, J = 8.6, 1.8 Hz, 1H), 7.22 (s, 1H), 7.17 (d, J = 3.1 Hz, 1H), 6.65 (dd, J = 8.1, 2.1 Hz, 2H), 6.62 (s, 1H), 6.18 (t, J = 6.3 Hz, 1H), 5.36 (s, 2H), 3.86 (s, 3H), 3.18 (d, J = 6.2 Hz, 2H), 2.02 – 1.97 (m, 3H), 1.72 (s, 3H), 1.64 (s, 3H), 1.58 – 1.54 (m, 6H). MS (ESI+): 457.3 (M + H)+. Methyl 4-((5-((((3r,5r,7r)-adamantan-1-yl)methyl)carbamoyl)-1H-indol-1- yl)methyl)-3-fluorobenzoate (3b). White solid; Yield: 52.4%. 1H NMR (500 MHz, Chloroform-d) δ 1H NMR (500 MHz, Chloroform-d) δ 8.10 (d, J = 1.7 Hz, 1H), 7.71 (d, J = 8.0 Hz, 1H), 7.61 (dd, J = 8.6, 1.7 Hz, 1H), 7.18 (d, J = 3.1 Hz, 1H), 6.65 (dd, J = 8.1, 2.1 Hz, 2H), 6.61 (s, 1H), 6.18 (t, J = 6.3 Hz, 1H), 5.35 (s, 2H), 3.85 (s, 3H), 3.74 (s, 3H), 3.18 (d, J = 6.2 Hz, 2H), 2.02 – 1.97 (m, 3H), 1.70 (s, 3H), 1.63 (s, 3H), 1.57 (d, J = 2.9 Hz, 6H). MS (ESI+): 475.2 (M + H)+. Methyl 4-((5-((((3r,5r,7r)-adamantan-1-yl)methyl)carbamoyl)-1H-indol-1- yl)methyl)-2-fluorobenzoate (3c). White solid; Yield: 58.8%. 1H NMR (500 MHz, Chloroform-d) δ 1H NMR (500 MHz, Chloroform-d) δ 8.10 (s, 1H), 7.74 (s, 1H), 7.68 (dd, J = 8.6, 1.8 Hz, 1H), 7.27 (d, J = 3.8 Hz, 1H), 6.65 (dd, J = 8.1, 2.1 Hz, 2H), 6.61 (s, 1H), 6.18 (t, J = 6.3 Hz, 1H), 5.38 (s, 2H), 3.87 (s, 3H), 3.19 (d, J = 6.2 Hz, 2H), 2.12 – 1.99 (m, 3H), 1.74 (s, 3H), 1.66 – 1.64 (m, 3H), 1.57 – 1.54 (m, 6H). MS (ESI+): 475.2 (M + H)+. Methyl 4-((5-((((3r,5r,7r)-adamantan-1-yl)methyl)carbamoyl)-1H-indol-1- yl)methyl)-3-methoxybenzoate (3d). White solid; Yield: 62.5%. 1H NMR (500 MHz, Chloroform-d) δ 1H NMR (500 MHz, Chloroform-d) δ 8.11 (s, 1H), 7.73 (s, 1H), 7.68 (dd, J = 8.6, 1.5 Hz, 1H), 7.27 (d, J = 3.2 Hz, 1H), 6.66 (dd, J = 7.1, 2.1 Hz, 2H), 6.64 (t, J =
2.3 Hz, 1H), 6.16 (t, J = 6.3 Hz, 1H), 5.36 (s, 2H), 3.87 (s, 3H), 3.77 (s, 3H), 3.15 (d, J = 6.2 Hz, 2H), 2.11 – 1.96 (m, 3H), 1.77 – 1.74 (m, 3H), 1.65 – 1.62 (m, 3H), 1.56 – 1.54 (m, 6H). MS (ESI+): 487.2 (M + H)+. Methyl 4-((5-((((3r,5r,7r)-adamantan-1-yl)methyl)carbamoyl)-1H-indol-1- yl)methyl)-2-methoxybenzoate (3e). White solid; Yield: 55.3%. 1H NMR (500 MHz, Chloroform-d) δ 1H NMR (500 MHz, Chloroform-d) δ 8.10 (s, 1H), 7.77 (s, 1H), 7.61 (dd, J = 7.8, 1.4 Hz, 1H), 7.24 (d, J = 1.2 Hz, 1H), 6.65 (dd, J = 7.5, 2.2 Hz, 2H), 6.64 (t, J = 1.8 Hz, 1H), 6.12 (t, J = 6.3 Hz, 1H), 5.32 (s, 2H), 3.87 (s, 3H), 3.85 (s, 3H), 3.14 (d, J = 6.2 Hz, 2H), 2.13 – 1.97 (m, 3H), 1.75 – 1.72 (m, 3H), 1.66 – 1.63 (m, 3H), 1.55 – 1.51 (m, 6H). MS (ESI+): 487.2 (M + H)+. Methyl 4-((5-((((3r,5r,7r)-adamantan-1-yl)methyl)carbamoyl)-1H-indol-1- yl)methyl)-2-methylbenzoate (3f). White solid; Yield: 50.5%. 1H NMR (500 MHz, Chloroform-d) δ 1H NMR (500 MHz, Chloroform-d) δ 8.10 (s, 1H), 7.76 (s, 1H), 7.63 (dd, J = 7.8, 1.5 Hz, 1H), 7.25 (d, J = 1.8 Hz, 1H), 6.65 (dd, J = 7.1, 1.2 Hz, 2H), 6.61 (t, J = 1.8 Hz, 1H), 6.12 (t, J = 6.3 Hz, 1H), 5.32 (s, 2H), 3.86 (s, 3H), 3.13 (d, J = 6.8 Hz, 2H), 2.22 (s, 3H), 1.92 (s, 3H), 1.77 – 1.74 (m, 3H), 1.66 – 1.64 (m, 3H), 1.55 – 1.52 (m, 6H). MS (ESI+): 471.2 (M + H)+. Methyl 4-((5-((((3r,5r,7r)-adamantan-1-yl)methyl)carbamoyl)-1H-indol-1- yl)methyl)-2-hydroxybenzoate (3g). White solid; Yield: 46.2%. 1H NMR (500 MHz, Chloroform-d) δ 1H NMR (500 MHz, Chloroform-d) δ 8.10 (s, 1H), 7.76 (d, J = 7.2, 2.5 Hz, 1H), 7.62 (dd, J = 7.1, 1.5 Hz, 1H), 7.24 (s, 1H), 6.62 (dd, J = 7.1, 1.2 Hz, 2H), 6.59 (t, J = 1.8 Hz, 1H), 6.17 (t, J = 6.3 Hz, 1H), 5.35 (s, 2H), 3.86 (s, 3H), 3.14 (d, J = 6.8 Hz, 2H), 2.22 – 1.94 (m, 3H), 1.76 – 1.74 (m, 3H), 1.66 – 1.61 (m, 3H), 1.56 – 1.51 (m, 6H).MS (ESI+): 473.2 (M + H)+. Methyl 4-((5-((((3r,5r,7r)-adamantan-1-yl)methyl)carbamoyl)-1H-indol-1- yl)methyl)-2-ethoxybenzoate (3h). White solid; Yield: 52.8%. 1H NMR (500 MHz, Chloroform-d) δ 1H NMR (500 MHz, Chloroform-d) δ 8.11 (s, 1H), 7.74 (d, J = 7.6, 1.5 Hz, 1H), 7.62 (dd, J = 7.1, 1.2 Hz, 1H), 7.23 (s, 1H), 6.62 (dd, J = 7.5, 1.2 Hz, 2H), 6.61 (s, 1H), 6.15 (t, J = 6.5 Hz, 1H), 5.32 (s, 2H), 3.85 (s, 3H), 3.68 – 3.61 (m, 2H), 3.15 – 3.11 (m, 2H), 2.23 – 1.98 (m, 3H), 1.76 – 1.72 (m, 5H), 1.66 – 1.62 (m, 3H), 1.58 – 1.54 (m, 6H). MS (ESI+): 501.2 (M + H)+.
Methyl 4-((5-((((3r,5r,7r)-adamantan-1-yl)methyl)carbamoyl)-1H-indol-1- yl)methyl)-2-chlorobenzoate (3i). White solid; Yield: 58.8%. 1H NMR (500 MHz, Chloroform-d) δ 8.09 (s, 1H), 7.75 (s, 1H), 7.67 (dd, J = 8.1, 1.2 Hz, 1H), 7.26 (d, J = 3.8 Hz, 1H), 6.66 (dd, J = 8.1, 2.1 Hz, 2H), 6.60 (s, 1H), 6.18 (t, J = 6.3 Hz, 1H), 5.37 (s, 2H), 3.86 (s, 3H), 3.18 (d, J = 6.1 Hz, 2H), 2.13 – 1.98 (m, 3H), 1.75 (s, 3H), 1.67 – 1.63 (m, 3H), 1.58 – 1.55 (m, 6H). MS (ESI+): 492.2 (M + H)+. Methyl 4-((5-((((3r,5r,7r)-adamantan-1-yl)methyl)carbamoyl)-1H-indol-1- yl)methyl)-2-bromobenzoate (3j). White solid; Yield: 60.7%. 1H NMR (500 MHz, Chloroform-d) δ 8.10 (s, 1H), 7.73 (s, 1H), 7.67 (dd, J = 8.1, 1.5 Hz, 1H), 7.27 (dd, J = 3.7 Hz, 1.2 Hz 1H), 6.65 (t, J = 8.1Hz, 2H), 6.62 (s, 1H), 6.17 (t, J = 6.3 Hz, 1H), 5.38 (s, 2H), 3.86 (s, 3H), 3.18 (d, J = 6.2 Hz, 2H), 2.13 – 1.97 (m, 3H), 1.73 (s, 3H), 1.65 – 1.60 (m, 3H), 1.56 – 1.51 (m, 6H). MS (ESI+): 536.1 (M + H)+. General procedure for the synthesis of compounds 4a-j. Solid NaOH (374 mg, 9.36 mmol) was dissolved in a 50% aqueous solution of NH2OH (4 mL) at 0 °C. A solution of compounds 3a-j (2.34 mmol) in 1:1 THF/MeOH (6 mL) was added dropwise with vigorous stirring. Upon complete addition, the ice bath was removed, and the reaction was allowed to stir for 15 min. The reaction was then neutralized with 2 N HCl solution, and the mixture was concentrated under a vacuum. The crude product was purified by Combi-Flash reverse column chromatography (ACN/H2O = 0-100%) to yield the compounds 4a-j after lyophilization. Example 1. N-(((3r,5r,7r)-adamantan-1-yl)methyl)-1-(4- (hydroxycarbamoyl)benzyl)-1H-indole-5-carboxamide (4a). White solid; Yield: 62.8%.1H NMR (500 MHz, DMSO-d6) δ 10.82 – 10.72 (m, 1H), 9.31 (s, 1H), 8.03 – 7.96 (m, 2H), 7.66 – 7.57 (m, 2H), 7.54 – 7.51 (m, 2H), 7.05 (d, J = 10.2 Hz, 1H), 6.88 (s, 1H), 6.59 (t, J = 5.3 Hz, 1H), 5.48 (d, J = 7.3 Hz, 2H), 2.95 (d, J = 6.3 Hz, 2H), 1.87 (d, J = 4.2 Hz, 3H), 1.64 (br s, 3H), 1.55 (br s, 3H), 1.46 (m, 6H). 13C NMR (126 MHz, DMSO-d6) δ 164.3, 152.1, 142.5, 137.8, 131.5, 130.2, 123.6, 121.8, 118.4, 113.8, 112.5, 110.7, 102.6, 100.4, 54.1, 51.6, 48.2, 42.7 (m, 2C), 37.2 (2C), 35.3, 34.9, 28.3 (2C), 27.8, 25.3. HRMS (ESI) for C28H31N3O3 [M + H]+ calcd 458.2399, found: 458.2402. Example 2. N-(((3r,5r,7r)-adamantan-1-yl)methyl)-1-(2-fluoro-4- (hydroxycarbamoyl)benzyl)-1H-indole-5-carboxamide (4b). White solid; Yield: 52.5%.1H
NMR (500 MHz, DMSO-d6) δ 10.88 (br s, 1H), 9.67 (br s, 1H), 8.11 (s, 2H), 7.66 – 7.61 (m, 2H), 7.54 (s, 2H), 7.15 (d, J = 7.8 Hz, 1H), 6.98 (s, 1H), 6.67 (t, J = 7.3 Hz, 1H), 5.45 (d, J = 7.8 Hz, 2H), 2.94 (d, J = 6.2 Hz, 2H), 1.79 (d, J = 4.2 Hz, 3H), 1.65 (s, 3H), 1.55 (m, 3H), 1.45 – 1.43 (m, 6H). 13C NMR (126 MHz, DMSO-d6) δ 162.5, 151.1, 142.6, 136.3, 130.4, 130.1, 123.2, 122.7, 118.3, 112.5, 111.9, 111.6, 102.4, 101.9, 54.3, 51.2, 47.2, 45.7 (m, 2C), 37.2 (3C), 34.4, 29.6 (2C), 28.4, 23.8. HRMS (ESI) for C28H30FN3O3 [M + H]+ calcd 476.2305, found: 476.2309. Example 3. N-(((3r,5r,7r)-adamantan-1-yl)methyl)-1-(3-fluoro-4- (hydroxycarbamoyl)benzyl)-1H-indole-5-carboxamide (4c). White solid; Yield: 57.9%.1H NMR (500 MHz, DMSO-d6) δ 10.92 – 10.79 (m, 1H), 9.15 (s, 1H), 8.10 (q, J = 3.8 Hz, 2H), 7.63 – 7.56 (m, 2H), 7.44 (dt, J = 20.4, 7.3 Hz, 2H), 7.03 (d, J = 10.5 Hz, 1H), 6.98 (d, J = 7.9 Hz, 1H), 6.58 (t, J = 4.3 Hz, 1H), 5.48 (d, J = 7.3 Hz, 2H), 2.95 (d, J = 6.3 Hz, 2H), 1.88 (d, J = 4.2 Hz, 3H), 1.61 (d, J = 10.5 Hz, 3H), 1.55 (d, J = 12.6 Hz, 3H), 1.46 (d, J = 5.6 Hz, 6H). 13C NMR (126 MHz, DMSO-d6) δ 161.4, 152.6, 140.8, 137.2, 131.7, 130.8, 125.3, 122.7, 118.5, 115.7, 113.8, 110.6, 104.5, 100.7, 53.9, 51.0, 47.1, 45.5 (m, 2C), 38.5 (3C), 36.3, 29.7 (2C), 28.6, 24.8. HRMS (ESI) for C28H30FN3O3 [M + H]+ calcd 476.2305, found: 476.2311. Example 4. N-(((3r,5r,7r)-adamantan-1-yl)methyl)-1-(4-(hydroxycarbamoyl)-2- methoxybenzyl)-1H-indole-5-carboxamide (4d). White solid; Yield: 44.9%.1H NMR (500 MHz, DMSO-d6) δ 11.14 (s, 1H), 9.00 (s, 1H), 8.12 – 8.08 (m, 2H), 7.59 (dd, J = 8.8, 1.7 Hz, 1H), 7.47 (d, J = 3.1 Hz, 1H), 7.40 (d, J = 8.7 Hz, 1H), 7.35 (d, J = 1.6 Hz, 1H), 7.17 (dd, J = 7.9, 1.6 Hz, 1H), 6.67 (d, J = 7.9 Hz, 1H), 6.56 (d, J = 3.3 Hz, 1H), 5.38 (s, 2H), 3.88 (s, 3H), 2.95 (d, J = 6.3 Hz, 2H), 1.90 – 1.87 (m, 3H), 1.62 (d, J = 12.2 Hz, 3H), 1.55 (d, J = 12.0 Hz, 3H), 1.46 (d, J = 2.9 Hz, 6H). 13C NMR (126 MHz, DMSO-d6) δ 161.0, 151.7, 141.2, 137.5, 131.2, 130.8, 126.3, 121.7, 117.5, 116.9, 115.8, 110.2, 108.5, 102.2, 54.9, 52.4, 47.1, 45.5 (m, 3C), 37.1 (3C), 38.8, 29.0 (2C), 28.7, 22.9. HRMS (ESI) for C29H33N3O4 [M + H]+ calcd 488.2505, found: 476.2508. Example 5. N-(((3r,5r,7r)-adamantan-1-yl)methyl)-1-(4-(hydroxycarbamoyl)-3- methoxybenzyl)-1H-indole-5-carboxamide (4e, PB94). White solid; Yield: 67.5%; 1H NMR (500 MHz, DMSO-d6) δ 10.51 (s, 1H), 9.00 (s, 1H), 8.12 – 8.05 (m, 2H), 7.62 – 7.54 (m, 2H), 7.47 (d, J = 8.6 Hz, 1H), 7.40 (d, J = 7.9 Hz, 1H), 7.04 (d, J = 1.4 Hz, 1H), 6.64
(dd, J = 7.8, 1.4 Hz, 1H), 6.57 (d, J = 3.1 Hz, 1H), 5.44 (s, 2H), 3.74 (s, 3H), 2.95 (d, J = 6.3 Hz, 2H), 1.90 – 1.86 (m, 3H), 1.64 – 1.59 (m, 3H), 1.55 (d, J = 11.5 Hz, 3H), 1.46 (d, J = 3.0 Hz, 6H).13C NMR (126 MHz, DMSO-d6) δ 162.3, 156.2, 140.1, 138.9, 130.9, 130.5, 121.4, 120.8, 119.2, 112.3, 111.1, 110.1, 102.7, 100.9, 56.1, 51.0, 49.6, 40.7 (m, 3C), 37.1 (3C), 34.9, 28.3 (3C), 25.4. MS (ESI+): 488.2 (M + H)+. HRMS (ESI) for C29H33N3O4[M + H]+, 488.2535; found, 488.2539. Melting point: 184.7 °C – 193.2 °C. Example 6. N-(((3r,5r,7r)-adamantan-1-yl)methyl)-1-(4-(hydroxycarbamoyl)-3- methylbenzyl)-1H-indole-5-carboxamide (4f). White solid; Yield: 54.1%. 1H NMR (500 MHz, DMSO-d6) δ 11.14 (s, 1H), 9.00 (s, 1H), δ 8.12 (s, 1H), 7.75 (s, 1H), 7.64 (dd, J = 7.8, 1.2 Hz, 1H), 7.26 (d, J = 1.8 Hz, 1H), 6.75 (dd, J = 7.1, 1.2 Hz, 2H), 6.63 (t, J = 1.5 Hz, 1H), 6.12 (t, J = 6.3 Hz, 1H), 5.52 (s, 2H), 3.13 (d, J = 6.8 Hz, 2H), 2.32 (s, 3H), 1.92 (s, 3H), 1.76 – 1.73 (m, 3H), 1.66 – 1.62 (m, 3H), 1.55 – 1.53 (m, 6H). 13C NMR (126 MHz, DMSO-d6) δ 161.1, 158.6, 144.5, 138.4, 132.7, 131.0, 126.7, 122.7, 119.4, 113.1, 110.7, 109.4, 102.8, 100.4, 57.1, 54.1, 49.7, 42.6 (m, 3C), 37.6 (3C), 33.4, 34.9, 28.7 (3C), 25.8. HRMS (ESI) for C29H33N3O3 [M + H]+ calcd 472.2555, found: 472.2558. Example 7. N-(((3r,5r,7r)-adamantan-1-yl)methyl)-1-(3-hydroxy-4- (hydroxycarbamoyl)benzyl)-1H-indole-5-carboxamide (4g). White solid; Yield: 40.5%.1H NMR (500 MHz, DMSO-d6) δ 11.10 (s, 1H), 8.22 (s, 1H), 8.07 (dt, J = 7.5, 3.5 Hz, 2H), 7.57 (dd, J = 8.6, 2.2 Hz, 1H), 7.49 (t, J = 2.7 Hz, 1H), 7.44 (ddd, J = 14.5, 8.4, 2.0 Hz, 2H), 6.53 (t, J = 2.7 Hz, 1H), 6.39 – 6.33 (m, 1H), 6.28 (s, 1H), 5.27 (d, J = 2.0 Hz, 2H), 2.95 (dd, J = 6.4, 2.1 Hz, 2H), 1.89 (s, 3H), 1.62 (d, J = 12.2 Hz, 3H), 1.58 – 1.51 (m, 3H), 1.47 (s, 6H). 13C NMR (126 MHz, DMSO-d6) δ 164.3, 152.1, 142.5, 137.8, 131.5, 130.2, 123.6, 121.8, 118.4, 113.1, 112.5, 110.7, 102.6, 100.4, 54.1, 51.6, 48.2, 42.7 (m, 2C), 37.2 (2C), 35.3, 34.9, 28.3 (2C), 27.8, 25.3. HRMS (ESI) for C29H33N3O4 [M + H]+ calcd 474.2348, found: 474.2347. Example 8. N-(((3r,5r,7r)-adamantan-1-yl)methyl)-1-(3-ethoxy-4- (hydroxycarbamoyl)benzyl)-1H-indole-5-carboxamide (4h). White solid; Yield: 44.3%.1H NMR (500 MHz, DMSO-d6) δ 8.10 – 8.07 (m, 2H), 7.61 – 7.56 (m, 2H), 7.47 (d, J = 8.7 Hz, 1H), 7.38 (d, J = 7.9 Hz, 1H), 7.00 (d, J = 1.4 Hz, 1H), 6.66 (dd, J = 7.7, 1.4 Hz, 1H), 6.56 (d, J = 3.2 Hz, 1H), 5.42 (s, 2H), 4.01 (q, J = 6.9 Hz, 2H), 2.95 (d, J = 6.4 Hz, 2H), 1.89 – 1.88 (m, 3H), 1.62 (d, J = 11.9 Hz, 3H), 1.55 (d, J = 12.0 Hz, 3H), 1.46 (d, J = 2.9
Hz, 6H), 1.26 (t, J = 6.9 Hz, 3H). 13C NMR (126 MHz, DMSO-d6) δ 162.4, 155.9, 140.3, 138.7, 132.4, 130.1, 124.9, 122.8, 118.4, 114.4, 112.5, 110.2, 102.8, 100.6, 54.2, 51.6, 48.2, 41.6 (m, 2C), 37.2 (2C), 35.3, 35.9, 28.4 (2C), 28.1, 25.5. HRMS (ESI) for C30H35N3O4 [M + H]+ calcd 502.2661, found: 502.2664. Example 9. N-(((3r,5r,7r)-adamantan-1-yl)methyl)-1-(3-chloro-4- (hydroxycarbamoyl)benzyl)-1H-indole-5-carboxamide (4i). White solid; Yield: 50.4%.1H NMR (500 MHz, DMSO-d6) δ 10.94 (s, 1H), 9.12 (s, 1H), 8.09 (s, 1H), 7.76 (s, 1H), 7.72 (dd, J = 8.2, 1.4 Hz, 1H), 7.22 (d, J = 3.8 Hz, 1H), 6.65 (dd, J = 8.1, 2.1 Hz, 2H), 6.60 (s, 1H), 6.15 (t, J = 6.5 Hz, 1H), 5.38 (s, 2H), 3.18 (d, J = 6.5 Hz, 2H), 2.12 – 1.97 (m, 3H), 1.76 (s, 3H), 1.67 – 1.64 (m, 3H), 1.58 – 1.56 (m, 6H).13C NMR (126 MHz, DMSO-d6) δ 162.3, 151.3, 142.5, 137.7, 131.4, 130.1, 122.5, 120.5, 118.4, 116.5, 112.4, 111.7, 102.5, 100.2, 54.1, 51.6, 48.2, 42.4 (m, 2C), 38.5 (2C), 35.1, 33.9, 28.8 (2C), 27.5, 25.1. HRMS (ESI) for C28H30ClN3O3 [M + H]+ calcd 493.1946, found: 493.1945. Example 10. N-(((3r,5r,7r)-adamantan-1-yl)methyl)-1-(3-bromo-4- (hydroxycarbamoyl)benzyl)-1H-indole-5-carboxamide (4j).White solid; Yield: 40.6%. 1H NMR (500 MHz, DMSO-d6) δ 10.84 (s, 1H), 9.18 (s, 1H), 8.10 (d, J = 6.2 Hz, 2H), 7.60 (d, J = 8.8 Hz, 2H), 7.47 (d, J = 7.5 Hz, 2H), 7.28 – 7.23 (m, 1H), 7.14 (d, J = 8.0 Hz, 1H), 6.58 (t, J = 3.2 Hz, 1H), 5.46 (s, 2H), 2.95 (d, J = 6.3 Hz, 2H), 1.89 – 1.87 (m, 2H), 1.61 (d, J = 11.9 Hz, 3H), 1.55 (d, J = 12.5 Hz, 3H), 1.46 (d, J = 3.1 Hz, 6H). 13C NMR (126 MHz, DMSO-d6) δ 161.8, 150.5, 144.2, 137.5, 136.9, 132.5, 121.2, 120.7, 119.5, 116.1, 114.4, 111.9, 102.2, 101.1, 54.4, 51.7, 45.2, 44.6, 42.3, 38.6 (2C), 35.8, 33.5, 28.7 (2C), 25.5, 25.7. HRMS (ESI) for C28H30BrN3O3 [M + H]+ calcd 537.1450, found: 537.1452. Scheme 2. Synthetic routes of analogues 7a-b, 10a-bα
General procedure for the synthesis of compounds 6a-b. To a solution of 3-methoxy-4-(methoxycarbonyl)benzoic acid (300 mg, 1.4 mmol) in DMF (20 mL) was added 2-(7-Azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (HATU, 597.0mg, 1.57 mmol, 1.1 eq) and triethylamine (433.3 mg, 4.28 mmol, 2 eq). Adamantan-1-ylmethanamine (259.5 mg, 1.57 mmol, 1.1eq) or 2- (adamantan-1-yl)ethan-1-amine (281.5 mg, 1.57 mmol, 1.1 eq) was then added after the reaction mixture was stirred at room temperature for 30 min. After the completion of the reaction, the DMF was evaporated under reduced pressure and the residue was diluted with EtOAc and water. The organic layers were combined, washed with brine, separated and dried over Na2SO4, filtered and concentrated in vacuo. The oily residue was purified by flash column chromatography to yield corresponding intermediates. General procedure for the synthesis of compounds 8a-b. 4-formyl-2-methoxybenzoate (1g, 5.15 mmol), adamantan-1-ylmethanamine (1.02 g, 6.18 mmol, 1.2 eq) or 2-(adamantan-1-yl)ethan-1-amine (1.11 g, 6.18 mmol, 1.2 eq) and
were dissolved in MeOH (25 mL). The mixture was stirred at room temperature for 2 h. Sodium borohydride (0.49 g, 7.73 mmol, 1.5eq) was then added, and the suspension was stirred overnight at room temperature. After completion of the reaction, MeOH was evaporated under reduced pressure and the residue was diluted with EtOAc and water. The organic layers were combined, washed with brine, separated, and dried over Na2SO4, filtered, and concentrated in vacuo. The oily residue was purified by flash column chromatography to yield corresponding intermediates. General procedure for the synthesis of compounds 9a-b. 8a (750.7 mg, 2.1mmol) or 8b (721.3 mg, 2.1mmol) was refluxed in 10 mL formic acid and 10 mL formalin for 24 h. The reaction mixture was neutralized with saturated sodium bicarbonate solution and partitioned between water and ethyl acetate. The aqueous layer was extracted twice more with ethyl acetate, and the combined organic layers were washed with water and brine, dried over Na2SO4, filtered and concentrated in vacuo. The residue was purified by flash column chromatography to yield 9a or 9b as a colorless oil. General procedure for the synthesis of compounds 7a-b, 10a-b. Solid NaOH (374 mg, 9.36 mmol) was dissolved in a 50% aqueous solution of NH2OH (4 mL) at 0 °C. A solution of ester intermediates 6a-b and 9a-b (2.34 mmol) in 1:1 THF/MeOH (6 mL) was added dropwise with vigorous stirring. Upon complete addition, the ice bath was removed, and the reaction was allowed to stir for 15 min. The reaction was then neutralized with 2 N HCl solution, and the mixture was concentrated under vacuum. The crude product was purified by Combi-Flash reverse column chromatography (ACN/H2O = 0-100%) to yield the compounds 7a-b, and 10a-b after lyophilization. Example 11. N4-(adamantan-1-ylmethyl)-N1-hydroxy-2-methoxyterephthalamide (7a) White solid; Yield: 95%. 1H NMR (400 MHz, DMSO-d6): δ = 10.70 (s, 1H), 9.14 (s, 1H), 8.39 (s, J = 6.0 Hz 1H), 7.60 (d, J = 8.0 Hz, 1H), 3.89 (s, 3H), 3.30 (m, 2H), 1.94 (s, 3H), 1.68–1.58 (m, 6H), 1.50 (m, 6H). 13C NMR (100 MHz, DMSO-d6) δ = 166.3, 163.1, 156.9, 138.4, 130.1, 125.3, 119.7, 110.0, 56.3, 51.1, 40.6, 37.0, 34.9, 28.2. HRMS (ESI) for C20H26N2O4 [M + H]+ calcd 359.1965, found: 359.1959. Example 12. N4-(2-(adamantan-1-yl)ethyl)-N1-hydroxy-2- methoxyterephthalamide (7b), White solid; Yield: 90%
1H NMR (400 MHz, DMSO-d6): δ = 10.70 (s, 1H), 9.14 (s, 1H), 8.48 (s, 1H), 7.58 (d, J = 8.0 Hz 1H), 7.49 (s, 1H), 7.46 (d, J = 8.0 Hz, 2H), 3.88 (s, 3H), 3.31–3.26 (m, 2H), 1.94 (s, 3H), 1.70–1.61 (m, 6H), 1.53 (m, 6H), 1.36–1.32 (m, 2H). 13C NMR (100 MHz, DMSO-d6) δ = 165.5, 163.0, 156.9, 138.2, 130.1, 125.3, 119.6, 110.9, 56.3, 43.7, 42.3, 37.1, 34.7, 32.0, 28.5. HRMS (ESI) for C21H28N2O4 [M + H]+ calcd 373.2122, found: 373.2118. Example 13. 4-(((adamantan-1-ylmethyl)(methyl)amino)methyl)-N-hydroxy-2- methoxybenzamide (10a). White solid; Yield: 95%. 1H NMR (400 MHz, DMSO-d6): δ = 10.54 (s, 1H), 9.04 (s, 1H), 7.55 (d, J = 8.0 Hz, 1H), 7.09 (s, 1H), 7.00 (s, J = 8.0 Hz, 1H), 3.83 (s, 3H), 3.55 (d, 2H), 2.19 (s, 3H), 2.12 (s, 2H), 1.93 (s, 3H), 1.69–1.58 (m, 6H), 1.51– 1.48 (m, 6H).13C NMR (100 MHz, DMSO-d6) δ = 163.5, 157.0, 145.1, 130.3, 121.0, 120.6, 111.8, 70.7, 64.5, 55.9, 45.9, 41.1, 37.2, 35.3, 28.3. HRMS (ESI) for C21H30N2O3 [M + H]+ calcd 359.2329, found: 359.2324. Example 14. 4-(((2-(adamantan-1-yl)ethyl)(methyl)amino)methyl)-N-hydroxy-2- methoxybenzamide (10b). White solid; Yield: 90%. 1H NMR (400 MHz, DMSO-d6): δ = 10.56 (s, 1H), 9.06 (s, 1H), 7.55 (d, J = 8.0 Hz, 1H), 7.02 (s, 1H), 6.94 (d, J = 8.0 Hz, 1H), 3.83 (s, 3H), 3.48 (s, 2H), 2.51 (s, 2H), 2.33-2.37(m, 2H), 2.11 (s, 3H), 1.90 (s, 3H), 1.67– 1.57 (m, 6H), 1.47 (m, 6H), 1.29-1.25 (m, 2H).13C NMR (100 MHz, DMSO-d6) δ = 163.5, 157.1, 144.3, 130.2, 121.1, 120.9, 111.9, 61.8, 56.0, 51.6, 42.5, 42.4, 41.3, 37.1, 32.0, 28.5. HRMS (ESI) for C22H32N2O3 [M + H]+ calcd 373.2486, found: 373.2424. Example 15. N-(((3r,5r,7r)-adamantan-1-yl)methyl)-1-(4-(2-propylhydrazine-1- carbonyl)benzyl)-1H-indole-5-carboxamide (12). Step 1. 4-((5-((((3r,5r,7r)-adamantan-1-yl)methyl)carbamoyl)-1H-indol-1- yl)methyl)-2-methoxybenzoic acid (11). To a solution of 3e (100 mg, 0.21 mmol) in THF/H2O was added LiOH powder (24.6 mg, 1.05 mmol) at room temperature. The mixture was stirred for 30 min at room temperature. After the completion of the reaction. The organic solution was removed under vacuum and the resultant solution was adjusted to pH = 7. The reaction was extracted with DCM. The organic layers were collected and purified by column chromatography to afford 11. White solid; Yield: 95%. 1H NMR (400 MHz, DMSO-d6): δ = 9.12 (s, 1H), 8.34 (s, 1H), 7.15 (d, J = 6.0 Hz, 1H), 7.02 (s, 1H), 6.75 (s, J = 8.0 Hz, 1H), 6.64–6.57 (m, 1H),
3.83 (s, 3H), 3.47–3.33 (m, 2H), 2.12–1.96 (m, 3H), 1.69–1.58 (m, 6H), 1.57–1.21 (m, 6H). MS (ESI+): 473.2 (M + H)+.. Step 2. N-(((3r,5r,7r)-adamantan-1-yl)methyl)-1-(4-(2-propylhydrazine-1- carbonyl)benzyl)-1H-indole-5-carboxamide (12). To a round bottom flask with compound 11 (100 mg, 0.21 mmol), HATU (119.8 mg, 0.32 mmol), and DIPEA (40.7 mg, 0.32 mmol) in DMF (30 mL) was added 1-chloro-2-propylhydrazine (45.6 mg, 0.42 mmol). The resulting mixture was stirred at room temperature for 12 h. Dichloromethane was added and the mixture was washed with saturated NaHCO3 water (3 × 30 mL), and brine (2 × 30 mL), and dried over anhydrous Na2SO4. Volatiles were removed under vacuum to get the crude residue, which was purified via Combi-flash chromatography to afford 12 as a white solid powder. Yield: 49.2%.1H NMR (400 MHz, DMSO-d6): δ = 8.11 (s, 1H), 7.65 (d, J = 8.0 Hz, 1H), 7.19 (s, 1H), 7.20–7.17 (m, 2H), 6.72–6.67 (m, 1H), 6.66–6.56 (m, 1H), 6.20– 6.18 (m, 1H), 5.36 (s, 2H), 4.44 (s, 1H), 3.70 (s, 3H), 3.17–3.21 (m, 2H), 2.02–1.76 (m, 4H), 1.72–1.65 (m, 9H), 1.61–1.57 (m, 16H), 0.74–0.78 (m, 3H). 13C NMR (100 MHz, DMSO-d6) δ = 163.5, 157.0, 145.1, 130.3, 121.0, 120.6, 111.8, 70.7, 64.5, 55.9, 45.9, 41.1, 37.2, 35.3, 28.3. HRMS (ESI) for C31H38N4O2 [M + H]+ calcd 499.3028, found: 499.3032. Example 16. Radiosynthesis of [11C]PB94 [11C]methyl iodide ([11C]CH3I) was trapped in a TRACERlab FX-M synthesizer reactor (General Electric) preloaded with a solution of precursor 3g in anhydrous DMF (2.0 mg/mL, 0.3 mL) and K2CO3 (5 mg). The mixture was stirred at 100 °C for 3 minutes. Then the reaction solution was cooled to room temperature and quenched with 0.1% TFA in water (1.5 mL) and purified by reverse-phase semipreparative HPLC (Column: Agilent Eclipse XDB-C18, 5 μm, 250 mm × 9.4 mm, flow rate = 5.0 mL/min, mobile phase = 0.1% TFA in water/0.1% TFA in acetonitrile, 30/70, v/v). The desired fraction ([11C]3g) was collected and then loaded onto a solid-phase exchange (SPE) C-18 cartridge, rinsed with H2O (5 mL). The C-18 cartridge was eluted with 0.6 M NaOH in MeOH/THF (1:1, 1.0 mL) into a vial containing 100 μL hydroxylamine aqueous solution (50 wt. % in H2O). After stirring at room temperature for 5 min, 1 mL of 3 M HCl was added to the mixture. The resulting mixture was injected into a reverse-phase semipreparative HPLC for purification (Column: Agilent Eclipse XDB-C18, 5 μm, 250 mm × 9.4 mm, flow rate = 5.0 mL/min, mobile phase = 0.1% TFA in water/0.1% TFA in acetonitrile, 52/48, v/v).
[11C]PB94 was collected and reformulated for animal PET imaging studies. The average time required for the synthesis from the end of cyclotron bombardment to the end of synthesis was approximately 35–40 min. The average radiochemical yield was 6.2%-9% (nondecay corrected to trapped [11C]CH3I, n = 3). Chemical and radiochemical purities were ≥ 98% with a specific activity of 120 GBq/μmol (EOB). The HPLC chromatogram of [11 C]PB94 and unlabeled PB94 is shown in FIG.41. Example 17. Synthesis of N-heterobicyclic HDAC6 inhibitors. Five different N-heterobicyclic-capped analogues (8a–e) were first obtained according to the synthetic routes (Scheme 2A). The N-heterobicyclic substituted benzyl esters (7a-e) were prepared by reacting methyl 4-(bromomethyl) benzoate (1) with corresponding commercially available heterobicyclic amines in the presence of a base. The resulting methyl esters were converted to corresponding hydroxamic acid (8a-8e) by treating aqueous NH2OH/NaOH solution at room temperature. Scheme 3. Synthesis of N-heterobicyclic HDAC6 inhibitorsα.
Example 18. Radiosynthesis of [18F]8b
Procedure: Compound 7b (see above Scheme) was first reacted with K222/[18F]KF in the presence of K2CO3 at 150 °C to provide the ester intermediate [18F]7b, followed by the hydroxamation to afford [18F]8b. To prepare [18F]PB131, the arylboronic ester 12 was employed as the precursor to react with K222/[18F]KF catalyzed by Cu2(OTf)2(py)4 in DMF at 120 to afford [18F]10c, which was converted to hydroxamate [18F]PB131 through the same condition as mentioned above. The radiochemical purities of [18F]8b and [18F]PB131 were more than 98%, and the average molar activities were 108 GBq/μmol and 114 GBq/μmol, respectively, at the end of synthesis (EOS). Example 19. Molecular modeling and simulation of PB94 To investigate the selectivity mechanism of PB94 for HDAC11, molecular docking studies were performed. Compound 4a and PB194 were docked into zHDAC6 (PDB: 6THV) with AutoDock Vina. As shown in FIG. 3A, the hydroxamate group of 4a engaged in the monodentate interaction with Zn2+ and yielded the hydrogen bonds between its carbonyl and Tyr745 as well as OH and His574, which resulted in the potent
binding affinity to HDAC6. Additional π-π stacking interactions were observed between the indole and Tyr745 as well as phenyl ring and Phe583/Phe643. Furthermore, the rigid adamantane capping group of 4a suitably occupied the HDAC6 specific L1- loop pocket (consisting of residues His463, Pro464, Phe583, and Leu712), which led to the selectivity for HDAC6. PB94 showed comparable interactions with HDAC6 relative to 4a (FIG. 3B), while the presence of the methoxy group on the benzyl linker formed the steric hindrance between the phenyl ring and residues Phe583 and Phe643, affecting the π-π stacking and hydrogen bonding interactions, thereby reducing its potency against HDAC6. As the crystal structure of HDAC11 was not available, a Swiss-Model was used to construct an HDAC11 homology model based on human HDAC2 (PDB: 7KBH) crystal structure and carried out a molecular docking study. As depicted in FIGs.4A and 4B, PB94 exhibited a favorable conformation in the binding pocket of HDAC11. The hydroxamate group of PB94 interacts with Zn2+ and forms a hydrogen bond. The benzyl linker and residue Tyr87 form a π-π stacking interaction, and the indole-adamantane group occupies the lateral pocket of the HDAC11 structure. Procedure: The amino acid sequence of hsHDAC11 was obtained from the protein database of NCBI (NP_079103.2) and BLASTed to determine the HDAC2 as the template structure. Then the 3D homology model of HDAC11 was constructed by aligning the amino acid sequence of hsHDAC11 to template HDAC2 with Modeler 9.14 software. Then the molecular docking study was performed using previous reported procedures. The zHDAC6 crystal structure was obtained from Protein Data Bank (6THV, www.rcsb.org). The original ligand (Tubastatin A) and the water molecules were removed by PyMOL. PB94 was docked with the binding pocket of HDAC6 and HDAC11 using AutoDock Vina (v 1.1.2). The plots of protein-ligand interaction between PB94 and zHDAC6 as well as PB94 and HDAC11 were generated using PyMOL. Example 20. Binding selectivity evaluation and in vitro phenotypic activity profile of PB94 The off-target binding of PB94 was evaluated in a panel of 46 targets (National Institute on Mental Health-Psychoactive Drug Screening Program (PDSP)) and observed
no significant off-target binding at 10 μM (details presented below). The in vitro activity profile of PB94 in the BioMAP Diversity PLUS panel of 12 human primary cell-based systems (Eurofins Discovery) was carried out. As a result, PB94 did not exhibit any cytotoxic effects at tested concentrations (0.37 μM – 3.3 μM) but exhibited antiproliferative activity to human primary endothelial cells, T cells, B cells, and coronary artery smooth muscle cells at 3.3 μM (grey arrows, FIG. 5D). Based on the cellular activity profile of PB94 in the testing panel, a comparative analysis of the biological activities of known bioactive agents in the BioMAP reference database was used to predict the safety, efficacy, and function of PB94. As a result, there are 22 common and 51 differentiating activities were observed in the overlayed bioactivity fingerprint of PB94 and reference benchmark vorinostat (a pan-inhibitor of HDAC1, HDAC2 and HDAC3 (Class I), HDAC7 (Class II), and HDAC11 (Class IV)) (FIG. 5A). Interestingly, PB94 showed similar pharmacological activities to a selective HDAC1 inhibitor parthenolide (FIG. 5B), which can selectively inhibit HDAC1 without affecting other class I/II HDACs and modulate NF-κB-mediated inflammatory responses. Additionally, mechanism HeatMAP analysis (FIG.6) showed that PB94 is modestly active with three inflammation-related biomarkers, including IL-10, sPGE2, MCP1, and MIG, indicating the potential anti-inflammatory property of PB94. Representative inhibition values are shown in Table 2. Table 2. The off-target binding of PB94
Example 21. Western blot analysis The tissues lysates were obtained by homogenization in cold RIPA buffer (89900, Thermo Fisher) containing proteinase inhibitor (05892970001, Roche) with a PRO200 homogenizer. Supernatants were collected and total protein concentrations were measured by using a BCA Protein Assay Kit (23227, Thermo Scientific). Equal amounts of protein (50 μg) were used for electrophoresis on 4- 20% Criterion TGX stain-free precast gels (5678095, Bio-Rad) and electrophoretically transferred onto PVDF membranes (1620264, Millipore). The membranes were blocked in 3% BSA 0.5 hour at room temperature and then probed with antibody against HDAC-11 (1:1000, 09-827, Millipore) and GAPDH (1:10000, ab8245, Abcam) overnight at 4°C. The blots were then incubated for 1 hour with anti-rabbit (1:5000, #7074, Cell Signaling Technology) secondary antibodies at room temperature. Signal was visualized using ECL Solution and Imager (Bio-Rad). Densitometry of protein bands was analyzed by image J. For the quantification of the protein, the band intensities were normalized by GAPDH as the internal reference. Subsequently, normalized band intensities were divided by the average of the sham group to determine normalized fold change vs. the sham group. Example 22. HDAC 1-11 enzyme inhibition assays The HDAC inhibition assay of target compounds were carried out at Nanosyn (Santa Clara CA, United States) using the electrophoretic mobility shift assay. Full-length human recombinant HDAC proteins were expressed in the baculoviral system and purified
by affinity chromatography. The peptide substrates were used: FAM-RHKK(Ac)-NH2 for HDAC3, HDAC6, and HDAC8; FITC-H3K27(Ac)-NH2 for HDAC1, HDAC2, and HDAC10; and FAM-RHKK (tri-fluor-Ac)-NH2 for HDAC4, HDAC5, HDAC7, HDAC9, and HDAC11. Test compounds were diluted in 100% DMSO using 3-fold dilution steps. The final compound concentration in the assay ranged from 10 μM to 0.056 nM. Compound, enzymes (Table 3), and substrate were combined in reaction buffer (100 mM N-2-hydroxyethylpiperazine-Nƍ-2-ethanesulfonic acid [HEPES; pH 7.5], 25 mM KCl, 0.1% bovine serum albumin, 0.01% Triton X-100) at 25°C and quenched by the addition of termination buffer (100 mM HEPES [pH7.5], 0.01% Triton X-100, 0.05% sodium dodecyl sulfate). The fluorescence intensity of the electrophoretically separated de- acetylated product and substrate peptide were measured and analyzed using the LabChip 3000 microfluidic electrophoresis instrument (Perkin Elmer/Caliper Life Sciences). The 50% inhibitory concentration (IC50) values of inhibitors were determined by fitting the percent inhibition curves with a 4-parameter dose-response model using XLfit 4 software (IDBS). Reference compounds, TSA was tested in an identical manner. Representative results are shown in Table 4. Table 3. HDAC enzyme information
The inhibitory activities of exemplary compounds against HDAC6 and HDAC11 were evaluated (see Tables 6 and 7). Compounds without indole moiety in the Cap group display weak inhibitory activity against HDAC11 and no significant activity against HDAC6, suggesting that the indol moiety is essential for structural modification. On the
other hand, the analogues bearing a hydrazide group failed to show improved HDAC11 binding affinity, with moderate potency (IC50 = 4.2 μM and 3.1 μM, respectively) and minimal selectivity against HDAC11. Table 4. HDAC isoforms profiling of synthetic compounds 4a-ja
Table 5. Additional HDAC isoform dose response data
Table 6. Inhibitory activities of representative compounds against HDAC6 and HDAC11a
Table 7. Additional inhibitory activities of representative compounds against HDAC6
Example 23. Defatty acylation of SHMT2 assays The HDAC11 inhibitory activity of PB94 in HEK293T cells was evaluated. SHMT2 was identified as a defatty-acylation substrate of HDAC11 in cells. HEK293T cells were treated with PB94 to test whether it could upregulate the fatty acylation level of SHMT2 via HDAC11 inhibition. HEK293T was incubated with Alk14 (an alkyne-tagged myristic acid analog) and PB94 at different concentrations for 3 hours. Then, the Alk14- labeled SHMT2 was conjugated with biotin using click chemistry, pulled down with streptavidin, and measured by Western blot. A known HDAC11 inhibitor, TD034, was used as the reference compound. As a result, PB94 significantly increased the fatty acylation level of SHMT2 at the concentration of 20 μM (FIG. 14), indicating it has HDAC11 inhibitory activity in cells. Procedure: HEK293T cells were incubated with 50 μM Alk14 and inhibitors at various concentrations for 3 h. The cells were harvested and lysed in SDS lysis buffer (50 mM triethanolamine, 150 mM NaCl, 4% SDS, pH 7.4) with a 1:100 protease inhibitor cocktail and 1:1000 nuclease for 15 min. Then the cell lysates were diluted with HEPES buffer (50 mM HEPES, 150 mM NaCl, 1% NP-40, pH 7.4), and concentrated for 30 min at 21000g. Meanwhile, magnetic streptavidin beads (10 μg) were suspended in HEPES buffer (100 μL), after which Biotin-N3 (5 μL, 5 mM in DMF) was added. The mixture was shaken at 37 °C for 30 minutes, then the supernatant was removed, and the beads were washed with HEPES buffer (1 x 100 μL). The mixture was shaken for 1 h at 37°C, and the supernatant was removed. Hydroxylamine in HEPES buffer (100 μL, 0.5 M) was added, and the mixture was then shaken for 30 min. The supernatant was removed, and the beads were washed with HEPES buffer (3 × 500 μL). The remaining beads were incubated at 95 °C with 20 μL of 4% SDS lysis buffer and 4 μL of 6× loading buffer for 10 min. The eluants were further analyzed by SDS-PAGE and Western blot for SHMT2.
Example 24. HDAC11 protein level increased in neuropathic pain The promising drug-like properties of PB94 support its therapeutic potential for neuropathic pain. The primary somatosensory cortex has been previously identified as a key brain region implicated in pain processing. Therefore, HDAC11 expression was assessed in the primary somatosensory cortex after CCI injury by qPCR. Notably, HDAC11 protein significantly increased in the cortex compared with sham mice 14 days after surgery (FIG. 11A). HDAC6 expression levels were less effected by CCI injury. Procedure using qPCR analysis: A one-step real-time PCR was performed using iTaq™ Universal SYBR® Green One-Step Kit (BioRad 1725150) in a Thermofisher 7500 fast thermocycler. The primer sequences are as follows: GAPDH: CATCACTGCCACCCAGAAGACTG ((forward) and ATGCCAGTGAGCTTCCCGTTCAG (reverse); HDAC11: ATGGGGCAAGGTGATCAACT (forward) and AGGACCACTTCAGCTCGTTG (reverse). Mouse brain tissue (contralateral somatosensory cortex) was harvested one week after sham or CCI surgery, followed by RNA isolation using Trizol. Melting curve and Ct value used for quantification. Gapdh was used as the internal control for normalization for each sample. Example 25. PET/CT imaging in rodents To investigate the pharmacokinetics of PB94 in vivo, radiolabeled PB94 was used for PET imaging studies using [11C]PB94 in rodents. [11C]PB94 was prepared through a two-step reaction using 3g as the precursor (FIG. 8). Next, 100-150 μCi [11C]PB94 was injected into C57BL/6 mice (male, n = 4) through the tail vein for a 60-minute dynamic PET imaging followed by a 10-minute computed tomography (CT). The representative PET/CT images focused on the mice brain (coronal, sagittal, and axial, summed from 0 to 60 minutes) and time-activity curves (TACs) of eight brain regions of interest are shown in FIG. 8B. As expected, [11C]PB94 exhibited significant blood-brain-barrier (BBB) penetration and fast brain uptake, with the maximum %ID/cc (percent injected dose per cc tissue) of 2.8 in the whole brain at the first few minutes post-injection. Regional brain analysis was carried out using the FUSION module (Ma-Benveniste-Mirrione) in PMOD (PMOD 4.003, PMOD Technologies Ltd., Zurich, Switzerland). Heterologous distribution of radioactivity was observed in eight ROIs, indicating the heterologous expression level
of HDAC11 in brain regions. Of note, relatively high radioactivity uptake was found in the striatum, cortex, and amygdala, while the cerebellum and brain stem showed lower radioactivity uptake. The biodistribution of [11C]PB94 in several peripheral organs of mice, including the heart, liver, lung, kidney, and spleen was also examined. Four time points (5, 10, 30, and 60 min) after [11C]PB94 injection were selected to investigate the uptake, distribution, and clearance of PB94 in the organs of interest. As shown in FIG. 10, high radioactivity (%ID/cc > 5) was seen in the blood-rich organs, including the heart, liver, and kidney, after [11C]PB94 injection. In the kidney, the radioactivity accumulated moderately and peaked at 15 minutes, while the radio signals decreased gradually in other organs. The high accumulation of radioactivity in the liver and kidney suggested the hepatobiliary and urinary excretion of [11C]PB94. Similar studies were carried out for [18F]8b (see FIGs.19- 22). Procedure: Micro-PET/CT imaging was performed in two groups: male C57BL/6 mice (6-month-old), used for general brain imaging and blocking studies. After intravenous injection of [11C]PB94 (3.7-5.6 Mbq per animal), a 60-min dynamic PET acquisition was performed and followed a 10-min CT scan. PET data were reconstructed using a 3D- MLEM method resulting in full width at a half-maximum resolution of 1 mm. These files were imported and analyzed using PMOD (PMOD 4.01, PMOD Technologies Ltd., Zurich, Switzerland). Example 26. Chronic Constriction Injury (CCI) model The increase of HDAC11 in the primary somatosensory cortex raised intriguing possibilities that HDAC11 is critically implicated in pain and that targeting HDAC11 might provide therapeutic effects. To test this, PB94 was administered in mice that underwent CCI to assess the development of nociceptive behavior. In one set of experiments, as shown in FIG. 11B, the hind paw mechanical withdrawal thresholds ipsilateral to the injury side decreased after surgery and remained at low levels from day 3 to day 14. In contrast, no significant change in mechanical pain thresholds was observed in the contralateral paw. At day 14 after CCI injury, mice were treated with PB94 at different doses, and mechanical withdrawal thresholds were examined. Single-dose injection of PB94 was able to increase mechanical withdrawal thresholds (FIG. 12). Notably, this effect of PB94 appeared to be
dose-dependent. At 10mg/kg, these effects lasted for more than 3 hours. As such, 10 mg/kg was chosen to be administered twice daily for another set of experiments. As shown in FIGs. 13A and 13B, PB94 (10 mg/kg) was able to significantly alleviate mechanical and thermal pain-like behaviors during the entire experimental period of 14 days. Importantly, there were no significant side effects noticed during PB94 treatment. Mouse body weight remained similar between saline or PB94-treated animals (FIG.13C). Procedure: The mice were anesthetized with 2.5 – 3% isoflurane in an anesthesia induction chamber. The left lower extremity was prepared with an alcohol swab. A 0.5 - 1 cm incision was made using a blade on the left lower extremity. The left side of the sciatic nerve was exposed in the mid-thigh. Four ligatures using 6.0 mm chronic gut sutures were loosely placed around the exposed sciatic nerve with a 1.0 - 1.5 mm interval between each ligature. Skin incision was closed with two 6-0 vicryl sutures (Ethicon, Somerville, NJ) Example 27. Mechanical withdrawal threshold Mice (C57/BL6, male, 6-month-old) were habituated and placed on a platform with a clear chamber individually 30 minutes daily for 3 consecutive days. Mechanical paw withdrawal thresholds (PWTs)) was carried out using calibrated manual Von Frey filaments (Stoelting, Kiel, Wl, USA). A Von Frey monofilament was applied to the plantar surface of the hind paw, and a logarithmic scale of force was delivered for 2 s. The positive response was recorded when the mice withdrew or shacked their paws during the stimulation. A negative response was followed by testing with the next larger filament. The “up-down” methodological approach was used to calculate mechanical sensitivity. All CCI mice were tested before surgery (baseline) and 3, 5, 7, 10, and 14 days after surgery. On day 21, all the mice received a final test for dose-response evaluation: PB94 treatment. PB94 was dissolved in DMSO/Tween80/saline (1/1/8, v/v/v). On day 21 after surgery, CCI mice were randomly divided into three groups (n = 4 for each group) and treated with an IP injection of 3 mg/kg, 6 mg/kg, and 10mg/kg, respectively. PWTs of CCI mice were measured every 30 min during a 3-hour period after PB94 administration. Example 28. Hindpaw withdrawal latency Mice were placed on a preheated glass platform (28 - 29°C) and clear Plexiglas cubicles to acclimate to the testing room 30 minutes daily for 3 consecutive days before the testing. A radiant heat source emitted from underneath the glass and focused on the
middle of the hindpaws of mice. Paw withdrawal latency was defined as the time (seconds) from the initiation of heat exposure to the hind paw withdrawal. A cut-off time was set at 20 seconds to avoid tissue damage. Example 29. Examination of analgesic effect of PB94 by Iba-1 staining To interrogate potential mechanisms that are linked to the analgesic effect of PB94, brain samples of mice received 14 days of PB94 treatment were stained for Iba-1, a microglia marker. Microglia-mediated neuroinflammation has been shown to be critical for the development of neuropathic pain, including pain in the CCI model. The hindlimb region of the primary somatosensory cortex (S1HL) and anteroposterior region (VPL) of the thalamus, two brain regions that are important for pain processing, exhibited a lower number of Iba-1 positive cells in the ‘PB94 + CCI’ group than the ‘vehicle + CCI’ group (see FIGs.15 and 16), suggesting the role of PB94 in neuroinflammation modulation.4 Procedure: Mice were transcranial perfused with ice-cold PBS followed by 4% paraformaldehyde. Extracted mouse brains were stored at 4°C with 4% PFA fixation for two days. After being washed in 1x PBS, brains were sliced at 40 μm in thickness using a Leica vibratome (VT 1000s). The desired slices were bathed in a blocking buffer containing 0.03% Tween-20 and 5% BSA for 1h at room temperature. The primary antibody (Iba1; 1:1000; Wako) in PBS was incubated at 4°C overnight. After three times of 1x PBS washing, the slices were incubated with the second antibody of anti-rabbit Alexa488 (1:2000; Invitrogen) for one hour at room temperature. Using an Olympus microscope, images were taken at 4x and 20× magnification for analysis. Images were analyzed using ImageJ (NIH open-source software). Example 30. CYP inhibition assay of PB94 Phenacetin, acetaminophen, (+)-N-3-Benaylnirvanol, α-Naphthoflavone, diclofenac, sulfaphenazole, dextrorphan tartrate, quinidine, testosterone, 6- hydroxytestosterone, ketoconazole were purchased from Sigma (St. Louis, MO, USA). 4- Hydroxydiclofenac, s-mephenytoin, 4- hydroxymephenytoin, dextromethorphan, ticlopidine were purchased from TRC (Toronto, Canada). Pooled human liver microsomes (Batch # 452161) were purchased from BD Gentest Corporation (Woburn, MA, USA). NADPH were purchased from Roche (Shanghai, China). All inorganic salts are of analytical grade were purchased from Sinopharm Chemical Reagent Co. (Shanghai,
China). All organic solvents are of HPLC grade and were purchased from Sigma (St. Louis, MO, USA). Distilled water, prepared from demineralized water, was used throughout the study. For 2C19 inhibition test, incubation mixtures contained pooled human liver microsome (0.5 mg/mL), 3.0 mM MgCl2, specific substrate of each isoform, and probe inhibitor or test compound (10 and 0 μM) in 0.1 M potassium phosphate buffer (total volume 0.1 mL). The final concentrations of substrates and inhibitors are listed in the table above. Final concentration of organic solvent is less than 1% (v/v). The mixture was pre- incubated for 10 min at 37 °C. Then, 1 mM NADPH was added to initiate reaction. Following a 25-min incubation at 37 °C, the reaction was terminated by addition of 400 uL acetonitrile containing tolbutamide and labetalol as internal standards. For other CYP inhibition, incubation mixtures contained pooled human liver microsome (0.1 mg/mL), 3.0 mM MgCl2, specific substrate of each isoform, and probe inhibitor or test compound (10 and 0 μM) in 0.1 M potassium phosphate buffer (total volume 0.1 mL). The final concentrations of substrates and inhibitors are listed in the table above. Final concentration of organic solvent is less than 1% (v/v). The mixture was pre-incubated for 10 min at 37 °C. Then, 1 mM NADPH was added to initiate reaction. Following a 10-min incubation at 37 °C, the reaction was terminated by addition of 400 μL acetonitrile containing tolbutamide and labetalol as internal standards. The reactions were terminated by the addition of 4-fold volume of ice-cold acetonitrile containing internal standard. The mixture was centrifuged at 4000 rpm for 20 min. The supernatant was mixed with 4-fold volume of water. Aliquot of the resulting solution was injected into the LC- MS/MS system for analysis. The peak area ratio of product to internal standard will be plotted as a percentage of the relevant negative control for each reaction to represent the residual enzymatic activity. The percentage inhibition is calculated by the equation: Inhibition = 100*(Control - Treatment)/Control. Example 31. Mice brain/plasma PK studies of PB94 In vivo mice brain and plasma PK studies were conducted by HD Biosciences (China) Co., Ltd. C57BL/6 mice (female, 6-8 week, n = 3 for each time point) were acclimated for 3 days prior to use and were confirmed to be in good health. Compound PB94 was dissolved in 10%DMSO/10 % Tween 80/80% saline to prepare the stock solution. The final concentration of formulation solution is 1mg/mL. Approximately 25μL
solution was administered into C57BL/6 male mice via a single intraperitoneal (IP) injection. At each time point (0.5 h, 1 h, and 4 h), around 80 μL of blood will be collected from the submandibular point using the microcapillary pipet and put into EDTA-2K coated tube. Mixed thoroughly and quickly put on ice. The blood samples will be centrifuged at 4000 × rpm, 4°C, 10 min to yield around 30 μL plasma. The plasma samples will be stored under -80°C until LC-MS/MS analysis. For the LC-MS/MS analysis, an aliquot of 20 μL plasma was spiked into a 1.5 mL tube, and 80 μL of acetonitrile containing internal standard was added for protein precipitation. The mixture was vortexed, centrifuged at 14000 rpm for 5 min. Transfer 80 μL of supernatant was mixed with 320 μL of H2O and the final solution was injected for LC- MS/MS analysis (Chromatographic separation was achieved on the Kinetex C18 column 2.6um, 2.1*50mm,100A). Immediately after the blood sampling, the brain was quickly removed, rinsed with cold saline (0.9% NaCl), blotted with dry gauze, weighed, and stored at -70°C until further processing within 1 hour of collection. Each brain sample was homogenized in proper volume of cold PBS, pH 7.4 on ice. The brain homogenate from each brain is then stored at -70°C until further processing. The plasma and brain samples were processed using acetonitrile precipitation and analyzed by LC- MS/MS. The exposure levels (ng/mL or ng/g) of PB94 in plasma and brain samples were then determined by LC-MS/MS. The plasma: brain ratios were also calculated. Example 32. Hepatocyte stability Test compound PB94 was weighed and dissolved in 100% DMSO to get 10 mM stock solution. The stock solution was diluted to 500 μM with mixture of methanol and H2O (1:1). The final concentrations of DMSO and methanol were equal or less than 0.1%. Stock solutions of testosterone and 7-ethoxycoumarin were prepared at a concentration of 10 mM in 100% DMSO, respectively. The stock solution for each compound was diluted into 500 μM or 100 μM with mixture of methanol and H2O (1:1) . The final concentrations of DMSO and methanol were equal or less than 0.1%. Hepatocytes incubations were conducted in duplicate in 96-well plates. Each well contains 50 μ L of williams E medium containing 1*glutamax and 1 million/mL hepatocytes and test compound (5 μM) or positive control compound (5 μM or 1μM). Reactions in appropriate wells as designed were terminated at various time points
(0, 15, 30, 60, 120 min) by adding 200 μL of ice-cold acetonitrile containing internal standard. Centrifuge the plate (4000 rpm, 20 min) and transfer 50 μL from all samples to a daughter plate containing 200 μL of ddH2O per well. Analyze samples using LC/MS/MS. Example 33. In vitro metabolic stability evaluation of PB94 The in vitro metabolic stability studies were conducted by HD Biosciences (China) Co., Ltd. Liver microsome stability: Test compound PB94 was weighed and dissolved in 100% DMSO to get 10 mM stock solution. The stock solution was diluted to 500 μM with 50% acetonitrile. Liver microsome incubations were conducted in duplicate in 96-well plates. Each well contains 40 μL of 0.1 M potassium phosphate buffer (pH 7.4), 4.125 mM MgCl2, 0.625 mg/mL liver microsomes, and test compound (1.25 μM) or positive control. After 5-min preincubation at 37 °C, 10 μL of 5.0 mM NADPH in 0.1 M potassium phosphate buffer was added to initiate the enzymatic reaction. The final component concentrations are 0.1 M potassium phosphate buffer (pH 7.4), 1.0 mM. NADPH, 3.3 mM MgCl2, 0.5 mg/mL liver microsomes, and test compound (1.0 μM) or positive control (1.0 μM). Reactions were terminated at various time points (0, 5, 10, 20, 40 min) by adding 200 μL of ice-cold acetonitrile containing internal standard. A parallel incubation was performed using 0.1 M potassium phosphate buffer (pH 7.4) instead of NADPH as the negative control, and reactions was terminated at 40 min after incubation at 37°C. Samples were analyzed by HPLC- MS/MS and peak areas were recorded for each analyte. The peak area ratio of test compound to internal standard will be plotted as a percentage of the relevant zero time point control (%Remained) for each reaction. The rate of metabolism (k) is the slope of the linear regression from log percentage remaining versus incubation time. The in vitro T1/2 is calculated as -0.693/k. Example 34. Acute toxicity assays To investigate the safety profile of PB94, acute toxicity was evaluated in mice. The results showed that there is no observed adverse effect after treating the BP94 at 200 mg/kg. The biochemical analysis showed that BP94 administration didn’t change the important kidney and liver function indexes, such as uric acid and alanine aminotransferase, as well as electrolytes including Na+, K+, Cl-. The blood analysis showed that BP94 administration didn’t change the blood count indexes, including red blood cells, white blood cells, and blood platelets (FIG.28A). And there are no significant differences in body weight between
control (FIG.28B). In addition, no pathological abnormality of the main organs, including the heart, liver, spleen, lung, and kidney, was observed (FIG. 29). Collectively, BP94 is well tolerated in vivo. Procedure: Male and female mice (Balb/c) (around 20 g, 5 weeks old) were procured from HFK Biotechnology Company (Beijing, China) with Animal Quarantine Conformity Certificates. Mice were maintained at around 20 °C and 55% humidity, with a 12 h light/dark cycle and ad libitum food/water. The acute toxicity assays on animals were performed in conformity with the ARRIVE guidelines which were approved by the Institutional Animal Care and Treatment Committee of West China Hospital (Permit Number: 20230105003). Mice received an intraperitoneal dose of BP94 at 200 mg/kg. The control group was given the solvent. The body weight of the mice was recorded every three days. After a fortnight, the mice were euthanized. Blood samples were taken for both biochemical and routine blood examinations. Additionally, primary organs such as the heart, liver, spleen, lungs, and kidneys were harvested for H&E staining. Example 35. In Vitro ADME Evaluation and In Vivo Pharmacokinetic Profiling of PB94 In vitro ADME assessments were carried out to evaluate the drug-like profiles of PB94. Data shown in Table 8 indicate that PB94 possesses good metabolic stability in human liver microsomal and mouse plasma, with half-lives (t1/2) of 54.6 min and 133.8 min, respectively. In addition, no significant inhibitory effects were observed on cytochrome P450 enzymes (CYPs) 1A2, 2C19, and 2D6 at 10 μM of PB94. The pharmacokinetic (PK) profiles of PB94 were assessed by administrating 10 mg/kg PB94 intravenously (i.v) and orally (p.o) in mice. Results show that PB94 had suitable PK properties with a half-life of 5.3 hours by p.o. administration. Of note, PB94 showed less favorable bioavailability when by oral administration (11.2 %). Moreover, to evaluate the brain permeability of PB94, in vivo brain/plasma pharmacokinetic studies were performed by IP administrating PB94 at 1mg/kg in C57BL/6 mice. As a result, PB94 exhibited good brain permeability, with brain/plasma ratios of 2.3 at 30 min and 2.2 at 4 h post-injection. Table 8. ADME/PK studies of PB94Į
Example 37. Cell-based Assay of PB94 Using Mouse Microglia BV2 Cells HDAC11 is characterized by immune regulatory functions involving regulation of IL-10. A mechanistic study was performed in order to evaluate whether PB94 may affect neuroinflammatory events with a focus on IL-10 using mouse microglia BV2 cells. Mouse microglia BV2 cells were induced by the well-characterized and previously reported immune-stimulating molecule lipopolysaccharides (LPS), alone or in combination with PB94, to assess inflammatory changes as a function of PB94. As a result, PB94 significantly reduced IL-10 expression in LPS (10 ng/ml) treated cells (FIG.7), indicating the inflammation regulatory activity of PB94.
Claims
WHAT IS CLAIMED IS: 1. A compound of Formula (I):
or a pharmaceutically acceptable salt thereof, wherein: Q is a bond or -NH-; L is -NH(C=O)(C1-C4 alkyl)-*, -O-(C1-C6 alkyl)-*, -(C=O)-, and -(C1-C4 alkyl)-, wherein “*” indicates the point of attachment to N; R1 is -OH, -C1-C4 haloalkyl, and -NH(C1-C4 alkyl); R2 is halogen, -OH, C1-C6 alkyl, and C1-C6 alkoxy; R3 is hydrogen, C1-C6 alkenyl, and C1-C6 alkyl optionally substituted with C3- C6 cycloalkyl; R4 is C1-C4 alkyl, phenyl, 9-15 membered heteroaryl, 9-15 membered heterocyclyl, each optionally substituted with 1-2 R4a; or R3 and R4 taken together with the nitrogen to which each is bound join to form a 9-13 membered heterocyclyl or 9-10 membered heteroaryl, each optionally substituted with R5; each R4a is halogen, C1-C6 alkyl, C1-C6 alkoxy, C6-C10 cycloalkyl, oxo, and - (C=O)NH(C1-C4 alkyl optionally substituted with C6-C10 cycloalkyl); R5 is -(C=O)NR5aR5b, -NR5cR5d, -(CH2)NR5eR5f, and C1-C4 alkyl optionally substituted with C6-C10 cycloalkyl; R5a, R5b, R5c, R5d, R5e and R5f are each hydrogen, C1-C6 alkyl and C1-C6 alkenyl, each optionally substituted with oxo and/or C6-C10 cycloalkyl; and n is 0 or 1.
2. The compound of claim 1, wherein Q is a bond.
3. The compound of claim 1, wherein Q is -NH-.
4. The compound of any one of claims 1-3, wherein L is -NH(C=O)(C1-C4 alkyl)-*, wherein “*” indicates the point of attachment to N.
5. The compound of any one of claims 1-3, wherein L is -O-(C1-C6 alkyl)-*, wherein “*” indicates the point of attachment to N.
6. The compound of any one of claims 1-3, wherein L is -(C=O)-.
7. The compound of any one of claims 1-3, wherein L is -(C1-C4 alkyl)-.
8. The compound of any one of claims 1-7, wherein R1 is -OH.
9. The compound of any one of claims 1-7, wherein R1 is -C1-C4 haloalkyl.
10. The compound of any one of claims 1-7, wherein R1 is -NH(C1-C4 alkyl).
11. The compound of any one of claims 1-10, wherein R2 is halogen.
12. The compound of any one of claims 1-10, wherein R2 is -OH.
13. The compound of any one of claims 1-10, wherein R2 is C1-C6 alkyl.
14. The compound of any one of claims 1-10, wherein R2 is C1-C6 alkoxy.
15. The compound of any one of claims 1-14, wherein R3 is hydrogen.
16. The compound of any one of claims 1-14, wherein R3 is C1-C6 alkenyl.
17. The compound of any one of claims 1-14, wherein R3 is C1-C6 alkyl optionally substituted with C3-C6 cycloalkyl.
18. The compound of any one of claims 1-17, wherein R4 is C1-C4 alkyl optionally substituted with 1-2 R4a.
19. The compound of any one of claims 1-17, wherein R4 is phenyl optionally substituted with 1-2 R4a.
20. The compound of any one of claims 1-17, wherein R4 is 9-15 membered heteroaryl optionally substituted with 1-2 R4a.
21. The compound of any one of claims 1-17, wherein R4 is 9-15 membered heterocyclyl optionally substituted with 1-2 R4a.
22. The compound of any one of claims 1-14, wherein R3 and R4 taken together with the nitrogen to which each is bound join to form a 9-13 membered heterocyclyl or 9-10 membered heteroaryl, each optionally substituted with R5.
23. The compound of any one of claims 1-14 and 22, wherein R3 and R4 taken together with the nitrogen to which each is bound join to form a 9-13 membered heterocyclyl optionally substituted with R5.
24. The compound of any one of claims 1-14 and 22-23, wherein R3 and R4 taken together with the nitrogen to which each is bound join to form an unsubstituted 9-13 membered heterocyclyl.
25. The compound of any one of claims 1-14 and 22, wherein R3 and R4 taken together with the nitrogen to which each is bound join to form a 9-10 membered heteroaryl optionally substituted with R5.
26. The compound of claim 25, wherein the 9-10 membered heteroaryl is selected from indolyl, azaindolyl, quinazolinedionyl, and benzimidazoly.
27. The compound of claim 25 or 26, wherein the 9-10 membered heteroaryl is selected from the group consisting of indolyl, pyrrolo[2,3-b]pyridinyl, benzo[d]imidazolyl, and quinazoline-2,4-dione.
28. The compound of any one of claims 25-27, wherein the 9-10 membered heteroaryl is indolyl substituted with R5.
29. The compound of any one of claims 25-27, wherein the 9-10 membered heteroaryl is pyrrolo[2,3-b]pyridinyl substituted with R5.
30. The compound of any one of claims 25-27, wherein the 9-10 membered heteroaryl is benzo[d]imidazolyl substituted with R5.
31. The compound of any one of claims 25-27, wherein the 9-10 membered heteroaryl is quinazoline-2,4-dione substituted with R5.
32. The compound of any one of claims 1-31, wherein at least one R4a is halogen.
33. The compound of any one of claims 1-31, wherein at least one R4a is C1-C6 alkyl.
34. The compound of any one of claims 1-31, wherein at least one R4a is C1-C6 alkoxy.
35. The compound of any one of claims 1-31, wherein at least one R4a is C6-C10 cycloalkyl.
36. The compound of any one of claims 1-31, wherein at least one R4a is oxo.
37. The compound of any one of claims 1-31, wherein at least one R4a is - (C=O)NH(C1-C4 alkyl optionally substituted with C6-C10 cycloalkyl).
38. The compound of any one of claims 1-37, wherein R5 is -(C=O)NR5aR5b.
39. The compound of any one of claims 1-37, wherein R5 is -NR5cR5d.
40. The compound of any one of claims 1-37, wherein R5 is -(CH2)NR5eR5f.
41. The compound of any one of claims 1-37, wherein R5 is C1-C4 alkyl optionally substituted with C6-C10 cycloalkyl.
42. The compound of any one of claims 1-41, wherein one of R5a and R5b is hydrogen and the other one of R5a and R5b is C1-C6 alkyl^ substituted with oxo and/or C6-C10 cycloalkyl.
43. The compound of any one of claims 1-41, wherein one of R5c and R5d is hydrogen and the other one of R5c and R5d is C1-C6 alkyl^ substituted with oxo and/or C6-C10 cycloalkyl.
44. The compound of any one of claims 1-41, wherein one of R5c and R5d is hydrogen and the other one of R5c and R5d is C1-C6 alkenyl^substituted with oxo and/or C6-C10 cycloalkyl.
45. The compound of any one of claims 1-41, wherein one of R5e and R5f is hydrogen and the other one of R5e and R5f is C1-C6 alkyl^ substituted with oxo and/or C6-C10 cycloalkyl.
46. The compound of any one of claims 1-45, wherein one of R5a, R5b, R5c, R5d, R5e and R5f is C1-C6 alkyl substituted with oxo and/or adamantly.
47. The compound of any one of claims 1-45, wherein one of R5a, R5b, R5c, R5d, R5e and R5f is C1-C6 alkenyl substituted with oxo and/or adamantly.
48. The compound of any one of claims 1-47, wherein n is 0.
49. The compound of any one of claims 1-47, wherein n is 1.
58. A pharmaceutical composition comprising a compound of any one of claims 1-57, or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable excipients.
59. A method of treating an HDAC-associated disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of any one of claims 1-57, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 58.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202263385999P | 2022-12-05 | 2022-12-05 | |
| US63/385,999 | 2022-12-05 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2024123700A1 true WO2024123700A1 (en) | 2024-06-13 |
Family
ID=91380086
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2023/082358 Ceased WO2024123700A1 (en) | 2022-12-05 | 2023-12-04 | Histone deacetylase inhibitors |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2024123700A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN119591595A (en) * | 2024-12-04 | 2025-03-11 | 四川大学华西医院 | A HDAC6 inhibitor, a pharmaceutical composition and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040214862A1 (en) * | 2001-06-15 | 2004-10-28 | Ulrike Leser-Reiff | Aromatic dicarboxylic acid derivatives |
| US20170037059A1 (en) * | 2009-09-11 | 2017-02-09 | Merck Sharp & Dohme Corp. | Gyrase inhibitors |
| US20190375735A1 (en) * | 2017-01-10 | 2019-12-12 | Cstone Pharmaceuticals (Suzhou) Co., Ltd. | HDAC6 Selective Inhibitors, Preparation Method Therefor, and Application Thereof |
-
2023
- 2023-12-04 WO PCT/US2023/082358 patent/WO2024123700A1/en not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040214862A1 (en) * | 2001-06-15 | 2004-10-28 | Ulrike Leser-Reiff | Aromatic dicarboxylic acid derivatives |
| US20170037059A1 (en) * | 2009-09-11 | 2017-02-09 | Merck Sharp & Dohme Corp. | Gyrase inhibitors |
| US20190375735A1 (en) * | 2017-01-10 | 2019-12-12 | Cstone Pharmaceuticals (Suzhou) Co., Ltd. | HDAC6 Selective Inhibitors, Preparation Method Therefor, and Application Thereof |
Non-Patent Citations (1)
| Title |
|---|
| DATABASE PUBCHEM SUBSTANCE 22 April 2017 (2017-04-22), ANONYMOUS: "SCHEMBL18485212", XP093182531, Database accession no. 333585490 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN119591595A (en) * | 2024-12-04 | 2025-03-11 | 四川大学华西医院 | A HDAC6 inhibitor, a pharmaceutical composition and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6788683B2 (en) | Heterocyclic compound | |
| CA2948721C (en) | Deuterated compounds and uses thereof | |
| JP7631235B2 (en) | N-(phenyl)-indole-3-sulfonamide derivatives and related compounds as GPR17 modulators for treating CNS disorders such as multiple sclerosis | |
| JP4604129B2 (en) | Quinuclidinol derivatives as muscarinic receptor antagonists | |
| TW202039435A (en) | Substituted 3-((3-aminophenyl)amino)piperidine-2,6-dione compounds, compositions thereof, and methods of treatment therewith | |
| JP2020502047A (en) | MAGL inhibitor | |
| JP2011506487A (en) | Translocator protein ligand | |
| US20240327361A1 (en) | Radiolabeled compositions and methods of use thereof | |
| EP4089102A1 (en) | Modulators of sortilin activity | |
| WO2022042707A1 (en) | Cyclic-amp response element binding protein (cbp) and/or adenoviral e1a binding protein of 300 kda (p300) degradation compounds and methods of use | |
| HUE035413T2 (en) | Diazacarbazole derivatives as tau-PET ligand | |
| JP2015523385A (en) | Methods for inhibiting tau phosphorylation | |
| KR20120094056A (en) | MGLU2 agonists | |
| CN109651359A (en) | Substituted nicotinamide compound and medical composition and its use | |
| JP7492005B2 (en) | Benzene ring-containing compounds and their applications | |
| JP2012507534A (en) | Novel substituted azabenzoxazoles | |
| TW202333671A (en) | Deuterated organic compounds and uses thereof | |
| WO2016079669A1 (en) | Labeled amino pyrimidine derivatives | |
| TW202340145A (en) | Deuterated organic compounds and uses thereof | |
| CN102066345B (en) | *Azolidine derivatives as NMDA antagonists | |
| JP2022532810A (en) | Condensed heterocyclic derivative with selective BACE1 inhibitory activity | |
| US20140328755A1 (en) | Highly selective sigma receptor ligands and radioligands as probes in nociceptive processing and the pathphysiological study of memory deficits and cognitive disorders | |
| TW202515554A (en) | Bicyclic heteroaryl-containing piperidine inhibitors of slc6a19 function | |
| CA2911307C (en) | Use of fluorinated derivatives of 4-aminopyridine in therapeutics and medical imaging | |
| WO2019222267A1 (en) | Abhd12 inhibitors and methods of making and using same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23901406 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 23901406 Country of ref document: EP Kind code of ref document: A1 |

















































