WO2024093790A1 - Stable and high-yield targeted integration cell, method for preparing same, and use thereof - Google Patents

Abstract

The present application relates to the field of biotechnology, and in particular, to a stable and high-yield targeted integration cell, a method for preparing same, and use thereof. Compared with conventional techniques, the present application has the following beneficial effects: it is found by means of extensive screening that by inserting an exogenous target gene into a proper position of the Mtfl gene of a host cell, the resultant targeted integration cell features a stable and high yield of the target product. Moreover, the resultant targeted integration cell does not require restricted culture processes. The present application features a simple self-construction process, efficiency, cost-efficiency, good repeatability, and high controllability.

Description

Stable and high-yield targeted integration cells and preparation methods and applications thereof

Cross-references to related applications

This application claims the priority right of Chinese patent application No. 202211348560.7, filed with the Chinese Patent Office on October 31, 2022, and entitled “Stable and high-yield targeted integrated cells, preparation methods and applications thereof”, the entire contents of which are incorporated by reference into this application.

Technical Field

The present application relates to the field of biotechnology, and in particular to a stable, high-yield targeted integration cell and a preparation method and application thereof.

Background technique

At present, biology has entered a stage of rapid development. With the development of multiple disciplines such as genetic engineering, protein engineering and cell engineering, the biotechnology industry has been vigorously developed, and the biopharmaceutical industry has also flourished. The biopharmaceutical industry is a strategic emerging industry. Its continuous development is accompanied by an increase in the requirements for product expression and expression stability, and cell line construction is a key factor in determining product expression yield and expression stability.

At present, most drug production adopts random integration to construct cell lines, and it usually takes at least 6 months to obtain a stable cell line. This method has a huge workload and high cost, and the copy number and site are unstable. The site also has uncertainty in the impact of the site on cell physiology, which leads to unstable cell state and cannot effectively evaluate stable yield and establish a stable production process. These shortcomings will lead to poor stability of the cell line passage, resulting in the loss of the target gene during the growth process and loss of production value.

In view of this, this application is hereby filed.

Summary of the invention

One of the purposes of an embodiment of the present application includes providing a nucleic acid, wherein a host cell containing the nucleic acid is capable of stably and efficiently expressing an exogenous nucleic acid fragment integrated into SEQ ID No.1.

In the first aspect of the present application, a nucleic acid is provided, which comprises a nucleic acid fragment, wherein in the 5'-3' direction, the nucleic acid fragment is composed of the nucleotide sequences shown in SEQ ID No.1 and SEQ ID No.8 connected in sequence, and the nucleic acid fragment is used to integrate exogenous nucleic acid fragments.

In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3435th-3635th base interval of the nucleic acid fragment;

In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3440th-3624th base interval of the nucleic acid fragment;

In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3451st-3615th base interval of the nucleic acid fragment;

In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3460th-3597th base interval of the nucleic acid fragment;

In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3470th-3580th base interval of the nucleic acid fragment;

In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3480th-3570th base interval of the nucleic acid fragment;

In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3490th-3559th base interval of the nucleic acid fragment;

In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3505th to 3546th base interval of the nucleic acid fragment;

In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3525th-3557th base interval of the nucleic acid fragment;

In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3530th-3545th base interval of the nucleic acid fragment;

In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3531-3540 base interval of the nucleic acid fragment.

In some embodiments of the present application, the exogenous nucleic acid fragment comprises: a first recombination recognition sequence and a second recombination recognition sequence recognized by a recombinase, a selection marker gene and/or a target gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter that regulates the expression of the selection marker gene and/or the target gene.

In some embodiments of the present application, the recombinase is Bxb1 integrase, ΦC31 integrase, Cre recombinase or FLP recombinase.

In some embodiments of the present application, the first recombination recognition sequence and the second recombination recognition sequence are independently selected from one or more of the following sequences: LoxP sequence, LoxPL3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, Lox66 sequence, FRT sequence, Bxb1attP sequence, Bxb1attB sequence, attP sequence and attB sequence.

In some embodiments of the present application, the selection marker gene is selected from one or more of a neomycin resistance gene, a thymidine kinase gene, a hygromycin phosphotransferase gene, a dihydrofolate reductase gene, a thymidine kinase gene, a glutamine synthetase gene, an asparagine synthetase gene, a tryptophan synthetase gene, a histidinol dehydrogenase gene, an aminoglycoside phosphotransferase gene, a tryptophan synthetase gene and a fluorescent protein gene.

In some embodiments of the present application, the promoter is a CMV promoter, an SV40 promoter, an RSV promoter, a β-globin promoter, an UBC promoter, an EF1a promoter, an ubiquitin promoter, a β-actin promoter, a PGK1 promoter, a Rosa26 promoter, a HSP70 promoter, a GAPDH promoter, an Eif4A1 promoter, an Egr1 promoter, a FerH promoter, an SM22α promoter or an Endothelin-1 promoter.

In some embodiments of the present application, the target gene encodes one or more of an antibody, a recombinant protein, a polypeptide, an enzyme, a hormone, a growth factor and a receptor.

In the second aspect of the present application, a recombinant vector is provided, characterized in that the vector comprises:

a. a 5' homology arm homologous to the sequence fragment existing in the above-mentioned nucleic acid fragment (the nucleic acid fragment is composed of the nucleotide sequences shown in SEQ ID No.1 and SEQ ID No.8 connected in sequence in the 5'-3' direction),

b. Target gene,

c. A 3’ homology arm that is homologous to the sequence fragment existing in the above-mentioned nucleic acid fragment (in the 5’-3’ direction, the nucleic acid fragment is composed of the nucleotide sequences shown in SEQ ID No.1 and SEQ ID No.8 connected in sequence).

In some embodiments of the present application, the recombinant vector is a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a herpes virus vector, a poxvirus vector, a baculovirus vector, a papillomavirus vector, a papillomas virus vector, an integrative phage vector, a non-viral vector, a transposon and/or a transposase, an integrase substrate or a plasmid.

In the third aspect of the present application, a targeted integrated cell is provided, wherein the targeted integrated cell comprises the nucleic acid described in the first aspect.

In some embodiments of the present application, the targeted integration cell is a eukaryotic cell;

In some embodiments of the present application, the eukaryotic cell is a mammalian cell;

In some embodiments of the present application, the mammalian cells include Chinese hamster ovary CHO cells and human embryonic kidney HEK293 cells.

In a fourth aspect of the present application, a method for preparing the targeted integrated cell according to the third aspect is provided, the preparation method comprising the following steps:

Introduce the nucleic acid described in the first aspect into a cell, or provide a cell containing the above-mentioned nucleic acid fragment (in the 5'-3' direction, the nucleic acid fragment is composed of the nucleotide sequences shown in SEQ ID No.1 and SEQ ID No.8 connected in sequence) and integrate the exogenous nucleic acid fragment into the nucleic acid fragment to prepare a targeted integrated cell.

In the fifth aspect of the present application, a method for producing a target gene expression product is provided, the method comprising the following steps: culturing the targeted integration cell described in the third aspect, and collecting the expression product of the target gene in the exogenous nucleic acid fragment.

Compared with the traditional technology, this application has the following beneficial effects:

After a large number of screenings, the present application found that the insertion of the exogenous target gene at the appropriate position of the Mtf1 gene of the host cell resulted in the obtained targeted integration cells having the characteristics of stable and high yield of the target product (whether it is a fusion protein, a bispecific antibody or a monospecific antibody). In addition, the obtained targeted integration cells have no strict requirements on the culture process, and the self-construction process is simple, time-consuming, cost-reduced, repeatable and controllable.

BRIEF DESCRIPTION OF THE DRAWINGS

In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more completely understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present application, and those skilled in the art can obtain other drawings based on these drawings without creative work.

FIG1 is a process flow chart of an embodiment of the present application;

FIG2 is a plasmid map for integration site screening in an embodiment of the present application;

FIG3 is a transfection plasmid map of the product of the embodiment of the present application;

FIG4 is a statistical diagram of the expression of integrated cell fusion protein in an embodiment of the present application;

FIG5 is a diagram for verifying the stability and high yield of the integrated cell fusion protein in the embodiment of the present application;

FIG6 is an electrophoresis diagram of integrated cells producing fusion proteins in an embodiment of the present application;

FIG7 is a transfection plasmid map of the product of the embodiment of the present application;

FIG8 is a statistical diagram of monoclonal antibody expression levels in integrated cells according to an embodiment of the present application;

FIG. 9 is an electrophoresis diagram of integrated cells producing monoclonal antibodies according to an embodiment of the present application.

Detailed ways

The present application will be further described in detail below in conjunction with the accompanying drawings, embodiments and examples. It should be understood that these embodiments and examples are only used to illustrate the present application and are not used to limit the scope of the present application. The purpose of providing these embodiments and examples is to make the understanding of the disclosure of the present application more thorough and comprehensive. It should also be understood that the present application can be implemented in many different forms, is not limited to the embodiments and examples described herein, and those skilled in the art can make various changes or modifications without violating the connotation of the present application, and the equivalent form obtained also falls within the protection scope of the present application. In addition, in the description below, a large number of specific details are given in order to provide a more comprehensive understanding of the present application, and it should be understood that the present application can be implemented without one or more of these details.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application belongs. The terms used herein in the specification of this application are only for the purpose of describing implementation modes and embodiments and are not intended to limit this application.

the term

Unless otherwise specified or incompatible herewith, the terms and phrases used herein shall have the following meanings:

The terms "and/or", "or/and", and "and/or" used in this article include any one of two or more related listed items, and also include any and all combinations of related listed items, and the arbitrary and all combinations include any combination of two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and/or", "or/and", and "and/or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions that are all connected by "logical and", and undoubtedly includes technical solutions that are all connected by "logical or". For example, "A and/or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and/or, B, and/or, C, and/or, D" includes any one of A, B, C, and D (that is, the technical solution that is all connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the combination of four of A, B, C, and D (that is, the technical solution that is all connected by "logical AND").

In the present application, "plurality", "multiple", "multiple times", "multiples", etc., unless otherwise specified, refer to a number greater than 2 or equal to 2. For example, "one or more" means one or greater than or equal to two.

As used herein, "combination thereof", "any combination thereof", "any combination thereof" etc. include all suitable combinations of any two or more of the listed items.

Herein, the “suitable” mentioned in “suitable combination”, “suitable method”, “any suitable method”, etc., shall be based on the ability to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.

Herein, “preferred”, “better”, “more preferred” and “suitable” are merely used to describe implementation methods or examples with better effects, and it should be understood that they do not constitute limitations on the scope of protection of this application.

In the present application, "further", "further", "particularly" and the like are used for descriptive purposes to indicate differences in content, but should not be construed as limiting the scope of protection of the present application.

In this application, "optionally", "optional", and "optional" mean optional or dispensable, that is, any one of the two parallel schemes of "yes" or "no". If multiple "options" appear in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "option" is independent.

In the present application, the terms "first", "second", "third", "fourth", etc. in "the first aspect", "the second aspect", "the third aspect", "the fourth aspect", etc. are used only for descriptive purposes and cannot be understood as indicating or implying relative importance or quantity, nor can they be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", "fourth", etc. only serve the purpose of non-exhaustive enumeration and description, and it should be understood that they do not constitute a closed limitation on quantity.

In the present application, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

In this application, when a numerical interval (i.e., a numerical range) is involved, unless otherwise specified, the optional numerical distribution within the numerical interval is deemed to be continuous and includes the two numerical endpoints of the numerical range (i.e., the minimum value and the maximum value), and every numerical value between the two numerical endpoints. Unless otherwise specified, when a numerical interval refers only to integers within the numerical interval, it includes the two endpoint integers of the numerical range, as well as Each integer between the two endpoints is equivalent to directly listing each integer in this article, such as t is an integer selected from 1 to 10, which means that t is any integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. In addition, when multiple ranges are provided to describe features or characteristics, these ranges can be combined. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges included therein.

The temperature parameters in this application, unless otherwise specified, are allowed to be either constant temperature treatment or to vary within a certain temperature range. It should be understood that the constant temperature treatment allows the temperature to fluctuate within the accuracy range controlled by the instrument. Fluctuations within the range of ±5°C, ±4°C, ±3°C, ±2°C, and ±1°C are allowed.

In the present application, % (w/w) and wt% both represent weight percentage, % (v/v) refers to volume percentage, and % (w/v) refers to mass volume percentage.

In this application, "about" or "approximately" means within an acceptable error range for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, according to the practice in the art, "about" can mean within 3 or more than 3 standard deviations. Alternatively, "about" can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and even more preferably up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude of a value, preferably within 5-fold, and more preferably within 2-fold.

In the present application, a "selection marker gene" may be a gene that allows targeted integration cells carrying the gene to be specifically selected for or against the gene in the presence of a corresponding selection agent. For example, but not limiting, a selection marker may allow targeted integration cells transformed with a selection marker gene to be positively selected in the presence of the gene; non-transformed targeted integration cells will not be able to grow or survive under selection conditions. The selection marker may be positive, negative, or bifunctional. A positive selection marker may allow cells carrying the marker to be selected, while a negative selection marker may allow cells carrying the marker to be selectively eliminated. The selection marker may confer resistance to a drug or compensate for metabolic or catabolism defects in targeted integration cells.

In this application, "antibody" is used in the broadest sense and includes a variety of antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), half antibodies, and antibody fragments, as long as the fragment exhibits the desired antigen-binding activity. As used herein, the term "antibody fragment" refers to a molecule other than an intact antibody that contains a portion of an intact antibody that binds to the antigen bound by the intact antibody. Examples of antibody fragments include but are not limited to Fv, Fab, Fab′, Fab′-SH, F(ab′)2; diabodies; linear antibodies; single-chain antibody molecules (e.g., scFv); and multispecific antibodies formed from antibody fragments. For a review of certain antibody fragments, see Holliger and Hudson, Nature Biotechnology 23: 1126-1136 (2005).

In this application, the term "targeted integration cell" refers to a cell into which an exogenous nucleic acid has been introduced, including the offspring of such cells. Targeted integration cells include "transformants" and "transformed cells", which include primary transformed cells and offspring derived therefrom, regardless of the number of passages. The nucleic acid content of the offspring may not be exactly the same as that of the parental cell, but may contain mutations. Mutant offspring having the same function or biological activity as that screened or selected for in the initial transformed cell are included herein.

In this application, the term "vector" refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is connected. The term includes vectors that are self-replicating nucleic acid structures and vectors that are incorporated into the genome of a targeted integration cell into which it has been introduced. In certain embodiments, a vector directs the expression of a nucleic acid to which it is operably connected. Such vectors are referred to herein as "expression vectors."

In the present application, the term "homologous fragment" refers to a sequence fragment that has a significant sequence similarity as determined by sequence alignment. For example, two sequence fragments can be about 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 99.9% homologous. Alignment is performed by algorithms and computer programs (including but not limited to BLAST, FASTA and HMME), which compare sequence fragments and calculate the statistical significance of the match based on factors such as sequence length, sequence identity and similarity, and the presence and length of sequence mismatches and gaps; for example, it can be the ratio of the length of similar sequence fragments to the length of the aligned region. Homologous sequence fragments can refer to both DNA and protein sequences.

The currently disclosed subject matter provides a targeted integration cell suitable for an exogenous nucleotide sequence. In certain embodiments, the targeted integration cell comprises an exogenous nucleotide sequence integrated at an integration site on the genome of the host cell. An "integration site" comprises a nucleic acid sequence within the genome of the targeted integration cell, in which an exogenous nucleotide sequence is inserted. In certain embodiments, the integration site is between two adjacent nucleotides on the genome of the targeted integration cell. In certain embodiments, the integration site comprises a nucleotide extension, and an exogenous nucleotide sequence can be inserted between any of the nucleotides.

The first aspect of the present application

The present application provides a nucleic acid, which comprises a nucleic acid fragment. In the 5'-3' direction, the nucleic acid fragment is composed of the nucleotide sequences shown in SEQ ID No. 1 and SEQ ID No. 8 connected in sequence, and the nucleic acid fragment is used to integrate exogenous nucleic acid fragments.

It should be noted that the nucleotide sequence of the nucleic acid fragment contained in the nucleic acid is as follows (in order to facilitate the preparation of the sequence table, the The nucleic acid fragment is divided into an upper half SEQ ID No.1 and a lower half SEQ ID No.8, i.e., the nucleic acid fragment):

In one example of the present application, the sequence fragment into which the exogenous nucleic acid fragment is integrated maintains no less than 90% consistency with the nucleic acid fragment (in the 5'-3' direction, the nucleic acid fragment is composed of the nucleotide sequences shown in SEQ ID No. 1 and SEQ ID No. 8, respectively), for example, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, and 99.9% consistency.

In the present application, the integration site of the exogenous nucleic acid fragment can correspond to the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, ... 17870, 17871, 17872, 17873, 17874, 17875, 17876, 17877, 17878th position of the nucleic acid fragment.

Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3435th-3635th base interval of the nucleic acid fragment.

Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3440th-3624th base interval of the nucleic acid fragment.

Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3451st-3615th base interval of the nucleic acid fragment.

Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3460th-3597th base interval of the nucleic acid fragment.

Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3470th-3580th base interval of the nucleic acid fragment.

Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3480th-3570th base interval of the nucleic acid fragment.

Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3490th-3559th base interval of the nucleic acid fragment.

Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3505th-3546th base interval of the nucleic acid fragment.

Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3525th-3557th base interval of the nucleic acid fragment.

Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3530th-3545th base interval of the nucleic acid fragment.

Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3331-3540 (e.g., 3531, 3532, 3533, 3534, 3535, 3536, 3537, 3538, 3539, 3540) base interval of the nucleic acid fragment.

In one example of the present application, the exogenous nucleic acid fragment comprises: a first recombination recognition sequence and a second recombination recognition sequence recognized by a recombinase, a selection marker gene and/or a target gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter that regulates the expression of the selection marker gene and/or the target gene.

In one example of the present application, the recombinase is Bxb1 integrase, ΦC31 integrase, Cre recombinase or FLP recombinase.

In one example of the present application, the first recombination recognition sequence and the second recombination recognition sequence are independently selected from one or more of the following sequences: LoxP sequence, LoxPL3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, Lox66 sequence, FRT sequence, Bxb1attP sequence, Bxb1attB sequence, attP sequence and attB sequence.

In one example of the present application, the selection marker gene is selected from one or more of a neomycin resistance gene, a thymidine kinase gene, a hygromycin phosphotransferase gene, a dihydrofolate reductase gene, a thymidine kinase gene, a glutamine synthetase gene, an asparagine synthetase gene, a tryptophan synthetase gene, a histidinol dehydrogenase gene, an aminoglycoside phosphotransferase gene, a tryptophan synthetase gene and a fluorescent protein gene.

In one example of the present application, the promoter is CMV promoter, SV40 promoter, RSV promoter, β-globin promoter, UBC promoter, EF1a promoter, ubiquitin promoter, β-actin promoter, PGK1 promoter, Rosa26 promoter, HSP70 promoter, GAPDH promoter, Eif4A1 promoter, Egr1 promoter, FerH promoter, SM22α promoter or Endothelin-1 promoter.

In one example of the present application, the target gene encodes one or more of an antibody, a recombinant protein, a polypeptide, an enzyme, a hormone, a growth factor and a receptor.

The second aspect of the present application

The present application provides a recombinant vector, which comprises:

a. a 5' homology arm homologous to the sequence fragment existing in the above-mentioned nucleic acid fragment provided in the present application (the nucleic acid fragment is composed of the nucleotide sequences shown in SEQ ID No. 1 and SEQ ID No. 8 connected in sequence in the 5'-3' direction),

b. Target gene,

c. A 3’ homology arm that is homologous to the sequence fragment existing in the above-mentioned nucleic acid fragment provided in the present application (in the 5’-3’ direction, the nucleic acid fragment is composed of the nucleotide sequences shown in SEQ ID No.1 and SEQ ID No.8 connected in sequence).

In one example of the present application, the recombinant vector is a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a herpes virus vector, a poxvirus vector, a baculovirus vector, a papillomavirus vector, a papillomas virus vector, an integrative phage vector, a non-viral vector, a transposon and/or a transposase, an integrase substrate or a plasmid.

The third aspect of the present application

The present application provides a targeted integrated cell, wherein the targeted integrated cell comprises the nucleic acid described in the first aspect.

In one example of the present application, the targeted integration cell is a eukaryotic cell;

Optionally, the eukaryotic cell is a mammalian cell;

Optionally, the mammalian cells include Chinese hamster ovary CHO cells and human embryonic kidney HEK293 cells.

Optionally, the CHO cells include CHO host cells, CHO K1 host cells, CHO K1SV host cells, DG44 host cells, DUKXB-11 host cells, CHOK1S host cells or CHO K1M host cells.

The fourth aspect of the present application

The present application provides a method for preparing the targeted integrated cell described in the third aspect, the preparation method comprising the following steps:

The nucleic acid described in the first aspect is introduced into a cell, or a cell is provided that contains the above-mentioned nucleic acid fragment provided in the present application (in the 5'-3' direction, the nucleic acid fragment is composed of the nucleotide sequences shown in SEQ ID No. 1 and SEQ ID No. 8 connected in sequence) and the exogenous nucleic acid fragment is integrated into the nucleic acid fragment to prepare a targeted integrated cell.

Optionally, the integration method includes, but is not limited to, site-specific recombination technology derived from homologous recombination technology, which relies on integrase targeting specific recognition sites to achieve genetic engineering operations such as gene replacement, gene knock-out and knock-in between the genome and exogenous DNA, for example, it can be recombinase-mediated cassette exchange, for example, it can be CRISPR/Cas9-mediated gene targeted integration.

The fifth aspect of the present application

The present application provides a method for producing a target gene expression product, the method comprising the following steps: culturing the targeted integration cell described in the third aspect, and collecting the expression product of the target gene in the exogenous nucleic acid fragment.

The targeted integrated cells in this application are stable and high-yielding.

In the present application, the nucleotide sequence of the integration site and/or the nucleotide sequence flanking the integration site can be identified experimentally: in some embodiments of the present application, the nucleotide sequence of the integration site and/or the nucleotide sequence flanking the integration site can be identified by a whole genome screening method to isolate host cells; in some embodiments of the present application, the nucleotide sequence of the integration site and/or the nucleotide sequence flanking the integration site can be identified by a whole genome screening method after a transposase-based cassette integration event; in some embodiments of the present application, the nucleotide sequence of the integration site and/or the nucleotide sequence flanking the integration site can be identified by a brute force random integration screening. The nucleotide sequence of the integration site and/or the nucleotide sequence flanking the integration site; in some embodiments of the present application, the nucleotide sequence of the integration site and/or the nucleotide sequence flanking the integration site can be determined by conventional sequencing methods (such as target locus amplification), followed by next-generation sequencing and whole genome sequencing; in some embodiments of the present application, the location of the integration site on the chromosome can be determined by conventional cell biology methods (such as fluorescence in situ hybridization analysis).

Specific embodiments

The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manual or normal conditions in this area, can also be based on the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

The consumables in the following specific embodiments involve: Neon Resuspension Buffer R (ThermoFisher), electroporation solution E (ThermoFisher), recovery medium EX-CELL Advanced CHO Fed-batch Medium (Sigma-Aldrich), expansion medium EX-CELL Advanced CHO Fed-batch Medium plus 200 μg/ml hygromycin (ThermoFisher) and 1% GlutaMAX (ThermoFisher), shake flask medium EX-CELL Advanced CHO Fed-batch Medium plus 1% GlutaMAX, basal medium in fed-batch medium uses 100% EX-CELL Advanced CHO Fed-batch Medium plus 1% GlutaMAX, and feed medium is 4% Cell Boost 7a/7b (HyClone).

Example 1

The operation flow of this embodiment is shown in FIG1 , and mainly includes the following steps:

(1) Using the green fluorescent protein gene (EGFP) as a marker gene for screening and the attP sequence as a homology arm, a recombinant plasmid containing RMCE was constructed, as shown in Figure 2;

(2) Amplifying and linearizing the constructed plasmid and using it for transfection;

(3) Take 3×10E6 CHO cells into a 50 mL centrifuge tube, centrifuge at 1000 rpm for 5 min at room temperature, and discard the supernatant;

(4) Wash the cells with 5 mL of Ex-Cell Advanced CHO Fed-batch medium, centrifuge at 1000 rpm for 5 min at room temperature, and discard the supernatant;

(5) Resuspend the cells with 100 μL of resuspension buffer for the cell electroporator;

(6) Add 15 μg of the linearized plasmid to the resuspended cells in step (5), mix gently, and pipette 50 times to avoid generating bubbles;

(7) Turn on the cell electroporator, adjust the parameters, install the motor slot into the electroporator, and add 3 mL of electroporation solution E into the slot;

(8) sucking the cell plasmid suspension from step (6) into the tip of the electroporation gun, placing it into the electroporation tank, and performing electroporation;

(9) Immediately transfer the electroporated cells into a 6-well plate containing 2 mL of recovery medium and place in a 37°C 5% CO ₂ incubator for overnight culture;

(10) 48 hours after electroporation, pressure screening was performed. The cells were passaged every 2-3 days. The cell viability first decreased and then increased. When the cell viability was greater than 90%, the cells were considered to be a stable cell pool.

(11) Using flow cytometry to sort the cells in the stable cell pool to screen for highly fluorescent cells, and obtaining 1% of cells with the highest fluorescence;

(12) After enrichment, cells are precisely selected using a precision selection system and then fluorescently sorted to complete monoclonalization;

(13) Monoclonal fluorescent cells are expanded and cultured to form cell lines, and fluorescence detection is performed in the shake flask stage. The high-fluorescence cell line is retained and recorded as GBBc001 cells;

(14) The high fluorescence cell line was subjected to a 90-day passage stability study to confirm that cells with small fluorescence value changes and stable cell line growth were stable high fluorescence cells;

(15) Referring to step (1), the target gene 1 (Fc fusion protein) fragment was cloned into the plasmid to construct a recombinant plasmid containing RMCE, as shown in FIG3 ; the schematic diagram of the construction of the target gene 2 (monoclonal antibody) recombinant plasmid is shown in FIG7 .

The target gene fragment 1 has the sequence shown in SEQ ID No. 2, SEQ ID No. 2:

(16) Select the stable high fluorescence cell GBBc001 in step (14) for transfection and integration verification, amplify and linearize the recombinant plasmid in step (15), and co-transfect it with Bxb-1 integrase into the stable high fluorescence cell GBBc001, and the transfection steps are as described above;

(17) Two days after transfection, the cell pool was subjected to pressure screening, and a stable cell pool was formed in about 2 weeks;

(18) Counting the proportion of non-fluorescent cells in the cell pool, enriching them by FACS after the cell viability recovers to more than 90%, expanding the culture, and plating them by limiting dilution method after the viability recovers to 90% to make the cell pool monoclonal;

(19) The non-fluorescent cells in the monoclonal cells were placed in a constant temperature incubator (37°C, 80% humidity) for further expansion (Advanced+1% Glutamax) and expanded to the shake flask stage (Advanced+1% Glutamax). After about 1 month, the cell line can enter the feeding stage and be cultured by fed-batch culture (Advanced+1% Glutamax for the first three days, 3% 7a and 0.3% 7b (cytiva) on the 3rd and 5th days, 5% 7a and 0.5% 7b (cytiva) on the 7th, 9th, 11th and 13th days, and sugar was supplemented on the 3rd, 5th, 7th, 9th, 11th and 13th days according to the sugar consumption of the cells and the expression level was evaluated. The expression level of the single copy cell line of the fixed-site integrated product and the random integration cell line [1] cultured under the same conditions are compared in Figure 4 (fusion protein) and Figure 8 (monoclonal antibody);

In order to investigate the stability of the cell product clones corresponding to the targeted integration fusion protein (Fc fusion protein) product, the product clones were continuously passaged for about 90 days for stability assessment. During the continuous passage process, the cells of the targeted integration fusion protein on the 1st day, the 42nd day, and the 91st day were taken for 7 days of batch culture (Advanced+1% GlutaMAX), and sugar was supplemented on the 3rd, 5th, and 7th days according to the sugar consumption of the cells. The results showed that the fusion protein product clone cells showed stability and high yield from the expression level (Figure 5);

The second-generation whole genome sequencing was performed on the target gene 1 high expression cell line GBBc001-14, and the annotation information of the integration site on CHO was obtained as follows: NC_048595: 28250698 is located intron 3of11 of Mtf1.

The sequence fragment after integration of the target gene 1 is shown in SEQ ID No. 3, SEQ ID No. 3:

The above-mentioned breakpoint upstream primer F1 (SEQ ID No. 4: gtctgggcatggtggttgca, 131 bp upstream of the breakpoint) and the target gene 1 downstream primer R1 (SEQ ID No. 5: gaggacactccacgcaaca, about 600 bp downstream of the translation start site of the target gene 1) on the product plasmid were used to amplify the genome of the cell line corresponding to the product plasmid to obtain a fragment that met the theoretical size (2113 bp) (genome 131 bp, The original vector integrated into the genome is 696 bp, and the product sequence after site replacement is 1286 bp), as shown in Figure 6 (the corresponding band of lane GBBc001-14).

The amplified bands were recovered by gel excision, purified, and multiple pairs of primers were designed for DNA sequencing. The sequence after splicing of the sequencing results was shown above, which was consistent with the theoretical sequence (sequence SEQ ID No. 3), thus confirming that the target gene was correctly integrated into the target site.

Similarly, the sequence fragment after the target gene is integrated into the target gene 2 high-expression cell line GBBc001-3 is shown in SEQ ID No.6, SEQ ID No.6:

The above-mentioned breakpoint upstream primer F3 (SEQ ID No. 4): gtctgggcatggtggttgca and the product gene downstream primer R3 (SEQ ID No. 7): actcgcctctattgaagct on the plasmid used for the product were used to amplify the genome of the product cell line to obtain a fragment that met the theoretical size (3198 bp), as shown in Figure 9 (corresponding band of lane GBBc001-3).

The amplified bands were excised, recovered, purified, and multiple pairs of primers were designed for DNA sequencing. The sequence after splicing of the sequencing results was shown above, which was consistent with the theoretical sequence (sequence SEQ ID No. 6), thus confirming that the target gene was correctly integrated into the target site.

references:

[1] Takeshi Omasa et al. Cell engineering and cultivation of Chinese hamster ovary (CHO) cells. Curr Pharm Biotechnol. 2010Apr; 11(3): 233-40.

The technical features of the above-mentioned implementation modes and examples can be combined in any appropriate manner. To make the description concise, not all possible combinations of the technical features in the above-mentioned implementation modes and examples are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

The above-described embodiments only express several implementation methods of the present application, which is convenient for understanding the technical solution of the present application in detail, but it cannot be understood as a limitation on the scope of protection of the patent application. It should be pointed out that for ordinary technicians in this field, without departing from the concept of the present application, several deformations and improvements can be made, which all belong to the protection scope of the present application. In addition, it should be understood that after reading the above-mentioned teaching content of the present application, the technicians in this field can make various changes or modifications to the present application, and the equivalent forms obtained also fall within the protection scope of the present application. It should also be understood that the technical solutions obtained by the technicians in this field through logical analysis, reasoning or limited experiments on the basis of the technical solutions provided in the present application are all within the protection scope of the claims attached to the present application. Therefore, the protection scope of the patent of the present application shall be based on the content of the attached claims, and the description and drawings can be used to explain the content of the claims.

Claims (13)

1. Nucleic acid, characterized in that the nucleic acid comprises a nucleic acid fragment, wherein in the 5'-3' direction, the nucleic acid fragment is composed of the nucleotide sequences shown in SEQ ID No.1 and SEQ ID No.8 connected in sequence, and the nucleic acid fragment is used to integrate exogenous nucleic acid fragments.
2. The nucleic acid according to claim 1, characterized in that the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3435th-3635th base interval of the nucleic acid fragment;

   Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3440th-3624th base interval of the nucleic acid fragment;

   Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3451st to 3615th base interval of the nucleic acid fragment;

   Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3460th-3597th base interval of the nucleic acid fragment;

   Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3470th-3580th base interval of the nucleic acid fragment;

   Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3480th-3570th base interval of the nucleic acid fragment;

   Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3490th-3559th base interval of the nucleic acid fragment;

   Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3505th to 3546th base interval of the nucleic acid fragment;

   Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3525th-3557th base interval of the nucleic acid fragment;

   Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3530th-3545th base interval of the nucleic acid fragment;

   Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the 3531-3540 base interval of the nucleic acid fragment.
3. The nucleic acid according to claim 1 or 2 is characterized in that the exogenous nucleic acid fragment contains: a first recombination recognition sequence and a second recombination recognition sequence recognized by a recombinase, a selection marker gene and/or a target gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter that regulates the expression of the selection marker gene and/or the target gene.
4. The nucleic acid according to claim 3, characterized in that the recombinase is Bxb1 integrase, ΦC31 integrase, Cre recombinase or FLP recombinase; or/and,

   The first recombination recognition sequence and the second recombination recognition sequence are independently selected from one or more of the following sequences: LoxP sequence, LoxPL3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, Lox66 sequence, FRT sequence, Bxb1 attP sequence, Bxb1 attB sequence, attP sequence and attB sequence.
5. The nucleic acid according to claim 3, characterized in that the selection marker gene is selected from one or more of a neomycin resistance gene, a thymidine kinase gene, a hygromycin phosphotransferase gene, a dihydrofolate reductase gene, a thymidine kinase gene, a glutamine synthetase gene, an asparagine synthetase gene, a tryptophan synthetase gene, a histidinol dehydrogenase gene, an aminoglycoside phosphotransferase gene, a tryptophan synthetase gene and a fluorescent protein gene.
6. The nucleic acid according to claim 3, characterized in that the promoter is a CMV promoter, an SV40 promoter, an RSV promoter, a β-globin promoter, a UBC promoter, an EF1a promoter, an ubiquitin promoter, a β-actin promoter, a PGK1 promoter, a Rosa26 promoter, a HSP70 promoter, a GAPDH promoter, an Eif4A1 promoter, an Egr1 promoter, a FerH promoter, a SM22α promoter or an Endothelin-1 promoter.
7. The nucleic acid according to claim 3, characterized in that the target gene encodes one or more of an antibody, a recombinant protein, a polypeptide, an enzyme, a hormone, a growth factor and a receptor.
8. The recombinant vector is characterized in that the vector comprises:

   a. a 5' homology arm homologous to the sequence fragment present in the nucleic acid fragment of claim 1,

   b. Target gene,

   c. a 3' homology arm that is homologous to the sequence fragment existing in the nucleic acid fragment of claim 1.
9. The recombinant vector according to claim 8, characterized in that the recombinant vector is a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a herpes virus vector, a poxvirus vector, a baculovirus vector, a papillomavirus vector, a papillomasovacuolar virus vector, an integrative phage vector, a non-viral vector, a transposon and/or a transposase, an integrase substrate or a plasmid.
10. The targeted integrated cell is characterized in that the targeted integrated cell comprises the nucleic acid according to any one of claims 1 to 7.
11. The targeted integrated cell according to claim 10, characterized in that the targeted integrated cell is a eukaryotic cell;

    Optionally, the eukaryotic cell is a mammalian cell;

    Optionally, the mammalian cells include Chinese hamster ovary CHO cells and human embryonic kidney HEK293 cells.
12. The method for preparing targeted integrated cells according to claim 10 or 11, characterized in that the preparation method comprises the following steps:

    The nucleic acid according to any one of claims 1 to 7 is introduced into a cell, or a cell comprising the nucleic acid fragment according to claim 1 is provided and the exogenous nucleic acid fragment is integrated into the nucleic acid fragment to prepare a targeted integrated cell.
13. A method for producing a target gene expression product, characterized in that the method comprises the following steps: culturing the targeted integration cell according to claim 10 or 11, and collecting the expression product of the target gene in the exogenous nucleic acid fragment.