WO2024090800A1 - Pharmaceutical composition comprising lipocalin 2 inhibitor for preventing or treating liver fibrosis - Google Patents

Pharmaceutical composition comprising lipocalin 2 inhibitor for preventing or treating liver fibrosis Download PDF

Info

Publication number
WO2024090800A1
WO2024090800A1 PCT/KR2023/014274 KR2023014274W WO2024090800A1 WO 2024090800 A1 WO2024090800 A1 WO 2024090800A1 KR 2023014274 W KR2023014274 W KR 2023014274W WO 2024090800 A1 WO2024090800 A1 WO 2024090800A1
Authority
WO
WIPO (PCT)
Prior art keywords
lipocalin
inhibitor
liver fibrosis
pharmaceutical composition
preventing
Prior art date
Application number
PCT/KR2023/014274
Other languages
French (fr)
Korean (ko)
Inventor
임승순
이은호
Original Assignee
계명대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020220140726A external-priority patent/KR20240083161A/en
Application filed by 계명대학교 산학협력단 filed Critical 계명대학교 산학협력단
Publication of WO2024090800A1 publication Critical patent/WO2024090800A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/13—Nucleic acids or derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating liver fibrosis containing a lipocalin 2 inhibitor, a pharmaceutical preparation containing the composition, and a use and treatment method thereof.
  • the liver is a very important organ that is located between the digestive system and the systemic circulatory system and performs the function of defending the entire body from foreign substances that enter the digestive system. Because extracorporeal substances that enter the body pass through the liver, the liver is at greater risk of being exposed to many toxic substances in addition to nutrients than other organs, and the risk of damage is also higher than that of other organs.
  • liver tissues hepatocytes perform major liver functions such as absorption and metabolism of nutrients, storage, and plasma protein synthesis, and Kupffer cells, which are intrahepatic macrophages, synthesize connective tissue excessively when liver is damaged.
  • hepatic stellate cells lipocytes; HSC
  • endothelial cells endothelial cells
  • pit cells that cause liver fibrosis exist.
  • hepatocytes account for more than 90% of the total cells that make up liver tissue, and are parenchymal cells that perform the main functions of the liver. Deterioration of liver function during liver disease is caused by damage to these liver cells.
  • liver damage due to various causes commonly results in liver fibrosis and the mechanism can be summarized as follows.
  • Kupffer cells are activated and secrete various cytokines
  • hepatic stellate cells are activated to create connective tissue.
  • interstitial repair is triggered in which damaged liver cells are replaced by connective tissue, wounds are formed due to excessive accumulation of connective tissue in the liver tissue, and liver function deteriorates due to liver cell damage, resulting in liver fibrosis and cirrhosis.
  • HSCs hepatic stellate cells
  • Lipocalin 2 is a member of the lipocalin family that binds to and transports lipids and other hydrophobic molecules (Flower, D. R. et al. 2000, Biochim Biophys Acta 1482: 9-24).
  • LCN2 is known to be important in both apoptosis and survival of cells (Nelson, A. M. et al. 2008, J Clin Invest 118: 1468-1478), and plays a central role in inducing cell differentiation in the kidney during embryogenesis. It is known that it protects the kidney from ischemic damage (Yang, J. et al. 2002, Mol Cell 10: 1045-1056) and protects the kidney from ischemic damage (Mishra, J.
  • LCN2 facilitates mucosal regeneration by promoting cell migration in various types of gastrointestinal tract damage (Playford, R. J. et al. 2006, Gastroenterology 131: 809-817).
  • LCN2 is a liver fibrosis-inducing substance, and research on methods to prevent and treat liver fibrosis by inhibiting it has been reported to date. does not exist.
  • One aspect is to provide a pharmaceutical composition for preventing or treating liver fibrosis, which includes a lipocalin 2 inhibitor as an active ingredient.
  • Another aspect is to provide a pharmaceutical preparation for preventing or treating liver fibrosis comprising the composition.
  • Another aspect is to provide a health functional food composition for preventing or improving liver fibrosis, including a lipocalin 2 inhibitor.
  • Another aspect is to provide a pharmaceutical composition containing a lipocalin 2 inhibitor as an active ingredient for use in preventing or treating liver fibrosis.
  • Another aspect is to provide a method for preventing or treating liver fibrosis using a pharmaceutical composition containing a lipocalin 2 inhibitor as an active ingredient.
  • lipocalin 2 is a factor that induces liver cells into hepatic stellate cells, and by suppressing the expression of lipocalin 2, it suppresses the expression of hepatic stellate cells, showing the effect of preventing and treating liver diseases such as liver fibrosis. was confirmed.
  • the present invention provides a pharmaceutical composition for preventing or treating liver fibrosis, comprising a lipocalin 2 inhibitor as an active ingredient.
  • the lipocalin-2 (LCN2) inhibitor according to the present invention can be usefully used to prevent and treat liver fibrosis.
  • the LCN2 inhibitor may include, without limitation, substances capable of achieving the purpose of LCN2 inhibition.
  • the LCN2 inhibitor may be an expression or activity inhibitor of LCN2 or an LCN2 receptor antagonist.
  • the lipocalin 2 inhibitor is an antisense nucleotide, aptamer, small interfering RNA (siRNA), short hairpin RNA (shRNA), micro RNA (miRNA) and It may be one or more selected from the group consisting of RNA interference (RNAi).
  • RNAi RNA interference
  • the lipocalin 2 inhibitor can inhibit the expression of lipocalin 2 by specifically binding to lipocalin 2 mRNA.
  • expression inhibition means inhibition of gene transcription and inhibition of translation into protein. In addition, it includes not only completely stopped gene expression, but also reduced gene expression.
  • the most common method of suppressing gene expression is to use antisense molecules.
  • the actions of antisense molecules to suppress the expression of target genes include inhibition of transcription initiation by triple strand formation, inhibition of transcription by hybrid formation at the site where a local open loop structure is created by RNA polymerase, and progression of synthesis. Inhibition of transcription by hybrid formation in the RNA being formed, inhibition of splicing by hybrid formation at the junction between introns and exons, inhibition of splicing by hybrid formation at the spliceosome formation site, and inhibition of splicing by hybrid formation with mRNA. These include inhibition of migration to the cytoplasm and inhibition of translation initiation by hybrid formation at the translation initiation factor binding site. They inhibit the expression of target genes by inhibiting transcription, splicing or translation processes.
  • the antisense molecules include triplicates, ribozymes, RNAi, or antisense nucleic acids.
  • Triplexer wraps around double-stranded DNA to form a three-stranded helix, thereby inhibiting transcription initiation (Maher et al., Antisense Res. and Dev., 1(3):227, 1991; Helene, C., Anticancer Drug Design, 6(6):569, 1991).
  • a ribozyme is an RNA enzyme that has the ability to specifically cleave single-stranded RNA. The ribozyme recognizes a specific nucleotide sequence within the target RNA molecule and cleaves it site-specifically, thereby suppressing protein expression of the target gene (Cech, J.Amer.
  • RNA interference is a method of suppressing gene expression at the transcriptional or post-transcriptional level using hairpin-shaped small molecule RNA that acts specifically on the base sequence (Mette et al., EMBO J., 19: 5194- 5201, 2000).
  • the small molecule RNA used in the RNAi method is a double-stranded RNA molecule that has homology to the target gene.
  • known chemical synthesis methods and enzymatic methods can be used. For example, chemical synthesis of RNA molecules can be done using methods disclosed in the literature (Verma and Eckstein, Annu.
  • Antisense nucleic acid refers to a DNA or RNA molecule that is at least partially complementary to a target mRNA molecule (Weintraub, Scientific American, 262:40, 1990).
  • antisense nucleic acids hybridize with the corresponding mRNA to form a double-stranded molecule, thereby inhibiting mRNA translation of the target gene and suppressing protein expression (Marcus-Sakura, Anal. Biochem., 172:289, 1988).
  • the antisense nucleic acid is preferably in the form of an oligonucleotide and can be prepared by any suitable method known in the art.
  • the antisense oligonucleotides can be synthesized by chemical synthesis, for example, by phosphoamidite chemistry by sulfurization with tetraethylthiuram disulfide in acetonitrile as described in Tetrahedron Lett., 1991, 32, 30005-30008. It can be manufactured very easily.
  • the siRNA against lipocalin 2 of the present invention consists of a sense sequence of 15 to 30 mers selected from the base sequence of the mRNA of the gene encoding the LCN2 protein and an antisense sequence that binds complementary to the sense sequence.
  • the sense sequence is not particularly limited thereto, but is preferably composed of 25 bases.
  • the lipocalin 2 inhibitor may be one or more selected from the group consisting of compounds that specifically bind to the lipocalin 2 protein, peptides, peptide mimetics, substrate analogs, aptamers, and antibodies.
  • the lipocalin 2 inhibitor can inhibit the activity of LCN2 by specifically binding to the LCN2 protein.
  • the lipocalin 2 inhibitor may be one or more selected from the group consisting of compounds, peptides, peptide mimetics, and substrate analogs that specifically bind to the lipocalin 2 receptor (24p3R) protein.
  • the lipocalin 2 inhibitor can act antagonistically with lipocalin 2 by specifically binding to the lipocalin 2 receptor protein, thereby inhibiting the activity of lipocalin 2.
  • the peptide mimetics may inhibit the activity of LCN2 protein by acting antagonistically on lipocalin 2 protein expression or the binding domain of lipocalin 2.
  • Peptidomimetics may be peptides or non-peptides and may be composed of amino acids linked by non-peptide bonds, such as psi bonds.
  • the peptide mimetic is structured similarly to the secondary structure characteristics of the LCN2 protein, can mimic the inhibitory properties of large molecules such as antibodies or soluble receptors, and is a novel antibody that can act with an effect equivalent to that of a natural antagonist. It may be a small molecule.
  • the aptamer is a single-stranded DNA or RNA molecule that can be converted to a specific chemical or biological molecule by an evolutionary method using an oligonucleotide library called SELEX (systematic evolution of ligands by exponential enrichment). It can be obtained by separating oligomers that bind with high affinity and selectivity. Aptamers can specifically bind to a target and modulate the target's activity, for example, they can block the target's function through binding.
  • SELEX systematic evolution of ligands by exponential enrichment
  • the anti-lipocalin 2 antibody may be a polyclonal antibody or a monoclonal antibody.
  • the antibody of the present invention can be produced by a conventional method widely known in the field of immunology using LCN2 protein as an antigen.
  • the lipocalin 2 antibody may be an anti-LCN2 antibody capable of neutralizing the activity of LCN2.
  • Polyclonal antibodies can be prepared from various warm-blooded animals such as horses, cattle, goats, sheep, dogs, chickens, turkeys, rabbits, mice, or rats using any of the techniques conventional in the art. That is, the animal is immunized through intraperitoneal, intramuscular, intraocular, or subcutaneous injection of the antigen. Immunity to the antigen can be increased using adjuvants, such as Freund's complete adjuvant or incomplete adjuvant. Following booster immunization, a small sample of serum is collected and tested for reactivity to the antigen of interest.
  • adjuvants such as Freund's complete adjuvant or incomplete adjuvant.
  • Monoclonal antibodies can also be produced using known techniques (Kennettm McKearn and Bechtol (eds.), Monoclonal Antibodies, Hybridomas; A New Dimension in Biological Analyses, Plenum Press, 1980).
  • the monoclonal antibody immunizes animals using the LCN2 protein as an immunogen, creates hybridomas by fusing the spleen cells of the immunized animal with myeloma cells, selects hybridomas that selectively recognize the LCN2 protein, and selects the selected high It can be produced by culturing hybridomas and isolating antibodies from the hybridoma culture medium.
  • the monoclonal antibody of the present invention can be prepared by injecting the above hybridoma that produces an anti-LCN2 antibody that selectively recognizes the LCN2 protein into an animal and isolating it from the ascites of the animal recovered after a certain period of time after the injection. You can.
  • the lipocalin 2 inhibitor may inhibit the induction of lipocalin 2 from liver cells to hepatic stellate cells.
  • liver fibrosis refers to liver cirrhosis, hepatorenal syndrome, peliosis hepatis, metabolic liver disease, chronic liver disease, hepatitis B virus infection, and hepatitis C virus infection.
  • prevention used in the present invention refers to all actions that suppress or delay the onset of bone disease by the pharmaceutical composition according to the present invention.
  • treatment refers to any action in which the symptoms of a bone disease are improved or beneficially changed by the pharmaceutical composition according to the present invention.
  • the pharmaceutical composition can reduce the expression of pro-fibrotic (fibrosis-related) factors, which refer to factors conventionally known to be involved in fibrosis.
  • pro-fibrotic (fibrosis-related) factors which refer to factors conventionally known to be involved in fibrosis.
  • transforming growth factor- ⁇ TGF- ⁇
  • alpha smooth muscle actin ⁇ -SMA
  • tissue inhibitor matrix metalloproteinase-1 tissue inhibitor matrix metalloproteinase-1
  • TIMP-1 tissue inhibitor matrix metalloproteinase-1
  • collagen type I alpha 1 chain, COL1A1, collagen type III alpha 1 chain, COL3A1, collagen type V alpha 2 chain It may be COL5A2), collagen type VI alpha 1 chain (COL6A1), matrix metallopeptidase 2 (MMP2), or matrix metallopeptidase 9 (MMP9).
  • the pharmaceutical composition of the present invention can be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally, intranasally, inhaled, or applied topically) according to the desired method, and the dosage depends on the patient's condition. It varies depending on body weight, disease severity, drug type, administration route and time, but may be appropriately selected by a person skilled in the art.
  • the pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat or diagnose a disease with a reasonable benefit/risk ratio applicable to medical treatment or diagnosis, and the effective dose level is determined by the type of disease, severity, and drug of the patient. It can be determined based on factors including activity, sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field.
  • the pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. Considering all of the above factors, it is important to administer an amount that can achieve maximum effect with the minimum amount without side effects, and this can be easily determined by a person skilled in the art.
  • the effective amount of the pharmaceutical composition of the present invention may vary depending on the patient's age, gender, condition, body weight, absorption, inactivation rate and excretion rate of the active ingredient in the body, type of disease, and drug used in combination.
  • it can be administered every day or every other day, or divided into 1 to 3 times a day.
  • the above dosage does not limit the scope of the present invention in any way.
  • the lipocalin 2 inhibitor is added to the pharmaceutical composition in an amount of 0.1 ⁇ g to 3.0 ⁇ g, 0.1 ⁇ g to 2.5 ⁇ g, 0.1 ⁇ g to 2.0 ⁇ g, 0.15 ⁇ g to 2.0 ⁇ g, 0.2 ⁇ g to 2.0 ⁇ g, 0.25 ⁇ g It may be included in ⁇ g to 2.0 ⁇ g, 0.25 ⁇ g to 1.5 ⁇ g or 0.25 ⁇ g to 1.0 ⁇ g.
  • the lipocalin 2 inhibitor When administered as a composition, it may be formulated with an appropriate amount of a pharmaceutically acceptable vehicle or carrier to provide an appropriate dosage form.
  • composition may further include a carrier, excipient, and diluent used in the preparation of the pharmaceutical composition.
  • the carrier is commonly used and includes, but is not limited to, saline solution, sterilized water, Ringer's solution, buffered saline solution, cyclodextrin, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome, etc., and if necessary, antioxidant. , and other common additives such as buffer solutions may be further included.
  • excipients such as aqueous solutions, suspensions, emulsions, etc., pills, capsules, granules, or tablets.
  • excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, Examples include, but are not limited to, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil.
  • the formulations can be preferably formulated according to each ingredient using the method disclosed in Remington's literature.
  • the pharmaceutical composition of the present invention is not particularly limited in formulation, but may be formulated as an injection formulation, an injection formulation, a spray formulation, an inhalation formulation, or an external application for the skin.
  • composition can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, and sterile injectable solutions.
  • Solid preparations for oral administration can be tablets, pills, powders, granules, capsules, etc., and the solid preparations include the tectorigenin and its fractions with at least one excipient, such as starch, calcium carbonate, and sucrose. It can be prepared by mixing , lactose, or gelatin. Additionally, in addition to the above excipients, lubricants such as magnesium styrate and talc may be used.
  • Liquid preparations for oral administration may include suspensions, oral solutions, emulsions, and syrups.
  • simple diluents such as water and liquid paraffin
  • excipients such as wetting agents, sweeteners, fragrances, and preservatives may be used.
  • Preparations for parenteral administration can be sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories.
  • the non-aqueous solvent or suspension may be propylene glycol, polyethylene glycol, vegetable oil such as olive oil, or injectable ester such as ethyl oleate.
  • injectable ester such as ethyl oleate.
  • witepsol, macrogol, tween 61, cacao, laurel, and glycerogenatin can be used as a base for the suppository.
  • the present invention provides a pharmaceutical composition for preventing or treating liver fibrosis, comprising a polynucleotide encoding a lipocalin 2 inhibitor as an active ingredient.
  • the polynucleotide encoding the lipocalin 2 inhibitor may include DNA or RNA.
  • the polynucleotide is introduced into an expression vector such as a plasmid or a viral vector by a known method, and then the expression vector is targeted by infection or transduction by various methods known in the art. It can be introduced into cells.
  • an expression vector such as a plasmid or a viral vector
  • the plasmid expression vector is an FDA-approved gene delivery method for use in humans and is a method of delivering plasmid DNA directly to human cells (Nabel, E. G., et al., Science, 249:1285-1288, 1990). Unlike viral vectors, plasmid DNA has the advantage of being able to be purified homogeneously.
  • a mammalian expression plasmid known in the art can be used as a mammalian expression plasmid known in the art.
  • pRK5 European Patent No. 307,247)
  • pSV16B International Patent Publication No. 91/08291
  • pVL1392 are representative examples.
  • the plasmid expression vector containing the polynucleotide according to the present invention can be used by methods known in the art, such as, but not limited to, transient transfection, microinjection, and transduction. , cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE Dextran-mediated transfection, polybrene-mediated transfection ), electroporation, gene gun, and other known methods for introducing DNA into cells.
  • An expression vector capable of expressing the lipocalin 2 inhibitor can be administered by a known method.
  • it can be administered topically parenterally, orally, intranasally, intravenously, intramuscularly, subcutaneously, or by other suitable means.
  • the present invention can provide a pharmaceutical composition for preventing or treating liver fibrosis, which contains an expression vector containing a polynucleotide encoding a lipocalin 2 inhibitor as an active ingredient.
  • the present invention provides a pharmaceutical formulation for preventing or treating liver fibrosis, comprising the composition.
  • the present invention provides a health functional food composition for preventing or improving liver fibrosis containing a lipocalin 2 inhibitor.
  • the term “improvement” means any action that reduces at least the severity of a parameter related to the condition being treated, such as a symptom.
  • the health functional food composition can be used simultaneously or separately with a drug for treatment before or after the onset of the disease in order to prevent or improve the disease.
  • the active ingredient can be added as is to food or used together with other foods or food ingredients, and can be used appropriately according to conventional methods.
  • the mixing amount of the active ingredient can be appropriately determined depending on the purpose of use (prevention or improvement).
  • the composition of the present invention may be added in an amount of preferably 15% by weight or less, preferably 10% by weight or less, based on the raw materials.
  • the amount may be below the above range.
  • the health functional food composition of the present invention may contain other ingredients as essential ingredients without any particular restrictions.
  • it may contain various flavoring agents or natural carbohydrates as additional ingredients.
  • natural carbohydrates include monosaccharides such as glucose, fructose, etc.; Disaccharides such as maltose, sucrose, etc.; and polysaccharides, such as common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • natural flavoring agents thaumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.)
  • synthetic flavoring agents sacharin, aspartame, etc.
  • the ratio of the natural carbohydrates can be appropriately determined by the selection of a person skilled in the art.
  • the health functional food composition of the present invention contains various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, colorants and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, It may contain alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. These components can be used independently or in combination, and the proportions of these additives can also be appropriately selected by those skilled in the art.
  • Lipocalin 2 inhibitor “liver fibrosis,” “prevention,” etc. may be within the aforementioned scope.
  • the present invention provides a method for preventing or treating liver fibrosis, comprising administering the pharmaceutical composition to a subject.
  • “individual” refers to a subject in need of treatment for a disease, and more specifically, human or non-human primates, mice, rats, dogs, cats, horses, and cows. It means mammal.
  • Lipocalin 2 inhibitor “Lipocalin 2 inhibitor,” “liver fibrosis,” “administration,” “prevention,” “treatment,” etc. may be within the aforementioned scope.
  • the present invention provides a use of the pharmaceutical composition for preventing or treating liver fibrosis.
  • the present invention provides the use of a lipocalin 2 inhibitor for manufacturing a drug for treating liver fibrosis.
  • the present invention also provides the use of a composition comprising a lipocalin 2 inhibitor for preparing a medicament for treating liver disease.
  • the pharmaceutical composition for preventing or treating liver fibrosis containing the lipocalin 2 inhibitor of the present invention as an active ingredient prevents and treats liver fibrosis by suppressing the induction of liver cells into hepatic stellate cells by suppressing the expression of lipocalin 2. It can be expressed.
  • Figure 1 is a diagram confirming liver fibrosis due to the expression of lipocalin 2 using mice in which liver fibrosis was induced.
  • Figures 1A to 1C show results confirming that liver fibrosis progresses less in SREBP-1c knockout mice compared to the normal mouse control group.
  • Figure 1D shows the results confirming that when lipocalin 2 expression is decreased in a liver fibrosis mouse model, the expression of liver fibrosis-inducing factors is also decreased.
  • Figure 2 is a diagram confirming that liver fibrosis increases when lipocalin 2 is overexpressed in SREBP-1c knockout mice.
  • Figure 3 shows the results confirming that there is a correlation between the expression level of lipocalin 2 and the development stage of liver fibrosis.
  • liver fibrosis induction by CCl 4 (Carbon tetrachloride) administration
  • 12 8-week-old C57BL/6J male mice and 12 SREBP-1c gene knockout transgenic mice were prepared and then divided into 4 groups of 6 mice each, into a CCl 4 administration group and a non-administration group.
  • the breeding room environment is at 23°C and 60 to 70% humidity with a 12:12 hour light/dark cycle (light from 6 am to 6 pm, dark from 6 pm to 6 pm) with free access to water, and mouse facilities free of specific pathogens. Accepted.
  • Liver fibrosis was induced for 5 weeks by administering 2 ml/kg CCl 4 twice a week by intramuscular injection into the legs of normal mice and SREBP-1c gene knockout transgenic mice, and then the degree of liver fibrosis was verified. Mice were anesthetized with isoflurane (Gyeonggi-do Hana Pharmaceutical) and sacrificed at 9 AM during the photoperiod. The present inventors performed all animal experiments at Keimyung University College of Medicine, Daegu, South Korea, according to protocols approved by the Keimyung University Animal Experiment and Use Committee (KM-2022-15R1).
  • mice A total of four groups of mice, each transgenic and normal, administered and not administered CCl 4 for 5 weeks, were sacrificed by anesthetizing with isoflurane, blood was collected, the liver was incised, and the separated liver tissue was placed in formalin. It was fixed and cut to a thickness of 10 ⁇ m using a microtome to create tissue slides.
  • liver fibrosis The morphology of liver tissue and liver fibrosis were confirmed through H&E (hematoxylin & eosin), Masson's trichrome, and Sirius red staining, and tissue staining was performed through an experimental procedure widely known in the art. As a result, it was confirmed that liver fibrosis progressed less in SREBP-1c knockout mice compared to the normal mouse control group (see Figures 1A to 1C).
  • fibrosis-related genes were analyzed to investigate the degree of liver fibrosis induction by CCl 4 administration.
  • qPCR was performed with a CFX96TM real-time PCR system (Bio-Rad Laboratories). mRNA levels were normalized to the expression of ribosomal protein L32 by calculating the delta-delta threshold cycle method. Primer sequences of genes used in qPCR are shown in [Table 1].
  • lipocalin 2 is an important factor in causing liver fibrosis.
  • lipocalin 2 was overexpressed in SREBP-1c knockout mice again and the degree of liver fibrosis was confirmed.
  • SREBP-1c knockout mice were injected with LCN2 adenovirus through the tail vein and then treated with CCl 4 for 5 weeks to induce liver fibrosis.
  • the degree of liver fibrosis was measured using the Sirius Red staining method.
  • total RNA was prepared using liver tissue, and cDNA was synthesized using the iScriptTM cDNA synthesis kit. Primer sequences of genes used in qPCR are shown in [Table 2].
  • mice overexpressing lipocalin 2 had an increased degree of liver fibrosis compared to SREBP-1c knockout mice (see Figure 2A).
  • liver fibrosis-related genes The expression levels of ‘Tgfb1, Col1a1, Col3a1, Col5a2, Col6a1, Mmp2, Mmp9, and Timp1’, mRNAs of liver fibrosis-related genes, were measured (see Figures 2B to 2I). As a result, it was confirmed that the expression level of liver fibrosis-related genes was increased in mice overexpressing lipocalin 2 compared to SREBP-1c knockout mice. This indicates that lipocalin 2 is an important factor in the progression of liver fibrosis.
  • hepatocytes were isolated from normal mice and SREBP-1c gene knockout transgenic mice and incubated with 10% FBS and 1% (v/v) penicillin/streptomycin (Gibco). The cells were cultured in high-glucose DMEM (HyClone) under 5% CO 2 humidified culture conditions and at a temperature of 37°C. Afterwards, the cells were dispensed into a 6 well (2 To measure the expression level of genes, total RNA was prepared by the TriZol procedure (Invitrogen), and cDNA was synthesized using the iScriptTM cDNA synthesis kit. Primer sequences of genes used in qPCR are shown in [Table 3].
  • lipocalin 2 and inflammation-related gene mRNAs ‘F4/80, Tnf- ⁇ , Il-6, and Mcp1’ were measured (see Figures 3A to 3E).
  • the expression levels of lipocalin 2 and inflammation-related genes in primary hepatocytes were decreased in SREBP-1c gene knockout transgenic mice treated with fatty acid compared to normal mice treated with fatty acid (see Figures 3A to 3E).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

A lipocalin 2 Inhibitor of the present invention can exhibit the effects of preventing and treating liver fibrosis by inhibiting the induction of liver cells into hepatic stellate cells through the inhibition of lipocalin 2 expression, and thus a pharmaceutical composition comprising same is expected to be used in therapeutic agents and the like for exhibiting excellent treatment effects on liver fibrosis.

Description

리포칼린 2 억제제를 포함하는 간섬유화 예방 또는 치료용 약학적 조성물 Pharmaceutical composition for preventing or treating liver fibrosis containing a lipocalin 2 inhibitor
본 발명은 리포칼린 2 억제제를 포함하는 간섬유화 예방 또는 치료용 약학적 조성물, 상기 조성물을 포함하는 약학 제제, 이의 용도 및 치료방법에 관한 것이다.The present invention relates to a pharmaceutical composition for preventing or treating liver fibrosis containing a lipocalin 2 inhibitor, a pharmaceutical preparation containing the composition, and a use and treatment method thereof.
간은 소화기계와 전신순환계 사이에 위치함으로써 소화기계로 들어온 생체 외 물질로부터 전신을 방어하는 기능을 수행하고 있는 매우 중요한 장기이다. 일단 생체내로 들어온 생체 외 물질이 간을 통과하는 까닭에 간은 영양소 외에도 많은 독성물질에 대한 노출 위험이 다른 장기보다 많아 그만큼 손상될 확률도 다른 장기에 비해 높다.The liver is a very important organ that is located between the digestive system and the systemic circulatory system and performs the function of defending the entire body from foreign substances that enter the digestive system. Because extracorporeal substances that enter the body pass through the liver, the liver is at greater risk of being exposed to many toxic substances in addition to nutrients than other organs, and the risk of damage is also higher than that of other organs.
간 조직 중에는 영양물질 흡수 및 대사, 저장, 혈장단백질 합성 등과 같은 간의 주요기능을 수행하는 간세포 (hepatocyte), 간 내 대식세포 (macrophage)인 쿠퍼세포 (Kupffer cell), 간 손상 시 결합조직을 과다 합성함으로써 간섬유화를 초래하는 간성상세포 (hepatic stellate cell, lipocyte; HSC) 및 내피 세포(endothelial cell), 오목 세포 (pit cell) 등이 존재한다. 이중 간세포는 간조직을 구성하는 전체 세포의 약 90 %이상을 차지하며, 간의 주요기능을 수행하는 실질 세포 (parenchymal cell)로써 간질환시 간기능 저하는 바로 이 간세포 손상으로 인해 초래되는 것이다.Among liver tissues, hepatocytes perform major liver functions such as absorption and metabolism of nutrients, storage, and plasma protein synthesis, and Kupffer cells, which are intrahepatic macrophages, synthesize connective tissue excessively when liver is damaged. As a result, hepatic stellate cells (lipocytes; HSC), endothelial cells, and pit cells that cause liver fibrosis exist. Among them, hepatocytes account for more than 90% of the total cells that make up liver tissue, and are parenchymal cells that perform the main functions of the liver. Deterioration of liver function during liver disease is caused by damage to these liver cells.
여러 원인에 의한 만성 간 손상은 공통적으로 간섬유화를 초래하게 되며 그 기전을 요약하면 다음과 같다. 여러 원인에 의해 간세포가 손상되고, 쿠퍼 세포가 활성화되어 여러 사이토카인 (cytokines)을 분비하게 되면 이에 의해 간성상세포가 활성화되어 결합조직을 생성한다. 간 손상이 지속되게 되면 손상당한 간세포가 결합조직으로 대치되는 간질 복구가 유발되어 간 조직 내 결합조직 과다축적으로 인한 상처가 형성되고 간세포 손상으로 인해 간기능이 저하되면서 간섬유화 및 간경화가 초래되는 것이다 (Friedman SL et al., J. Hepatol.,38(1), ppS38-53, 2003).Chronic liver damage due to various causes commonly results in liver fibrosis, and the mechanism can be summarized as follows. When liver cells are damaged due to various causes and Kupffer cells are activated and secrete various cytokines, hepatic stellate cells are activated to create connective tissue. If liver damage continues, interstitial repair is triggered in which damaged liver cells are replaced by connective tissue, wounds are formed due to excessive accumulation of connective tissue in the liver tissue, and liver function deteriorates due to liver cell damage, resulting in liver fibrosis and cirrhosis. (Friedman SL et al., J. Hepatol.,38(1), ppS38-53, 2003).
간섬유화 치료제는 간섬유화 시 가장 문제가 되는 과다한 결합조직을 생성하는 간성상세포 (hepatic stellate cell, HSC)를 중심으로 연구되고 있다. 기존에는 간섬유화 치료제의 개발을 위하여 간성상세포 활성억제 또는 결합조직 합성 억제 및 분해 촉진에 초점을 맞추어 연구되어왔다 (Boker K et al., J. Hepatol.,13(3), ppS35-40, 1991 ; Bataller R et al., Semin. Liver Dis., 21, pp437-451, 2001).Liver fibrosis treatments are being studied with a focus on hepatic stellate cells (HSCs), which produce excessive connective tissue, which is the most problematic factor in liver fibrosis. Previously, for the development of treatments for liver fibrosis, research has focused on inhibiting hepatic stellate cell activity or inhibiting connective tissue synthesis and promoting decomposition (Boker K et al., J. Hepatol., 13(3), ppS35-40, 1991 ; Bataller R et al., Semin. Liver Dis., 21, pp437-451, 2001).
리포칼린 2 (Lipocalin 2, LCN2)는 리포칼린 패밀리의 일원으로, 지질 및 여타 소수성 분자와 결합하거나 그들을 운반한다(Flower, D. R. et al. 2000, Biochim Biophys Acta 1482: 9-24). 또한, LCN2는 세포의 아폽토시스 및 생존 모두에서 중요하다는 것이 알려졌고(Nelson, A. M. et al. 2008, J Clin Invest 118: 1468-1478), 배발생(embryogenesis) 중에 신장에서 세포 분화를 유도하는데 중심적인 역할을 하고(Yang, J. et al. 2002, Mol Cell 10: 1045-1056), 신장을 허혈성 손상으로부터 보호한다는 점이 알려져 있다(Mishra, J. et al. 2004, J Am Soc Nephrol 15: 3073-3082). 또한, 다양한 형태의 위장관 손상에서 LCN2는 세포 이동을 촉진함으로써 점막의 재생을 용이하게 함이 알려져 있다(Playford, R. J. et al. 2006, Gastroenterology 131: 809-817). 상기한 바와 같이, LCN2의 다양한 역할에 대한 것이 밝혀져 있으나, LCN2가 간섬유화 유도 물질에 해당함 대해서는 아직까지 밝혀진 바 없으며, 이를 억제하여 간섬유화를 예방 및 치료하는 방법에 대한 연구는 현재까지 보고된 바 없다.Lipocalin 2 (LCN2) is a member of the lipocalin family that binds to and transports lipids and other hydrophobic molecules (Flower, D. R. et al. 2000, Biochim Biophys Acta 1482: 9-24). In addition, LCN2 is known to be important in both apoptosis and survival of cells (Nelson, A. M. et al. 2008, J Clin Invest 118: 1468-1478), and plays a central role in inducing cell differentiation in the kidney during embryogenesis. It is known that it protects the kidney from ischemic damage (Yang, J. et al. 2002, Mol Cell 10: 1045-1056) and protects the kidney from ischemic damage (Mishra, J. et al. 2004, J Am Soc Nephrol 15: 3073-3082 ). In addition, it is known that LCN2 facilitates mucosal regeneration by promoting cell migration in various types of gastrointestinal tract damage (Playford, R. J. et al. 2006, Gastroenterology 131: 809-817). As mentioned above, the various roles of LCN2 have been revealed, but it has not yet been revealed that LCN2 is a liver fibrosis-inducing substance, and research on methods to prevent and treat liver fibrosis by inhibiting it has been reported to date. does not exist.
일 양상은 리포칼린 2 억제제를 유효성분으로 포함하는, 간섬유화 예방 또는 치료용 약학적 조성물을 제공하는 것이다.One aspect is to provide a pharmaceutical composition for preventing or treating liver fibrosis, which includes a lipocalin 2 inhibitor as an active ingredient.
다른 양상은 상기 조성물을 포함하는 간섬유화 예방 또는 치료용 약학 제제를 제공하는 것이다.Another aspect is to provide a pharmaceutical preparation for preventing or treating liver fibrosis comprising the composition.
다른 양상은 리포칼린 2 억제제를 포함하는, 간섬유화 예방 또는 개선용 건강기능식품 조성물을 제공하는 것이다.Another aspect is to provide a health functional food composition for preventing or improving liver fibrosis, including a lipocalin 2 inhibitor.
다른 양상은 리포칼린 2 억제제를 유효성분으로 포함하는 약학적 조성물의, 간섬유화 예방 또는 치료용도를 제공하는 것이다.Another aspect is to provide a pharmaceutical composition containing a lipocalin 2 inhibitor as an active ingredient for use in preventing or treating liver fibrosis.
다른 양상은 리포칼린 2 억제제를 유효성분으로 포함하는 약학적 조성물을 이용한, 간섬유화 예방 또는 치료방법을 제공하는 것이다.Another aspect is to provide a method for preventing or treating liver fibrosis using a pharmaceutical composition containing a lipocalin 2 inhibitor as an active ingredient.
본 발명자들은 리포칼린 2가 간 세포를 간성상세포로 유도하는 인자임을 확인하였으며, 리포칼린 2의 발현을 억제함으로 인해, 간성상세포 발현을 억제하여 간섬유화 등의 간 질환의 예방 및 치료 효과를 나타냄을 확인하였다.The present inventors confirmed that lipocalin 2 is a factor that induces liver cells into hepatic stellate cells, and by suppressing the expression of lipocalin 2, it suppresses the expression of hepatic stellate cells, showing the effect of preventing and treating liver diseases such as liver fibrosis. was confirmed.
이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.
본 발명은 리포칼린 2 억제제를 유효성분으로 포함하는, 간섬유화 예방 또는 치료용 약학적 조성물을 제공한다.The present invention provides a pharmaceutical composition for preventing or treating liver fibrosis, comprising a lipocalin 2 inhibitor as an active ingredient.
본 발명에서는 SREBP-1c 유전자 넉아웃 마우스에서 리포칼린 2의 발현이 감소함을 확인하였으며, 이에 따라 정상 마우스에 비해 간섬유화 진행이 감소됨을 확인하였다. 또한, 리포칼린 2를 다시 과발현시키는 경우 간섬유화가 다시 진행됨을 확인하였으며, 이를 통해 리포칼린 2가 간섬유화 유도 인자임을 확인하였다.In the present invention, it was confirmed that the expression of lipocalin 2 was reduced in SREBP-1c gene knockout mice, and accordingly, the progression of liver fibrosis was confirmed to be reduced compared to normal mice. In addition, it was confirmed that when lipocalin 2 was overexpressed again, liver fibrosis progressed again, and through this, lipocalin 2 was confirmed to be a factor inducing liver fibrosis.
따라서, 본 발명에 따른 리포칼린 2 (lipocalin-2, LCN2) 억제제는 간섬유화 예방 및 치료에 유용하게 사용될 수 있다.Therefore, the lipocalin-2 (LCN2) inhibitor according to the present invention can be usefully used to prevent and treat liver fibrosis.
본 발명의 일 실시예에서, 상기 LCN2의 억제제는 LCN2 억제 목적을 달성할 수 있는 물질을 제한 없이 포함할 수 있다. 일 구체예에서, 상기 LCN2 억제제는 LCN2의 발현 또는 활성 억제제 또는 LCN2 수용체 길항제일 수 있다.In one embodiment of the present invention, the LCN2 inhibitor may include, without limitation, substances capable of achieving the purpose of LCN2 inhibition. In one embodiment, the LCN2 inhibitor may be an expression or activity inhibitor of LCN2 or an LCN2 receptor antagonist.
본 발명의 일 실시예에서, 상기 리포칼린 2 억제제는 리포칼린 2 mRNA에 상보적으로 결합하는 안티센스 뉴클레오티드, 앱타머, 작은 간섭 RNA (siRNA), 짧은 헤어핀 RNA (shRNA), 마이크로 RNA (miRNA) 및 RNA 간섭(RNAi)으로 이루어진 군으로부터 선택된 하나 이상일 수 있다. 이 경우, 리포칼린 2 억제제는 리포칼린 2 Mrna에 특이적으로 결합함으로써 리포칼린 2의 발현을 억제할 수 있다.In one embodiment of the present invention, the lipocalin 2 inhibitor is an antisense nucleotide, aptamer, small interfering RNA (siRNA), short hairpin RNA (shRNA), micro RNA (miRNA) and It may be one or more selected from the group consisting of RNA interference (RNAi). In this case, the lipocalin 2 inhibitor can inhibit the expression of lipocalin 2 by specifically binding to lipocalin 2 mRNA.
본 발명에서 "발현 억제"에는 유전자 전사의 억제 및 단백질로의 번역 억제를 포함하는 것을 의미한다. 또한, 유전자 발현이 완전히 정지된 것뿐만 아니라 발현이 감소된 것도 포함된다. 유전자의 발현을 억제하는 방법으로는 안티센스 분자를 이용하는 것이 가장 보편적이다. 안티센스 분자가 표적 유전자의 발현을 억제하는 작용으로는 삼중쇄 형성에 의한 전사개시 저해, RNA 폴리머라제에 의해 국부적인 개방형 고리 (open loop) 구조가 만들어진 부위에서 하이브리드 형성에 의한 전사 억제, 합성이 진행되고 있는 RNA에서 하이브리드 형성에 의한 전사 저해, 인트론과 엑손과의 접합점에서 하이브리드 형성에 의한 스플라이싱 억제, 스플라이소좀 형성 부위에서 하이브리드 형성에 의한 스플라이싱 억제, mRNA와의 하이브리드 형성에 의한 핵으로부터 세포질로의 이행 억제, 번역 개시인자 결합 부위에서 하이브리드 형성에 의한 번역개시 억제 등이 있다. 이들은 전사, 스플라이싱 또는 번역 과정을 저해하여 표적 유전자의 발현을 억제한다.In the present invention, “expression inhibition” means inhibition of gene transcription and inhibition of translation into protein. In addition, it includes not only completely stopped gene expression, but also reduced gene expression. The most common method of suppressing gene expression is to use antisense molecules. The actions of antisense molecules to suppress the expression of target genes include inhibition of transcription initiation by triple strand formation, inhibition of transcription by hybrid formation at the site where a local open loop structure is created by RNA polymerase, and progression of synthesis. Inhibition of transcription by hybrid formation in the RNA being formed, inhibition of splicing by hybrid formation at the junction between introns and exons, inhibition of splicing by hybrid formation at the spliceosome formation site, and inhibition of splicing by hybrid formation with mRNA. These include inhibition of migration to the cytoplasm and inhibition of translation initiation by hybrid formation at the translation initiation factor binding site. They inhibit the expression of target genes by inhibiting transcription, splicing or translation processes.
상기 안티센스 분자로는 3중제, 리보자임(ribozyme), RNAi, 또는 안티센스 핵산 등이 포함된다. 3중제는 이중나선 DNA 주변을 감아 3 본쇄 나선을 형성하도록 함으로써 전사 개시가 억제되도록 한다(Maher et al.,Antisense Res. and Dev., 1(3):227, 1991; Helene, C., Anticancer Drug Design, 6(6):569, 1991). 리보자임은 1 본쇄 RNA를 특이적으로 절단하는 능력을 보유한 RNA 효소이다. 리보자임은 표적 RNA 분자 내 특정 뉴클레오티드 서열을 인식하여 부위 특이적으로 절단시킴으로써 표적 유전자의 단백질 발현을 억제한다(Cech, J.Amer. Med. Assn., 260:3030, 1998; Sarver et al., Science 247:1222-1225, 1990). RNAi(RNA interference)는 염기서열 특이적으로 작용하는 헤어핀 형태의 소분자의 RNA를 사용하여 전사 수준 또는 전사 후 수준에서 유전자 발현을 억제시키는 방법이다(Mette et al., EMBO J., 19: 5194-5201, 2000). 상기 RNAi 방법에 사용되는 소분자 RNA는 표적 유전자와 상동성을 가지는 이중가닥 RNA 분자이다. 상기에서 RNA 분자를 제조하는 방법으로는 공지된 화학적 합성 방법 및 효소적 방법을 사용할 수 있다. 예를 들면, RNA 분자의 화학적 합성은 문헌에 개시되어 있는 방법을 사용할 수 있으며(Verma and Eckstein, Annu. Rev. Biochem. 67, 99-134, 1999), RNA 분자의 효소적 합성은 T7, T3 및 SP6 RNA 폴리머라제와 같은 파아지 RNA 폴리머라제를 이용하는 방법이 문헌에 개시되어 있다(Milligan and Uhlenbeck, Methods Enzymol. 180:51-62, 1989). 안티센스 핵산은 표적 mRNA 분자와 적어도 일부분이 상보적인 DNA 또는 RNA 분자를 말한다(Weintraub, Scientific American, 262:40, 1990). 세포내에서, 안티센스 핵산은 이에 상응하는 mRNA와 혼성화되어 2본쇄 분자를 형성함으로써 표적 유전자의 mRNA 해독을 저해하여 단백질 발현을 억제한다(Marcus-Sakura, Anal. Biochem., 172:289, 1988). 상기 안티센스 핵산은 바람직하게는 올리고뉴클레오타이드 형태로서 당업계에 공지된 임의의 적합한 방법에 의해 제조할 수 있다. 상기 안티센스 올리고뉴클레오타이드는 화학 합성법, 예를 들어 문헌(Tetrahedron Lett., 1991, 32, 30005-30008)에 기재된 바와 같이 아세토니트릴 중에서 테트라에틸티우람 디술파이드로 황화시키는 포스포아미다이트 화학과 같은 방법에 의해 매우 용이하게 제조할 수 있다.The antisense molecules include triplicates, ribozymes, RNAi, or antisense nucleic acids. Triplexer wraps around double-stranded DNA to form a three-stranded helix, thereby inhibiting transcription initiation (Maher et al., Antisense Res. and Dev., 1(3):227, 1991; Helene, C., Anticancer Drug Design, 6(6):569, 1991). A ribozyme is an RNA enzyme that has the ability to specifically cleave single-stranded RNA. The ribozyme recognizes a specific nucleotide sequence within the target RNA molecule and cleaves it site-specifically, thereby suppressing protein expression of the target gene (Cech, J.Amer. Med. Assn., 260:3030, 1998; Sarver et al., Science 247:1222-1225, 1990). RNA interference (RNAi) is a method of suppressing gene expression at the transcriptional or post-transcriptional level using hairpin-shaped small molecule RNA that acts specifically on the base sequence (Mette et al., EMBO J., 19: 5194- 5201, 2000). The small molecule RNA used in the RNAi method is a double-stranded RNA molecule that has homology to the target gene. As a method for producing RNA molecules above, known chemical synthesis methods and enzymatic methods can be used. For example, chemical synthesis of RNA molecules can be done using methods disclosed in the literature (Verma and Eckstein, Annu. Rev. Biochem. 67, 99-134, 1999), and enzymatic synthesis of RNA molecules can be done using T7, T3. and methods using phage RNA polymerases such as SP6 RNA polymerase have been disclosed in the literature (Milligan and Uhlenbeck, Methods Enzymol. 180:51-62, 1989). Antisense nucleic acid refers to a DNA or RNA molecule that is at least partially complementary to a target mRNA molecule (Weintraub, Scientific American, 262:40, 1990). In the cell, antisense nucleic acids hybridize with the corresponding mRNA to form a double-stranded molecule, thereby inhibiting mRNA translation of the target gene and suppressing protein expression (Marcus-Sakura, Anal. Biochem., 172:289, 1988). The antisense nucleic acid is preferably in the form of an oligonucleotide and can be prepared by any suitable method known in the art. The antisense oligonucleotides can be synthesized by chemical synthesis, for example, by phosphoamidite chemistry by sulfurization with tetraethylthiuram disulfide in acetonitrile as described in Tetrahedron Lett., 1991, 32, 30005-30008. It can be manufactured very easily.
본 발명의 리포칼린 2에 대한 siRNA는 LCN2 단백질을 암호화하는 유전자의 mRNA의 염기서열 내에서 선택되는 15 내지 30머(mer)의 센스 서열 및 상기 센스 서열에 상보적으로 결합하는 안티센스 서열로 구성되며, 이때, 상기 센스서열은 특별히 이에 제한되는 것은 아니나, 25개의 염기로 구성되는 것이 바람직하다.The siRNA against lipocalin 2 of the present invention consists of a sense sequence of 15 to 30 mers selected from the base sequence of the mRNA of the gene encoding the LCN2 protein and an antisense sequence that binds complementary to the sense sequence. , At this time, the sense sequence is not particularly limited thereto, but is preferably composed of 25 bases.
본 발명의 일 실시예에서, 상기 리포칼린 2 억제제는 리포칼린 2 단백질에 특이적으로 결합하는 화합물, 펩티드, 펩티드 모방체, 기질 유사체, 앱타머 및 항체로 구성된 군으로부터 선택된 하나 이상일 수 있다. 이 경우, 리포칼린 2 억제제는 LCN2 단백질과 특이적으로 결합함으로써 LCN2의 활성을 억제할 수 있다.In one embodiment of the present invention, the lipocalin 2 inhibitor may be one or more selected from the group consisting of compounds that specifically bind to the lipocalin 2 protein, peptides, peptide mimetics, substrate analogs, aptamers, and antibodies. In this case, the lipocalin 2 inhibitor can inhibit the activity of LCN2 by specifically binding to the LCN2 protein.
본 발명의 일 실시예에서, 상기 리포칼린 2 억제제는 리포칼린 2 수용체 (24p3R) 단백질에 특이적으로 결합하는 화합물, 펩티드, 펩티드 모방체 및 기질 유사체로 구성된 군으로부터 선택된 하나 이상일 수 있다. 이 경우, 리포칼린 2 억제제는 리포칼린 2 수용체 단백질과 특이적으로 결합함으로써 리포칼린 2와 길항적으로 작용하여, 리포칼린 2의 활성을 억제할 수 있다.In one embodiment of the present invention, the lipocalin 2 inhibitor may be one or more selected from the group consisting of compounds, peptides, peptide mimetics, and substrate analogs that specifically bind to the lipocalin 2 receptor (24p3R) protein. In this case, the lipocalin 2 inhibitor can act antagonistically with lipocalin 2 by specifically binding to the lipocalin 2 receptor protein, thereby inhibiting the activity of lipocalin 2.
본 명세서에서 상기 펩티드 모방체(Peptide mimetics)는 리포칼린 2 단백질 발현 또는 리포칼린 2의 결합 도메인에 길항적으로 작용하여 LCN2 단백질의 활성을 억제하는 것일 수 있다. 펩티드 모방체는 펩티드 또는 비펩티드일 수 있고, psi 결합과 같은, 비펩티드 결합에 의해 결합된 아미노산으로 구성될 수 있다. 또한, "구조적으로 강제된(conformationally constrained)" 펩티드, 사이클릭 모방체(cyclic mimetics), 적어도 하나의 엑소사이클릭 도메인(exocyclic domain), 결합 부분(결합 아미노산) 및 활성 부위를 포함하는 사이클릭 모방체일 수 있다. 일 구체예에서, 상기 펩티드 모방체는 LCN2 단백질의 이차구조 특성과 유사하게 구조화되고 항체 또는 수용성 수용체와 같은 거대한 분자의 억제 특성을 모방할 수 있으며, 천연의 길항제와 동등한 효과로 작용할 수 있는 신규한 소분자일 수 있다.In the present specification, the peptide mimetics may inhibit the activity of LCN2 protein by acting antagonistically on lipocalin 2 protein expression or the binding domain of lipocalin 2. Peptidomimetics may be peptides or non-peptides and may be composed of amino acids linked by non-peptide bonds, such as psi bonds. Additionally, “conformationally constrained” peptides, cyclic mimetics, cyclic mimetics comprising at least one exocyclic domain, a binding moiety (binding amino acid) and an active site. It can be a sieve. In one embodiment, the peptide mimetic is structured similarly to the secondary structure characteristics of the LCN2 protein, can mimic the inhibitory properties of large molecules such as antibodies or soluble receptors, and is a novel antibody that can act with an effect equivalent to that of a natural antagonist. It may be a small molecule.
본 명세서에서 상기 앱타머(aptamer)는 단일 사슬 DNA 또는 RNA 분자로서, SELEX(systematic evolution of ligands by exponential enrichment)라 불리는 올리고뉴클레오티드 (oligonucleotide) 라이브러리를 이용한 진화적인 방법에 의해 특정 화학 분자나 생물학적 분자에 높은 친화력과 선별력을 갖고 결합하는 올리고머를 분리하여 수득할 수 있다. 앱타머는 표적에 특이적으로 결합하고 표적의 활성을 조정할 수 있는데, 예컨대, 결합을 통하여 표적의 기능을 차단할 수 있다.In the present specification, the aptamer is a single-stranded DNA or RNA molecule that can be converted to a specific chemical or biological molecule by an evolutionary method using an oligonucleotide library called SELEX (systematic evolution of ligands by exponential enrichment). It can be obtained by separating oligomers that bind with high affinity and selectivity. Aptamers can specifically bind to a target and modulate the target's activity, for example, they can block the target's function through binding.
본 발명에서 항-리포칼린 2 항체는 다클론 항체 또는 단클론 항체일 수 있다. 본 발명의 항체는 LCN2 단백질을 항원으로 하여 면역학 분야에서 널리 알려져 있는 통상의 방법으로 제조할 수 있다. 본 발명의 일 실시예에서, 상기 리포칼린 2 항체는 LCN2의 활성을 중화시킬 수 있는 항-LCN2 항체일 수 있다.In the present invention, the anti-lipocalin 2 antibody may be a polyclonal antibody or a monoclonal antibody. The antibody of the present invention can be produced by a conventional method widely known in the field of immunology using LCN2 protein as an antigen. In one embodiment of the present invention, the lipocalin 2 antibody may be an anti-LCN2 antibody capable of neutralizing the activity of LCN2.
다클론 항체는 말, 소, 염소, 양, 개, 닭, 칠면조, 토끼, 마우스 또는 랫트와 같은 여러 온혈 동물로부터 당해 분야의 통상적인 기술 중의 하나를 사용할 수 있다. 즉, 항원을 복막 내, 근육 내, 안내 또는 피하 주사를 통해 동물을 면역시킨다. 상기 항원에 대한 면역성은 보조제, 예를 들어 프로인트(Freund)의 완전 보조제 또는 불완전 보조제를 사용하여 증가시킬 수 있다. 부스터(booster) 면역처리에 따른 다음, 혈청의 소형 샘플을 수집하고 목적하는 항원에 대한 반응성을 시험한다. 동물의 역가가 일단 항원에 대한 이의 반응성의 관점으로 정체 상태에 도달하면, 다량의 다클론 면역혈청을 1주 마다의 출혈 또는 동물을 방혈시킴으로써 수득할 수 있다. 단클론항체도 공지된 기술을 사용하여 생성시킬 수 있다(Kennettm McKearn and Bechtol(eds.), Monoclonal Antibodies, Hybridomas; A New Dimension in Biological Analyses, Plenum Press, 1980). 단클론 항체는 LCN2 단백질을 면역원으로 하여 동물을 면역화시키고, 면역화된 동물의 비장세포를 골수종 세포와 융합하여 하이브리도마를 생성하고, LCN2 단백질을 선택적으로 인식하는 하이브리도마를 선별하며, 선별한 하이브리도마를 배양하고, 하이브리도마의 배양액으로부터 항체를 분리함으로써 제조할 수 있다. 또한, 본 발명의 단클론 항체는 LCN2 단백질을 선택적으로 인식하는 항-LCN2 항체를 생산하는 상기의 하이브리도마를 동물에 주입하고, 주입 후 일정기간이 지난 다음 회수한 동물의 복수로부터 분리함으로써 제조할 수 있다.Polyclonal antibodies can be prepared from various warm-blooded animals such as horses, cattle, goats, sheep, dogs, chickens, turkeys, rabbits, mice, or rats using any of the techniques conventional in the art. That is, the animal is immunized through intraperitoneal, intramuscular, intraocular, or subcutaneous injection of the antigen. Immunity to the antigen can be increased using adjuvants, such as Freund's complete adjuvant or incomplete adjuvant. Following booster immunization, a small sample of serum is collected and tested for reactivity to the antigen of interest. Once the titer of the animal has reached a plateau in terms of its reactivity to antigen, large quantities of polyclonal immune serum can be obtained by weekly bleeding or exsanguination of the animal. Monoclonal antibodies can also be produced using known techniques (Kennettm McKearn and Bechtol (eds.), Monoclonal Antibodies, Hybridomas; A New Dimension in Biological Analyses, Plenum Press, 1980). The monoclonal antibody immunizes animals using the LCN2 protein as an immunogen, creates hybridomas by fusing the spleen cells of the immunized animal with myeloma cells, selects hybridomas that selectively recognize the LCN2 protein, and selects the selected high It can be produced by culturing hybridomas and isolating antibodies from the hybridoma culture medium. In addition, the monoclonal antibody of the present invention can be prepared by injecting the above hybridoma that produces an anti-LCN2 antibody that selectively recognizes the LCN2 protein into an animal and isolating it from the ascites of the animal recovered after a certain period of time after the injection. You can.
본 발명의 일 실시예에서, 상기 리포칼린 2 억제제는 리포칼린 2의 간 세포의 간성상세포로의 유도를 억제하는 것일 수 있다.In one embodiment of the present invention, the lipocalin 2 inhibitor may inhibit the induction of lipocalin 2 from liver cells to hepatic stellate cells.
본 명세서에서 "간섬유증"은 간경변증(liver cirrhosis), 간신증후군(hepatorenal syndrome), 간자반병(peliosis hepatis), 대사성 간질환, 만성 간질환, B형 간염 바이러스 감염, C형 간염 바이러스 감염. D형 간염 바이러스 감염, 주혈흡충증(Schistosomiasis), 알콜성 간질환, 비알콜성 지방간염, 당뇨, 단백질 결핍증, 관상동맥질환, 자가면역 간염, 알파-1 항트립신 결핍증(α-1-Antitrypsin deficiency) 및 일차성 담즙성 간경화증으로 이루어지는 군으로부터 선택되는 1종일 수 있으나, 이에 제한되는 것은 아니다.In this specification, “liver fibrosis” refers to liver cirrhosis, hepatorenal syndrome, peliosis hepatis, metabolic liver disease, chronic liver disease, hepatitis B virus infection, and hepatitis C virus infection. Hepatitis D virus infection, schistosomiasis, alcoholic liver disease, non-alcoholic steatohepatitis, diabetes, protein deficiency, coronary artery disease, autoimmune hepatitis, alpha-1-antitrypsin deficiency and primary biliary cirrhosis, but is not limited thereto.
본 발명에서 사용되는 용어, “예방”이란 본 발명에 따른 약학적 조성물에 의해 골 질환을 억제시키거나 발병을 지연시키는 모든 행위를 의미한다.The term “prevention” used in the present invention refers to all actions that suppress or delay the onset of bone disease by the pharmaceutical composition according to the present invention.
본 발명에서 사용되는 용어, “치료”란 본 발명에 따른 약학적 조성물에 의해 골 질환에 대한 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미한다.As used in the present invention, the term “treatment” refers to any action in which the symptoms of a bone disease are improved or beneficially changed by the pharmaceutical composition according to the present invention.
상기 약학적 조성물은 섬유증(pro-fibrotic) 관련(fibrosis-related) 인자의 발현을 감소시킬 수 있는데, 상기 섬유증 관련 인자는 종래 섬유증에 관여하는 인자로 알려진 인자를 말하며. 예를 들면, 전환성장인자 베타(transforming Growth Factor-β, TGF-β), 알파 평활근 액틴(α-smooth muscle actin, α-SMA), 메탈로펩티다제 억제제 1(tissue inhibitor matrix metalloproteinase-1, TIMP-1), 콜라겐 1형 알파 1(collagen type I alpha 1 chain, COL1A1), 콜라겐 3형 알파 1(collagen type III alpha 1 chain, COL3A1), 콜라겐 5형 알파 2(collagen type V alpha 2 chain, COL5A2), 콜라겐 6형 알파 1(collagen type VI alpha 1 chain, COL6A1), 기질 금속단백질 분해효소 2(matrix metallopeptidase 2, MMP2) 또는 기질 금속단백질 분해효소 9(matrix metallopeptidase 9, MMP9)일 수 있다.The pharmaceutical composition can reduce the expression of pro-fibrotic (fibrosis-related) factors, which refer to factors conventionally known to be involved in fibrosis. For example, transforming growth factor-β (TGF-β), alpha smooth muscle actin (α-SMA), tissue inhibitor matrix metalloproteinase-1 (tissue inhibitor matrix metalloproteinase-1), TIMP-1), collagen type I alpha 1 chain, COL1A1, collagen type III alpha 1 chain, COL3A1, collagen type V alpha 2 chain, It may be COL5A2), collagen type VI alpha 1 chain (COL6A1), matrix metallopeptidase 2 (MMP2), or matrix metallopeptidase 9 (MMP9).
본 발명의 약학적 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구 투여(예를 들어, 정맥 내, 피하, 복강 내, 비강 내, 흡입 또는 국소에 적용)할 수 있으며, 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 시간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다.The pharmaceutical composition of the present invention can be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally, intranasally, inhaled, or applied topically) according to the desired method, and the dosage depends on the patient's condition. It varies depending on body weight, disease severity, drug type, administration route and time, but may be appropriately selected by a person skilled in the art.
본 발명의 약학적 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에 있어서 “약학적으로 유효한 양”은 의학적 치료 또는 진단에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료 또는 진단하기에 충분한 양을 의미하며, 유효용량 수준은 환자의 질환 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명에 다른 약학적 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. In the present invention, “pharmaceutically effective amount” means an amount sufficient to treat or diagnose a disease with a reasonable benefit/risk ratio applicable to medical treatment or diagnosis, and the effective dose level is determined by the type of disease, severity, and drug of the patient. It can be determined based on factors including activity, sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field. The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. Considering all of the above factors, it is important to administer an amount that can achieve maximum effect with the minimum amount without side effects, and this can be easily determined by a person skilled in the art.
구체적으로 본 발명의 약학적 조성물의 유효량은 환자의 연령, 성별, 상태, 체중, 체내에 활성 성분의 흡수도, 불활성률 및 배설속도, 질병종류, 병용되는 약물에 따라 달라질 수 있다. 또한, 그 주기에 있어서 매일 또는 격일 투여하거나, 1일 1 내지 3회로 나누어 투여할 수 있다. 그러나 투여 경로, 비만의 중증도, 성별, 체중, 연령 등에 따라서 증감 될 수 있으므로 상기 투여량이 어떠한 방법으로도 본 발명의 범위를 한정하는 것은 아니다.Specifically, the effective amount of the pharmaceutical composition of the present invention may vary depending on the patient's age, gender, condition, body weight, absorption, inactivation rate and excretion rate of the active ingredient in the body, type of disease, and drug used in combination. In addition, in the cycle, it can be administered every day or every other day, or divided into 1 to 3 times a day. However, since it may increase or decrease depending on the route of administration, severity of obesity, gender, weight, age, etc., the above dosage does not limit the scope of the present invention in any way.
본 발명의 일 실시예에서, 상기 리포칼린 2 억제제는 상기 약학적 조성물에 0.1 ㎍ 내지 3.0 ㎍, 0.1 ㎍ 내지 2.5㎍, 0.1 ㎍ 내지 2.0㎍, 0.15 ㎍ 내지 2.0㎍, 0.2 ㎍ 내지 2.0㎍, 0.25 ㎍ 내지 2.0㎍, 0.25 ㎍ 내지 1.5㎍ 또는 0.25 ㎍ 내지 1.0㎍으로 포함될 수 있다.In one embodiment of the present invention, the lipocalin 2 inhibitor is added to the pharmaceutical composition in an amount of 0.1 ㎍ to 3.0 ㎍, 0.1 ㎍ to 2.5 ㎍, 0.1 ㎍ to 2.0 ㎍, 0.15 ㎍ to 2.0 ㎍, 0.2 ㎍ to 2.0 ㎍, 0.25 ㎍ It may be included in ㎍ to 2.0 ㎍, 0.25 ㎍ to 1.5 ㎍ or 0.25 ㎍ to 1.0 ㎍.
상기 리포칼린 2 억제제가 조성물로서 투여되는 경우, 적절한 투여 형태를 제공하도록 적합한 양의 약학적으로 허용되는 비히클 또는 담체와 함께 제형화될 수 있다.When the lipocalin 2 inhibitor is administered as a composition, it may be formulated with an appropriate amount of a pharmaceutically acceptable vehicle or carrier to provide an appropriate dosage form.
한편, 상기 조성물은 약학적 조성물의 제조에 사용되는 담체, 부형제 및 희석제를 더 포함할 수 있다.Meanwhile, the composition may further include a carrier, excipient, and diluent used in the preparation of the pharmaceutical composition.
상기 담체는 통상적으로 이용되는 것으로서, 식염수, 멸균수, 링거액, 완충 식염수, 사이클로덱스트린, 덱스트로즈 용액, 말토덱스트린 용액, 글리세롤, 에탄올, 리포좀 등을 포함하지만 이에 한정되지 않으며, 필요에 따라 항산화제, 완충액 등 다른 통상의 첨가제를 더 포함할 수 있다.The carrier is commonly used and includes, but is not limited to, saline solution, sterilized water, Ringer's solution, buffered saline solution, cyclodextrin, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome, etc., and if necessary, antioxidant. , and other common additives such as buffer solutions may be further included.
또한 부형제, 희석제, 분산제, 계면활성제, 결합제, 윤활제 등을 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있다.In addition, excipients, diluents, dispersants, surfactants, binders, lubricants, etc. can be additionally added to formulate injectable formulations such as aqueous solutions, suspensions, emulsions, etc., pills, capsules, granules, or tablets.
상기 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유를 들 수 있으나, 이에 제한되는 것은 아니다.The excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, Examples include, but are not limited to, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil.
적합한 약학적으로 허용되는 담체 및 제제화에 관해서는 레밍턴의 문헌에 개시되어 있는 방법을 이용하여 각 성분에 따라 바람직하게 제제화할 수 있다. 본 발명의 약학적 조성물은 제형에 특별한 제한은 없으나 주사제형, 주입제형, 분무제형, 흡입제형 또는 피부 외용제 등으로 제제화할 수 있다.Regarding suitable pharmaceutically acceptable carriers and formulations, the formulations can be preferably formulated according to each ingredient using the method disclosed in Remington's literature. The pharmaceutical composition of the present invention is not particularly limited in formulation, but may be formulated as an injection formulation, an injection formulation, a spray formulation, an inhalation formulation, or an external application for the skin.
또한, 상기 조성물은 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제제화 하여 사용할 수 있다.In addition, the composition can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, and sterile injectable solutions.
경구 투여를 위한 고형제제는 정제, 환제, 산제, 과립제, 캡슐제 등이 사용될 수 있고, 상기 고형제제는 상기 텍토리게닌과 이의 분획물들에 적어도 하나 이상의 부형제, 예컨대, 전분, 칼슘카보네이트, 수크로스, 락토오스, 또는 젤라틴 등을 혼합하여 조제할 수 있다. 또한, 상기 부형제 이외에 마그네슘 스티레이트, 탈크 같은 윤활제가 사용될 수 있다.Solid preparations for oral administration can be tablets, pills, powders, granules, capsules, etc., and the solid preparations include the tectorigenin and its fractions with at least one excipient, such as starch, calcium carbonate, and sucrose. It can be prepared by mixing , lactose, or gelatin. Additionally, in addition to the above excipients, lubricants such as magnesium styrate and talc may be used.
경구 투여를 위한 액상 제제는 현탁제, 내용액제, 유제, 시럽제 등이 사용될 수 있고, 단순희석제인 물, 리퀴드 파라핀 외에 여러 가지 부형제, 예컨대 습윤제, 감미제, 방향제, 보존제 등이 사용될 수 있다.Liquid preparations for oral administration may include suspensions, oral solutions, emulsions, and syrups. In addition to simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be used.
비경구 투여를 위한 제제는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 사용될 수 있다. 상기 비수성용제, 현탁제는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르가 사용될 수 있다. 상기 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴이 사용될 수 있다.Preparations for parenteral administration can be sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. The non-aqueous solvent or suspension may be propylene glycol, polyethylene glycol, vegetable oil such as olive oil, or injectable ester such as ethyl oleate. As a base for the suppository, witepsol, macrogol, tween 61, cacao, laurel, and glycerogenatin can be used.
또한, 본 발명은 리포칼린 2 억제제를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는, 간섬유화 예방 또는 치료용 약학적 조성물을 제공한다.Additionally, the present invention provides a pharmaceutical composition for preventing or treating liver fibrosis, comprising a polynucleotide encoding a lipocalin 2 inhibitor as an active ingredient.
본 발명의 일 실시예에서, 상기 리포칼린 2 억제제를 암호화하는 폴리뉴클레오티드는 DNA 또는 RNA를 포함할 수 있다.In one embodiment of the present invention, the polynucleotide encoding the lipocalin 2 inhibitor may include DNA or RNA.
여기서 상기 폴리뉴클레오티드는 플라스미드 또는 바이러스 벡터와 같은 발현 벡터 내로 공지의 방법에 의해 도입시킨 후 상기 발현 벡터를 당업계에 공지된 다양한 방법으로 감염(infection) 또는 형질도입(transduction)에 의해 발현형으로 표적 세포 내에 도입시킬 수 있다.Here, the polynucleotide is introduced into an expression vector such as a plasmid or a viral vector by a known method, and then the expression vector is targeted by infection or transduction by various methods known in the art. It can be introduced into cells.
플라스미드 발현 벡터는 사람에게 사용할 수 있는 FDA의 승인된 유전자 전달방법으로 사람 세포에 직접적으로 플라스미드 DNA를 전달하는 방법이다(Nabel, E. G., et al., Science, 249:1285-1288, 1990). 플라스미드 DNA는 바이러스 벡터와는 달리 균질하게 정제될 수 있는 장점이 있다. 본 발명에서 사용할 수 있는 플라스미드 발현 벡터로는 당업계에 공지된 포유동물 발현 플라스미드를 사용할 수 있다. 예를 들면, 이에 한정되지는 않으나 pRK5(유럽특허 제307,247호), pSV16B(국제특허공개 제91/08291호) 및 pVL1392(PharMingen) 등이 대표적이다.The plasmid expression vector is an FDA-approved gene delivery method for use in humans and is a method of delivering plasmid DNA directly to human cells (Nabel, E. G., et al., Science, 249:1285-1288, 1990). Unlike viral vectors, plasmid DNA has the advantage of being able to be purified homogeneously. As a plasmid expression vector that can be used in the present invention, a mammalian expression plasmid known in the art can be used. For example, but not limited to this, pRK5 (European Patent No. 307,247), pSV16B (International Patent Publication No. 91/08291), and pVL1392 (PharMingen) are representative examples.
본 발명에 따른 폴리뉴클레오티드를 포함하는 플라스미드 발현 벡터(plasmid expression vector)는 당업계에 공지된 방법, 예를 들어 이에 한정되지는 않으나, 일시적 형질감염(transient transfection), 미세주사, 형질도입 (transduction), 세포융합, 칼슘 포스페이트 침전법, 리포좀 매개된 형질감염(liposome-mediated transfection), DEAE 덱스트란-매개된 형질감염(DEAE Dextran- mediated transfection), 폴리브렌-매개된 형질감염(polybrene-mediated trans fection), 전기침공법(electropora tion), 유전자 건(gene gun) 및 세포 내로 DNA를 유입시키기 위한 다른 공지의 방법에 의해 세포 내로 도입할 수 있다.The plasmid expression vector containing the polynucleotide according to the present invention can be used by methods known in the art, such as, but not limited to, transient transfection, microinjection, and transduction. , cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE Dextran-mediated transfection, polybrene-mediated transfection ), electroporation, gene gun, and other known methods for introducing DNA into cells.
상기 리포칼린 2 억제제를 발현시킬 수 있는 발현 벡터는 공지의 방법에 의해 투여될 수 있다. 예를 들면, 국소적으로 비경구, 경구, 비강, 정맥, 근육 내, 피하 내 또는 다른 적절한 수단에 의해 투여될 수 있다.An expression vector capable of expressing the lipocalin 2 inhibitor can be administered by a known method. For example, it can be administered topically parenterally, orally, intranasally, intravenously, intramuscularly, subcutaneously, or by other suitable means.
따라서 본 발명은 리포칼린 2 억제제를 암호화하는 폴리뉴클레오티드를 포함하는 발현벡터를 유효성분으로 함유하는 간섬유화 예방 또는 치료용 약학적 조성물을 제공할 수 있다.Therefore, the present invention can provide a pharmaceutical composition for preventing or treating liver fibrosis, which contains an expression vector containing a polynucleotide encoding a lipocalin 2 inhibitor as an active ingredient.
또한, 본 발명은 상기 조성물을 포함하는, 간섬유화 예방 또는 치료용 약학 제제를 제공한다.Additionally, the present invention provides a pharmaceutical formulation for preventing or treating liver fibrosis, comprising the composition.
또한, 본 발명은 리포칼린 2 억제제를 포함하는 간섬유화 예방 또는 개선용 건강기능식품 조성물을 제공한다.Additionally, the present invention provides a health functional food composition for preventing or improving liver fibrosis containing a lipocalin 2 inhibitor.
본 발명에서 사용되는 용어, "개선"이란 치료되는 상태와 관련된 파라미터, 예를 들면, 증상의 정도를 적어도 감소시키는 모든 행위를 의미한다.As used herein, the term "improvement" means any action that reduces at least the severity of a parameter related to the condition being treated, such as a symptom.
이때, 상기 건강기능식품 조성물은 상기 질환의 예방 또는 개선을 위하여 해당 질환의 발병 단계 이전 또는 발병 후, 치료를 위한 약제와 동시에 또는 별개로서 사용될 수 있다.At this time, the health functional food composition can be used simultaneously or separately with a drug for treatment before or after the onset of the disease in order to prevent or improve the disease.
본 발명의 건강기능식품 조성물에서, 유효성분을 식품에 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효 성분의 혼합량은 그의 사용 목적 (예방 또는 개선용)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품 또는 음료의 제조시에 본 발명의 조성물은 원료에 대하여 바람직하게 15 중량% 이하, 바람직하게는 10 중량% 이하의 양으로 첨가될 수 있다. 그러나 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 양은 상기 범위 이하일 수 있다.In the health functional food composition of the present invention, the active ingredient can be added as is to food or used together with other foods or food ingredients, and can be used appropriately according to conventional methods. The mixing amount of the active ingredient can be appropriately determined depending on the purpose of use (prevention or improvement). In general, when producing food or beverages, the composition of the present invention may be added in an amount of preferably 15% by weight or less, preferably 10% by weight or less, based on the raw materials. However, in the case of long-term intake for the purpose of health and hygiene or health control, the amount may be below the above range.
본 발명의 건강기능식품 조성물은 상기 유효성분을 함유하는 것 외에 특별한 제한없이 다른 성분들을 필수 성분으로서 함유할 수 있다. 예를 들면, 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스 등; 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당, 및 자일리톨, 소르비톨, 에리트리톨 등의 당 알코올일 수 있다. 상술한 것 이외의 향미제로서 천연 향미제 (타우마틴, 스테비아 추출물 (예를 들어, 레바우디오시드 A, 글리시르히진 등)) 및 합성 향미제 (사카린, 아스파르탐 등)를 유리하게 사용할 수 있다. 상기 천연 탄수화물의 비율은 당업자의 선택에 의해 적절하게 결정될 수 있다.In addition to containing the above active ingredients, the health functional food composition of the present invention may contain other ingredients as essential ingredients without any particular restrictions. For example, like regular beverages, it may contain various flavoring agents or natural carbohydrates as additional ingredients. Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose, etc.; Disaccharides such as maltose, sucrose, etc.; and polysaccharides, such as common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents other than those described above, natural flavoring agents (thaumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used. You can. The ratio of the natural carbohydrates can be appropriately determined by the selection of a person skilled in the art.
상기 외에 본 발명의 건강기능식품 조성물은 여러 가지 영양제, 비타민, 광물 (전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제 (치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있으며, 이러한 첨가제의 비율 또한 당업자에 의해 적절히 선택될 수 있다.In addition to the above, the health functional food composition of the present invention contains various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, colorants and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, It may contain alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. These components can be used independently or in combination, and the proportions of these additives can also be appropriately selected by those skilled in the art.
"리포칼린 2 억제제", "간섬유화", "예방" 등은 전술한 범위 내일 수 있다.“Lipocalin 2 inhibitor,” “liver fibrosis,” “prevention,” etc. may be within the aforementioned scope.
또한, 본 발명은 상기 약학적 조성물을 개체에 투여하는 단계를 포함하는 간섬유화 예방 또는 치료방법을 제공한다.Additionally, the present invention provides a method for preventing or treating liver fibrosis, comprising administering the pharmaceutical composition to a subject.
본 발명에서 “개체”란 질병의 치료를 필요로 하는 대상을 의미하고, 보다 구체적으로는 인간 또는 비-인간인 영장류, 생쥐(mouse), 쥐(rat), 개, 고양이, 말 및 소 등의 포유류를 의미한다.In the present invention, “individual” refers to a subject in need of treatment for a disease, and more specifically, human or non-human primates, mice, rats, dogs, cats, horses, and cows. It means mammal.
"리포칼린 2 억제제", "간섬유화", "투여", "예방", "치료" 등은 전술한 범위 내일 수 있다.“Lipocalin 2 inhibitor,” “liver fibrosis,” “administration,” “prevention,” “treatment,” etc. may be within the aforementioned scope.
또한, 본 발명은 상기 약학적 조성물의 간섬유화 예방 또는 치료 용도를 제공한다.Additionally, the present invention provides a use of the pharmaceutical composition for preventing or treating liver fibrosis.
또한, 본 발명은 간섬유화 치료용 약제를 제조하기 위한 리포칼린 2 억제제의 용도를 제공한다.Additionally, the present invention provides the use of a lipocalin 2 inhibitor for manufacturing a drug for treating liver fibrosis.
또한, 본 발명은 간 질환 치료용 약제를 제조하기 위한 리포칼린 2 억제제를 포함하는 조성물의 용도를 제공한다.The present invention also provides the use of a composition comprising a lipocalin 2 inhibitor for preparing a medicament for treating liver disease.
본 발명의 리포칼린 2 억제제를 유효성분으로 포함하는 간섬유화 예방 또는 치료용 약학적 조성물은 리포칼린 2의 발현 억제를 통해 간 세포의 간성상세포로의 유도를 억제함으로써 간섬유화의 예방 및 치료 효과를 나타낼 수 있다.The pharmaceutical composition for preventing or treating liver fibrosis containing the lipocalin 2 inhibitor of the present invention as an active ingredient prevents and treats liver fibrosis by suppressing the induction of liver cells into hepatic stellate cells by suppressing the expression of lipocalin 2. It can be expressed.
도 1은 간섬유화를 유도한 마우스를 이용하여 리포칼린 2의 발현에 따른 간섬유화를 확인한 도이다. 도 1A 내지 1C는 SREBP-1c 넉아웃 마우스에서 정상 마우스 대조군에 비해 간섬유화가 덜 진행됨을 확인한 결과이다. 도 1D는 간섬유화 마우스 모델에서 리포칼린 2 발현이 감소하는 경우, 간섬유화 유발 인자들의 발현도 감소함을 확인한 결과이다.Figure 1 is a diagram confirming liver fibrosis due to the expression of lipocalin 2 using mice in which liver fibrosis was induced. Figures 1A to 1C show results confirming that liver fibrosis progresses less in SREBP-1c knockout mice compared to the normal mouse control group. Figure 1D shows the results confirming that when lipocalin 2 expression is decreased in a liver fibrosis mouse model, the expression of liver fibrosis-inducing factors is also decreased.
도 2는 SREBP-1c 넉아웃 마우스에 리포칼린 2를 과발현시킨 경우 간섬유화가 증가함을 확인한 도이다.Figure 2 is a diagram confirming that liver fibrosis increases when lipocalin 2 is overexpressed in SREBP-1c knockout mice.
도 3은 리포칼린 2의 발현양과 간섬유화 발달 단계가 상호관계가 있음을 확인한 결과이다.Figure 3 shows the results confirming that there is a correlation between the expression level of lipocalin 2 and the development stage of liver fibrosis.
이하 본 발명을 실시예 및 실험예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예 및 실험예에 한정되는 것은 아니다. Hereinafter, the present invention will be described in more detail through examples and experimental examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples and experimental examples.
실시예 및 실험예Examples and Experimental Examples
실험예 1. CCl4 처리 마우스 동물실험Experimental Example 1. CCl4-treated mouse animal experiment
CCl4(Carbon tetrachloride) 투여에 의한 간섬유화 유도 정도를 조사하기 위해 간섬유화 유도 동물모델을 제작하고, 그 특징을 분석하였다. 구체적으로, 8주령 C57BL/6J 수컷 마우스와 SREBP-1c 유전자 넉아웃 형질전환마우스를 각각 12마리씩 준비한 후, CCl4 투여군 및 비투여군으로 6마리씩 총 4그룹으로 나누어 실시하였다. 사육실 환경은 23℃ 및 60 내지 70% 습도에서 12:12 시간 명암주기 (오전 6에서 오후 6 광 조사, 오후 6에서 오후 6 암전)로 물에 자유롭게 접근할 수 있고, 특정 병원체가 없는 마우스 시설에 수용하였다.To investigate the degree of liver fibrosis induction by CCl 4 (Carbon tetrachloride) administration, an animal model for liver fibrosis induction was created and its characteristics were analyzed. Specifically, 12 8-week-old C57BL/6J male mice and 12 SREBP-1c gene knockout transgenic mice were prepared and then divided into 4 groups of 6 mice each, into a CCl 4 administration group and a non-administration group. The breeding room environment is at 23°C and 60 to 70% humidity with a 12:12 hour light/dark cycle (light from 6 am to 6 pm, dark from 6 pm to 6 pm) with free access to water, and mouse facilities free of specific pathogens. Accepted.
일반 마우스와 SREBP-1c 유전자 넉아웃 형질전환마우스의 다리에 근육 주사(intramuscular)로 주 2회씩 2 ml/kg CCl4를 투여하여 5주 동안 간섬유화를 유도한 후, 간섬유화 정도를 검증하였다. 마우스를 이소플루란(isoflurane)(경기도 하나 제약)으로 마취시키고 광주기 동안 오전 9시에 희생시켰다. 본 발명자들은 모든 동물 실험을 계명대학교 동물 실험 및 사용위원회 (KM-2022-15R1)에서 승인한 프로토콜에 따라 대한민국 대구 계명대학교 의과대학에서 수행하였다.Liver fibrosis was induced for 5 weeks by administering 2 ml/kg CCl 4 twice a week by intramuscular injection into the legs of normal mice and SREBP-1c gene knockout transgenic mice, and then the degree of liver fibrosis was verified. Mice were anesthetized with isoflurane (Gyeonggi-do Hana Pharmaceutical) and sacrificed at 9 AM during the photoperiod. The present inventors performed all animal experiments at Keimyung University College of Medicine, Daegu, South Korea, according to protocols approved by the Keimyung University Animal Experiment and Use Committee (KM-2022-15R1).
실험예 2. 조직염색Experimental Example 2. Tissue staining
5주간 CCl4 투여 및 비투여한 형질전환 마우스와 정상마우스 각각 총 4그룹의 마우스를 이소플루란으로 마취시키는 방법으로 희생시킨 후 혈액을 수집하고, 간을 절개하여 분리한 간 조직을 포르말린에 넣어서 고정화시키고 마이크로톰(microtome)을 이용하여 10 ㎛의 두께로 잘라 조직슬라이드를 만들었다.A total of four groups of mice, each transgenic and normal, administered and not administered CCl 4 for 5 weeks, were sacrificed by anesthetizing with isoflurane, blood was collected, the liver was incised, and the separated liver tissue was placed in formalin. It was fixed and cut to a thickness of 10 ㎛ using a microtome to create tissue slides.
간조직의 형태 및 간섬유화를 H&E (hematoxylin & eosin), masson’s trichrome 및 sirius red staining을 통해 확인하였으며, 조직 염색은 당업계에 널리 알려진 실험 과정을 통하여 수행하였다. 그 결과, SREBP-1c 넉아웃 마우스에서 정상 마우스 대조군에 비해 간섬유화가 덜 진행됨을 확인하였다 (도 1A 내지 1C 참조).The morphology of liver tissue and liver fibrosis were confirmed through H&E (hematoxylin & eosin), Masson's trichrome, and Sirius red staining, and tissue staining was performed through an experimental procedure widely known in the art. As a result, it was confirmed that liver fibrosis progressed less in SREBP-1c knockout mice compared to the normal mouse control group (see Figures 1A to 1C).
실험예 3. 간섬유화 관련 유전자 발현 확인Experimental Example 3. Confirmation of liver fibrosis-related gene expression
또한, CCl4 투여에 의한 간섬유화 유도 정도를 조사하기 위해 섬유화 관련 유전자를 분석하였다.In addition, fibrosis-related genes were analyzed to investigate the degree of liver fibrosis induction by CCl 4 administration.
TriZol 절차(Invitrogen)에 의해 CCl4 투여에 의해 간섬유화가 유도된 마우스의 간 조직으로부터 총 RNA를 제조하고, cDNA를 iScript ™ cDNA 합성 키트 (Bio-Rad Laboratories, Hercules, CA, USA)를 사용하여 합성하였다. 다양한 유전자의 mRNA 발현 수준을 측정하기 위해 CFX96TM 실시간 PCR 시스템 (Bio-Rad Laboratories)으로 qPCR을 수행하였다. mRNA 수준은 델타-델타 역치 사이클 방법을 계산하여 리보솜 단백질 L32의 발현으로 정규화하였다. qPCR에 사용된 유전자의 프라이머 서열은 [표 1]에 표시하였다.Total RNA was prepared from liver tissue of mice in which liver fibrosis was induced by CCl 4 administration by the TriZol procedure (Invitrogen), and cDNA was synthesized using the iScript™ cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA, USA). synthesized. To measure the mRNA expression levels of various genes, qPCR was performed with a CFX96TM real-time PCR system (Bio-Rad Laboratories). mRNA levels were normalized to the expression of ribosomal protein L32 by calculating the delta-delta threshold cycle method. Primer sequences of genes used in qPCR are shown in [Table 1].
프라이머primer 염기서열base sequence
Lcn2Lcn2 ForwardForward TGGCCCTGAGTGTCATGTG (서열번호 1)TGGCCCTGAGTGTCATGTG (SEQ ID NO: 1)
ReverseReverse CTCTTGTAGCTCATAGATGGTGC (서열번호 2)CTCTTGTAGCTCATAGATGGTGC (SEQ ID NO: 2)
α-Smaα-Sma ForwardForward TCCTGACGCTGAAGTATCCGATA (서열번호 3)TCCTGACGCTGAAGTATCCGATA (SEQ ID NO: 3)
ReverseReverse GGTGCCAGATCTTTTCCATGTC (서열번호 4)GGTGCCAGATCTTTTCCATGTC (SEQ ID NO: 4)
Col1a1Col1a1 ForwardForward TTCGGACTAGACATTGG (서열번호 5)TTCGGACTAGACATTGG (SEQ ID NO: 5)
ReverseReverse GGGTTGTTCGTCTGTTTC (서열번호 6)GGGTTGTTCGTTCTGTTTC (SEQ ID NO: 6)
Col3a1Col3a1 ForwardForward ACGTAGATGAATTGGGATGCAG (서열번호 7)ACGTAGATGAATTGGGATGCAG (SEQ ID NO: 7)
ReverseReverse GGGTTGGGGCAGTCTAGTG (서열번호 8)GGGTTGGGGCAGTCTAGTG (SEQ ID NO: 8)
Col5a2Col5a2 ForwardForward TTGGAAACCTTCTCCATGTCAGA (서열번호 9)TTGGAAACCTTCTCCATGTCAGA (SEQ ID NO: 9)
ReverseReverse TCCCCAGTGGGTGTTATAGGA (서열번호 10)TCCCCAGTGGTGTTATAGGA (SEQ ID NO: 10)
상기 방법에 따라 CCl4 투여가 끝난 마우스의 간조직에서 섬유화와 관련된 인자를 조사하였으며, 섬유화 관련 유전자의 mRNA인 ‘α-Sma, Col1a1, Col3a1, Col5a2’의 발현 수준을 측정하였다 (도 1D 참조). 그 결과, 간섬유화 마우스 모델에서 리포칼린 2 발현이 감소하는 경우, 간섬유화 유발 인자들의 발현도 감소함을 확인하였다.According to the above method, factors related to fibrosis were investigated in the liver tissue of mice after CCl 4 administration, and the expression levels of 'α-Sma, Col1a1, Col3a1, and Col5a2', mRNAs of fibrosis-related genes, were measured (see Figure 1D). . As a result, it was confirmed that when lipocalin 2 expression decreased in the liver fibrosis mouse model, the expression of liver fibrosis-inducing factors also decreased.
실험예 4. SREBP-1c 넉아웃 마우스에 리포칼린 2 투여시 간섬유화 회복 확인Experimental Example 4. Confirmation of liver fibrosis recovery when lipocalin 2 is administered to SREBP-1c knockout mice
리포칼린 2가 간섬유화 유발에 중요한 인자 인지를 확인하였다.It was confirmed that lipocalin 2 is an important factor in causing liver fibrosis.
간섬유화 유발에 리포칼린 2의 역할을 확인하기 위해서 SREBP-1c 넉아웃 마우스에 리포칼린 2를 다시 과발현시켜 간섬유화 정도를 확인하였다. 구체적으로, SREBP-1c 넉아웃 마우스에 LCN2 아데노 바이러스를 꼬리정맥으로 주사한 후 5주간 CCl4를 처리하여 간섬유화를 유도하였다. Sirius Red 염색방법으로 간섬유화 정도를 측정하였다. 간섬유화 관련 유전자의 발현량을 측정하기 위해 간조직을 사용하여 총 RNA를 제조하고, cDNA를 iScript ™ cDNA 합성 키트를 사용하여 합성하였다. qPCR에 사용된 유전자의 프라이머 서열은 [표 2]에 표시하였다.To confirm the role of lipocalin 2 in inducing liver fibrosis, lipocalin 2 was overexpressed in SREBP-1c knockout mice again and the degree of liver fibrosis was confirmed. Specifically, SREBP-1c knockout mice were injected with LCN2 adenovirus through the tail vein and then treated with CCl 4 for 5 weeks to induce liver fibrosis. The degree of liver fibrosis was measured using the Sirius Red staining method. To measure the expression level of liver fibrosis-related genes, total RNA was prepared using liver tissue, and cDNA was synthesized using the iScript™ cDNA synthesis kit. Primer sequences of genes used in qPCR are shown in [Table 2].
그 결과, 리포칼린 2를 과발현시킨 마우스가 SREBP-1c 넉아웃 마우스에 비해 간섬유화 정도가 증가함을 확인하였다 (도 2A 참조). As a result, it was confirmed that mice overexpressing lipocalin 2 had an increased degree of liver fibrosis compared to SREBP-1c knockout mice (see Figure 2A).
간섬유화 관련 유전자의 mRNA인 ‘Tgfb1, Col1a1, Col3a1, Col5a2, Col6a1, Mmp2, Mmp9, Timp1’의 발현 수준을 측정하였다 (도 2B 내지 2I 참조). 그 결과, 간섬유화 관련 유전자의 발현량에서도 리포칼린 2를 과발현시킨 마우스가 SREBP-1c 넉아웃 마우스에 비해 간섬유화 관련 유전자가 증가하는 것을 확인하였다. 이는 리포칼린 2가 간섬유화로 진행되는데 중요한 인자임을 나타낸다.The expression levels of ‘Tgfb1, Col1a1, Col3a1, Col5a2, Col6a1, Mmp2, Mmp9, and Timp1’, mRNAs of liver fibrosis-related genes, were measured (see Figures 2B to 2I). As a result, it was confirmed that the expression level of liver fibrosis-related genes was increased in mice overexpressing lipocalin 2 compared to SREBP-1c knockout mice. This indicates that lipocalin 2 is an important factor in the progression of liver fibrosis.
프라이머primer 염기서열base sequence
Tgfb1Tgfb1 ForwardForward ATTTGGAGCCTGGACACACA (서열번호 11)ATTTGGAGCCTGGACACACA (SEQ ID NO: 11)
ReverseReverse GAGCGCACAATCATGTTGGA (서열번호 12)GAGCGCACAATCATGTTGGA (SEQ ID NO: 12)
Col1a1Col1a1 ForwardForward TTCGGACTAGACATTGG (서열번호 5)TTCGGACTAGACATTGG (SEQ ID NO: 5)
ReverseReverse GGGTTGTTCGTCTGTTTC (서열번호 6)GGGTTGTTCGTTCTGTTTC (SEQ ID NO: 6)
Col3a1Col3a1 ForwardForward ACGTAGATGAATTGGGATGCAG (서열번호 7)ACGTAGATGAATTGGGATGCAG (SEQ ID NO: 7)
ReverseReverse GGGTTGGGGCAGTCTAGTG (서열번호 8)GGGTTGGGGCAGTCTAGTG (SEQ ID NO: 8)
Col5a2Col5a2 ForwardForward TTGGAAACCTTCTCCATGTCAGA (서열번호 9)TTGGAAACCTTCTCCATGTCAGA (SEQ ID NO: 9)
ReverseReverse TCCCCAGTGGGTGTTATAGGA (서열번호 10)TCCCCAGTGGTGTTATAGGA (SEQ ID NO: 10)
Col6a1Col6a1 ForwardForward CTGCTGCTACAAGCCTGCT (서열번호 13)CTGCTGCTACAAGCCTGCT (SEQ ID NO: 13)
ReverseReverse GCACGAAGAATAGATCCACAGGG (서열번호 14)GCACGAAGAATAGATCCACAGGG (SEQ ID NO: 14)
Mmp2Mmp2 ForwardForward ACCTGAACACTTTCTATGGCTG (서열번호 15)ACCTGAACACTTTCTATGGCTG (SEQ ID NO: 15)
ReverseReverse CTTCCGCATGGTCTCGATG (서열번호 16)CTTCCGCATGGTCTCGATG (SEQ ID NO: 16)
Mmp9Mmp9 ForwardForward GCGTCGTGATCCCCACTTAC (서열번호 17)GCGTGTGATCCCACTTAC (SEQ ID NO: 17)
ReverseReverse CAGGCCGAATAGGAGCGTC (서열번호 18)CAGGCCGAATAGGAGCGTC (SEQ ID NO: 18)
Timp1Timp1 ForwardForward GAGACCACCTTATACCAGCGTT (서열번호 19)GAGACCACCTTATACCAGCGTT (SEQ ID NO: 19)
ReverseReverse TACGCCAGGGAACCAAGAAG (서열번호 20)TACGCCAGGGAACCAAGAAG (SEQ ID NO: 20)
실험예 5. 간섬유화 발달 단계에 따른 염증 관련 유전자와 리포칼린 2 발현양 확인간섬유화 발달 단계에 따른 염증 관련 유전자와 리포칼린 2의 발현양의 변화를 확인하였다. Experimental Example 5. Confirmation of expression levels of inflammation-related genes and lipocalin 2 according to the development stage of liver fibrosis. Changes in the expression levels of inflammation-related genes and lipocalin 2 according to the development stage of liver fibrosis were confirmed.
염증 관련 유전자와 리포칼린 2의 발현량을 측정하기 위해 일반 마우스와 SREBP-1c 유전자 넉아웃 형질전환마우스에서 일차간세포를 분리하여 10% FBS 및 1%(v/v) 페니실린/스트렙토마이신(Gibco)의 high-glucose DMEM(HyClone)에서 5% CO2 가습된 배양 조건 및 37℃의 온도로 배양하였다. 그 후, 세포를 6 well(2×105 cells/wells) 배양접시에 분주한 후 24시간 배양하고, 지방산(fatty acid, FA)를 처리하여 24시간 동안 재배양한 후 수집한 pellet은 염증 관련 유전자의 발현량을 측정하기 위해 TriZol 절차(Invitrogen)에 의해 총 RNA를 제조하고, cDNA를 iScript ™ cDNA 합성 키트를 사용하여 합성하였다. qPCR에 사용된 유전자의 프라이머 서열은 [표 3]에 표시하였다. 상등액은 원심분리하여 lipocalin-2 ELISA kit의 절차(R&D systems)에 따라 시료 준비와 발현량을 측정하였다. 이후 Infinite® 200 PRO(Tecan Trading AG, Switzerland)를 사용하여 450nm 파장에서 시료 및 표준 물질의 흡광도를 측정했다.To measure the expression levels of inflammation-related genes and lipocalin 2, primary hepatocytes were isolated from normal mice and SREBP-1c gene knockout transgenic mice and incubated with 10% FBS and 1% (v/v) penicillin/streptomycin (Gibco). The cells were cultured in high-glucose DMEM (HyClone) under 5% CO 2 humidified culture conditions and at a temperature of 37°C. Afterwards, the cells were dispensed into a 6 well (2 To measure the expression level of genes, total RNA was prepared by the TriZol procedure (Invitrogen), and cDNA was synthesized using the iScript™ cDNA synthesis kit. Primer sequences of genes used in qPCR are shown in [Table 3]. The supernatant was centrifuged, and sample preparation and expression level were measured according to the lipocalin-2 ELISA kit procedure (R&D systems). Afterwards, the absorbance of the samples and standards was measured at a wavelength of 450 nm using Infinite® 200 PRO (Tecan Trading AG, Switzerland).
리포칼린 2와 염증 관련 유전자의 mRNA인 ‘F4/80, Tnf-α, Il-6, Mcp1’의 발현 수준을 측정하였다 (도 3A 내지 3E 참조). 그 결과, 리포칼린 2와 염증 관련 유전자의 발현량이 일차간세포에서 지방산 처리한 일반 마우스에 비하여 지방산 처리한 SREBP-1c 유전자 넉아웃 형질전환마우스에서 감소하는 결과를 확인하였다 (도 3A 내지 3E 참조).The expression levels of lipocalin 2 and inflammation-related gene mRNAs ‘F4/80, Tnf-α, Il-6, and Mcp1’ were measured (see Figures 3A to 3E). As a result, it was confirmed that the expression levels of lipocalin 2 and inflammation-related genes in primary hepatocytes were decreased in SREBP-1c gene knockout transgenic mice treated with fatty acid compared to normal mice treated with fatty acid (see Figures 3A to 3E).
지방산 처리한 SREBP-1c 유전자 넉아웃 형질전환마우스에서 지방산 처리한 일반 마우스보다 리포칼린 2의 발현양이 감소함을 확인하였다 (도 3F 참조). 이는 간섬유화 발달 단계와 리포칼린 2 사이에 상호관계가 있음을 나타낸다.It was confirmed that the expression level of lipocalin 2 was decreased in SREBP-1c gene knockout transgenic mice treated with fatty acid compared to normal mice treated with fatty acid (see Figure 3F). This indicates that there is a correlation between the stage of liver fibrosis development and lipocalin 2.
프라이머primer 염기서열base sequence
Lcn2Lcn2 ForwardForward TGGCCCTGAGTGTCATGTG (서열번호 1)TGGCCCTGAGTGTCATGTG (SEQ ID NO: 1)
ReverseReverse CTCTTGTAGCTCATAGATGGTGC (서열번호 2)CTCTTGTAGCTCATAGATGGTGC (SEQ ID NO: 2)
F4/80F4/80 ForwardForward CTTTGGCTATGGGCTTCCAGTC (서열번호 21)CTTTGGCTATGGGCTTCCAGTC (SEQ ID NO: 21)
ReverseReverse GCAAGGAGGACAGAGTTTATCGTG (서열번호 22)GCAAGGAGGACAGAGTTTATCGTG (SEQ ID NO: 22)
Tnf-αTnf-α ForwardForward CCCTCACACTCAGATCATCTTCT (서열번호 23)CCCTCACACTCAGATCATCTTCT (SEQ ID NO: 23)
ReverseReverse GCTACGACGTGGGCTACAG (서열번호 24)GCTACGACGTGGGCTACAG (SEQ ID NO: 24)
Il-6IL-6 ForwardForward GTGACGTTGACATCCGTAAAGA (서열번호 25)GTGACGTTGACATCCGTAAAGA (SEQ ID NO: 25)
ReverseReverse GCCGGACTCATCGTACTCC (서열번호 26)GCCGGACTCATCGTACTCC (SEQ ID NO: 26)
Mcp-1Mcp-1 ForwardForward CCACTCACCTGCTGCTACTCA (서열번호 27)CCACTCACCTGCTGCTACTCA (SEQ ID NO: 27)
ReverseReverse TGGTGATCCTCTTGTAGCTCTCC (서열번호 28)TGGTGATCCTCTTGTAGCTCTCC (SEQ ID NO: 28)

Claims (12)

  1. 리포칼린 2 억제제를 유효성분으로 포함하는, 간섬유화 예방 또는 치료용 약학적 조성물.A pharmaceutical composition for preventing or treating liver fibrosis, comprising a lipocalin 2 inhibitor as an active ingredient.
  2. 청구항 1에 있어서,In claim 1,
    상기 리포칼린 2 억제제는 리포칼린 2 mRNA에 상보적으로 결합하는 안티센스 뉴클레오티드, 앱타머, 작은 간섭 RNA (siRNA), 짧은 헤어핀 RNA (shRNA), 마이크로 RNA (miRNA) 및 RNA 간섭(RNAi)으로 이루어진 군으로부터 선택된 하나 이상인, 약학적 조성물.The lipocalin 2 inhibitor is a group consisting of antisense nucleotides, aptamers, small interfering RNA (siRNA), short hairpin RNA (shRNA), micro RNA (miRNA), and RNA interference (RNAi) that bind complementary to lipocalin 2 mRNA. One or more pharmaceutical compositions selected from.
  3. 청구항 1에 있어서,In claim 1,
    상기 리포칼린 2 억제제는 리포칼린 2 억제제 단백질에 특이적으로 결합하는 화합물, 펩티드, 펩티드 모방체, 기질 유사체, 앱타머 및 항체로 구성된 군으로부터 선택된 하나 이상인, 약학적 조성물.A pharmaceutical composition wherein the lipocalin 2 inhibitor is at least one selected from the group consisting of a compound that specifically binds to a lipocalin 2 inhibitor protein, a peptide, a peptide mimetic, a substrate analog, an aptamer, and an antibody.
  4. 청구항 1에 있어서,In claim 1,
    상기 리포칼린 2 억제제는 리포칼린 2 수용체 (24p3R) 단백질에 특이적으로 결합하는 화합물, 펩티드, 펩티드 모방체 및 기질 유사체로 구성된 군으로부터 선택된 하나 이상인, 약학적 조성물.A pharmaceutical composition wherein the lipocalin 2 inhibitor is at least one selected from the group consisting of compounds, peptides, peptide mimetics, and substrate analogs that specifically bind to lipocalin 2 receptor (24p3R) protein.
  5. 청구항 1에 있어서,In claim 1,
    상기 리포칼린 2 억제제는 리포칼린 2의 간 세포의 간성상세포로의 유도를 억제하는 것을 특징으로 하는, 약학적 조성물.The lipocalin 2 inhibitor is a pharmaceutical composition characterized in that it inhibits the induction of lipocalin 2 from liver cells to hepatic stellate cells.
  6. 리포칼린 2 억제제를 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는, 간섬유화 예방 또는 치료용 약학적 조성물.A pharmaceutical composition for preventing or treating liver fibrosis, comprising a polynucleotide encoding a lipocalin 2 inhibitor as an active ingredient.
  7. 청구항 6에 있어서,In claim 6,
    상기 폴리뉴클레오티드는 발현 벡터 내에 포함되는 것을 특징으로 하는 약학적 조성물.A pharmaceutical composition, characterized in that the polynucleotide is contained in an expression vector.
  8. 청구항 7에 있어서,In claim 7,
    상기 발현 벡터는 플라스미드 또는 바이러스성 벡터인 것을 특징으로 하는 약학적 조성물.A pharmaceutical composition, wherein the expression vector is a plasmid or viral vector.
  9. 청구항 1의 조성물을 포함하는, 간섬유화 예방 또는 치료용 약학 제제.A pharmaceutical preparation for preventing or treating liver fibrosis, comprising the composition of claim 1.
  10. 리포칼린 2 억제제를 포함하는, 간섬유화 예방 또는 개선용 건강기능식품 조성물.A health functional food composition for preventing or improving liver fibrosis, comprising a lipocalin 2 inhibitor.
  11. 리포칼린 2 억제제를 유효성분으로 포함하는 약학적 조성물의, 간섬유화 예방 또는 치료용도.Use of a pharmaceutical composition containing a lipocalin 2 inhibitor as an active ingredient for preventing or treating liver fibrosis.
  12. 리포칼린 2 억제제를 유효성분으로 포함하는 약학적 조성물을 대상에게 투여하는 단계를 포함하는, 간섬유화 예방 또는 치료방법.A method for preventing or treating liver fibrosis, comprising administering to a subject a pharmaceutical composition containing a lipocalin 2 inhibitor as an active ingredient.
PCT/KR2023/014274 2022-10-27 2023-09-20 Pharmaceutical composition comprising lipocalin 2 inhibitor for preventing or treating liver fibrosis WO2024090800A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2022-0140726 2022-10-27
KR1020220140726A KR20240083161A (en) 2022-10-27 Pharmaceutical Composition comprising Inhibitor of lipocalin-2 for Preventing or Treating of Liver Disease

Publications (1)

Publication Number Publication Date
WO2024090800A1 true WO2024090800A1 (en) 2024-05-02

Family

ID=90831321

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/014274 WO2024090800A1 (en) 2022-10-27 2023-09-20 Pharmaceutical composition comprising lipocalin 2 inhibitor for preventing or treating liver fibrosis

Country Status (1)

Country Link
WO (1) WO2024090800A1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150040185A (en) * 2013-10-04 2015-04-14 경북대학교 산학협력단 Composition comprising lipocalin 2 inhibitor for preventing and treating inflammatory pain
KR20230112257A (en) * 2022-01-20 2023-07-27 경상국립대학교산학협력단 Pharmaceutical composition for preventing or treating liver fibrosis induced by nonalcoholic steatohepatitis comprising lipocalin 2 or its receptor inhibitor as effective component

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150040185A (en) * 2013-10-04 2015-04-14 경북대학교 산학협력단 Composition comprising lipocalin 2 inhibitor for preventing and treating inflammatory pain
KR20230112257A (en) * 2022-01-20 2023-07-27 경상국립대학교산학협력단 Pharmaceutical composition for preventing or treating liver fibrosis induced by nonalcoholic steatohepatitis comprising lipocalin 2 or its receptor inhibitor as effective component

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
ANASTASIA ASIMAKOPOULOU: "Lipocalin 2 (LCN2) Expression in Hepatic Malfunction and Therapy", FRONTIERS IN PHYSIOLOGY, FRONTIERS RESEARCH FOUNDATION, CH, vol. 7, 27 September 2016 (2016-09-27), CH , XP093163276, ISSN: 1664-042X, DOI: 10.3389/fphys.2016.00430 *
ANONYMOUS: "Identification of the mechanism controlling ‘fibrosis of non-alcoholic steatohepatitis’ caused by obesity and diabetes", GNU TODAY PRESS RELEASE, 17 May 2022 (2022-05-17), XP093163272, Retrieved from the Internet <URL:https://www.gnu.ac.kr/main/na/ntt/selectNttInfo.do?mi=1070&bbsId=1021&nttSn=2134953> *
CHEN JIEGEN, ARGEMI JOSEPMARIA, ODENA GEMMA, XU MING-JIANG, CAI YAN, MASSEY VERONICA, PARRISH AUSTIN, VADIGEPALLI RAJANIKANTH, ALT: "Hepatic lipocalin 2 promotes liver fibrosis and portal hypertension", SCIENTIFIC REPORTS, vol. 10, no. 1, 1 December 2020 (2020-12-01), XP055874089, DOI: 10.1038/s41598-020-72172-7 *
IM, SEUNG SOON: "Developmental mechanism and control strategy on nonalcoholic steaohapatitis by SREBP-1-mediated LCN2", MID-CAREER RESEARCH FINAL REPORT OF GOVERNMENT PROJECT, March 2022 (2022-03-01), pages 1 - 35 *
KIM KYUNG EUN, LEE JAEWOONG, SHIN HYUN JOO, JEONG EUN AE, JANG HYE MIN, AHN YU JEONG, AN HYEONG SEOK, LEE JONG YOUL, SHIN MEONG CH: "Lipocalin‐2 activates hepatic stellate cells and promotes nonalcoholic steatohepatitis in high‐fat diet–fed Ob/Ob mice", HEPATOLOGY, JOHN WILEY & SONS, INC., US, vol. 77, no. 3, 1 March 2023 (2023-03-01), US , pages 888 - 901, XP093079160, ISSN: 0270-9139, DOI: 10.1002/hep.32569 *
KRIZANAC MARINELA, MASS SANCHEZ PAOLA BERENICE, WEISKIRCHEN RALF, ASIMAKOPOULOS ANASTASIA: "A Scoping Review on Lipocalin-2 and Its Role in Non-Alcoholic Steatohepatitis and Hepatocellular Carcinoma", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 22, no. 6, pages 2865, XP093079155, DOI: 10.3390/ijms22062865 *
XU GANG, WANG YU-MIN, YING MIAO-MIAO, CHEN SUI-DAN, LI ZONG-RUI, MA HONG-LEI, ZHENG MING-HUA, WU JIAN, DING CHUNMING: "Serum lipocalin-2 is a potential biomarker for the clinical diagnosis of nonalcoholic steatohepatitis", CLINICAL AND MOLECULAR HEPATOLOGY, KOREAN ASSOCIATION FOR THE STUDY OF THE LIVER, KOREA, vol. 27, no. 2, 1 April 2021 (2021-04-01), Korea , pages 329 - 345, XP093079156, ISSN: 2287-2728, DOI: 10.3350/cmh.2020.0261 *

Similar Documents

Publication Publication Date Title
CN110151749B (en) Application of oridonin in preparing medicine for preventing or treating NLRP3 inflammation body related diseases
Zuo et al. Inhibition of NF-κB pathway in fibroblast-like synoviocytes by α-mangostin implicated in protective effects on joints in rats suffering from adjuvant-induced arthritis
Lei et al. Early-life lipopolysaccharide exposure potentiates forebrain expression of NLRP3 inflammasome proteins and anxiety-like behavior in adolescent rats
WO2014182051A1 (en) Composition comprising asm inhibitor as active ingredient for preventing or treating degenerative neurological disorders
KR20160108258A (en) Compositions for Preventing or Treating Metabolic Diseases
Zhang et al. Interleukin 6 inhibition by triptolide prevents inflammation in a mouse model of ulcerative colitis
Yang et al. Hirudin ameliorates renal interstitial fibrosis via regulating TGF-β1/Smad and NF-κB signaling in UUO rat model
JP6918839B2 (en) Methods and pharmaceutical compositions for treating microbiome dysregulation associated with circadian clock disturbances
Ono et al. Effect of Sho‐saiko‐to Extract on HGF and TGF‐β Levels of Intraorgans in Liver‐injured Rats after Partial Hepatectomy
WO2024090800A1 (en) Pharmaceutical composition comprising lipocalin 2 inhibitor for preventing or treating liver fibrosis
Sinen et al. Neuropeptide-S prevents 6-OHDA-induced gastric dysmotility in rats
Wu et al. Jieduquyuzishen prescription attenuates renal fibrosis in MRL/lpr mice via inhibiting EMT and TGF-β1/smad2/3 pathway
CN110128506B (en) Oligopeptide and application thereof
EP1740167B1 (en) Treatment of type 1 diabetes with inhibitors of macrophage migration inhibitory factor
Mo et al. Prolactin affects the disappearance of ALV-J viremia in vivo and inhibits viral infection
KR20240083161A (en) Pharmaceutical Composition comprising Inhibitor of lipocalin-2 for Preventing or Treating of Liver Disease
KR20090032809A (en) Screening method for the composition for prevention or treatment of osteoporosis and metabolic bone disease using tallyho/jngj mouse
WO2021125920A1 (en) Method for alleviating cancer-induced pain through control of pain signals in central nervous system
US20180134782A1 (en) Use of Macrophage inflammatory protein-1Beta (MIP-1Beta) inhibitor to protect pancreas and prevent blood sugar from rising
Wu et al. Ganoderma lucidum polysaccharides ameliorates D-galactose-induced aging salivary secretion disorders by upregulating the rhythm and aquaporins
KR101889097B1 (en) Compositions for Preventing or Treating Metabolic Diseases
CN109789116B (en) Use of SC-43 for improving fibrosis
Scolaro et al. Short-Term Caloric Restriction in Mice Promotes Resolution of Atherosclerosis, While Weight Regain Accelerates Its Progression
CN107582574B (en) Application of nostoc commune alcohol extract in preparation of medicine for treating inflammatory bowel disease
KR101976633B1 (en) Pharmaceutical composition for preventing or treating pulmonary fibrosis