WO2024111838A1 - 엔도라이신을 생산하는 형질전환 바실러스 서브틸리스 균주 - Google Patents

엔도라이신을 생산하는 형질전환 바실러스 서브틸리스 균주 Download PDF

Info

Publication number
WO2024111838A1
WO2024111838A1 PCT/KR2023/013949 KR2023013949W WO2024111838A1 WO 2024111838 A1 WO2024111838 A1 WO 2024111838A1 KR 2023013949 W KR2023013949 W KR 2023013949W WO 2024111838 A1 WO2024111838 A1 WO 2024111838A1
Authority
WO
WIPO (PCT)
Prior art keywords
strain
gene
endolysin
recombinant
bacillus subtilis
Prior art date
Application number
PCT/KR2023/013949
Other languages
English (en)
French (fr)
Inventor
조재형
서민호
전다혜
박선일
박병묵
Original Assignee
주식회사 리신바이오
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 리신바이오 filed Critical 주식회사 리신바이오
Publication of WO2024111838A1 publication Critical patent/WO2024111838A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C12N9/80—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in linear amides (3.5.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/07—Bacillus
    • C12R2001/125—Bacillus subtilis ; Hay bacillus; Grass bacillus

Definitions

  • the present invention relates to a transformed Bacillus subtilis strain, and more particularly, to a transformed Bacillus subtilis strain that produces endolysin.
  • Endolysin is a specialized enzyme that can cleave a specific region of peptidoglycan, which has a cell wall made of a glycoprotein layer, and like phages, it is considered one of the powerful alternatives to antibiotics. The reason is that endolysin is known to have a much lower probability of developing resistance compared to phages. Bacteria can develop resistance to phages in a variety of ways, most notably by removing receptors that phages can attach to, or by specifically cutting phage DNA when it infiltrates. However, it is very difficult to develop resistance to endolysin.
  • the present invention is intended to solve several problems, including the above problems, by applying an endolysin secretion expression system to B. subtilis , known as a GRAS strain, to kill Staphylococcus aureus due to its excellent antibacterial activity.
  • the purpose is to provide a transformed Bacillus subtilis strain that produces an effectively inhibiting endolysin.
  • these tasks are illustrative and do not limit the scope of the present invention.
  • a recombinant plasmid vector containing a recombinant endolysin gene is transformed into a host cell, B. subtilis strain, and the recombinant endolysin is secreted extracellularly, a transformed Bacillus sub. Tillis strains are provided.
  • preparing a host Bacillus subtilis strain in which the alr A gene is deleted Transducing a plasmid containing a Bacillus repB gene, a gene encoding a recombinant endolysin, an antibiotic resistance gene, an E. coli origin of replication, and an alr A gene into the host Bacillus subtilis strain; Culturing the transduced host strain in an alanine-free medium to select positive colonies; And a method for mass production of recombinant endolysin is provided, comprising collecting the selected positive colonies and culturing them in a culture medium, then removing the strain from the culture medium and isolating and purifying the recombinant endolysin.
  • an antibacterial pharmaceutical composition comprising the transformed Bacillus subtilis strain or a culture supernatant of the strain as an active ingredient is provided.
  • a probiotic preparation containing the transformed Bacillus subtilis strain as an active ingredient is provided.
  • the transgenic Bacillus subtilis strain producing endolysin of the present invention as described above is produced by improving the Bacillus subtilis strain, known as a beneficial bacterium, at the genetic level and applying an endolysin expression system, so that it can be directly orally administered with high antibacterial activity. When administered, it can effectively suppress intestinal pathogens, so it can be used as a material for developing new antibiotics for humans or livestock. In addition, it can be used as a biological control agent that can effectively suppress cocci and the biofilms they produce, and can be widely used to treat diseases caused by infection by antibiotic-resistant E. coli, making it an alternative to conventional antibiotics. Of course, the scope of the present invention is not limited by this effect.
  • Figure 1 is a schematic diagram schematically showing the structure of the pLSB226 vector prepared according to an embodiment of the present invention.
  • FIG. 2 is a diagram showing the B. subtilis subtilisin gene sequence used to develop an exocrine expression system using Bacillus subtilis. Green represents RBS and red represents signal sequence.
  • Figure 3 is a photograph showing the expression of pLSB227-eGFP, a recombinant vector of the present invention manufactured using a Bacillus subtilis - E. coli shuttle vector, in LB medium.
  • Figure 4 is a photograph confirming the expression of pLSB227-eGFP, a recombinant vector, in B. subtilis cell lysate and supernatant by Western blot analysis.
  • Figure 5 is a photograph confirming the expression of the recombinant vector pLSB227-LB-SAL09 in B. subtilis cell lysate and supernatant by Western blot analysis.
  • Figure 6 is a photograph showing the antibacterial activity of the supernatant of B. subtilis 168 transformed with pLSB227-LB-SAL09 of the present invention treated with S. aureus .
  • Figure 7 is a schematic diagram schematically showing the manufacturing process of B. subtilis ( ⁇ alr A), a recombinant strain containing an auxotrophic marker.
  • Figure 8 is a photograph observing the expression of B. subtilis ( ⁇ alr A), a recombinant strain containing an auxotrophic marker.
  • Figure 9 is a gel photograph confirming the expression of B. subtilis ( ⁇ alr A) strain by performing PCR.
  • SM is DNA Ladder
  • Lane 1 was PCR performed using the genomic DNA of B. subtilis ( ⁇ alr A) strain as a template.
  • Lane 2 was a comparison sample where PCR was performed using B. subtilis 168 genomic DNA as a template.
  • Figure 10 is a photograph showing expression in LB medium after transformation of the pLSB228 recombinant vector into B. subtilis ( ⁇ alr A).
  • Figure 11 is a graph showing the results of a CFU reduction assay to confirm the killing ability of the recombinant endolysin SAL09 of the present invention against S. aureus .
  • Figure 12 is a graph showing the results of analyzing the cytotoxicity of the recombinant endolysin SAL09 of the present invention.
  • endolysin is also known as lysin or murein hydrolase and is produced by bacteriophage to kill the host in the final step of the lytic cycle. It is an enzyme that hydrolyzes the peptidoglycan layer in the cell wall of bacteria.
  • the endolysin of double-stranded DNA phage is generally a protein of 25 to 40 kDa in size and is a monomeric protein composed of two domains.
  • Endolysin of Gram-positive bacteria consists of a catalytic domain at the amino terminus (N-terminal) that plays a role in peptidoglycan decomposition and a cell-binding domain at the carboxyl terminus (C-terminal). .
  • Staphylococcus aureus used in this document is one of the staphylococcus aureus that resides on the skin and digestive tract of humans and animals, and is the causative agent of various epidermal infections such as abscesses, food poisoning, pneumonia, meningitis, and sepsis in humans. Staphylococcus is named after the shape of the fungus that forms the colony resembles a bunch of grapes, and aureus means gold.
  • Bacillus subtilis used in this document is a representative fungal species of the genus Bacillus. It is an aerobic Gram-positive bacterium with a single-layer structure, is not pathogenic to humans and animals, and secretes a large amount of protein in the medium. It is famous as a strain that can industrially produce useful enzymes such as amylase and protease. It is also widely used in recombinant DNA experiments. It is generally non-pathogenic and rarely causes eye infections in humans or urinary tract infections in chronically ill people. It is widely distributed in the natural world, including dry grass next to roads, soil, and air. It is a facultative anaerobic bacterium, the optimal temperature is 28 ⁇ 40°C, and it grows well on nutrient agar medium.
  • a recombinant plasmid vector containing a recombinant endolysin gene is transformed into a host cell, B. subtilis strain, and the recombinant endolysin is secreted extracellularly, a transformed Bacillus sub. Tillis strains are provided.
  • the recombinant plasmid vector may be a B. subtilis - E. coli shuttle vector containing a repB gene capable of replication in Bacillus subtilis, an origin of replication capable of replication in E. coli, and an antibiotic resistance gene, and the host cell may have an alr A gene. It may be deleted, and the plasmid DNA may additionally include the alr A gene.
  • the recombinant endolysin may consist of the amino acid sequence shown in SEQ ID NO: 1 and may have antibacterial activity against Staphylococcus aureus ( S. aureus ), and the Staphylococcus aureus is methicillin-resistant Staphylococcus aureus. It may be Methicillin-resistant S. aureus (MRSA) or Methicillin-sensitive S. aureus (MSSA).
  • S. aureus Staphylococcus aureus
  • MRSA Methicillin-resistant S. aureus
  • MSSA Methicillin-sensitive S. aureus
  • preparing a host Bacillus subtilis strain in which the alr A gene has been deleted Transducing a plasmid containing a Bacillus repB gene, a gene encoding a recombinant endolysin, an antibiotic resistance gene, an E.
  • coli origin of replication and an alr A gene into the host Bacillus subtilis strain; Culturing the transduced host strain in an alanine-free medium to select positive colonies; And a method for mass production of recombinant endolysin is provided, comprising collecting the selected positive colonies and culturing them in a culture medium, then removing the strain from the culture medium and isolating and purifying the recombinant endolysin.
  • an antibacterial pharmaceutical composition comprising the transformed Bacillus subtilis strain or a culture supernatant of the strain as an active ingredient is provided.
  • a probiotic preparation containing the transformed Bacillus subtilis strain as an active ingredient is provided.
  • the pharmaceutical composition of the present invention may vary depending on the type of patient's affected area, application area, number of treatments, treatment time, dosage form, patient's condition, type of adjuvant, etc.
  • the amount used is not particularly limited, but may be 0.01 ⁇ g/kg/day to 10 mg/kg/day.
  • the daily dose may be administered once a day, or divided into 2 to 3 times a day at appropriate intervals, or may be administered intermittently at intervals of several days.
  • the compound in the pharmaceutical composition of the present invention, can be administered orally or parenterally, and is preferably administered parenterally by intravenous injection, subcutaneous injection, intracerebroventricular injection, or intracerebrospinal fluid injection. , can be administered by intramuscular injection or intraperitoneal injection.
  • the pharmaceutical composition of the present invention may further include appropriate carriers, excipients, and diluents commonly used in the preparation of pharmaceutical compositions. Additionally, solid or liquid formulation additives can be used in the production of pharmaceutical compositions. Additives for formulations may be either organic or inorganic. Excipients include, for example, lactose, sucrose, white sugar, glucose, cornstarch, starch, talc, sorbitol, crystalline cellulose, dextrin, kaolin, calcium carbonate, and silicon dioxide.
  • binders include polyvinyl alcohol, polyvinyl ether, ethyl cellulose, methyl cellulose, gum arabic, tragacanth, gelatin, shellac, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, calcium citrate, Examples include dextrin and pectin.
  • lubricants include magnesium stearate, talc, polyethylene glycol, silica, and hydrogenated vegetable oil.
  • a coloring agent any coloring agent that is approved for addition to conventional medicines can be used. These tablets and granules can be coated with sugar coating, gelatin coating, or other appropriate coating as needed. Additionally, preservatives, antioxidants, etc. can be added as needed.
  • the pharmaceutical composition when it is a drug, it may additionally include one or more selected from the group consisting of fillers, anti-coagulants, lubricants, wetting agents, flavorings, emulsifiers, and preservatives.
  • the formulation of the pharmaceutical composition of the present invention may be in a preferred form depending on the method of use, and in particular, a method known in the art is adopted to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal. It is better to formulate it.
  • Examples of specific dosage forms include PLASTERS, GRANULES, LOTIONS, LINIMENTS, LEMONADES, POWDERS, SYRUPS, LIQUIDS AND SOLUTIONS, AEROSOLS, EXTRACTS, ELIXIRS, FLUIDEXTRACTS, EMULSIONS, SUSPENSIONS, DECOCTIONS, INFUSIONS, tablets (TABLETS), SUPPOSITORIES, INJECTIONS, SPIRITS, CATAPLSMA, CAPSULES, TROCHES, TINCTURES, PASTES, It may be any one selected from PILLS, soft or hard gelatin capsules.
  • the pharmaceutical composition of the present invention may further contain ingredients commonly used, such as stabilizers, solubilizers, and conventional auxiliaries such as flavoring agents, and carriers.
  • biofilm is a complex composed of a bacterial colony, which is a solid biological surface, and an outer membrane, which is a non-biological surface. Therefore, biofilm refers to the entirety including this outer membrane and the bacterial colonies contained within it.
  • a biofilm can be said to be a small city made up of bacteria, in which the bacteria communicate with each other and defend against the outside world. Because of this, biofilms enable bacteria to survive even under various environmental stresses, including antibiotics.
  • antibiotics that are effective against separately floating bacteria tend to lose their effectiveness when the bacteria form a biofilm.
  • bacteria form a biofilm antibodies cannot penetrate the outer membrane present in the biofilm, and the resistance of bacteria to antibiotics can increase by about 1,000 times, disabling the host's immune system.
  • biofilms it becomes difficult for antibiotics, which are widely used to treat infections, to work, ultimately weakening the effectiveness of antibiotic treatment. Therefore, in order to prevent the formation of such a biofilm from incapacitating antibiotic treatment, it is necessary to develop a new antibiotic that can remove the biofilm even if the biofilm is formed, or to destroy the outer membrane present in the biofilm so that the existing antibiotic can be effective.
  • Ingredients that can provide effective treatment should be used together with existing antibiotics.
  • the transgenic Bacillus subtilis strain that produces endolysin of the present invention can be improved at the genetic level and directly orally administered through an endolysin expression system to secrete endolysin in the intestines and can be used as an antibacterial material for oral preparations. .
  • the present inventors directly prepared the B. subtilis - E. coli shuttle vector pLSB226 (SEQ ID NO: 10) because there were not many commercially available vectors for B. subtilis compared to other research strains (E. coli, etc.).
  • replication protein B rep B
  • an antibiotic marker site that can be used as a selection marker in Bacillus subtilis were synthesized by referring to existing reports such as NCBI.
  • the corresponding gene region was inserted into the Eco RI restriction enzyme site of pBHA, a vector containing the pUC ori and ampicillin resistance gene that can be replicated in E. coli, and finally the B. subtilis - E. coli shuttle vector was created, which was transformed into pLSB226. It was named ( Figure 1).
  • the present inventors applied the previously reported exocrine expression system available in Bacillus subtilis as a method to express the target protein outside the cells of Bacillus subtilis (JH Kim et al., Biotechnology and Bioprocess Engineering , volume 13, Article number: 313, 2008) .
  • foreign protein expression was induced using the promoter and signal sequence of the B. subtilis subtilisin gene ( apr E) ( Figures 2a and 2b).
  • MCS and 6xhis tagging were added to the downstream region of the sequence shown in Figure 2 and used to confirm future foreign gene insertion and expression of the gene.
  • the above sequence was inserted into the pLSB226 vector using Spe I and Pst I at both ends, and the final name was pLSB227.
  • the present inventors inserted the eGFP gene, a reporter gene, into the Xho I site in the pLSB227 MCS prepared above and confirmed whether the gene was expressed outside the cell.
  • the eGFP gene was amplified using the pUC19-eGFP vector as a template and the primers shown in Table 1 below.
  • the amplified eGFP gene was treated with Xho I restriction enzyme and then inserted into the same restriction enzyme site of pLSB227, a Bacillus subtilis - E. coli shuttle vector.
  • the recombinant vector into which eGFP was inserted was named pLSB227-eGFP, and the vector was transformed into B. subtilis 168 strain through electroporation. Recombinant B.
  • subtilis 168 containing the pLSB227-eGFP was selected on an agar plate containing kanamycin (20 ⁇ g/ml), and one colony was plated on a new agar plate and cultured for 24 hours. Then, it was placed on a UV Transilluminator and the expression of eGFP was observed with the naked eye ( Figure 3). Then, to check extracellular secretion and expression, the strain was cultured in LB (kanamycin 20 ⁇ g/ml) medium for 24 hours and confirmed through Western blotting. The specific experimental method was to obtain a single transformed colony, inoculate it into 10 ml LB (kanamycin 20 ⁇ g/ml), and then seed culture was performed for 18 hours.
  • Primer sequence information primer Base sequence (5' ⁇ 3') sequence number XhoI_eGFP(F) CTCGAGGTGTCCAAAGGCGAAGAAC 2 XhoI_eGFP(R) CTCGAGTTTATACAGTTCATCCATG 3 SacI_SAL09(F) GAGCTCGCTAAGACTCAAGCAGAAATAAAT 4 XhoI_ SAL09(R) CTCGAGTTTAAATGTACCCCAAGCATTG 5 alrA ORF(F) ATGAGCACAAAACCTTTTTACAG 6 alrA ORF(R) TTAATTGCTTATATTTACCTGC 7 alrA promoter(F) ACTAGTCCGCCAAAGGCCAAACATGA 8 alrA ORF(R) ACTAGTTTAATTGCTTATATTTACCTGC 9
  • the present inventors inserted the gene sequence encoding the recombinant endolysin SAL09 targeting S. aureus, developed from a previously registered patent (Korean Patent No. 2426421), into pLSB227 and transformed it into B. subtilis .
  • the secretion and expression of LB-SAL09 outside the recombinant strain cells and its antibacterial activity were confirmed.
  • the LB-SAL09 region was PCR amplified and secured using the primers in Table 1, and the corresponding gene was treated with Sac I and Xho I restriction enzymes to isolate Bacillus subtilis - E.
  • the present inventors tested its antibacterial activity against Staphylococcus aureus ( S. aureus ) using the supernatant.
  • Staphylococcus aureus S. aureus
  • B. subtilis 168 transformed with pLSB227-LB-SAL09 and B. subtilis 168 without vector were each cultured for 24 hours, then 100 ⁇ l of sample was recovered and centrifuged, and the supernatant was filtered through a 0.45 ⁇ m filter.
  • the sample used for the antibacterial activity test was obtained by filtration. 10 ⁇ l of the obtained sample was dropped onto an agar plate containing S. aureus and left for 1 hour to check for antibacterial activity.
  • the method of expressing a specific protein in Bacillus subtilis is a selection marker that can maintain stability without adding additional antibiotics, which has a cost-saving effect when cultivating the microorganism in large quantities. In the future, it can be used as an oral medicine for the treatment of the gastrointestinal tract.
  • the expression vector can be maintained without separate antibiotic treatment after the microorganism settles in the intestines. Accordingly, the present inventors developed a recombinant vector and auxotrophic strain containing an auxotrophic marker.
  • D-alanine one of the essential amino acids, is a cell wall component and is encoded by the alr A gene.
  • the B. subtilis ( ⁇ alr A) strain was prepared by knocking out the gene from B. subtilis 168, and the strain can be said to be an auxotrophic strain that cannot grow in a medium without D-alanine. .
  • a knock-out cassette (SEQ ID NO: 13) containing about 400 bp before and after the alr A ORF (SEQ ID NO: 12) and the km r gene (including the promoter) in the middle was prepared, and the corresponding DNA The fragment was transferred to B. subtilis 168 through electroporation, and then B.
  • subtilis ( ⁇ alr A) strain was selected on LB agar plates containing kanamycin and D-alanine (0.45 mM) (FIG. 7).
  • an auxotrophic B. subtilis ( ⁇ alr A) strain that could not grow in a medium without D-alanine was identified, and the alr A gene region was disrupted through PCR using the primers in Table 1 above using genomic DNA as a template. Reconfirmed ( Figure 8). Afterwards, the alr A gene region containing the promoter was obtained through PCR using the primers in Table 1 using B.
  • subtilis 168 cDNA as a template and inserted into the Spe I site of the pLSB227 vector to create an auxotrophic marker where the alr A gene is expressed.
  • a recombinant vector pLSB228 containing was prepared.
  • pLSB228 was transformed into B. subtilis ( ⁇ alr A) and growth was confirmed in LB medium without D-alanine (FIG. 10).
  • the target gene SAL09 SEQ ID NO: 1 was expressed and purified using the B. subtilis ( ⁇ alr A) and pLSB228 vectors.
  • the present inventors performed the isolation and purification of SAL09 expressed from the recombinant B. subtilis of the present invention. Specifically, B. subtilis ( ⁇ alr A) transformed with pLSB228-LB-SAL09 was seeded in 10 ml of LB for 18 hours, then 1% was transferred to 100 ml of LB and cultured for 24 hours. did. Afterwards, cells and culture medium were separated through centrifugation (4,000 rpm), and the separated culture medium was filtered through a 0.45um filter to remove other foreign substances.
  • the culture medium containing SAL09 was passed through a column containing 1 ml of Ni-NTA agarose (QIAGEN) and washed with washing buffer (50 mM NaH 2 PO 4 , 300 mM NaCl, 30 mM imidazole, pH 7.9).
  • washing buffer 50 mM NaH 2 PO 4 , 300 mM NaCl, 30 mM imidazole, pH 7.9.
  • the target protein, SAL09 was obtained with 5 ml of elution buffer (50mM NaH 2 PO 4 , 300mM NaCl, 300mM imidazole, pH 7.9).
  • the eluate was transferred to a 3kDa cut-off dialysis membrane and then subjected to dialysis in 5L of PBS buffer stored at 4°C.
  • the present inventors conducted an experiment on the killing ability of SAL09 isolated and purified from the above medium. Specifically, to confirm the killing ability of purified SAL09 against S. aureus, the target strains used in the CFU reduction assay were Methicillin-Sensitive S. aureus (MSSA) [ATCC25923] and Methicillin-resistant S. aureus (MRSA). ) [ATCC43300] was used. The seeded and freshly cultured MSSA and MRSA strains were centrifuged to remove the supernatant (medium), and the settled cells were diluted with PBS to reach 1x10 6 cell/ml to prepare a 100 ⁇ l sample.
  • MSSA Methicillin-Sensitive S. aureus
  • MRSA Methicillin-resistant S. aureus
  • the present inventors performed a toxicity test to confirm the toxicity of SAL09 of the present invention. Specifically, Balb/c 3T3 cells were distributed in a 96-well cell culture plate at 2 x 10 4 cells/well and cultured in a CO 2 incubator for 18 hours. As a positive control, 1 % (w/v) triton Cell viability was measured using ,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) reagent. As a result, there was no significant change compared to the control group (PBS-treated group), confirming that cytotoxicity was low (FIG. 12).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Plant Pathology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 GRAS 균주로 알려진 고초균(B. subtilis)에 엔도라이신 분비 발현 시스템을 적용하여 우수한 항균활성으로 인해 황색포도상구균(Staphylococcus aureus)을 효과적으로 억제하는 엔도라이신을 생산하는 형질전환 바실러스 서브틸리스 균주를 제공한다.

Description

엔도라이신을 생산하는 형질전환 바실러스 서브틸리스 균주
본 발명은 형질전환 바실러스 서브틸리스 균주에 관한 것으로서, 더 상세하게는 엔도라이신을 생산하는 형질전환 바실러스 서브틸리스 균주에 관한 것이다.
엔도라이신(endolysin)은 당단백질 층으로 이루어진 세포벽을 갖는 펩티도글리칸(peptidoglycan)의 특정 부위를 절단할 수 있도록 특화된 효소로 파지와 마찬가지로 항생제를 대체할 수 있는 유력한 수단 중 하나로 여겨지고 있다. 그 이유는 엔도라이신은 파지에 비해 저항성이 생길 확률이 훨씬 낮다고 알려져 있다. 박테리아는 여러 방법으로 파지에 대해 저항성을 가질 수 있는데 대표적으로 파지가 부착할 수 있는 수용기를 없애거나, 파지 DNA가 침투했을 때 특이적으로 절단해버릴 수도 있다. 하지만 엔도라이신에 대해 저항성을 갖기는 매우 어렵다. 엔도라이신의 주요 기질인 펩티도글리칸 층은 박테리아의 생존에 있어 매우 중요한 요소이기 때문에 돌연변이가 일어날 확률이 현저히 떨어지기 때문이다. 또한 증식에 시간이 걸리는 파지와는 달리 곧바로 세포벽을 분해해버릴 수 있으므로, 충분한 양의 엔도라이신만 있다면 원하는 식중독균을 빠르게 제거할 수도 있다. 그러나 엔도라이신은 단백질이라는 물질 특성 때문에 다소 불안정하다. 환경에서 자유롭게 존재하다가 숙주를 만나면 비교적 자유롭게 자기 증식이 가능한 파지와는 달리, pH나 염 농도 등 여러 조건이 바뀌게 되면 엔도라이신의 활성도가 크게 영향을 받기 때문에 분자를 안정화시킬 수 있는 추가적인 기술들이 필요하다. 또한 시간이 지나면 활성이 떨어지므로 치료제로 사용하려면 지금의 항생제와 마찬가지로 일정 기간 동안 지속적인 투여가 필요하다. 또한 기존 단백질 기반 의약품의 경우 경구투여 시 위를 거치면서 낮은 pH 하에서 구조가 파괴되어 제기능을 하지 못하기 때문에 경구용 개발에 한계가 있어 보통 iv 용도로만 개발되어 왔다. 이를 극복하기 위해 장내 유익균으로 알려진 바실러스속 균주를 유전자 수준에서 개량하여 엔도라이신 분비 발현시스템을 활용하여 직접 경구로 투입할 경우 장내 정착이 용이하고 이후 장내에서 엔도라이신을 분비함에 따라 타겟 병원균을 제거할 수 있다. 이와 관련하여 대한민국 공개특허 제2097128호는 제2012-0119307호는 미코박테리아―대장균용 셔틀 벡터 및 이의 용도에 대해 개시하고 있다.
그러나 고초균(B. subtilis)에서 사용가능한 벡터는 다른 연구용 균주(대장균 등)에 비해 상용화된 벡터가 많이 없는 실정이다.
본 발명은 상기와 같은 문제점을 포함하여 여러 문제점들을 해결하기 위한 것으로서, GRAS 균주로 알려진 고초균(B. subtilis)에 엔도라이신 분비 발현 시스템을 적용하여 우수한 항균활성으로 인해 황색포도상구균(Staphylococcus aureus)을 효과적으로 억제하는 엔도라이신을 생산하는 형질전환 바실러스 서브틸리스 균주를 제공하는 것을 목적으로 한다. 그러나 이러한 과제는 예시적인 것으로, 이에 의해 본 발명의 범위가 한정되는 것은 아니다.
본 발명의 일 관점에 따르면, 재조합 엔도라이신 유전자를 포함하는 재조합 플라스미드 벡터가 숙주세포인 바실러스 서브틸리스(B. subtilis) 균주로 형질전환되어 상기 재조합 엔도라이신이 세포외로 분비되는, 형질전환 바실러스 서브틸리스 균주가 제공된다.
본 발명의 다른 일 관점에 따르면, alrA 유전자가 결실된 숙주 바실러스 서브틸리스 균주를 제조하는 단계; 상기 숙주 바실러스 서브틸리스 균주에 바실러스 repB 유전자, 재조합 엔도라이신을 암호화하는 유전자, 항생제 저항성 유전자, 대장균 복제기점 및 alrA 유전자를 포함하는 플라스미드를 형질도입하는 단계; 알라닌 불포함 배지에서 상기 형질도입된 숙주균주를 배양하여 양성 콜로니를 선별하는 단계; 및 선별된 양성 콜로니를 수집하여 배양배지에서 배양한 후, 상기 배양배지에서 상기 균주를 제거하고 재조합 엔도라이신을 분리 및 정제하는 단계를 포함하는, 재조합 엔도라이신의 대량생산 방법이 제공된다.
본 발명의 다른 일 관점에 따르면, 상기 형질전환 바실러스 서브틸리스 균주 또는 상기 균주의 배양 상등액을 유효성분으로 포함하는 항균용 약학적 조성물이 제공된다.
본 발명의 다른 일 관점에 따르면, 상기 형질전환 바실러스 서브틸리스 균주를 유효성분으로 포함하는, 프로바이오틱스 제제가 제공된다.
상기한 바와 같이 이루어진 본 발명의 엔도라이신을 생산하는 형질전환 바실러스 서브틸리스 균주는 유익균으로 알려진 바실러스 서브틸리스 균주를 유전자 수준에서 개량하여 엔도라이신 발현 시스템을 적용함에 따라 높은 항균 활성으로 직접 경구로 투여하면 장내 병원균을 효과적으로 억제할 수 있어 인체용 혹은 가축용 신규 항생제 개발 소재로 활용할 수 있다. 또한 구균과 이의 생성한 생물막을 효과적으로 억제할 수 있는 생물학적 조절제로 활용가능하고 항생제 내성을 갖는 대장균의 감염에 의한 질환 치료용으로 광범위하게 사용할 수 있어 종래 항생제 대체제로 활용가능하다. 물론 이러한 효과에 의해 본 발명의 범위가 한정되는 것은 아니다.
도 1은 본 발명의 일 실시예에 따라 제조한 pLSB226 벡터의 구조를 개략적으로 나타내는 개요도이다.
도 2는 고초균을 이용한 외분비 발현 시스템 개발을 위해 활용한 B. subtilis subtilisin 유전자 서열을 나타내는 그림이다. 녹색은 RBS, 붉은색은 시그널 시퀀스(signal sequence)를 나타낸다.
도 3은 Bacillus subtilis -E. coli shuttle vector를 이용하여 제조한 본 발명의 재조합 벡터인 pLSB227-eGFP의 발현을 LB 배지에서 관찰한 사진이다.
도 4는 고초균의 세포 용해물 및 상등액에서 재조합 벡터인 pLSB227-eGFP의 발현을 웨스턴 블랏 분석으로 확인한 사진이다.
도 5는 고초균의 세포 용해물 및 상등액에서 재조합 벡터인 pLSB227-LB-SAL09의 발현을 웨스턴 블랏 분석으로 확인한 사진이다.
도 6은 본 발명의 pLSB227-LB-SAL09가 형질전환된 B. subtilis 168의 상등액을 S. aureus에 처리하여 항균 활성을 관찰한 사진이다.
도 7은 영양 요구성 마커를 포함하는 재조합 균주인 B. subtilis (△alrA) 균주의 제조 과정을 개략적으로 나타내는 개요도이다.
도 8은 영양 요구성 마커를 포함하는 재조합 균주인 B. subtilis (△alrA) 균주의 발현을 관찰한 사진이다.
도 9는 PCR 수행하여 B. subtilis (△alrA) 균주의 발현을 확인한 겔 사진이다. SM은 DNA Ladder이고 Lane 1은 B. subtilis (△alrA) 균주의 게놈 DNA를 주형으로 PCR을 수행하였다. Lane 2는 비교 샘플로서 B. subtilis 168 게놈 DNA를 주형으로 PCR을 수행하였다.
도 10은 pLSB228 재조합 벡터를 B. subtilis (△alrA)내로 형질전환 시킨 후 발현을 LB 배지에서 관찰한 사진이다.
도 11은 본 발명의 재조합 엔도라이신 SAL09의 S. aureus에 대한 사멸능을 확인하기 위해 CFU reduction assay를 수행한 결과를 나타내는 그래프이다.
도 12는 본 발명의 재조합 엔도라이신 SAL09의 세포 독성을 분석한 결과를 나타내는 그래프이다.
용어의 정의:
본 문서에서 사용되는 "엔도라이신(endolysin)"은 리신(lysin) 또는 뮤레인 가수분해 효소 (murein hydrolase)로도 알려져 있으며 박테리오파지(bacteriophage)에 의해 생성되어 용균주기(lytic cycle)의 마지막 단계에서 숙주인 세균의 세포벽에 있는 펩티도글리칸(peptidoglycan) 층을 가수분해하는 효소이다. 이중가닥 DNA 파지의 엔도라이신은 일반적으로 25~40 kDa 크기의 단백질이며, 2개의 도메인(domain)으로 구성된 단량체 단백질이다. 그람양성균의 엔도라이신은 아미노말단(N-terminal)의 펩티도글리칸 분해 역할을 하는 촉매 도메인(catalytic domain)과 카르복실말단(C-terminal)의 세포 결합 도메인(cell-binding domain)으로 이루어져 있다.
본 문서에서 사용되는 "황색포도상구균(Staphylococcus aureus)"은 인간이나 동물의 피부, 소화관에 상재하는 포도상 구균의 하나로 인간에게 농양 등 다양한 표피 감염, 식중독, 폐렴, 수막염, 패혈증 등을 일으키는 원인균이다. Staphylococcus는 군집을 이루는 균의 모양이 포도송이를 닮아 붙여졌으며 aureus는 황금을 의미한다.
본 문서에서 사용되는 "고초균(Bacillus subtilis)"은 Bacillus속의 대표적 균종으로 단막구조의 호기성 그람양성균으로, 사람과 동물에 병원성이 없고, 배지 중에 다량의 단백질을 분비한다. 아밀라아제, 프로테아제 등의 유용 효소를 공업적으로 생산할 수 있는 균주로서 유명하다. 또한 재조합 DNA 실험 등에서도 많이 사용된다. 일반적으로는 비병원성으로 드물게 사람의 눈의 감염이나 만성질환자의 요로 감염을 일으킨다. 도로 옆의 마른풀, 토양, 공기 등 자연계에 널리 분포한다. 통성 혐기성균이며 최적 온도는 28~40℃이고 영양한천배지에서도 잘 자란다.
발명의 상세한 설명:
본 발명의 일 관점에 따르면, 재조합 엔도라이신 유전자를 포함하는 재조합 플라스미드 벡터가 숙주세포인 바실러스 서브틸리스(B. subtilis) 균주로 형질전환되어 상기 재조합 엔도라이신이 세포외로 분비되는, 형질전환 바실러스 서브틸리스 균주가 제공된다.
상기 균주에 있어서, 상기 재조합 플라스미드 벡터는 고초균에서 복제 가능한 repB 유전자, 대장균에서 복제 가능한 복제기점 및 항생제 저항성 유전자를 포함하는 B. subtilis - E. coli 셔틀 벡터일 수 있고 상기 숙주세포는 alrA 유전자가 결실된 것일 수 있으며 상기 플라스미드 DNA는 alrA 유전자를 추가로 포함할 수 있다.
상기 균주에 있어서, 상기 재조합 엔도라이신은 서열번호 1로 기재되는 아미노산 서열로 구성될 수 있고 황색포도상구균(S. aureus)에 대해 항균활성을 가질 수 있으며 상기 황색포도상구균은 메티실린 내성 황색포도상구균(Methicillin-resistant S. aureus, MRSA) 또는 메티실린 감수성 황색포도상구균(Methicillin-sensitivity S. aureus, MSSA)일 수 있다.
본 발명의 다른 일 관점에 따르면, alrA 유전자가 결실된 숙주 바실러스 서브틸리스 균주를 제조하는 단계; 상기 숙주 바실러스 서브틸리스 균주에 바실러스 repB 유전자, 재조합 엔도라이신을 암호화하는 유전자, 항생제 저항성 유전자, 대장균 복제기점 및 alrA 유전자를 포함하는 플라스미드를 형질도입하는 단계; 알라닌 불포함 배지에서 상기 형질도입된 숙주균주를 배양하여 양성 콜로니를 선별하는 단계; 및 선별된 양성 콜로니를 수집하여 배양배지에서 배양한 후, 상기 배양배지에서 상기 균주를 제거하고 재조합 엔도라이신을 분리 및 정제하는 단계를 포함하는, 재조합 엔도라이신의 대량생산 방법이 제공된다.
본 발명의 다른 일 관점에 따르면, 상기 형질전환 바실러스 서브틸리스 균주 또는 상기 균주의 배양 상등액을 유효성분으로 포함하는 항균용 약학적 조성물이 제공된다.
본 발명의 다른 일 관점에 따르면, 상기 형질전환 바실러스 서브틸리스 균주를 유효성분으로 포함하는, 프로바이오틱스 제제가 제공된다.
본 발명의 약학적 조성물은 환자의 환부의 종류, 적용부위, 처리회수, 처리시간, 제형, 환자의 상태, 보조제의 종류 등에 따라 변할수 있다. 사용량은 특별히 한정되지 않지만, 0.01μg/kg/day 내지 10 mg/kg/day일일 수 있다. 상기 1일량은 1일에 1회, 또는 적당한 간격을 두고 하루에 2~3회에 나눠 투여해도 되고, 수일(數日) 간격으로 간헐(間歇)투여해도 된다.
본 발명의 약학적 조성물에서 상기 화합물은 경구 또는 비경구로 투여되는 것이 가능하며, 바람직하게는 비경구 투여로 정맥내 주입, 피하 주입, 뇌실내 주입(intracerebroventricular injection), 뇌척수액내 주입(intracerebrospinal fluid injection), 근육내 주입 및 복강 주입 등으로 투여할 수 있다.
본 발명의 약학적 조성물은 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다. 또한, 약학적 조성물의 제조에는 고체 또는 액체의 제제용 첨가물을 사용할 수 있다. 제제용 첨가물은 유기 또는 무기 중 어느 것이어도 된다. 부형제로서는 예를 들면 유당, 자당, 백당, 포도당, 옥수수 전분(cornstarch), 전분, 탈크, 소르비트, 결정 셀룰로오스, 덱스트린, 카올린, 탄산칼슘 및 이산화규소 등을 들 수 있다. 결합제로서는 예를 들면 폴리비닐알코올, 폴리비닐에테르, 에틸셀룰로오스, 메틸셀룰로오스, 아라비아고무, 트래거캔스(tragacanth),젤라틴, 셀락(shellac), 히드록시프로필셀룰로오스, 히드록시프로필메틸셀룰로오스, 구연산칼슘, 덱스트린 및 펙틴(pectin) 등을 들 수 있다. 활택제로서는 예를 들면 스테아린산마그네슘, 탈크, 폴리에틸렌글리콜, 실리카, 경화식물유 등을 들 수 있다. 착색제로서는 통상 의약품에 첨가하는 것이 허가되어 있는 것이라면 모두 사용할 수 있다. 이들의 정제, 과립제에는 당의(糖衣), 젤라틴코팅, 기타 필요에 따라 적절히 코팅할 수 있다. 또한, 필요에 따라 방부제, 항산화제 등을 첨가할 수있다. 또한 약학적 조성물이 약제인 경우, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제 또는 방부제 중 선택되는 하나 이상을 추가적으로 포함할 수 있다. 한편, 본 발명의 약학적 조성물의 제형은 사용방법에 따라 바람직한 형태일 수 있으며, 특히 포유동물에 투여된 후 활성 성분의 신속, 지속 또는 지연된 방출을 제공할 수 있도록 당업계에 공지된 방법을 채택하여 제형화 하는 것이 좋다. 구체적인 제형의 예로는 경고제(PLASTERS), 과립제(GRANULES), 로션제(LOTIONS), 리니멘트제(LINIMENTS), 리모나데제(LEMONADES), 산제(POWDERS), 시럽제(SYRUPS), 액제(LIQUIDS AND SOLUTIONS), 에어로솔제(AEROSOLS), 엑스제(EXTRACTS), 엘릭실제(ELIXIRS), 유동엑스제(FLUIDEXTRACTS), 유제(EMULSIONS), 현탁제(SUSPENSIONS), 전제(DECOCTIONS), 침제(INFUSIONS), 정제(TABLETS), 좌제(SUPPOSITORIES), 주사제(INJECTIONS), 주정제(SPIRITS), 카타플라스마제(CATAPLSMA), 캅셀제(CAPSULES), 트로키제(TROCHES), 틴크제(TINCTURES), 파스타제(PASTES), 환제(PILLS), 연질 또는 경질 젤라틴 캅셀 중 선택되는 어느 하나일 수 있다.
본 발명의 약학적 조성물에 통상적으로 이용되는 성분들을 추가로 더 포함할 수 있으며, 예컨대 안정화제, 용해화제 및 향료와 같은 통상적인 보조제, 그리고 담체를 포함할 수 있다.
현재까지 항생제의 광범위한 사용은 항생제에 대해 저항성을 보이는 세균을 발생시키는 문제를 유발했다. 세균이 감염된 부분에는, 폴리머(polymer) 기질로 감싼 세균의 집락인 점액질이 존재할 때가 있다. 세균에 의해 형성된 점액질의 세균 복합체를 바이오필름(biofilm)이라 부른다. 즉 바이오필름은 고형(solid)의 생물학적 표면(biological surface)인 세균집락과 비생물학적 표면(non-biological surface)인 외막으로 구성된 복합체인 것이다. 따라서 바이오필름이란 이 외막과 그 속에 들어있는 세균집락을 포함한 전체를 의미한다. 바이오필름은 세균으로 이루어진 작은 도시라 할 수 있으며, 그 속에서 세균은 서로 의사소통을 하고, 외부세계에 대하여 방어를 한다. 이로 인하여 바이오필름은 항생제를 포함한 여러 환경 스트레스(environmental stress) 아래에서도 세균의 생존을 가능하게 만든다. 한편, 별개로 부유하던 세균(planktonic bacteria)에 대해 약효를 나타내던 항생제도 세균이 바이오필름을 형성하면 효능을 상실하는 경향이 커진다. 세균이 바이오필름을 형성하면 바이오필름에 존재하는 외막을 항체 등이 투과할 수 없어, 항생제에 대한 세균의 저항성이 약 1,000배까지 높아질 수 있으며, 숙주의 면역체계(hostimmune system)를 무력화시키게 된다. 이러한 이유들로 인하여 바이오필름이 형성되면 감염증 치료에 널리 사용되던 항생제의 작용이 어렵게 되어 결과적으로 항생제에 의한 치료 효과가 약화된다. 따라서 이러한 바이오필름의 형성으로 인한 항생제 치료의 무력화를 막기 위해서는 바이오필름이 형성되더라도 상기 바이오필름을 제거할 수 있는 새로운 항생제를 개발하거나, 기존 항생제가 효능을 발휘할 수 있도록 바이오필름에 존재하는 외막을 파괴해 줄 수 있는 성분을 기존 항생제와 함께 사용하여야 한다.
기존 단백질 기반 의약품의 경우 경구용 개발에 한계가 있었기에 보통 iv 용도로만 개발이 되었는데 이러한 단백질 의약품은 경구 투여 시 위를 거치면서 낮은 pH 하에서 제기능을 하지 못하는 문제점이 존재하였다. 본 발명자들의 종래 등록된 특허(대한민국 등록특허 제2426421호)의 경우, 두 개의 도메인(domain)을 연결하여 신규한 키메라 형태(chimeric form)의 재조합 엔도라이신(endolysin)을 제조하였고 대장균에서 발현 및 정제를 수행하여 SAL09 단백질의 높은 항균 활성을 확인하였다. 그 후, 본 발명자들은 상기 재조합 엔도라이신 SAL09을 대장균이 아닌 GRAS 균주로 알려진 고초균에서 발현을 시도하였고 세포외 분비 발현 시스템을 통해 SAL09가 세포 외로 항시 분비 및 발현 되는 것을 관찰하였다. 본 발명의 엔도라이신을 생산하는 형질전환 바실러스 서브틸리스 균주는 유전자 레벨에서 개량하여 엔도라이신 발현 시스템으로 직접 경구로 투입하면 장내에서 엔도라이신을 분비하여 경구용 제제를 위한 항균 물질 소재로 활용 가능하다.
이하, 실시예를 통하여 본 발명을 더 상세히 설명한다. 그러나 본 발명은 이하에서 개시되는 실시예에 한정되는 것이 아니라 서로 다른 다양한 형태로 구현될 수 있는 것으로, 이하의 실시예는 본 발명의 개시가 완전하도록 하며, 통상의 지식을 가진 자에게 발명의 범주를 완전하게 알려주기 위해 제공되는 것이다.
실시예 1: 셔틀 벡터의 제조
본 발명자들은 고초균(B. subtilis)에서 사용가능한 벡터는 다른 연구용 균주(대장균 등)에 비해 상용화된 벡터가 많이 없어 직접 B. subtilis-E. coli shuttle vector pLSB226(서열번호 10)를 제조하였다. 구체적으로 고초균에서 복제할 수 있는 replication protein B(repB) 및 고초균에서 선별마커(selection marker)로 사용할 수 있는 항생제 마커 부위를 NCBI등 기존 보고된 것을 참고하여 합성을 진행하였다. 이후 해당 유전자 부위는 대장균에서 복제가능한 pUC ori 및 암피실린 저항성(Ampicillin resistance) 유전자가 포함된 벡터인 pBHA의 EcoRI 제한효소 위치에 삽입하여 최종적으로 B. subtilis - E. coli shuttle vector를 제조하였고 이를 pLSB226이라 명명하였다(도 1).
실시예 2: 발현 시스템 개발
본 발명자들은 목적단백질을 고초균의 세포 밖으로 발현시키기 위한 방법으로 종래 보고된 고초균에서 이용 가능한 외분비 발현시스템을 적용하였다(JH Kim et al., Biotechnology and Bioprocess Engineering, volume 13, Article number: 313, 2008). 이를 위해 B. subtilis subtilisin gene(aprE)의 프로모터 및 시그널 펩타이드(signal sequece)를 이용하여 외래 단백질 발현을 유도하였다(도 2a 및 2b). 상기 도 2에 도시된 서열의 다운스트림(downstream) 부위에 MCS 및 6xhis tagging을 더하여 향후 외래 유전자 삽입 및 해당 유전자 발현 여부 확인을 위해 사용하였다. 상기 서열은 양 끝에 SpeI, PstI를 이용해 pLSB226 벡터에 내로 삽입하였으며 최종 pLSB227이라 명명하였다.
실시예 3: 외래 유전자 발현 확인 1
본 발명자들은 리포터(repoter) 유전자인 eGFP 유전자를 상기 제조한 pLSB227 MCS내 XhoI 위치에 삽입하여 해당 유전자의 세포 외부로의 발현 여부를 확인하였다. 상기 eGFP 유전자는 pUC19-eGFP vector를 주형으로 하여 하기 표 1의 프라이머를 이용하여 증폭을 수행하였다. 상기 증폭된 eGFP 유전자는 XhoI 제한효소로 처리 후 Bacillus subtilis -E. coli shuttle vector인 pLSB227의 동일 제한효소 부위에 삽입하였다. 상기 eGFP가 삽입된 재조합 벡터는 pLSB227-eGFP라 명명하였으며 상기 벡터는 B. subtilis 168 균주내로 전기천공(electroportion) 방법을 통해 형질전환(transformation)시켰다. 상기 pLSB227-eGFP가 포함된 재조합 B. subtilis 168은 kanamycin(20 ㎍/ml)이 포함된 아가 플레이트(agar plate)에서 선별하였으며 이중 하나의 콜로니(colony)는 새로운 아가 플레이트에 도말한 후 24시간 배양한 다음 UV Transilluminator에 올려 eGFP의 발현 여부를 육안으로 관찰하였다(도 3). 그 후, 세포 외 분비 및 발현 여부를 확인하기 위해 해당 균주를 LB (카나마이신 20 ㎍/ml) 배지에서 24시간 배양하여 웨스턴 블랏(Western blotting)을 통해 확인하였다. 구체적인 실험방법은 형질전환된 단일 콜로니(single colony)를 수득하여 10 ml LB(kanamycin 20 ㎍/ml)에 접종한 후, 시드 배양(seed culture)을 18시간 동안 수행하였다. 그 후, 진탕 배양된 시드 배양액 1%를 100 ml LB 배지(kanamycin 20 ug/ml)에 접종하여 본 배양(main culture)을 24시간 동안 수행하였다. 이어서 상기 배양액 1 ml을 수득하여 세포와 상등액을 분리하였고 각각 웨스턴 블랏 분석에 사용하였다. eGFP의 경우 pLSB227 벡터내 XhoI 제한효소 자리로 삽입된 상황으로 발현 시 His-tagging까지 발현되는 형태로 이를 이용해 1차 항체(1st Ab)는 6x-his 단일클론 항체(monoclonal antibody)를 사용하였으며 2차 항체(secondary antibody)는 Goat anti-mouse IgG(H+L) Secondary Antibody, AP를 사용하였으며 1-StepTM NBT/BCIP solution을 이용하여 검출하였다. 그 결과, 재조합 벡터인 pLSB227-eGFP의 세포 용해물 및 상등액 모두에서 목적 단백질이 발현되는 것을 관찰하였다(도 4). 상기 증폭에 사용된 프라이머를 포함하여 본 발명에서 사용된 프라이머의 서열 정보를 하기 표 1에 요약하였다.
프라이머 서열 정보
프라이머 염기서열(5'→3') 서열번호
XhoI_ eGFP(F) CTCGAGGTGTCCAAAGGCGAAGAAC 2
XhoI_ eGFP(R) CTCGAGTTTATACAGTTCATCCATG 3
SacI_ SAL09(F) GAGCTCGCTAAGACTCAAGCAGAAATAAAT 4
XhoI_ SAL09(R) CTCGAGTTTAAATGTACCCCAAGCATTG 5
alrA ORF(F) ATGAGCACAAAACCTTTTTACAG 6
alrA ORF(R) TTAATTGCTTATATTTACCTGC 7
alrA promoter(F) ACTAGTCCGCCAAAGGCCAAACATGA 8
alrA ORF(R) ACTAGTTTAATTGCTTATATTTACCTGC 9
실시예 4: 외래 유전자 발현 확인 2
본 발명자들은 기등록 특허(대한민국 등록특허 제2426421호)에서 개발한 S. aureus를 타겟으로하는 재조합 엔도라이신 SAL09를 인코딩(encoding)하는 해당 유전자 서열을 pLSB227내로 삽입 후 B. subtilis 내로 형질전화 시켰으며 재조합 균주 세포 외로LB-SAL09 분비 및 발현 여부 및 항균활성 여부를 확인하였다. 구체적으로 기존 개발한 pET31b(+)-LB-SAL09 벡터를 주형으로 하여 상기 표 1의 프라이머를 이용해 상기 LB-SAL09 부위를 PCR 증폭 및 확보하였으며 해당 유전자는 SacI, XhoI 제한효소를 처리하여 Bacillus subtilis - E. coli shuttle vector인 pLSB227의 동일 제한효소 자리로 삽입하였으며 상기 제조한 재조합 벡터를 pLSB227-LB-SAL09라 명명하였다. 그 후 상기 리포터 유전자인 eGFP의 발현 여부 확인 방법과 동일하게 LB-SAL09의 발현 여부를 웨스턴 블랏 분석을 수행한 결과 세포 용해물 및 상등액 모두에서 목적 단백질인 LB-SAL09가 분비 및 발현되는 것을 확인하였다(도 5).
실시예 5: 항균활성 분석
본 발명자들은 상기 항균 펩타이드인 LB-SAL09의 발현을 확인한 후 상등액을 이용하여 황색포도상구균(S. aureus)에 대한 항균 활성을 테스트하였다. 구체적으로 pLSB227-LB-SAL09가 형질전환된 B. subtilis 168 및 벡터를 삽입하지 않은 B. subtilis 168을 각각 24시간 동안 배양한 후 100 ㎕의 샘플을 회수하여 원심분리하였고 이의 상등액은 0.45 μm 필터로 여과하여 항균활성 실험에 사용한 샘플을 확보하였다. 상기 확보한 샘플은 S. aureus가 포함된 아가 플레이트에 10 ㎕씩 점적한 후 1시간 동안 방치하여 항균 활성 여부를 확인하였다. 그 결과, 본 발명의 pLSB227-LB-SAL09가 형질전환된 B. subtilis 168 상등액을 처리하여 S. aureus를 사멸시킨 투명존(clear zone)을 확인함에 따라 높은 항균 활성을 관찰하였다(도 6).
실시예 6: 영양 요구성 균주 개발
특정 단백질을 고초균에서 발현시키는 방법은 선별 마커(selection marker)로서 별도의 항생제를 첨가하지 않고도 안정성(stability)을 유지할 수 있어 해당 미생물을 대량 배양 시 비용 절감 효과가 있으며 향후 위장관 치료용 경구용 의약품으로서 활용할 경우 해당 미생물이 장내 정착 후 별도의 항생제 처리 없이도 발현 벡터를 유지할 수 있는 장점이 있다. 이에 본 발명자들은 영양 요구성 마커를 포함하는 재조합 벡터 및 영양 요구성 균주를 개발하였다. 구체적으로 필수 아미노산 중 D-알라닌은 세포벽 구성 성분으로서 alrA 유전자에 의해 암호화 되어 있으며 알라닌라세마아제(alanine racemase) 효소의 결핍 시 D-alanine을 만들지 못하기에 세포는 사멸하게 된다. B. subtilis 168로부터 상기 유전자를 넉-아웃(knock-out)시켜 B. subtilis (△alrA) 균주를 제조하였으며 상기 균주는 D-alanine이 없는 배지에서는 성장하지 못하는 영양 요구성 균주라 할 수 있다. 그 후, alrA ORF(서열번호 12)의 앞, 뒤 약 400 bp 및 중간에 kmr 유전자(프로모터 포함)를 포함하는 넉-아웃 카세트(knock-out cassette, 서열번호 13)를 제조하였으며 해당 DNA 단편을 전기천공법을 통해 상기 B. subtilis 168로 전달하였고 이후 kanamycin 및 D-alanine(0.45 mM)이 포함된 LB 아가 플레이트에서 B. subtilis(△alrA) 균주를 선별하였다(도 7). 그 결과, D-alanine이 없는 배지에서는 성장하지 못하는 영양 요구성 B. subtilis (△alrA) 균주를 확인하였으며 게놈 DNA를 주형으로 상기 표 1의 프라이머를 이용한 PCR을 통해 alrA 유전자 부위가 disruption 되었음을 재확인하였다(도 8). 그 후, 프로모터가 포함된 alrA 유전자 부위를 B. subtilis 168 cDNA를 주형으로 표 1의 프라이머를 이용한 PCR을 통해 수득하였으며 pLSB227 벡터의 SpeI 사이트 내로 삽입하여 alrA 유전자가 발현되는 영양 요구성 마커를 포함하는 재조합 벡터 pLSB228을 제조하였다. 이어서 추가 실험으로 상기 pLSB228을 B. subtilis(△alrA)내로 형질전환시킨 후 D-alanine이 없는 LB배지에서의 성장 여부를 확인하였다(도 10). 그 후, 상기 B. subtilis(△alrA) 및 pLSB228 벡터를 이용해 목적 유전자 SAL09(서열번호 1)의 발현 및 정제를 수행하였다.
실시예 7: SAL09의 분리 및 정제
본 발명자들은 본 발명의 재조합 B. subtilis로부터 발현된 SAL09의 분리 및 정제를 수행하였다. 구체적으로, pLSB228-LB-SAL09가 형질전환된 B. subtilis(△alrA)은 LB 10 ml에 18시간 동안 시드 배양 후 LB 100 ml에 1%를 트랜스퍼(transfer)하여 24시간 동안 본 배양을 진행하였다. 이후 원심분리(4,000 rpm) 통해 세포와 배양액을 분리하였으며 상기 분리된 배양액은 0.45um 필터로 여과하여 기타 이물질들을 제거하였다. 그 후 SAL09가 포함된 배양액은 이후 Ni-NTA agarose(QIAGEN社) 1 ml이 포함된 컴럼(column)에 통과 시켰고 세척 버퍼(50 mM NaH2PO4, 300 mM NaCl, 30 mM imidazole, pH7.9) 20 ml로 수세 과정을 거치고 용출 버퍼(50 mM NaH2PO4, 300 mM NaCl, 300 mM imidazole, pH7.9) 5 ml로 목적 단백질인 SAL09를 수득하였다. 상기 용출액은 3kDa cut-off dialysis membrane에 옮긴 후 4℃에 보관중인 PBS buffer 5L에서 투석(dialysis) 과정을 수행하였다.
실시예 8: SAL09의 사멸능 실험
본 발명자들은 상기 배지로부터 분리 및 정제한 SAL09의 사멸능 실험을 수행하였다. 구체적으로 정제된 SAL09의 S. aureus에 대한 사멸능을 확인하기 위해 CFU reduction assay를 위해 실험에 사용된 타겟 균주는 Methicillin-Sensitive S. aureus(MSSA)[ATCC25923] 및 Methicillin-resistance S. aureus(MRSA) [ATCC43300]을 이용하였다. 시드 배양 및 신선 배양한 상기 MSSA 및 MRSA 균주는 원심분리하여 상등액(배지)를 제거하였고 가라앉은 세포는 1x 106 cell/ml 수가 되도록 PBS로 희석하여 100 ㎕ 샘플을 제조하였다. 그 후, 정제된 SAL09는 0(PBS), 0.2, 0.4, 0.8, 1.6, 및 3.2 ㎍/ml 농도로 100 ㎕ 샘플을 제조하였고 상기 제조한 MSSA, MRSA 샘플 100 ㎕에 더하여 총 200 ㎕ 반응 샘플을 제조하였다. 이어서, 상온에서 1시간 방치 후 LB 아가 플레이트에 로딩(loading) 하여 콜로니수를 확인하였고 MSSA 및 MRSA 균주에 대한 SAL09의 항균 활성능을 평가하였다.
그 결과, SAL09가 첨가되지 않은 대조군과 비교하여 SAL09가 첨가된 실험군은 농도의존적으로 MSSA, MRSA 모두에서 사멸능이 확인됐으며 3.2 ㎍/ml이 첨가된 샘플에서는 MSSA, MRSA 두 균주 모두 사멸시키는 결과로서 높은 항균활성능을 나타냄을 확인하였다(도 11).
실시예 9: In vitro 독성 실험
본 발명자들은 본 발명의 SAL09에 대한 독성 여부를 확인하기 위해 독성 실험을 수행하였다. 구체적으로 Balb/c 3T3세포를 이용하여 96-웰 세포 배양 플레이트에 2 x 104 cells/well로 분주 후 CO2 배양기에서 18시간 배양하였다. 양성 대조군으로 1%(w/v) triton X-100을 처리하였고 SAL09는 0(PBS), 250, 500 및 1,000 ug/ml 처리한 후 CO2 배양기에서 24시간 추가 배양 후 MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)- 2-(4-sulfophenyl)-2H-tetrazolium) 시약을 사용하여 세포 생존율을 측정하였다. 그 결과 대조군(PBS처리군)과 비교하여 큰 변화를 보이지 않아 세포독성이 낮음을 확인하였다(도 12).
본 발명은 상술한 실시예를 참고로 설명되었으나 이는 예시적인 것에 불과하며, 당해 기술분야에서 통상의 지식을 가진 자라면 이로부터 다양한 변형 및 균등한 다른 실시예가 가능하다는 점을 이해할 것이다. 따라서 본 발명의 진정한 기술적 보호 범위는 첨부된 특허청구범위의 기술적 사상에 의하여 정해져야 할 것이다.

Claims (10)

  1. 재조합 엔도라이신 유전자를 포함하는 재조합 플라스미드 벡터가 숙주세포인 바실러스 서브틸리스(B. subtilis) 균주로 형질전환되어 상기 재조합 엔도라이신이 세포외로 분비되는, 형질전환 바실러스 서브틸리스 균주.
  2. 제1항에 있어서,
    상기 재조합 플라스미드 벡터는 고초균에서 복제 가능한 repB 유전자, 대장균에서 복제 가능한 복제기점 및 항생제 저항성 유전자를 포함하는 B. subtilis - E. coli 셔틀 벡터인, 균주.
  3. 제1항에 있어서,
    상기 숙주세포는 alrA 유전자가 결실된 것인. 균주.
  4. 제3항에 있어서,
    상기 플라스미드 DNA는 alrA 유전자를 추가로 포함하는, 균주.
  5. 제1항에 있어서,
    상기 재조합 엔도라이신은 서열번호 1로 기재되는 아미노산 서열로 구성되는, 균주.
  6. 제1항에 있어서,
    황색포도상구균(S. aureus)에 대해 항균활성을 갖는, 균주.
  7. 제6항에 있어서,
    상기 황색포도상구균은 메티실린 내성 황색포도상구균(Methicillin-resistant S. aureus, MRSA) 또는 메티실린 감수성 황색포도상구균(Methicillin-sensitivity S. aureus, MSSA)인, 균주.
  8. alrA 유전자가 결실된 숙주 바실러스 서브틸리스 균주를 제조하는 단계;
    상기 숙주 바실러스 서브틸리스 균주에 바실러스 repB 유전자, 재조합 엔도라이신을 암호화하는 유전자, 항생제 저항성 유전자, 대장균 복제기점 및 alrA 유전자를 포함하는 플라스미드를 형질도입하는 단계;
    알라닌 불포함 배지에서 상기 형질도입된 숙주균주를 배양하여 양성 콜로니를 선별하는 단계; 및
    선별된 양성 콜로니를 수집하여 배양배지에서 배양한 후, 상기 배양배지에서 상기 균주를 제거하고 재조합 엔도라이신을 분리 및 정제하는 단계를 포함하는, 재조합 엔도라이신의 대량생산 방법.
  9. 제1항의 형질전환 바실러스 서브틸리스 균주 또는 상기 균주의 배양 상등액을 유효성분으로 포함하는 항균용 약학적 조성물.
  10. 제1항의 형질전환 바실러스 서브틸리스 균주를 유효성분으로 포함하는, 프로바이오틱스 제제.
PCT/KR2023/013949 2022-11-23 2023-09-15 엔도라이신을 생산하는 형질전환 바실러스 서브틸리스 균주 WO2024111838A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2022-0158214 2022-11-23
KR1020220158214A KR102556868B1 (ko) 2022-11-23 2022-11-23 엔도라이신을 생산하는 형질전환 바실러스 서브틸리스 균주

Publications (1)

Publication Number Publication Date
WO2024111838A1 true WO2024111838A1 (ko) 2024-05-30

Family

ID=87427437

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/013949 WO2024111838A1 (ko) 2022-11-23 2023-09-15 엔도라이신을 생산하는 형질전환 바실러스 서브틸리스 균주

Country Status (2)

Country Link
KR (1) KR102556868B1 (ko)
WO (1) WO2024111838A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102556868B1 (ko) * 2022-11-23 2023-07-26 주식회사 리신바이오 엔도라이신을 생산하는 형질전환 바실러스 서브틸리스 균주

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009536017A (ja) * 2006-01-24 2009-10-08 ピュラック バイオケム ビー．ブイ． ホモ乳酸的好熱性バチルスの遺伝子改変
KR20200078526A (ko) * 2017-11-06 2020-07-01 로께뜨프레르 유전자 변형된 바실러스 서브틸리스 균주, 최적화된 벡터 및 그의 용도
KR20220099319A (ko) * 2021-01-06 2022-07-13 주식회사 리신바이오 신규 재조합 엔도라이신 및 이의 용도
KR102556868B1 (ko) * 2022-11-23 2023-07-26 주식회사 리신바이오 엔도라이신을 생산하는 형질전환 바실러스 서브틸리스 균주

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009536017A (ja) * 2006-01-24 2009-10-08 ピュラック バイオケム ビー．ブイ． ホモ乳酸的好熱性バチルスの遺伝子改変
KR20200078526A (ko) * 2017-11-06 2020-07-01 로께뜨프레르 유전자 변형된 바실러스 서브틸리스 균주, 최적화된 벡터 및 그의 용도
KR20220099319A (ko) * 2021-01-06 2022-07-13 주식회사 리신바이오 신규 재조합 엔도라이신 및 이의 용도
KR102556868B1 (ko) * 2022-11-23 2023-07-26 주식회사 리신바이오 엔도라이신을 생산하는 형질전환 바실러스 서브틸리스 균주

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BROPHY JENNIFER A.; TRIASSI ALEXANDER J.; ADAMS BRYN L.; RENBERG REBECCA L.; STRATIS-CULLUM DIMITRA N.; GROSSMAN ALAN D.; VOIGT CH: "Engineered integrative and conjugative elements for efficient and inducible DNA transfer to undomesticated bacteria", NATURE MICROBIOLOGY, NATURE PUBLISHING GROUP UK, LONDON, vol. 3, no. 9, 20 August 2018 (2018-08-20), London , pages 1043 - 1053, XP036573612, DOI: 10.1038/s41564-018-0216-5 *
JEONG DA-EUN, KIM MAN SU; KIM HA-RIM; CHOI SOO-KEUN: "Cell Factory Engineering of Undomesticated Bacillus Strains Using a Modified Integrative and Conjugative Element for Efficient Plasmid Delivery", FRONTIERS IN MICROBIOLOGY, FRONTIERS MEDIA, LAUSANNE, vol. 13, 26 April 2022 (2022-04-26), Lausanne , XP093174731, ISSN: 1664-302X, DOI: 10.3389/fmicb.2022.802040 *

Also Published As

Publication number Publication date
KR102556868B1 (ko) 2023-07-26

Similar Documents

Publication Publication Date Title
KR100781669B1 (ko) 황색포도상구균 특이적 사멸능을 갖는 박테리오파지
WO2024111838A1 (ko) 엔도라이신을 생산하는 형질전환 바실러스 서브틸리스 균주
KR100759988B1 (ko) 황색포도상구균에 특이적인 항균 단백질
WO2010079858A1 (ko) 박테리아 특이적 넓은 항균 활성을 갖는 신규한 리신 단백질
KR101957266B1 (ko) 엔테로코쿠스 패슘에 대하여 용균력을 가지는 신규한 항균단백질 efal-2
CN110621775A (zh) 新型铜绿假单胞菌噬菌体Pse-AEP-4及其用于抑制铜绿假单胞菌的增殖的用途
CN110612349A (zh) 新型铜绿假单胞菌噬菌体Pse-AEP-3及其用于抑制铜绿假单胞菌的增殖的用途
RU2409661C2 (ru) Штамм enterococcus faecium lvp1073, продуцент бактериоцина против бактериальных патогенов, бактериоцин e1073 против бактериальных патогенов, штамм lactobacillus plantarum 1 lvp7 - индуктор синтеза бактериоцина e1073, сигнальный пептид сп1073 - регулятор синтеза бактериоцина e1073, способ получения бактериоцина e1073
WO2019235781A1 (ko) 신규한 스트렙토코커스 수이스 박테리오파지 str-sup-1 및 이의 스트렙토코커스 수이스 균 증식 억제 용도
WO2022039561A1 (ko) 클로스트리디움 디피실리 감염의 치료 또는 예방용 조성물
US11155801B2 (en) Unglycosylated lysostaphin variant protein
KR100958139B1 (ko) 엔테로코쿠스 패칼리스 특이적 사멸능을 갖는 신규한박테리오파지
WO2019235783A1 (ko) 신규한 스트렙토코커스 수이스 박테리오파지 str-sup-3 및 이의 스트렙토코커스 수이스 균 증식 억제 용도
KR102426421B1 (ko) 신규 재조합 엔도라이신 및 이의 용도
WO2021246670A1 (ko) 클로스트리디오이데스 디피실리 균에 대하여 용균 활성을 갖는 항균단백질
WO2021215687A1 (ko) 클로스트리디오이데스 디피실리 균에 대하여 용균 활성을 갖는 항균단백질 cdl200
KR101201337B1 (ko) 신규한 락토바실러스속 유산균 복합 균주를 포함하는 사료첨가제
KR102129427B1 (ko) 메티실린 내성 황색포도알균의 생장을 억제하는 신규 미생물 브레비바실러스 속 tgs2-1 균주 및 tgs2-1 균주에서 분리된 화합물
KR102419028B1 (ko) 박테리오파지 유래 신규 재조합 엔도라이신 및 이의 용도
KR102423986B1 (ko) 액티노바실러스 플루로뉴모니애 균에 대하여 용균활성을 갖는 항균물질 및 이의 제조방법
KR101461096B1 (ko) 스트렙토마이세스속 또는 크리벨라속을 포함하는 생물막 형성 방지 또는 억제제 및 이를 이용한 생물막 형성 방지 또는 억제 방법
KR20180103788A (ko) 신규한 녹농균 박테리오파지 Pse-AEP-3 및 이의 녹농균 증식 억제 용도
KR102438863B1 (ko) 액티노바실러스 플루로뉴모니애 균에 대하여 용균활성을 갖는 항균물질 및 이의 제조방법
CN116024144B (zh) 一种海洋源黄色钱培元菌及其在制备抑菌药物中的应用
WO2023113396A1 (ko) 클로스트리듐 디피실 세균을 효과적으로 사멸시키는 재조합 항균 단백질의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23894769

Country of ref document: EP

Kind code of ref document: A1