WO2024081937A2 - Protéines de fusion cas12a et leurs procédés d'utilisation - Google Patents

Protéines de fusion cas12a et leurs procédés d'utilisation Download PDF

Info

Publication number
WO2024081937A2
WO2024081937A2 PCT/US2023/076920 US2023076920W WO2024081937A2 WO 2024081937 A2 WO2024081937 A2 WO 2024081937A2 US 2023076920 W US2023076920 W US 2023076920W WO 2024081937 A2 WO2024081937 A2 WO 2024081937A2
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
grna
fusion protein
seq
polynucleotide
Prior art date
Application number
PCT/US2023/076920
Other languages
English (en)
Other versions
WO2024081937A3 (fr
Inventor
Timothy REDDY
Schuyler MELORE
Charles GERSBACH
Original Assignee
Duke University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Duke University filed Critical Duke University
Publication of WO2024081937A2 publication Critical patent/WO2024081937A2/fr
Publication of WO2024081937A3 publication Critical patent/WO2024081937A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00—Libraries per se, e.g. arrays, mixtures
    • C40B40/04—Libraries containing only organic compounds
    • C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/01048—Histone acetyltransferase (2.3.1.48)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Definitions

  • RNA-guided nucleases have been adapted for genome modification in human cells including CRISPR systems derived from organisms such as Streptococcus pyogenes and Staphylococcus aureus. For example, various Cas proteins make blunt-ended double- stranded breaks (DSBs) in genomic DNA.
  • DSBs blunt-ended double- stranded breaks
  • This DNA cleavage stimulates the natural DNA- repair machinery, leading to one of two possible repair pathways.
  • the break will be repaired by non-homologous end joining (NHEJ), an error-prone repair pathway that leads to small insertions or deletions (indels) of DNA at the repaired site.
  • NHEJ non-homologous end joining
  • This method can be used to intentionally knockout a gene, remove a splice acceptor, or disrupt, delete, or alter the reading frame of targeted gene sequences.
  • the cellular machinery will repair the break by homologous recombination, which is enhanced several orders of magnitude in the presence of DNA cleavage.
  • This method can be used to introduce specific changes in the DNA sequence at target sites.
  • Engineered nucleases have been used for gene editing in a variety of cells. However, a major hurdle for implementation of these technologies is delivering to particular tissues in vivo in a way that is effective, efficient, and facilitates successful genome modification. [0005] There is also a need for epigenome modification. Synthetic transcription factors have been engineered to control gene expression for many different medical and scientific applications. Epigenome-modifying enzymes have been fused to programmable DNA- binding proteins to achieve targeted DNA methylation, DNA hydroxymethylation, and histone demethylation, methylation, and deacetylation. However, limitations include specificity of the gene targeting, efficient delivery to targeted cells, and sufficient expression of the epigenome-modifying enzymes.
  • Cas9 guide RNAs are >300 bp, most of which is constant sequence. They may include a Polymerase III promoter (typically the 250 bp U6 promoter), a 20 bp spacer sequence, and a 76 bp gRNA scaffold.
  • the fusion protein may comprise a first polypeptide domain comprising a Cas12a protein selected from Lb-dCas12a, Lb-dHyperCas12a, As-dCas12a, and As-dEnCas12a; and a second polypeptide domain comprising SID or the histone acetyltransferase domain of p300.
  • the Cas12a protein comprises an amino acid sequence having one, two, three, four, or five or more changes selected from amino acid substitutions, insertions, or deletions, relative to a polypeptide sequence selected from SEQ ID NOs: 20, 22, 24, and 26; or the Cas12a protein comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to a polypeptide sequence selected from SEQ ID NOs: 20, 22, 24, and 26; or the Cas12a protein comprises a polypeptide sequence selected from SEQ ID NOs: 20, 22, 24, and 26; or the Cas12a protein is encoded by a polynucleotide comprising a sequence having one, two, three, four, or five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to a polynucleotide sequence selected from SEQ ID NOs: 21, 23, 25, and 27; or the Cas12a protein is encoded by a polynucleotide comprising a
  • the second polypeptide domain comprises SID and the fusion protein represses transcription of a target gene.
  • the SID comprises the sequence of SEQ ID NO: 56, or the SID is encoded by a polynucleotide comprising the sequence of SEQ ID NO: 57.
  • the fusion protein comprises an amino acid sequence having one, two, three, four, or five or more changes selected from amino acid substitutions, insertions, or deletions, relative to a polypeptide sequence selected from SEQ ID NOs: 36, 38, 40, and 42; or the fusion protein comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to a polypeptide sequence selected from SEQ ID NOs: 36, 38, 40, and 42; or the fusion protein comprises a polypeptide sequence selected from SEQ ID NOs: 36, 38, 40, and 42; or the fusion protein is encoded by a polynucleotide comprising a sequence having one, two, three, four, or five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to a polynucleotide sequence selected from SEQ ID NOs: 37, 39, 41, and 43; or the fusion protein is encoded by a polynucleotide comprising
  • the second polypeptide domain comprises the histone acetyltransferase domain of p300 and the fusion protein activates transcription of a target gene.
  • the histone acetyltransferase domain of p300 comprises the sequence of SEQ ID NO: 52, or the histone acetyltransferase domain of p300 is encoded by a polynucleotide comprising the sequence of SEQ ID NO: 53.
  • the fusion protein comprises an amino acid sequence having one, two, three, four, or five or more changes selected from amino acid substitutions, insertions, or deletions, relative to a polypeptide sequence selected from SEQ ID NOs: 28, 30, 32, and 34; or the fusion protein comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to a polypeptide sequence selected from SEQ ID NOs: 28, 30, 32, and 34; or the fusion protein comprises a polypeptide sequence selected from SEQ ID NOs: 28, 30, 32, and 34; or the fusion protein is encoded by a polynucleotide comprising a sequence having one, two, three, four, or five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to a polynucleotide sequence selected from SEQ ID NOs: 29, 31, 33, and 35; or the fusion protein is encoded by a polynucleotide comprising a sequence having at least 80%
  • the disclosure relates to a DNA targeting system.
  • the DNA targeting composition may include at least one fusion protein as detailed herein, and at least one guide RNA (gRNA).
  • gRNA guide RNA
  • the at least one gRNA targets a target region of a target gene.
  • the target region comprises a non-open chromatin region, or an open chromatin region, or a transcribed region of the target gene, or a region upstream of a transcription start site of the target gene, or a regulatory element of the target gene, or a target enhancer of the target gene, or a cis-regulatory region of the target gene, or a trans-regulatory region of the target gene, or an intron of the target gene, or an exon of the target gene, or a promoter of the target gene.
  • the at least one gRNA comprises a gRNA array of 2 to 25 gRNAs, each gRNA binding to a different target region.
  • the gRNA array comprises a first gRNA for a first Cas12a protein and a second gRNA for a second Cas12a protein. In some embodiments, the gRNA array comprises a first gRNA for a first Cas12a protein, a second gRNA for a second Cas12a protein, and a third gRNA for a third Cas12a protein.
  • Another aspect of the disclosure provides an isolated polynucleotide encoding a fusion protein as detailed herein or a DNA targeting system as detailed herein.
  • Another aspect of the disclosure provides a vector comprising an isolated polynucleotide as detailed herein.
  • compositions comprising at least one vector encoding a DNA targeting system as detailed herein.
  • the composition comprises a first vector encoding a first fusion protein; a second vector encoding a second fusion protein; and a third vector encoding the at least one gRNA.
  • the composition comprises a first vector encoding a first fusion protein and a second fusion protein; and a second vector encoding the at least one gRNA.
  • the composition comprises a single vector encoding the at least one fusion protein and the at least one gRNA.
  • the at least one vector encoding the at least one gRNA further encodes an RNA Pol2 promoter.
  • the at least one vector encodes a gRNA array comprising 2 to 25 gRNAs, or 3 to 20 gRNAs, or 4 to 10 gRNAs.
  • the vector encoding the at least one gRNA comprises a barcode sequence, wherein the barcode sequence is 4 to 12 nucleotides in length and is unique to each one of the at least one gRNA.
  • the barcode is 3’ of a polynucleotide encoding the at least one gRNA.
  • Another aspect of the disclosure provides a pharmaceutical composition comprising a fusion protein as detailed herein, or a DNA targeting system as detailed herein, or an isolated polynucleotide as detailed herein, or a vector as detailed herein, or a composition as detailed herein.
  • Another aspect of the disclosure provides a method of modulating gene expression of a target gene in a cell or subject. The method may include contacting the cell or subject with a DNA targeting system as detailed herein, or an isolated polynucleotide as detailed herein, or a vector as detailed herein, or a composition as detailed herein, or a pharmaceutical composition as detailed herein.
  • the gene expression of the target gene is activated or repressed relative to a control.
  • Another aspect of the disclosure provides a method of activating gene expression of a target gene in a cell or subject.
  • the method may include contacting the cell or subject with a DNA targeting system as detailed herein, or an isolated polynucleotide as detailed herein, or a vector as detailed herein, or a composition as detailed herein, or a pharmaceutical composition as detailed herein, wherein second polypeptide domain comprises the histone acetyltransferase domain of p300 and the fusion protein activates transcription of a target gene.
  • Another aspect of the disclosure provides a method of reducing gene expression of a target gene in a cell or subject.
  • the method may include contacting the cell or subject with a DNA targeting system as detailed herein, or an isolated polynucleotide as detailed herein, or a vector as detailed herein, or a composition as detailed herein, or a pharmaceutical composition as detailed herein, wherein second polypeptide domain comprises SID and the fusion protein represses transcription of a target gene.
  • Another aspect of the disclosure provides a method of treating a disease in a subject. The method may include administering to the subject a DNA targeting system as detailed herein, or an isolated polynucleotide as detailed herein, or a vector as detailed herein, or a composition as detailed herein, or a pharmaceutical composition as detailed herein.
  • FIGS.1A-1B are schematic diagrams comparing Cas9 and Cas12a systems. Shown in FIG.1A is a schematic of multiplex targeting of three different genes by Cas12a. Shown in FIG.1B is a schematic of relative lengths of Cas9 and Cas12 gRNAs. [00019] FIG.2 is a schematic diagram comparing Cas9 and Cas12a systems encoding multiple gRNAs. [00020] FIGS.3A-3F are graphs of relative mRNA expression for various fusion Cas12a fusion proteins.
  • FIG.3A Shown in FIG.3A is a graph of mRNA expression from the HBE1 promoter for a dCas12a variant (Lb-dCas12a, Lb-dHyperCas12a, As-dCas12a, or As-dEnCas12a) fused to VPR.
  • FIG.3B Shown in FIG.3B is a graph of mRNA expression from the RAB11A promoter for a dCas12a variant (Lb-dCas12a, Lb-dHyperCas12a, As-dCas12a, or As- dEnCas12a) fused to KRAB.
  • FIG.3C Shown in FIG.3C is a graph of mRNA expression from the HBE1 promoter using one or three gRNAs with Lb-dCas12a-VPR. Shown in FIG.3D is mRNA expression for AR or HBB with Lb-dCas12a-VPR. Shown in FIG.3E is a graph of mRNA expression using As-dEnCas12a-VPR or Lb-dCas12a-VPR, showing activation of MYOD1 expression. Shown in FIG.3F is a graph of mRNA expression using As- dEnCas12a-KRAB or Lb-dCas12a-KRAB, showing repression of RAB5A expression.
  • FIGS.4A-4B are graphs of relative mRNA expression for various fusion Cas12a fusion proteins. Shown in FIG.4A is a graph of mRNA expression for MYOD1, showing activation with As-dEnCas12a-p300 or Lb-dCas12a-p300. Shown in FIG.4B is a graph of mRNA expression for RAB5A, showing repression with As-dEnCas12a-4xSID or Lb- dCas12a-4xSID.
  • FIG.5 is a graph of mRNA expression for Lb-dCas12a-p300 or Lb-dCas12a- VPR, showing activation of the AR promoter in 293T cells using a gRNA array with or without a second direct repeat (DR).
  • FIG.6 is a schematic of the Cas12a fusion proteins and gRNAs used and a graph of relative mRNA expression of HBE1 or MYOD1, showing that As-dEnCas12a-p300 and Lb-dCas12a-p300 each upregulated expression of HBE1 and MYOD1.
  • FIG.7 is a schematic of the Cas12a fusion proteins and gRNAs used and a graph of relative mRNA expression of MYOD1, showing that As-dEnCas12a-p300 increased MYOD1 gene expression by targeting the distal regulatory region of MYOD1.
  • FIGS.8A-8B is a schematic (FIG.8A) of the Cas12a fusion proteins and gRNA array used and a graph (FIG.8B) of relative mRNA expression of HBE1 or MYOD1, showing that Lb-dHyperCas12a-p300 demonstrated robust and simultaneous activation of all three target genes using the gRNA array.
  • FIG.9 is a schematic of the Cas12a fusion proteins and gRNA array used and a graph of relative mRNA expression of AR or HBE1 or MYOD1, showing that Lb- dHyperCas12a-p300 was able to activate two of the three target genes when stably expressed in a cell line.
  • FIG.10 is a schematic of the Cas12a fusion proteins and gRNA array used and a graph of relative mRNA expression of MYC, RAB11A, RAB5A, or VEGFA, showing that both As-dEnCas12a-4xSID and Lb-dCas12a-4xSID fusion proteins repressed the four different target genes in 293T cells using the gRNA array.
  • FIG.11 is a schematic of the Cas12a fusion proteins and gRNA array used and a graph of relative mRNA expression of PIK3C3, RAB11A, or VEGFA, showing that both Lb- dHyperCas12a-4xSID and As-dEnCas12a-4xSID drove simultaneous repression of three target genes.
  • FIG.12 is a schematic of the Cas12a fusion proteins and gRNA array used and a graph of relative mRNA expression of PIK3C3, RAB11A, or VEGFA, showing that the stable Lb-dHyperCas12a-4xSID cell line repressed two of the four target genes.
  • FIG.13 is a schematic diagram of the crRNA cloning vector that encoded multiple gRNAs on a single transcript.
  • An array of six gRNAs collectively targeting two different genes was used, with each gene targeted by three different gRNAs.
  • Each of the six gRNAs was identified by a unique bipartite barcode (BC) that was flanked by TruSeq primer sequences for easy amplification and shorter amplicon length.
  • BC bipartite barcode
  • FIG.14 is a schematic of the Cas12a fusion proteins and gRNA array used and graphs of relative mRNA expression of HBE1, MYOD1, RAB11A, and MYC, showing that As-dEnCas12a-VPR and Lb-dHyperCas12a-KRAB used the chimeric gRNA array for robust activation or repression of all target genes when transfected individually, and that As- dEnCas12a-VPR and Lb-dHyperCas12a-KRAB simultaneously activated expression of one target gene and repressed expression of another target gene when co-transfected together.
  • FIG.15 is a schematic of the Cas12a fusion protein and gRNA array used and a graph of relative mRNA expression of AR, showing that dAsCas12a-p300 was able to upregulate expression of AR with a gRNA array.
  • DETAILED DESCRIPTION [00033] Described herein are molecular compositions, systems, and methods for modulation of gene expression via targeted epigenetic manipulation, including multiplexed activation or repression of gene expression. Combinations of regulatory elements or genes may act together to impact a phenotype, and understanding those combinatorial mechanisms may be a challenge in biomedical research today. Cas12a can overcome the challenges of Cas9-based methods for combinatorial studies of gene regulatory mechanisms.
  • Cas12a like Cas9, is a programmable RNA-guided DNA endonuclease. Unlike Cas9, Cas12a can process arrays of gRNAs into useable individual gRNAs (FIG.1A, FIG.2), allowing for multiplexing without the need for multiple promoter sequences and only requiring a 20 bp scaffold sequence between each spacer (FIG.1B). Arrays containing up to, for example, 25 gRNAs, can be expressed in mammalian cells, enabling highly multiplexed screening.
  • the compositions, systems, and methods detailed herein take advantage of distinct properties of CRISPR-Cas12a that make it particularly well-suited to target multiple genomic sites at once in the same cell.
  • compositions, systems, and methods include fusion proteins of DNAse-inactive versions of Cas12a (dCas12a) and an additional polypeptide such as, for example, SID or the histone acetyltransferase domain of p300. Further detailed herein are DNA constructs encoding an array of gRNAs.
  • the gRNA array may include gRNAs targeting different regulatory regions of the same or different genes, and/or gRNAs for use with Cas12a proteins from different species. 1. Definitions [00034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document, including definitions, will control.
  • the term “about” refers to a range of values that fall within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
  • “about” can mean within 3 or more than 3 standard deviations, per the practice in the art.
  • the term “about” can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2- fold, of a value.
  • Adeno-associated virus or “AAV” as used interchangeably herein refers to a small virus belonging to the genus Dependovirus of the Parvoviridae family that infects humans and some other primate species. AAV is not currently known to cause disease and consequently the virus causes a very mild immune response.
  • Amino acid refers to naturally occurring and non-natural synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code.
  • Amino acids can be referred to herein by either their commonly known three-letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Amino acids include the side chain and polypeptide backbone portions.
  • “Binding region” as used herein refers to the region within a target region that is recognized and bound by the CRISPR/Cas-based gene editing system.
  • the terms “cancer”, “cancer cell”, “tumor”, and “tumor cell” are used interchangeably herein and refer generally to a group of diseases characterized by uncontrolled, abnormal growth of cells (e.g., a neoplasia).
  • cancer refers to all types of cancer or neoplasm or malignant tumors found in animals, including carcinoma, adenoma, melanoma, sarcoma, lymphoma, leukemia, blastoma, glioma, astrocytoma, mesothelioma, or a germ cell tumor.
  • Cancer may include cancer of, for example, the colon, rectum, stomach, bladder, cervix, uterus, skin, epithelium, muscle, kidney, liver, lymph, bone, blood, ovary, prostate, lung, brain, head and neck, and/or breast.
  • Cancer may include medullablastoma, non-small cell lung cancer, and/or mesothelioma.
  • the cancer includes leukemia.
  • leukemia refers to broadly progressive, malignant diseases of the hematopoietic organs/systems and is generally characterized by a distorted proliferation and development of leukocytes and their precursors in the blood and bone marrow.
  • Leukemia diseases include, for example, acute nonlymphocytic leukemia, chronic lymphocytic leukemia, acute granulocytic leukemia, chronic granulocytic leukemia, acute promyelocytic leukemia, adult T-cell leukemia, aleukemic leukemia, a leukocythemic leukemia, basophilic leukemia, blast cell leukemia, bovine leukemia, chronic myelocytic leukemia, leukemia cutis, embryonal leukemia, eosinophilic leukemia, Gross' leukemia, Rieder cell leukemia, Schilling's leukemia, stem cell leukemia, subleukemic leukemia, undifferentiated cell leukemia, hairy-cell leukemia, hemoblastic leukemia, hemocytoblastic leukemia, histiocytic leukemia, stem cell leukemia, acute monocytic leukemia, leukopenic leukemia, lymphatic leukemia,
  • the leukemia is chronic myeloid leukemia (CML). In some embodiments, the leukemia is acute myeloid leukemia (AML).
  • CML chronic myeloid leukemia
  • AML acute myeloid leukemia
  • CRISPRs Clustered Regularly Interspaced Short Palindromic Repeats” and “CRISPRs”, as used interchangeably herein, refers to loci containing multiple short direct repeats that are found in the genomes of approximately 40% of sequenced bacteria and 90% of sequenced archaea.
  • Coding sequence or “encoding nucleic acid” as used herein means the nucleic acids (RNA or DNA molecule) that comprise a nucleotide sequence which encodes a protein.
  • the coding sequence can further include initiation and termination signals operably linked to regulatory elements including a promoter and polyadenylation signal capable of directing expression in the cells of an individual or mammal to which the nucleic acid is administered.
  • the regulatory elements may include, for example, a promoter, an enhancer, an initiation codon, a stop codon, or a polyadenylation signal.
  • the coding sequence may be codon optimized.
  • “Complement” or “complementary” as used herein means a nucleic acid can mean Watson-Crick (e.g., A-T/U and C-G) or Hoogsteen base pairing between nucleotides or nucleotide analogs of nucleic acid molecules.
  • “Complementarity” refers to a property shared between two nucleic acid sequences, such that when they are aligned antiparallel to each other, the nucleotide bases at each position will be complementary.
  • “Contacting” as used herein, as in “contacting a sample” refers to contacting a sample directly or indirectly in vitro, ex vivo, or in vivo (for example, within a subject or cell as defined herein). Contacting a sample may include addition of a compound to a sample, or administration to a subject or a cell. Contacting encompasses administration to a solution, cell, tissue, mammal, subject, patient, or human. Further, contacting a cell includes adding an agent to a cell culture.
  • the terms “control,” “reference level,” and “reference” are used herein interchangeably.
  • the reference level may be a predetermined value or range, which is employed as a benchmark against which to assess the measured result.
  • Control group refers to a group of control subjects.
  • the predetermined level may be a cutoff value from a control group.
  • the predetermined level may be an average from a control group. Cutoff values (or predetermined cutoff values) may be determined by Adaptive Index Model (AIM) methodology. Cutoff values (or predetermined cutoff values) may be determined by a receiver operating curve (ROC) analysis from biological samples of the patient group.
  • AIM Adaptive Index Model
  • ROC analysis is a determination of the ability of a test to discriminate one condition from another, e.g., to determine the performance of each marker in identifying a patient having CRC.
  • a description of ROC analysis is provided in P.J. Heagerty et al. (Biometrics 2000, 56, 337-44), the disclosure of which is hereby incorporated by reference in its entirety.
  • cutoff values may be determined by a quartile analysis of biological samples of a patient group.
  • a cutoff value may be determined by selecting a value that corresponds to any value in the 25 th -75 th percentile range, preferably a value that corresponds to the 25 th percentile, the 50 th percentile or the 75 th percentile, and more preferably the 75 th percentile.
  • Such statistical analyses may be performed using any method known in the art and can be implemented through any number of commercially available software packages (e.g., from Analyse-it Software Ltd., Leeds, UK; StataCorp LP, College Station, TX; SAS Institute Inc., Cary, NC.).
  • the healthy or normal levels or ranges for a target or for a protein activity may be defined in accordance with standard practice.
  • a control may be a subject or cell without a composition as detailed herein.
  • a control may be a subject, or a sample therefrom, whose disease state is known.
  • the subject, or sample therefrom may be healthy, diseased, diseased prior to treatment, diseased during treatment, or diseased after treatment, or a combination thereof.
  • “Correcting”, “gene editing,” and “restoring” as used herein refers to changing a mutant gene that encodes a dysfunctional protein or truncated protein or no protein at all, such that a full-length functional or partially full-length functional protein expression is obtained.
  • Correcting or restoring a mutant gene may include replacing the region of the gene that has the mutation or replacing the entire mutant gene with a copy of the gene that does not have the mutation with a repair mechanism such as homology-directed repair (HDR).
  • Correcting or restoring a mutant gene may also include repairing a frameshift mutation that causes a premature stop codon, an aberrant splice acceptor site or an aberrant splice donor site, by generating a double stranded break in the gene that is then repaired using non-homologous end joining (NHEJ).
  • NHEJ may add or delete at least one base pair during repair which may restore the proper reading frame and eliminate the premature stop codon.
  • Correcting or restoring a mutant gene may also include disrupting an aberrant splice acceptor site or splice donor sequence. Correcting or restoring a mutant gene may also include deleting a non-essential gene segment by the simultaneous action of two nucleases on the same DNA strand in order to restore the proper reading frame by removing the DNA between the two nuclease target sites and repairing the DNA break by NHEJ.
  • the term “disease” as used herein includes, but is not limited to, any abnormal condition and/or disorder of a structure or a function that affects a part of an organism. It may be caused by an external factor, such as an infectious disease, or by internal dysfunctions, such as cancer, cancer metastasis, and the like.
  • Donor DNA refers to a double-stranded DNA fragment or molecule that includes at least a portion of the gene of interest.
  • the donor DNA may encode a full-functional protein or a partially functional protein.
  • Enhancer refers to non-coding DNA sequences containing multiple activator and repressor binding sites. Enhancers range from 200 bp to 1 kb in length and may be either proximal, 5’ upstream to the promoter or within the first intron of the regulated gene, or distal, in introns of neighboring genes or intergenic regions far away from the locus.
  • enhancers Through DNA looping, active enhancers contact the promoter dependently of the core DNA binding motif promoter specificity. 4 to 5 enhancers may interact with a promoter. Similarly, enhancers may regulate more than one gene without linkage restriction and may “skip” neighboring genes to regulate more distant ones. Transcriptional regulation may involve elements located in a chromosome different to one where the promoter resides. Proximal enhancers or promoters of neighboring genes may serve as platforms to recruit more distal elements. [00051] “Frameshift” or “frameshift mutation” as used interchangeably herein refers to a type of gene mutation wherein the addition or deletion of one or more nucleotides causes a shift in the reading frame of the codons in the mRNA.
  • “Functional” and “full-functional” as used herein describes protein that has biological activity.
  • a “functional gene” refers to a gene transcribed to mRNA, which is translated to a functional protein.
  • Fusion protein refers to a chimeric protein created through the joining of two or more genes that originally coded for separate proteins. The translation of the fusion gene results in a single polypeptide with functional properties derived from each of the original proteins.
  • Geneetic construct refers to the DNA or RNA molecules that comprise a polynucleotide that encodes a protein.
  • the coding sequence includes initiation and termination signals operably linked to regulatory elements including a promoter and polyadenylation signal capable of directing expression in the cells of the individual to whom the nucleic acid molecule is administered.
  • the term “expressible form” refers to gene constructs that contain the necessary regulatory elements operable linked to a coding sequence that encodes a protein such that when present in the cell of the individual, the coding sequence will be expressed.
  • the regulatory elements may include, for example, a promoter, an enhancer, an initiation codon, a stop codon, or a polyadenylation signal.
  • Genome editing refers to changing the DNA sequence of a gene. Genome editing may include correcting or restoring a mutant gene or adding additional mutations. Genome editing may include knocking out a gene, such as a mutant gene or a normal gene. Genome editing may be used to treat disease or, for example, enhance muscle repair, by changing the gene of interest. In some embodiments, the compositions and methods detailed herein are for use in somatic cells and not germ line cells.
  • heterologous refers to nucleic acid comprising two or more subsequences that are not found in the same relationship to each other in nature.
  • a nucleic acid that is recombinantly produced typically has two or more sequences from unrelated genes synthetically arranged to make a new functional nucleic acid, for example, a promoter from one source and a coding region from another source.
  • the two nucleic acids are thus heterologous to each other in this context.
  • the recombinant nucleic acids When added to a cell, the recombinant nucleic acids would also be heterologous to the endogenous genes of the cell.
  • a heterologous nucleic acid would include a non-native (non- naturally occurring) nucleic acid that has integrated into the chromosome, or a non-native (non-naturally occurring) extrachromosomal nucleic acid.
  • a heterologous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (for example, a “fusion protein,” where the two subsequences are encoded by a single nucleic acid sequence).
  • “Homology-directed repair” or “HDR” as used interchangeably herein refers to a mechanism in cells to repair double strand DNA lesions when a homologous piece of DNA is present in the nucleus, mostly in G2 and S phase of the cell cycle. HDR uses a donor DNA template to guide repair and may be used to create specific sequence changes to the genome, including the targeted addition of whole genes.
  • a donor template is provided along with the CRISPR/Cas-based gene editing system, then the cellular machinery will repair the break by homologous recombination, which is enhanced several orders of magnitude in the presence of DNA cleavage. When the homologous DNA piece is absent, non-homologous end joining may take place instead.
  • “Identical” or “identity” as a percentage as used herein in the context of two or more polynucleotide or polypeptide sequences means that the sequences have a specified percentage of residues that are the same over a specified region.
  • the percentage may be calculated by optimally aligning the two sequences, comparing the two sequences over the specified region, determining the number of positions at which the identical residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the specified region, and multiplying the result by 100 to yield the percentage of sequence identity.
  • the residues of single sequence are included in the denominator but not the numerator of the calculation.
  • “Mutant gene” or “mutated gene” as used interchangeably herein refers to a gene that has undergone a detectable mutation. A mutant gene has undergone a change, such as the loss, gain, or exchange of genetic material, which affects the normal transmission and expression of the gene.
  • a “disrupted gene” as used herein refers to a mutant gene that has a mutation that causes a premature stop codon. The disrupted gene product is truncated relative to a full-length undisrupted gene product.
  • Non-homologous end joining (NHEJ) pathway refers to a pathway that repairs double-strand breaks in DNA by directly ligating the break ends without the need for a homologous template.
  • the template-independent re-ligation of DNA ends by NHEJ is a stochastic, error-prone repair process that introduces random micro-insertions and micro-deletions (indels) at the DNA breakpoint. This method may be used to intentionally disrupt, delete, or alter the reading frame of targeted gene sequences.
  • NHEJ typically uses short homologous DNA sequences called microhomologies to guide repair. These microhomologies are often present in single-stranded overhangs on the end of double-strand breaks.
  • NHEJ When the overhangs are perfectly compatible, NHEJ usually repairs the break accurately, yet imprecise repair leading to loss of nucleotides may also occur, but is much more common when the overhangs are not compatible.
  • Nuclease mediated NHEJ refers to NHEJ that is initiated after a nuclease cuts double stranded DNA.
  • Normal gene as used herein refers to a gene that has not undergone a change, such as a loss, gain, or exchange of genetic material. The normal gene undergoes normal gene transmission and gene expression. For example, a normal gene may be a wild-type gene.
  • Nucleic acid or “oligonucleotide” or “polynucleotide” as used herein means at least two nucleotides covalently linked together.
  • the depiction of a single strand also defines the sequence of the complementary strand.
  • a polynucleotide also encompasses the complementary strand of a depicted single strand.
  • Many variants of a polynucleotide may be used for the same purpose as a given polynucleotide.
  • a polynucleotide also encompasses substantially identical polynucleotides and complements thereof.
  • a single strand provides a probe that may hybridize to a target sequence under stringent hybridization conditions.
  • a polynucleotide also encompasses a probe that hybridizes under stringent hybridization conditions.
  • Polynucleotides may be single stranded or double stranded or may contain portions of both double stranded and single stranded sequence.
  • the polynucleotide can be nucleic acid, natural or synthetic, DNA, genomic DNA, Cdna, RNA, mRNA, or a hybrid, where the polynucleotide can contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including, for example, uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine, and isoguanine.
  • Polynucleotides can be obtained by chemical synthesis methods or by recombinant methods.
  • Open reading frame refers to a stretch of codons that begins with a start codon and ends at a stop codon. In eukaryotic genes with multiple exons, introns are removed, and exons are then joined together after transcription to yield the final mRNA for protein translation.
  • An open reading frame may be a continuous stretch of codons. In some embodiments, the open reading frame only applies to spliced mRNAs, not genomic DNA, for expression of a protein.
  • “Operably linked” as used herein means that expression of a gene is under the control of a promoter with which it is spatially connected. A promoter may be positioned 5’ (upstream) or 3’ (downstream) of a gene under its control.
  • the distance between the promoter and a gene may be approximately the same as the distance between that promoter and the gene it controls in the gene from which the promoter is derived. As is known in the art, variation in this distance may be accommodated without loss of promoter function.
  • Nucleic acid or amino acid sequences are “operably linked” (or “operatively linked”) when placed into a functional relationship with one another. For instance, a promoter or enhancer is operably linked to a coding sequence if it regulates, or contributes to the modulation of, the transcription of the coding sequence. Operably linked DNA sequences are typically contiguous, and operably linked amino acid sequences are typically contiguous and in the same reading frame.
  • enhancers generally function when separated from the promoter by up to several kilobases or more and intronic sequences may be of variable lengths
  • some polynucleotide elements may be operably linked but not contiguous.
  • certain amino acid sequences that are non-contiguous in a primary polypeptide sequence may nonetheless be operably linked due to, for example folding of a polypeptide chain.
  • operatively linked and “operably linked” can refer to the fact that each of the components performs the same function in linkage to the other component as it would if it were not so linked.
  • Partially-functional as used herein describes a protein that is encoded by a mutant gene and has less biological activity than a functional protein but more than a non- functional protein.
  • a “peptide” or “polypeptide” is a linked sequence of two or more amino acids linked by peptide bonds.
  • the polypeptide can be natural, synthetic, or a modification or combination of natural and synthetic.
  • Peptides and polypeptides include proteins such as binding proteins, receptors, and antibodies.
  • the terms “polypeptide”, “protein,” and “peptide” are used interchangeably herein.
  • Primary structure refers to the amino acid sequence of a particular peptide.
  • “Secondary structure” refers to locally ordered, three dimensional structures within a polypeptide. These structures are commonly known as domains, for example, enzymatic domains, extracellular domains, transmembrane domains, pore domains, and cytoplasmic tail domains. “Domains” are portions of a polypeptide that form a compact unit of the polypeptide and are typically 15 to 350 amino acids long. Exemplary domains include domains with enzymatic activity or ligand binding activity. Typical domains are made up of sections of lesser organization such as stretches of beta-sheet and alpha- helices. “Tertiary structure” refers to the complete three-dimensional structure of a polypeptide monomer.
  • “Quaternary structure” refers to the three-dimensional structure formed by the noncovalent association of independent tertiary units.
  • a “motif” is a portion of a polypeptide sequence and includes at least two amino acids.
  • a motif may be 2 to 20, 2 to 15, or 2 to 10 amino acids in length. In some embodiments, a motif includes 3, 4, 5, 6, or 7 sequential amino acids.
  • a domain may be comprised of a series of the same type of motif.
  • Premature stop codon” or “out-of-frame stop codon” as used interchangeably herein refers to nonsense mutation in a sequence of DNA, which results in a stop codon at location not normally found in the wild-type gene.
  • a premature stop codon may cause a protein to be truncated or shorter compared to the full-length version of the protein.
  • “Promoter” as used herein means a synthetic or naturally derived molecule which is capable of conferring, activating or enhancing expression of a nucleic acid in a cell.
  • a promoter may comprise one or more specific transcriptional regulatory sequences to further enhance expression and/or to alter the spatial expression and/or temporal expression of same.
  • a promoter may also comprise distal enhancer or repressor elements, which may be located as much as several thousand base pairs from the start site of transcription.
  • a promoter may be derived from sources including viral, bacterial, fungal, plants, insects, and animals.
  • a promoter may regulate the expression of a gene component constitutively, or differentially with respect to cell, the tissue or organ in which expression occurs or, with respect to the developmental stage at which expression occurs, or in response to external stimuli such as physiological stresses, pathogens, metal ions, or inducing agents.
  • promoters include the bacteriophage T7 promoter, bacteriophage T3 promoter, SP6 promoter, lac operator-promoter, tac promoter, SV40 late promoter, SV40 early promoter, RSV-LTR promoter, CMV IE promoter, SV40 early promoter or SV40 late promoter, human U6 (Hu6) promoter, and CMV IE promoter.
  • Promoters that target muscle-specific stem cells may include the CK8 promoter, the Spc5-12 promoter, and the MHCK7 promoter.
  • the term “recombinant” when used with reference to, for example, a cell, nucleic acid, protein, or vector indicates that the cell, nucleic acid, protein, or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified.
  • recombinant cells express genes that are not found within the native (naturally occurring) form of the cell or express a second copy of a native gene that is otherwise normally or abnormally expressed, under expressed, or not expressed at all.
  • sample or “test sample” as used herein can mean any sample in which the presence and/or level of a target is to be detected or determined or any sample comprising a DNA targeting or gene editing system or component thereof as detailed herein.
  • Samples may include liquids, solutions, emulsions, or suspensions. Samples may include a medical sample.
  • Samples may include any biological fluid or tissue, such as blood, whole blood, fractions of blood such as plasma and serum, muscle, interstitial fluid, sweat, saliva, urine, tears, synovial fluid, bone marrow, cerebrospinal fluid, nasal secretions, sputum, amniotic fluid, bronchoalveolar lavage fluid, gastric lavage, emesis, fecal matter, lung tissue, peripheral blood mononuclear cells, total white blood cells, lymph node cells, spleen cells, tonsil cells, cancer cells, tumor cells, bile, digestive fluid, skin, or combinations thereof.
  • the sample comprises an aliquot.
  • the sample comprises a biological fluid. Samples can be obtained by any means known in the art.
  • the sample can be used directly as obtained from a patient or can be pre-treated, such as by filtration, distillation, extraction, concentration, centrifugation, inactivation of interfering components, addition of reagents, and the like, to modify the character of the sample in some manner as discussed herein or otherwise as is known in the art.
  • the subject may be a human or a non-human.
  • the subject may be a vertebrate.
  • the subject may be a mammal.
  • the mammal may be a primate or a non- primate.
  • the mammal can be a non-primate such as, for example, cow, pig, camel, llama, hedgehog, anteater, platypus, elephant, alpaca, horse, goat, rabbit, sheep, hamster, guinea pig, cat, dog, rat, and mouse.
  • the mammal can be a primate such as a human.
  • the mammal can be a non-human primate such as, for example, monkey, cynomolgous monkey, rhesus monkey, chimpanzee, gorilla, orangutan, and gibbon.
  • the subject may be of any age or stage of development, such as, for example, an adult, an adolescent, a child, such as age 0-2, 2-4, 2-6, or 6-12 years, or an infant, such as age 0-1 years.
  • the subject may be male.
  • the subject may be female.
  • the subject has a specific genetic marker.
  • the subject may be undergoing other forms of treatment.
  • “Substantially identical” can mean that a first and second amino acid or polynucleotide sequence are at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% over a region of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100 amino acids or nucleotides, respectively.
  • Target gene refers to any nucleotide sequence encoding a known or putative gene product.
  • the target gene may be a mutated gene involved in a genetic disease.
  • the target gene may encode a known or putative gene product that is intended to be corrected or for which its expression is intended to be modulated.
  • Target region refers to the region of the target gene to which the CRISPR/Cas-based gene editing or targeting system is designed to bind.
  • Transgene as used herein refers to a gene or genetic material containing a gene sequence that has been isolated from one organism and is introduced into a different organism.
  • Transcriptional regulatory elements refers to a genetic element which can control the expression of nucleic acid sequences, such as activate, enhancer, or decrease expression, or alter the spatial and/or temporal expression of a nucleic acid sequence.
  • regulatory elements include, for example, promoters, enhancers, splicing signals, polyadenylation signals, and termination signals.
  • a regulatory element can be “endogenous,” “exogenous,” or “heterologous” with respect to the gene to which it is operably linked.
  • An “endogenous” regulatory element is one which is naturally linked with a given gene in the genome.
  • An “exogenous” or “heterologous” regulatory element is one which is not normally linked with a given gene but is placed in operable linkage with a gene by genetic manipulation.
  • “Treatment” or “treating” or “therapy” when referring to protection of a subject from a disease means suppressing, repressing, reversing, alleviating, ameliorating, or inhibiting the progress of disease, or completely eliminating a disease.
  • a treatment may be either performed in an acute or chronic way.
  • the term also refers to reducing the severity of a disease or symptoms associated with such disease prior to affliction with the disease. Treatment may result in a reduction in the incidence, frequency, severity, and/or duration of symptoms of the disease.
  • Preventing the disease involves administering a composition of the present invention to a subject prior to onset of the disease.
  • Suppressing the disease involves administering a composition of the present invention to a subject after induction of the disease but before its clinical appearance.
  • Repressing or ameliorating the disease involves administering a composition of the present invention to a subject after clinical appearance of the disease.
  • the term “gene therapy” refers to a method of treating a patient wherein polypeptides or nucleic acid sequences are transferred into cells of a patient such that activity and/or the expression of a particular gene is modulated.
  • the expression of the gene is suppressed.
  • the expression of the gene is enhanced.
  • the temporal or spatial pattern of the expression of the gene is modulated.
  • “Variant” used herein with respect to a polynucleotide means (i) a portion or fragment of a referenced nucleotide sequence; (ii) the complement of a referenced nucleotide sequence or portion thereof; (iii) a nucleic acid that is substantially identical to a referenced nucleic acid or the complement thereof; or (iv) a nucleic acid that hybridizes under stringent conditions to the referenced nucleic acid, complement thereof, or a sequence substantially identical thereto.
  • a variant can be a polynucleotide sequence that is substantially identical over the full length of the full polynucleotide sequence or a fragment thereof.
  • the polynucleotide sequence can be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or less than 100% identical over the full length of the polynucleotide sequence or a fragment thereof.
  • Variant may also mean a protein with an amino acid sequence that is substantially identical to a referenced protein with an amino acid sequence that retains at least one biological activity.
  • biological activity include the ability to be bound by a specific antibody or polypeptide or to promote an immune response.
  • Variant can mean a functional fragment thereof.
  • Variant can also mean multiple copies of a polypeptide. The multiple copies can be in tandem or separated by a linker.
  • a conservative substitution of an amino acid for example, replacing an amino acid with a different amino acid of similar properties (for example, hydrophilicity, degree and distribution of charged regions) is recognized in the art as typically involving a minor change. These minor changes may be identified, in part, by considering the hydropathic index of amino acids, as understood in the art (Kyte et al., J. Mol. Biol.1982, 157, 105-132).
  • the hydropathic index of an amino acid is based on a consideration of its hydrophobicity and charge. It is known in the art that amino acids of similar hydropathic indexes may be substituted and still retain protein function. In one aspect, amino acids having hydropathic indexes of ⁇ 2 are substituted.
  • the hydrophilicity of amino acids may also be used to reveal substitutions that would result in proteins retaining biological function. A consideration of the hydrophilicity of amino acids in the context of a peptide permits calculation of the greatest local average hydrophilicity of that peptide. Substitutions may be performed with amino acids having hydrophilicity values within ⁇ 2 of each other. Both the hydrophobicity index and the hydrophilicity value of amino acids are influenced by the particular side chain of that amino acid.
  • amino acid substitutions that are compatible with biological function are understood to depend on the relative similarity of the amino acids, and particularly the side chains of those amino acids, as revealed by the hydrophobicity, hydrophilicity, charge, size, and other properties.
  • a variant can be an amino acid sequence that is substantially identical over the full length of the amino acid sequence or fragment thereof.
  • the amino acid sequence can be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or less than 100% identical over the full length of the amino acid sequence or a fragment thereof.
  • Vector as used herein means a nucleic acid sequence containing an origin of replication.
  • a vector may be capable of directing the delivery or transfer of a polynucleotide sequence to target cells, where it can be replicated or expressed.
  • a vector may contain an origin of replication, one or more regulatory elements, and/or one or more coding sequences.
  • a vector may be a viral vector, bacteriophage, bacterial artificial chromosome, plasmid, cosmid, or yeast artificial chromosome.
  • a vector may be a DNA or RNA vector.
  • a vector may be a self-replicating extrachromosomal vector.
  • Viral vectors include, but are not limited to, adenovirus vector, adeno-associated virus (AAV) vector, retrovirus vector, or lentivirus vector.
  • a vector may be an adeno-associated virus (AAV) vector.
  • the vector may encode a Cas protein and at least one gRNA molecule.
  • DNA Targeting Systems Provided herein are DNA Targeting Systems.
  • a “DNA Targeting System” as used herein is a system capable of specifically targeting a particular region of DNA and modifying the genome or modulating gene expression by binding to that region.
  • the DNA Targeting System may be a nuclease system that acts through mutating or editing the target region (such as by insertion, deletion or substitution) or it may be a system that delivers a functional second polypeptide domain, such as an activator or repressor, to the target region.
  • the DNA targeting system comprises a DNA-binding portion or domain that specifically recognizes and binds to a particular target region of a target DNA.
  • the DNA- binding portion (for example, a Cas protein) can be linked to a second protein domain, such as a polypeptide with transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nuclease activity, nucleic acid association activity, methylase activity, demethylase activity, acetylation activity, or deacetylation activity, to form a fusion protein.
  • a second protein domain such as a polypeptide with transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nuclease activity, nucleic acid association activity, methylase activity, demethylase activity, acetylation activity, or deacetylation activity, to form a fusion protein.
  • Exemplary second polypeptide domains are detailed further below (see “Cas12a Fusion Protein”).
  • the DNA-binding portion can be linked to an activator and thus guide the activator to a specific target region of the target DNA.
  • the DNA-binding portion can be linked to a repressor and thus guide the repressor to a specific target region of the target DNA.
  • the DNA-binding portion comprises a Cas protein.
  • the DNA targeting system may include a Cas protein or a fusion protein, and at least one gRNA, and may also be referred to as a “CRISPR-Cas system.”
  • CRISPR-Cas system “Clustered Regularly Interspaced Short Palindromic Repeats” and “CRISPRs”, as used interchangeably herein, refers to loci containing multiple short direct repeats that are found in the genomes of approximately 40% of sequenced bacteria and 90% of sequenced archaea.
  • the CRISPR system is a microbial nuclease system involved in defense against invading phages and plasmids that provides a form of acquired immunity.
  • the CRISPR loci in microbial hosts contain a combination of CRISPR- associated (Cas) genes as well as non-coding RNA elements capable of programming the specificity of the CRISPR-mediated nucleic acid cleavage. Short segments of foreign DNA, called spacers, are incorporated into the genome between CRISPR repeats, and serve as a “memory” of past exposures.
  • Cas proteins include, for example, Cas12a, Cas9, and Cascade proteins. a.
  • Cas12a Protein [00085]
  • the DNA-binding portion may comprise a Cas12a protein.
  • Cas12a also known as Cpf1 is a Type V CRISPR-Cas effector endonuclease. Cas12a causes a staggered cut in double stranded DNA, while Cas9 produces a blunt cut. Cas12a forms a complex with the 5’ end of the guide RNA (gRNA), and the protein-gRNA pair recognizes its genomic target by complementary base pairing between the 3’ end of the gRNA sequence and a predefined DNA sequence, known as the protospacer. This complex is directed to homologous loci of DNA via regions encoded within the gRNA, i.e., the protospacers, and protospacer-adjacent motifs (PAMs) within the genome.
  • gRNA guide RNA
  • PAMs protospacer-adjacent motifs
  • Cas12a may function with PAM sequences rich in thymine “T.”
  • the Cas12a protein can be from any bacterial or archaea species, including, but not limited to, Acidaminococcus spp. (As) and Lachnospiraceae spp. (Lb).
  • the Cas12a protein is a Acidaminococcus spp.
  • Cas12a protein also referred herein as “AsCas12a”.
  • AsCas12a may comprise an amino acid sequence of SEQ ID NO: 16, encoded by a polynucleotide comprising SEQ ID NO: 17.
  • AsCas12a may comprise an amino acid sequence having one, two, three, four, or five or more changes selected from amino acid substitutions, insertions, or deletions, relative to the amino acid sequence of SEQ ID NO: 16.
  • AsCas12a may comprise an amino acid sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the amino acid sequence of SEQ ID NO: 16.
  • AsCas12a may be encoded by a polynucleotide comprising a sequence having one, two, three, four, or five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to the polynucleotide sequence of SEQ ID NO: 17.
  • AsCas12a may be encoded by a polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the polynucleotide sequence of SEQ ID NO: 17.
  • the Cas12a molecule is a Lachnospiraceae spp. Cas12a protein (also referred herein as “LbCas12a”).
  • LbCas12a may comprise an amino acid sequence of SEQ ID NO: 18, encoded by a polynucleotide comprising SEQ ID NO: 19.
  • LbCas12a may comprise an amino acid sequence having one, two, three, four, or five or more changes selected from amino acid substitutions, insertions, or deletions, relative to the amino acid sequence of SEQ ID NO: 18.
  • LbCas12a may comprise an amino acid sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the amino acid sequence of SEQ ID NO: 18.
  • LbCas12a may be encoded by a polynucleotide comprising a sequence having one, two, three, four, or five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to the polynucleotide sequence of SEQ ID NO: 19.
  • LbCas12a may be encoded by a polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the polynucleotide sequence of SEQ ID NO: 19.
  • a Cas12a molecule or a Cas12a fusion protein can interact with one or more gRNA molecule(s) and, in concert with the gRNA molecule(s), can localize to a site which comprises a target domain, and in certain embodiments, a PAM sequence.
  • the Cas12a protein forms a complex with the 5’ end of a gRNA.
  • the ability of a Cas12a molecule or a Cas12a fusion protein to recognize a PAM sequence can be determined, for example, by using a transformation assay as known in the art.
  • the specificity of the CRISPR-based system may depend on two factors: the target sequence and the protospacer-adjacent motif (PAM).
  • the target sequence is located on the 5’ end of the gRNA and is designed to bond with base pairs on the host DNA at the correct DNA sequence known as the protospacer.
  • the Cas12a protein can be directed to new genomic targets.
  • the ability of a Cas12a molecule or a Cas12a fusion protein to interact with and cleave a target nucleic acid is PAM sequence dependent.
  • the PAM sequence is located on the DNA to be altered (a sequence in the target nucleic acid) and is recognized by a Cas12a protein.
  • PAM recognition sequences of the Cas12a protein can be species specific.
  • cleavage of the target nucleic acid occurs upstream from the PAM sequence.
  • AsCas12a and LbCas12a may each recognize a PAM sequence of TTTV (wherein V is A or C or G; SEQ ID NO: 1).
  • Modified Cas12a proteins may recognize other PAM sequences.
  • As-EnCas12a or As-dEnCas12a may recognize a PAM sequence of TTYN (wherein Y is C or T, and N is A or T or C or G; SEQ ID NO: 2), VTTV (wherein V is A or C or G; SEQ ID NO: 3), and/or TRTV (wherein R is A or G, and V is A or C or G; SEQ ID NO: 4).
  • a Cas12a may recognize a PAM and direct cleavage of a target nucleic acid sequence 1 to 10, for example, 3 to 5, bp upstream from the PAM.
  • Cas12a proteins can be engineered to alter the PAM specificity of the Cas12a proteins.
  • a nucleic acid encoding a Cas12a protein or Cas12a fusion protein may comprise a nuclear localization sequence (NLS).
  • Nuclear localization sequences are known in the art, for example, SV40 NLS (Pro-Lys-Lys-Lys-Arg-Lys-Val; SEQ ID NO: 9).
  • the at least one Cas12a protein is a mutant Cas12a protein.
  • the Cas12a protein can be mutated so that the nuclease activity is inactivated.
  • An inactivated Cas12a protein may be referred to as “dCas12a.”
  • Exemplary mutations with reference to the wild-type AsCas12a sequence to inactivate the nuclease activity include D908A.
  • An AsCas12a protein with mutations to inactivate the nuclease activity (“As-dCas12a”) may comprise a polypeptide having the amino acid sequence of SEQ ID NO: 20, encoded by a polynucleotide comprising the sequence of SEQ ID NO: 21.
  • As- dCas12a may comprise an amino acid sequence having one, two, three, four, or five or more changes selected from amino acid substitutions, insertions, or deletions, relative to the amino acid sequence of SEQ ID NO: 20.
  • As-dCas12a may comprise an amino acid sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the amino acid sequence of SEQ ID NO: 20.
  • As-dCas12a may be encoded by a polynucleotide comprising a sequence having one, two, three, four, or five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to the polynucleotide sequence of SEQ ID NO: 21.
  • As-dCas12a may be encoded by a polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the polynucleotide sequence of SEQ ID NO: 21.
  • As-dEnCas12a Enhanced As-dCas12a (“As-dEnCas12a”). Relative to As-dCas12a, As- dEnCas12a includes the amino acid mutations E174R, S542R, and K548R. Relative to wild- type As-Cas12a, As-dEnCas12a includes the amino acid mutations D908A, E174R, S542R, and K548R. As-dEnCas12a may have enhanced (non-nuclease) activity relative to As- dCas12a.
  • As-dEnCas12a may comprise a polypeptide having the amino acid sequence of SEQ ID NO: 22, encoded by a polynucleotide comprising the sequence of SEQ ID NO: 23.
  • As-dEnCas12a may comprise an amino acid sequence having one, two, three, four, or five or more changes selected from amino acid substitutions, insertions, or deletions, relative to the amino acid sequence of SEQ ID NO: 22.
  • As-dEnCas12a may comprise an amino acid sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the amino acid sequence of SEQ ID NO: 22.
  • As-dEnCas12a may be encoded by a polynucleotide comprising a sequence having one, two, three, four, or five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to the polynucleotide sequence of SEQ ID NO: 23.
  • As-dEnCas12a may be encoded by a polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the polynucleotide sequence of SEQ ID NO: 23.
  • Exemplary mutations with reference to the wild-type LbCas12a sequence to inactivate the nuclease activity include D832A.
  • Lb-Cas12a protein with mutations to inactivate the nuclease activity may comprise a polypeptide having the amino acid sequence of SEQ ID NO: 24, encoded by a polypeptide sequence of SEQ ID NO: 25.
  • LbCas12a may comprise an amino acid sequence having one, two, three, four, or five or more changes selected from amino acid substitutions, insertions, or deletions, relative to the amino acid sequence of SEQ ID NO: 24.
  • LbCas12a may comprise an amino acid sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the amino acid sequence of SEQ ID NO: 24.
  • LbCas12a may be encoded by a polynucleotide comprising a sequence having one, two, three, four, or five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to the polynucleotide sequence of SEQ ID NO: 25.
  • LbCas12a may be encoded by a polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the polynucleotide sequence of SEQ ID NO: 25.
  • Lb-Cas12a Another example of an Lb-Cas12a protein with mutations to inactivate the nuclease activity is Hyper Lb-Cas12a (“Lb-dHyperCas12a”). Relative to Lb-dCas12a, Lb- dHyperCas12a includes the amino acid mutations D156R, D235R, E292R and D350R. Relative to wild-type Lb-Cas12a, Lb-dHyperCas12a includes the amino acid mutations D832A, D156R, D235R, E292R, and D350R.
  • Lb-dHyperCas12a may have enhanced (non- nuclease) activity relative to Lb-dCas12a.
  • Lb-dHyperCas12a may comprise a polypeptide having the amino acid sequence of SEQ ID NO: 26, encoded by a polynucleotide comprising the sequence of SEQ ID NO: 27.
  • Lb-dHyperCas12a may comprise an amino acid sequence having one, two, three, four, or five or more changes selected from amino acid substitutions, insertions, or deletions, relative to the amino acid sequence of SEQ ID NO: 26.
  • Lb- dHyperCas12a may comprise an amino acid sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the amino acid sequence of SEQ ID NO: 26.
  • Lb- dHyperCas12a may be encoded by a polynucleotide comprising a sequence having one, two, three, four, or five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to the polynucleotide sequence of SEQ ID NO: 27.
  • Lb-dHyperCas12a may be encoded by a polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the polynucleotide sequence of SEQ ID NO: 27.
  • a polynucleotide encoding a Cas12a molecule can be a synthetic polynucleotide.
  • the synthetic polynucleotide can be chemically modified.
  • the synthetic polynucleotide can be codon optimized, for example, at least one non-common codon or less-common codon has been replaced by a common codon.
  • the synthetic polynucleotide can direct the synthesis of an optimized messenger mRNA, for example, optimized for expression in a mammalian expression system, as described herein.
  • a Cas12a protein may be used to modify the sequence of a gene and/or modulate the expression of a gene.
  • the gene to be modified and/or modulated may be a wild-type gene.
  • the gene may be a mutant gene.
  • a mutant gene may include one or more mutations relative to the wild-type gene. Mutations may include, for example, nucleotide deletions, substitutions, additions, transversions, or combinations thereof.
  • a mutation in the gene may be a functional deletion of the gene.
  • the mutation in the gene comprises an insertion or deletion in the gene that prevents protein expression from the gene. Mutations may be in one or more exons and/or introns. Mutations may include deletions of all or parts of at least one intron and/or exon. An exon of a mutant gene may be mutated or at least partially deleted from the gene. An exon of a mutant gene may be fully deleted. A mutant gene may have a portion or fragment thereof that corresponds to the corresponding sequence in the wild-type gene. In some embodiments, a disrupted gene caused by a deleted or mutated exon can be restored by adding back the corresponding wild-type exon.
  • the CRISPR/Cas-based gene editing system can include a Cas12a fusion protein.
  • the fusion protein can comprise two heterologous polypeptide domains.
  • the first polypeptide domain comprises a Cas12a protein or a mutated Cas12a protein.
  • the first polypeptide domain is fused to at least one second polypeptide domain.
  • the second polypeptide domain has a different activity that what is endogenous to Cas12a protein.
  • the second polypeptide domain may have an activity such as transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nuclease activity, nucleic acid association activity, histone methylase activity, DNA methylase activity, histone demethylase activity, DNA demethylase activity, acetylation activity, and/or deacetylation activity.
  • the activity of the second polypeptide domain may be direct or indirect.
  • the second polypeptide domain may have this activity itself (direct), or it may recruit and/or interact with a polypeptide domain that has this activity (indirect).
  • the second polypeptide domain has transcription activation activity.
  • the second polypeptide domain has transcription repression activity.
  • the second polypeptide domain comprises a synthetic transcription factor.
  • the second polypeptide domain may be at the C- terminal end of the first polypeptide domain, or at the N-terminal end of the first polypeptide domain, or a combination thereof.
  • the fusion protein may include one second polypeptide domain. In some embodiments, the fusion protein comprises more than one second polypeptide domain.
  • the fusion protein may include two of the second polypeptide domains. For example, the fusion protein may include a second polypeptide domain at the N-terminal end of the first polypeptide domain as well as a second polypeptide domain at the C-terminal end of the first polypeptide domain.
  • the fusion protein may include a single first polypeptide domain and more than one (for example, two or three) second polypeptide domains in tandem.
  • the linkage from the first polypeptide domain to the second polypeptide domain can be through reversible or irreversible covalent linkage or through a non-covalent linkage, as long as the linker does not interfere with the function of the second polypeptide domain.
  • a Cas12a polypeptide can be linked to a second polypeptide domain as part of a fusion protein.
  • the fusion protein includes at least one linker.
  • a linker may be included anywhere in the polypeptide sequence of the fusion protein, for example, between the first and second polypeptide domains.
  • a linker may be of any length and design to promote or restrict the mobility of components in the fusion protein.
  • a linker may comprise any amino acid sequence of about 2 to about 100, about 5 to about 80, about 10 to about 60, or about 20 to about 50 amino acids.
  • a linker may comprise an amino acid sequence of at least about 2, 3, 4, 5, 10, 15, 20, 25, or 30 amino acids.
  • a linker may comprise an amino acid sequence of less than about 100, 90, 80, 70, 60, 50, or 40 amino acids.
  • a linker may include sequential or tandem repeats of an amino acid sequence that is 2 to 20 amino acids in length.
  • Linkers may include, for example, a GS linker (Gly-Gly-Gly- Gly-Ser) n , wherein n is an integer between 0 and 10 (SEQ ID NO: 10).
  • n can be adjusted to optimize the linker length and achieve appropriate separation of the functional domains.
  • linkers may include, for example, Gly-Gly-Gly-Gly-Gly-Gly (SEQ ID NO: 11), Gly-Gly-Ala-Gly-Gly (SEQ ID NO: 12), Gly/Ser rich linkers such as Gly-Gly-Gly-Gly- Ser-Ser-Ser (SEQ ID NO: 13), or Gly/Ala rich linkers such as Gly-Gly-Gly-Gly-Ala-Ala-Ala (SEQ ID NO: 14).
  • Linkers may also include SGSETPGTSESATPES (which may be referred to as an XTEN linker; SEQ ID NO: 15).
  • the Cas12a protein and/or the Cas12a fusion protein and/or gRNAs detailed herein may be used in compositions and methods for modulating expression of gene.
  • the term “reducing” or “repressing” may be used interchangeably and refer to a decrease by a statistically significant amount.
  • the expression of the gene may be modulated by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold, relative to a control.
  • the expression of the gene may be modulated by less than about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 1.5-fold, 2-fold, 3-fold, 4-fold, 5- fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold, relative to a control.
  • the expression of the gene may be modulated by about 5-95%, 10-90%, 15-85%, 20-80%, or 1.5-fold to 10-fold, relative to a control.
  • the expression of the gene may be reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold, relative to a control.
  • the expression of the gene may be reduced by less than about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 1.5- fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold, relative to a control.
  • the expression of the gene may be reduced by about 5-95%, 10-90%, 15-85%, 20-80%, or 1.5-fold to 10-fold, relative to a control.
  • the expression of the gene may be increased by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold, relative to a control.
  • the expression of the gene may be increased by less than about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold, relative to a control.
  • the expression of the gene may be increased by about 5-95%, 10- 90%, 15-85%, 20-80%, or 1.5-fold to 10-fold, relative to a control.
  • the second polypeptide domain can have transcription activation activity, for example, a transactivation domain.
  • gene expression of endogenous mammalian genes can be achieved by targeting a fusion protein of a first polypeptide domain, such as dCas12a, and a transactivation domain to mammalian promoters via a gRNA or combinations of gRNAs.
  • the transactivation domain can include, for example, p300 or a fragment thereof, and/or VPR.
  • the second polypeptide domain may comprise the histone acetyltransferase domain of p300, also known as “p300 core.”
  • the p300 protein may have histone modification activity.
  • Histone modification activity may include, for example, histone deacetylase, histone acetyltransferase, histone demethylase, and/or histone methyltransferase activity.
  • the p300 protein may have histone acetyltransferase activity.
  • the p300 protein may deposit H3K27Ac.
  • the p300 protein may comprise a polypeptide having the amino acid sequence of SEQ ID NO: 52, encoded by a polynucleotide comprising the sequence of SEQ ID NO: 53.
  • the second polypeptide domain may comprise VPR.
  • VPR may comprise a polypeptide having the amino acid sequence of SEQ ID NO: 54 encoded by a polynucleotide comprising the sequence of SEQ ID NO: 55. VPR may recruit mediators.
  • the fusion protein comprises As-dCas12a-p300, or As- dEnCas12a-p300, or Lb-dCas12a-p300, or Lb-dHyperCas12a-p300.
  • As-dCas12a-p300 may comprise a polypeptide having the amino acid sequence of SEQ ID NO: 28, encoded by a polynucleotide comprising the sequence of SEQ ID NO: 29.
  • As-dCas12a-p300 may comprise an amino acid sequence having one, two, three, four, or five or more changes selected from amino acid substitutions, insertions, or deletions, relative to the amino acid sequence of SEQ ID NO: 28.
  • As-dCas12a-p300 may comprise an amino acid sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the amino acid sequence of SEQ ID NO: 28.
  • As-dCas12a-p300 may be encoded by a polynucleotide comprising a sequence having one, two, three, four, or five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to the polynucleotide sequence of SEQ ID NO: 29.
  • As-dCas12a-p300 may be encoded by a polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the polynucleotide sequence of SEQ ID NO: 29.
  • As-dEnCas12a-p300 may comprise a polypeptide having the amino acid sequence of SEQ ID NO: 30, encoded by a polynucleotide comprising the sequence of SEQ ID NO: 31.
  • As-dEnCas12a-p300 may comprise an amino acid sequence having one, two, three, four, or five or more changes selected from amino acid substitutions, insertions, or deletions, relative to the amino acid sequence of SEQ ID NO: 30.
  • As-dEnCas12a-p300 may comprise an amino acid sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the amino acid sequence of SEQ ID NO: 30.
  • As-dEnCas12a-p300 may be encoded by a polynucleotide comprising a sequence having one, two, three, four, or five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to the polynucleotide sequence of SEQ ID NO: 31.
  • As-dEnCas12a-p300 may be encoded by a polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the polynucleotide sequence of SEQ ID NO: 31.
  • Lb-dCas12a-p300 may comprise a polypeptide having the amino acid sequence of SEQ ID NO: 32, encoded by a polynucleotide comprising the sequence of SEQ ID NO: 33.
  • Lb-dCas12a-p300 may comprise an amino acid sequence having one, two, three, four, or five or more changes selected from amino acid substitutions, insertions, or deletions, relative to the amino acid sequence of SEQ ID NO: 32.
  • Lb-dCas12a-p300 may comprise an amino acid sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the amino acid sequence of SEQ ID NO: 32.
  • Lb-dCas12a-p300 may be encoded by a polynucleotide comprising a sequence having one, two, three, four, or five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to the polynucleotide sequence of SEQ ID NO: 33.
  • Lb-dCas12a-p300 may be encoded by a polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the polynucleotide sequence of SEQ ID NO: 33.
  • Lb-dHyperCas12a-p300 may comprise a polypeptide having the amino acid sequence of SEQ ID NO: 34, encoded by a polynucleotide comprising the sequence of SEQ ID NO: 35.
  • Lb-dHyperCas12a-p300 may comprise an amino acid sequence having one, two, three, four, or five or more changes selected from amino acid substitutions, insertions, or deletions, relative to the amino acid sequence of SEQ ID NO: 34.
  • Lb-dHyperCas12a- p300 may comprise an amino acid sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the amino acid sequence of SEQ ID NO: 34.
  • Lb-dHyperCas12a-p300 may be encoded by a polynucleotide comprising a sequence having one, two, three, four, or five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to the polynucleotide sequence of SEQ ID NO: 35.
  • Lb-dHyperCas12a-p300 may be encoded by a polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the polynucleotide sequence of SEQ ID NO: 35.
  • ii) Transcription Repression Activity [000106]
  • the second polypeptide domain can have transcription repression activity.
  • Non- limiting examples of repressors include Kruppel associated box activity such as a KRAB domain or KRAB, Mad mSIN3 interaction domain (SID) or Mad-SID repressor domain, or SID4X (or 4xSID) repressor domain.
  • the second polypeptide domain has a KRAB domain activity, or SID4X repressor domain activity, or Mad-SID repressor domain activity.
  • the second polypeptide domain comprises four repeats of SID or four SID domains (4xSID). SID (and/or 4xSID) may recruit HDAC1/2.
  • 4xSID may comprise a polypeptide having the amino acid sequence of SEQ ID NO: 56 encoded by polynucleotide comprising the sequence of SEQ ID NO: 57.
  • the second polypeptide domain comprises KRAB.
  • KRAB may comprise a polypeptide having the amino acid sequence of SEQ ID NO: 58 encoded by polynucleotide comprising the sequence of SEQ ID NO: 59.
  • KRAB may recruit KAP1.
  • the fusion protein comprises As-dCas12a-4xSID, or As- dEnCas12a-4xSID, or Lb-dCas12a-4xSID, or Lb-dHyperCas12a-4xSID.
  • As-dCas12a-4xSID may comprise a polypeptide having the amino acid sequence of SEQ ID NO: 36, encoded by a polynucleotide comprising the sequence of SEQ ID NO: 37.
  • As-dCas12a-4xSID may comprise an amino acid sequence having one, two, three, four, or five or more changes selected from amino acid substitutions, insertions, or deletions, relative to the amino acid sequence of SEQ ID NO: 36.
  • As-dCas12a-4xSID may comprise an amino acid sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the amino acid sequence of SEQ ID NO: 36.
  • As-dCas12a-4xSID may be encoded by a polynucleotide comprising a sequence having one, two, three, four, or five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to the polynucleotide sequence of SEQ ID NO: 37.
  • As-dCas12a-4xSID may be encoded by a polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the polynucleotide sequence of SEQ ID NO: 37.
  • As-dEnCas12a-4xSID may comprise a polypeptide having the amino acid sequence of SEQ ID NO: 38, encoded by a polynucleotide comprising the sequence of SEQ ID NO: 39.
  • As-dEnCas12a-4xSID may comprise an amino acid sequence having one, two, three, four, or five or more changes selected from amino acid substitutions, insertions, or deletions, relative to the amino acid sequence of SEQ ID NO: 38.
  • As-dEnCas12a-4xSID may comprise an amino acid sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the amino acid sequence of SEQ ID NO: 38.
  • As-dEnCas12a-4xSID may be encoded by a polynucleotide comprising a sequence having one, two, three, four, or five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to the polynucleotide sequence of SEQ ID NO: 39.
  • As-dEnCas12a-4xSID may be encoded by a polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the polynucleotide sequence of SEQ ID NO: 39.
  • Lb-dCas12a-4xSID may comprise a polypeptide having the amino acid sequence of SEQ ID NO: 40, encoded by a polynucleotide comprising the sequence of SEQ ID NO: 41.
  • Lb-dCas12a-4xSID may comprise an amino acid sequence having one, two, three, four, or five or more changes selected from amino acid substitutions, insertions, or deletions, relative to the amino acid sequence of SEQ ID NO: 40.
  • Lb-dCas12a-4xSID may comprise an amino acid sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the amino acid sequence of SEQ ID NO: 40.
  • Lb-dCas12a-4xSID may be encoded by a polynucleotide comprising a sequence having one, two, three, four, or five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to the polynucleotide sequence of SEQ ID NO: 41.
  • Lb-dCas12a-4xSID may be encoded by a polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the polynucleotide sequence of SEQ ID NO: 41.
  • Lb-dHyperCas12a-4xSID may comprise a polypeptide having the amino acid sequence of SEQ ID NO: 42, encoded by a polynucleotide comprising the sequence of SEQ ID NO: 43.
  • Lb-dHyperCas12a-4xSID may comprise an amino acid sequence having one, two, three, four, or five or more changes selected from amino acid substitutions, insertions, or deletions, relative to the amino acid sequence of SEQ ID NO: 42.
  • Lb-dHyperCas12a- 4xSID may comprise an amino acid sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the amino acid sequence of SEQ ID NO: 42.
  • Lb-dHyperCas12a-4xSID may be encoded by a polynucleotide comprising a sequence having one, two, three, four, or five or more changes selected from nucleotide substitutions, insertions, or deletions, relative to the polynucleotide sequence of SEQ ID NO: 43.
  • Lb-dHyperCas12a-4xSID may be encoded by a polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, or 98% or greater identity to the polynucleotide sequence of SEQ ID NO: 43. c.
  • the CRISPR/Cas-based gene editing system includes at least one guide RNA (gRNA) molecule.
  • the CRISPR/Cas-based gene editing system may include two or more gRNA molecules.
  • the at least one gRNA molecule can bind and recognize a target region.
  • the gRNA is the part of the CRISPR-Cas system that provides DNA targeting specificity to the CRISPR/Cas-based gene editing system.
  • the gRNA is a fusion of two noncoding RNAs: a crRNA and a tracrRNA. gRNA mimics the naturally occurring crRNA:tracrRNA duplex involved in the Type II Effector system.
  • Cas12a uses just a crRNA; Cas12a does not use a crRNA:tracrRNA fusion.
  • the crRNA for Cas12a may be referred to as a gRNA.
  • the gRNA may target any desired DNA sequence by exchanging the sequence encoding a, for example 20 bp, protospacer which confers targeting specificity through complementary base pairing with the desired DNA target.
  • the “target region” or “target sequence” or “protospacer” refers to the region of the target gene to which the CRISPR/Cas- based gene editing system targets and binds.
  • the portion of the gRNA that targets the target sequence in the genome may be referred to as the “targeting sequence” or “targeting portion” or “targeting domain.”
  • “Protospacer” or “gRNA spacer” may refer to the region of the target gene to which the CRISPR/Cas-based gene editing system targets and binds; “protospacer” or “gRNA spacer” may also refer to the portion of the gRNA that is complementary to the targeted sequence in the genome.
  • the gRNA may include a gRNA scaffold, which may also be referred to as the constant region of the gRNA or the direct repeat (DR).
  • a gRNA scaffold facilitates Cas binding to the gRNA and may facilitate endonuclease activity.
  • the gRNA scaffold is a polynucleotide sequence that follows the portion of the gRNA corresponding to sequence that the gRNA targets. Together, the gRNA targeting portion and gRNA scaffold form one polynucleotide.
  • the gRNA scaffold (or constant region or direct repeat of the gRNA) may include the sequence of UAAUUUCUACUCUUGUAGAU (RNA; SEQ ID NO: 5), which is encoded by a sequence comprising TAATTTCTACTCTTGTAGAT (DNA; SEQ ID NO: 6 ), for As-Cas12a.
  • the gRNA scaffold (or constant region or direct repeat of the gRNA) may include the sequence of AAUUUCUACUAAGUGUAGAU (RNA; SEQ ID NO: 7), which is encoded by a sequence comprising AATTTCTACTAAGTGTAGAT (DNA; SEQ ID NO: 8), for Lb-Cas12a.
  • the CRISPR/Cas-based gene editing system may include at least one gRNA, wherein the gRNAs target different DNA sequences. The target DNA sequences may be overlapping.
  • the gRNA may comprise at its 3’ end the targeting domain that is sufficiently complementary to the target region to be able to hybridize to, for example, about 10 to about 23 nucleotides of the target region of the target gene, when it is preceded by an appropriate Protospacer Adjacent Motif (PAM).
  • PAM Protospacer Adjacent Motif
  • the target region or protospacer is preceded by a PAM sequence at the 5’ end of the protospacer in the genome.
  • Different Cas proteins have differing PAM requirements, as detailed above.
  • the targeting domain of the gRNA does not need to be perfectly complementary to the target region of the target DNA.
  • the targeting domain of the gRNA is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or at least 99% complementary to (or has 1, 2 or 3 mismatches compared to) the target region over a length of, such as, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides.
  • the DNA-targeting domain of the gRNA may be at least 80% complementary over at least 18 nucleotides of the target region.
  • the target region may be on either strand of the target DNA.
  • the gRNA may target the Cas12a protein or fusion protein to a gene or a regulatory element thereof.
  • the gRNA may target the Cas12a protein or fusion protein to a non-open chromatin region, an open chromatin region, a transcribed region of the target gene, a region upstream of a transcription start site of the target gene, a regulatory element of the target gene, an intron of the target gene, or an exon of the target gene, or a combination thereof.
  • the gRNA targets the Cas12a protein or fusion protein to a promoter of a gene.
  • the target region is located between about 1 to about 1000 base pairs upstream of a transcription start site of a target gene.
  • the DNA targeting composition comprises two or more gRNAs, each gRNA binding to a different target region.
  • the gRNA molecule comprises a targeting domain (also referred to as targeted or targeting sequence), which is a polynucleotide sequence complementary to the target DNA sequence.
  • the gRNA may comprise a “G” at the 5’ end of the targeting domain or complementary polynucleotide sequence.
  • the CRISPR/Cas-based gene editing system may use gRNAs of varying sequences and lengths.
  • the targeting domain of a gRNA molecule may comprise at least a 10 base pair, at least a 11 base pair, at least a 12 base pair, at least a 13 base pair, at least a 14 base pair, at least a 15 base pair, at least a 16 base pair, at least a 17 base pair, at least a 18 base pair, at least a 19 base pair, at least a 20 base pair, at least a 21 base pair, at least a 22 base pair, at least a 23 base pair, at least a 24 base pair, at least a 25 base pair, at least a 30 base pair, or at least a 35 base pair complementary polynucleotide sequence of the target DNA sequence followed by a PAM sequence.
  • the targeting domain of a gRNA molecule has 19-25 nucleotides in length. In certain embodiments, the targeting domain of a gRNA molecule is 20 nucleotides in length. In certain embodiments, the targeting domain of a gRNA molecule is 21 nucleotides in length. In certain embodiments, the targeting domain of a gRNA molecule is 22 nucleotides in length. In certain embodiments, the targeting domain of a gRNA molecule is 23 nucleotides in length.
  • the number of gRNA molecules that may be included in the CRISPR/Cas-based gene editing system can be at least 1 gRNA, at least 2 different gRNAs, at least 3 different gRNAs, at least 4 different gRNAs, at least 5 different gRNAs, at least 6 different gRNAs, at least 7 different gRNAs, at least 8 different gRNAs, at least 9 different gRNAs, at least 10 different gRNAs, at least 11 different gRNAs, at least 12 different gRNAs, at least 13 different gRNAs, at least 14 different gRNAs, at least 15 different gRNAs, at least 16 different gRNAs, at least 17 different gRNAs, at least 18 different gRNAs, at least 18 different gRNAs, at least 20 different gRNAs, at least 25 different gRNAs, at least 30 different gRNAs, at least 35 different gRNAs, at least 40 different gRNAs, at least 45 different gRNAs, or
  • the number of gRNA molecules that may be included in the CRISPR/Cas-based gene editing system can be less than 50 different gRNAs, less than 45 different gRNAs, less than 40 different gRNAs, less than 35 different gRNAs, less than 30 different gRNAs, less than 25 different gRNAs, less than 20 different gRNAs, less than 19 different gRNAs, less than 18 different gRNAs, less than 17 different gRNAs, less than 16 different gRNAs, less than 15 different gRNAs, less than 14 different gRNAs, less than 13 different gRNAs, less than 12 different gRNAs, less than 11 different gRNAs, less than 10 different gRNAs, less than 9 different gRNAs, less than 8 different gRNAs, less than 7 different gRNAs, less than 6 different gRNAs, less than 5 different gRNAs, less than 4 different gRNAs, less than 3 different gRNAs, or less than 2 different gRNAs.
  • the number of gRNAs that may be included in the CRISPR/Cas-based gene editing system can be between at least 1 gRNA to at least 50 different gRNAs, at least 1 gRNA to at least 45 different gRNAs, at least 1 gRNA to at least 40 different gRNAs, at least 1 gRNA to at least 35 different gRNAs, at least 1 gRNA to at least 30 different gRNAs, at least 1 gRNA to at least 25 different gRNAs, at least 1 gRNA to at least 20 different gRNAs, at least 1 gRNA to at least 16 different gRNAs, at least 1 gRNA to at least 12 different gRNAs, at least 1 gRNA to at least 8 different gRNAs, at least 1 gRNA to at least 4 different gRNAs, at least 4 gRNAs to at least 50 different gRNAs, at least 4 different gRNAs to at least 45 different gRNAs, at least 4 different gRNAs to at least 40 different g
  • the at least one gRNA comprises a gRNA array of 2 to 25 gRNAs, or 3 to 20 gRNAs, or 4 to 10 gRNAs, each gRNA binding to a different target region.
  • the different target regions may be for the same gene, and/or the different target regions may for different genes, and/or the different target regions may be for different Cas12a proteins, and/or the different target regions may be for Cas12a proteins from different species.
  • the gRNA array may comprise a first gRNA for a first Cas12a protein and a second gRNA for a second Cas12a protein.
  • the gRNA array may comprise a first gRNA for a first Cas12a protein, a second gRNA for a second Cas12a protein, and a third gRNA for a third Cas12a protein.
  • a gRNA may comprise a polynucleotide sequence selected from SEQ ID NOs: 96-131.
  • a gRNA may be encoded by a polynucleotide comprising a sequence selected from SEQ ID NOs: 60-95.
  • a gRNA may be encoded by a polynucleotide sequence selected from SEQ ID NOs: 60-95.
  • a gRNA may target and bind a polynucleotide comprising a sequence selected from SEQ ID NOs: 60-95.
  • a gRNA may target and bind a polynucleotide sequence selected from SEQ ID NOs: 60-95.
  • the CRISPR/Cas-based gene editing system may include at least one donor sequence.
  • a donor sequence comprises a polynucleotide sequence to be inserted into a genome.
  • a donor sequence may comprise a wild-type sequence of a gene.
  • the gRNA and donor sequence may be present in a variety of molar ratios. The molar ratio between the gRNA and donor sequence may be 1:1, or 1:15, or from 5:1 to 1:10, or from 1:1 to 1:5.
  • the molar ratio between the gRNA and donor sequence may be at least 1:1, at least 1:2, at least 1:3, at least 1:4, at least 1:5, at least 1:6, at least 1:7, at least 1:8, at least 1:9, at least 1:10, at least 1:15, or at least 1:20.
  • the molar ratio between the gRNA and donor sequence may be less than 20:1, less than 15:1, less than 10:1, less than 9:1, less than 8:1, less than 7:1, less than 6:1, less than 5:1, less than 4:1, less than 3:1, less than 2:1, or less than 1:1.
  • the CRISPR/Cas-based gene editing system may be used to introduce site- specific double strand breaks at targeted genomic loci.
  • HDR homology-directed repair
  • NHEJ non-homologous end joining
  • the donor template may include a nucleotide sequence encoding a full-functional protein or a partially functional protein.
  • the donor template may include fully functional gene construct for restoring a mutant gene, or a fragment of the gene that after homology-directed repair, leads to restoration of the mutant gene.
  • the donor template may include a nucleotide sequence encoding a mutated version of an inhibitory regulatory element of a gene. Mutations may include, for example, nucleotide substitutions, insertions, deletions, or a combination thereof.
  • introduced mutation(s) into the inhibitory regulatory element of the gene may reduce the transcription of or binding to the inhibitory regulatory element.
  • NHEJ Non-Homologous End Joining
  • Restoration of protein expression from gene may be through template-free NHEJ- mediated DNA repair.
  • NHEJ is a nuclease mediated NHEJ, which in certain embodiments, refers to NHEJ that is initiated a Cas molecule that cuts double stranded DNA.
  • the method comprises administering a presently disclosed CRISPR/Cas- based gene editing system or a composition comprising thereof to a subject for gene editing.
  • Nuclease mediated NHEJ may correct a mutated target gene and offer several potential advantages over the HDR pathway.
  • NHEJ does not require a donor template, which may cause nonspecific insertional mutagenesis.
  • NHEJ operates efficiently in all stages of the cell cycle and therefore may be effectively exploited in both cycling and post-mitotic cells, such as muscle fibers.
  • This provides a robust, permanent gene restoration alternative to oligonucleotide-based exon skipping or pharmacologic forced read-through of stop codons and could theoretically require as few as one drug treatment.
  • the CRISPR/Cas-based gene editing system may be encoded by or comprised within one or more genetic constructs.
  • the CRISPR/Cas-based gene editing system may comprise one or more genetic constructs.
  • the genetic construct such as a plasmid or expression vector, may comprise a nucleic acid that encodes the CRISPR/Cas-based gene editing system and/or at least one of the gRNAs.
  • a genetic construct encodes one gRNA molecule, i.e., a first gRNA molecule, and optionally a Cas12a molecule or fusion protein.
  • a genetic construct encodes two gRNA molecules, i.e., a first gRNA molecule and a second gRNA molecule, and optionally a Cas12a molecule or fusion protein.
  • a first genetic construct encodes one gRNA molecule, i.e., a first gRNA molecule, and optionally a Cas12a molecule or fusion protein
  • a second genetic construct encodes one gRNA molecule, i.e., a second gRNA molecule, and optionally a Cas12a molecule or fusion protein
  • a first genetic construct encodes one gRNA molecule and one donor sequence
  • a second genetic construct encodes a Cas12a molecule or fusion protein.
  • a first genetic construct encodes one gRNA molecule and a Cas12a molecule or fusion protein
  • a second genetic construct encodes one donor sequence.
  • a first genetic construct encodes at least one Cas12a molecule or fusion protein
  • a second genetic construct encodes at least one gRNA molecule, i.e., a first gRNA molecule.
  • a first genetic construct encodes at least one Cas12a molecule or fusion protein
  • a second genetic construct encodes an array of 2-25 gRNA molecules.
  • a first genetic construct encodes two or three Cas12a molecules or fusion proteins
  • a second genetic construct encodes an array of 2- 25 gRNA molecules.
  • a genetic construct encodes a gRNA array of multiple gRNAs, such as 2 to 25 gRNAs, or 3 to 20 gRNAs, or 4 to 10 gRNAs.
  • the sequences encoding each gRNA may be adjacent or successive to each other in the sequence.
  • the sequences encoding each gRNA may be immediately adjacent or successive to each other in the sequence.
  • a spacer sequence of 2 to 6 nucleotides or bp, or about 4 nucleotides or bp, is present between each sequence encoding a gRNA.
  • Genetic constructs may include polynucleotides such as vectors and plasmids.
  • the genetic construct may be a linear minichromosome including centromere, telomeres, or plasmids or cosmids.
  • the vector may be an expression vectors or system to produce protein by routine techniques and readily available starting materials including Sambrook et al., Molecular Cloning and Laboratory Manual, Second Ed., Cold Spring Harbor (1989), which is incorporated fully by reference.
  • the construct may be recombinant.
  • the genetic construct may be part of a genome of a recombinant viral vector, including recombinant lentivirus, recombinant adenovirus, and recombinant adenovirus associated virus.
  • the genetic construct may comprise regulatory elements for gene expression of the coding sequences of the nucleic acid.
  • the regulatory elements may be a promoter, an enhancer, an initiation codon, a stop codon, or a polyadenylation signal.
  • the genetic construct may comprise heterologous nucleic acid encoding the CRISPR/Cas-based gene editing system and may further comprise an initiation codon, which may be upstream of the CRISPR/Cas-based gene editing system coding sequence, and a stop codon, which may be downstream of the CRISPR/Cas-based gene editing system coding sequence.
  • the genetic construct may include more than one stop codon, which may be downstream of the CRISPR/Cas-based gene editing system coding sequence. In some embodiments, the genetic construct includes 1, 2, 3, 4, or 5 stop codons.
  • the genetic construct includes 1, 2, 3, 4, or 5 stop codons downstream of the sequence encoding the donor sequence.
  • a stop codon may be in-frame with a coding sequence in the CRISPR/Cas-based gene editing system.
  • one or more stop codons may be in-frame with the donor sequence.
  • the genetic construct may include one or more stop codons that are out of frame of a coding sequence in the CRISPR/Cas-based gene editing system.
  • one stop codon may be in-frame with the donor sequence, and two other stop codons may be included that are in the other two possible reading frames.
  • a genetic construct may include a stop codon for all three potential reading frames.
  • the initiation and termination codon may be in frame with the CRISPR/Cas-based gene editing system coding sequence.
  • the vector may also comprise a promoter that is operably linked to the CRISPR/Cas-based gene editing system coding sequence.
  • the promoter may be a constitutive promoter, an inducible promoter, a repressible promoter, or a regulatable promoter.
  • the promoter may be a ubiquitous promoter.
  • the promoter may be a tissue- specific promoter.
  • the tissue specific promoter may be a muscle specific promoter.
  • the tissue specific promoter may be a skin specific promoter.
  • the CRISPR/Cas-based gene editing system may be under the light-inducible or chemically inducible control to enable the dynamic control of gene/genome editing in space and time.
  • the promoter operably linked to the CRISPR/Cas-based gene editing system coding sequence may be a promoter from simian virus 40 (SV40), a mouse mammary tumor virus (MMTV) promoter, a human immunodeficiency virus (HIV) promoter such as the bovine immunodeficiency virus (BIV) long terminal repeat (LTR) promoter, a Moloney virus promoter, an avian leukosis virus (ALV) promoter, a cytomegalovirus (CMV) promoter such as the CMV immediate early promoter, Epstein Barr virus (EBV) promoter, or a Rous sarcoma virus (RSV) promoter.
  • SV40 simian virus 40
  • MMTV mouse mammary tumor virus
  • HSV human immunodeficiency virus
  • the promoter may also be a promoter from a human gene such as human ubiquitin C (hUbC), human actin, human myosin, human hemoglobin, human muscle creatine, or human metalothionein.
  • the promoter may be a RNA Pol2 promoter. Examples of a tissue specific promoter, such as a muscle or skin specific promoter, natural or synthetic, are described in U.S. Patent Application Publication No. US20040175727, the contents of which are incorporated herein in its entirety.
  • the promoter may be a CK8 promoter, a Spc512 promoter, a MHCK7 promoter, for example.
  • the genetic construct encoding the at least one gRNA may comprise a barcode sequence.
  • the barcode sequence may be 4 to 12 nucleotides or bp, or about 6 to about 10 nucleotides or bp, or about 8 nucleotides or bp in length.
  • the barcode is unique to each one of the at least one gRNA molecules.
  • each gRNA has its own unique barcode.
  • all the barcodes may be adjacent to each other in the DNA construct, forming a full or combined barcode of the individual or sub-barcodes. All the barcodes may be immediately adjacent to each other in the DNA construct, forming a full or combined barcode of the individual or sub- barcodes.
  • All the barcodes may be successive to each other in the DNA construct, forming a full or combined barcode of the individual or sub-barcodes.
  • a spacer sequence of 2 to 6 nucleotides or bp, or about 4 nucleotides or bp is present between each individual or sub-barcode in the full or combined barcode.
  • the individual barcodes, or sub-barcodes may be present in the reverse order 5’ to 3’, relative to the order of the gRNAs 5’ to 3’. Sequencing primer binding site(s) may flank one or both sides of the barcode.
  • the barcode may be 3’ of a polynucleotide encoding the at least one gRNA.
  • the genetic construct may comprise a polyadenylation signal, which may be downstream of the CRISPR/Cas-based gene editing system.
  • the polyadenylation signal may be a SV40 polyadenylation signal, LTR polyadenylation signal, bovine growth hormone (bGH) polyadenylation signal, human growth hormone (hGH) polyadenylation signal, or human ⁇ -globin polyadenylation signal.
  • the SV40 polyadenylation signal may be a polyadenylation signal from a pCEP4 vector (Invitrogen, San Diego, CA).
  • Coding sequences in the genetic construct may be optimized for stability and high levels of expression.
  • the genetic construct may also comprise an enhancer upstream of the CRISPR/Cas-based gene editing system or gRNAs.
  • the enhancer may be necessary for DNA expression.
  • the enhancer may be human actin, human myosin, human hemoglobin, human muscle creatine or a viral enhancer such as one from CMV, HA, RSV, or EBV.
  • Polynucleotide function enhancers are described in U.S. Patent Nos.5,593,972, 5,962,428, and WO94/016737, the contents of each are fully incorporated by reference.
  • the genetic construct may also comprise a mammalian origin of replication in order to maintain the vector extrachromosomally and produce multiple copies of the vector in a cell.
  • the genetic construct may also comprise a regulatory sequence, which may be well suited for gene expression in a mammalian or human cell into which the vector is administered.
  • the genetic construct may also comprise a reporter gene, such as a fluorescent protein such as green fluorescent protein (“GFP”) and/or a selectable marker, such as hygromycin (“Hygro”).
  • GFP green fluorescent protein
  • Hygro hygromycin
  • the genetic construct may be useful for transfecting cells with nucleic acid encoding the CRISPR/Cas-based gene editing system, which the transformed host cell is cultured and maintained under conditions wherein expression of the CRISPR/Cas-based gene editing system takes place.
  • the genetic construct may be transformed or transduced into a cell.
  • the genetic construct may be formulated into any suitable type of delivery vehicle including, for example, a viral vector, lentiviral expression, mRNA electroporation, and lipid-mediated transfection for delivery into a cell.
  • the genetic construct may be part of the genetic material in attenuated live microorganisms or recombinant microbial vectors which live in cells.
  • the genetic construct may be present in the cell as a functioning extrachromosomal molecule.
  • the cell is a stem cell.
  • the stem cell may be a human stem cell.
  • the cell is an embryonic stem cell.
  • the stem cell may be a human pluripotent stem cell (iPSCs).
  • iPSCs human pluripotent stem cell
  • stem cell-derived neurons such as neurons derived from iPSCs transformed or transduced with a DNA targeting system or component thereof as detailed herein.
  • a genetic construct may be a viral vector. Further provided herein is a viral delivery system. Viral delivery systems may include, for example, lentivirus, retrovirus, adenovirus, mRNA electroporation, or nanoparticles.
  • the vector is a modified lentiviral vector.
  • the viral vector is an adeno-associated virus (AAV) vector.
  • AAV adeno-associated virus
  • the AAV vector is a small virus belonging to the genus Dependovirus of the Parvoviridae family that infects humans and some other primate species.
  • AAV vectors may be used to deliver CRISPR/Cas-based gene editing systems using various construct configurations.
  • AAV vectors may deliver Cas12a or Cas12a fusion protein and gRNA expression cassettes on separate vectors or on the same vector.
  • the AAV vector has a 4.7 kb packaging limit.
  • the AAV vector is a modified AAV vector.
  • the modified AAV vector may have enhanced cardiac and/or skeletal muscle tissue tropism.
  • the modified AAV vector may be capable of delivering and expressing the CRISPR/Cas-based gene editing system in the cell of a mammal.
  • the modified AAV vector may be an AAV-SASTG vector (Piacentino et al. Human Gene Therapy 2012, 23, 635–646).
  • AAV vectors may include, for example, AAV type 1, AAV type 2, AAV type 3 (including types 3A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, AAV type rh32.33, AAV type rh8, AAV type rhl0, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, and any other AAV now known or later discovered.
  • the modified AAV vector may be based on one or more of several capsid types, including AAV1, AAV2, AAV5, AAV6, AAV8, and AAV9.
  • the modified AAV vector may be based on AAV2 pseudotype with alternative muscle-tropic AAV capsids, such as AAV2/1, AAV2/6, AAV2/7, AAV2/8, AAV2/9, AAV2.5, and AAV/SASTG vectors that efficiently transduce skeletal muscle or cardiac muscle by systemic and local delivery (Seto et al. Current Gene Therapy 2012, 12, 139-151).
  • the modified AAV vector may be AAV2i8G9 (Shen et al. J. Biol. Chem.2013, 288, 28814-28823). 4.
  • Pharmaceutical Compositions [000137] Further provided herein are pharmaceutical compositions comprising the above- described genetic constructs or gene editing systems.
  • the pharmaceutical composition may comprise about 1 ng to about 10 mg of DNA encoding the CRISPR/Cas-based gene editing system.
  • the systems or genetic constructs as detailed herein, or at least one component thereof, may be formulated into pharmaceutical compositions in accordance with standard techniques well known to those skilled in the pharmaceutical art.
  • the pharmaceutical compositions can be formulated according to the mode of administration to be used. In cases where pharmaceutical compositions are injectable pharmaceutical compositions, they are sterile, pyrogen free, and particulate free.
  • An isotonic formulation is preferably used. Generally, additives for isotonicity may include sodium chloride, dextrose, mannitol, sorbitol and lactose.
  • compositions may further comprise a pharmaceutically acceptable excipient.
  • the pharmaceutically acceptable excipient may be functional molecules as vehicles, adjuvants, carriers, or diluents.
  • pharmaceutically acceptable carrier may be a non-toxic, inert solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
  • Pharmaceutically acceptable carriers include, for example, diluents, lubricants, binders, disintegrants, colorants, flavors, sweeteners, antioxidants, preservatives, glidants, solvents, suspending agents, wetting agents, surfactants, emollients, propellants, humectants, powders, pH adjusting agents, and combinations thereof.
  • the pharmaceutically acceptable excipient may be a transfection facilitating agent, which may include surface active agents, such as immune-stimulating complexes (ISCOMS), Freunds incomplete adjuvant, LPS analog including monophosphoryl lipid A, muramyl peptides, quinone analogs, vesicles such as squalene and squalene, hyaluronic acid, lipids, liposomes, calcium ions, viral proteins, polyanions, polycations, or nanoparticles, or other known transfection facilitating agents.
  • the transfection facilitating agent may be a polyanion, polycation, including poly-L-glutamate (LGS), or lipid.
  • the transfection facilitating agent may be poly-L- glutamate, and more preferably, the poly-L-glutamate may be present in the composition for gene editing in skeletal muscle or cardiac muscle at a concentration less than 6 mg/mL. 5.
  • the systems or genetic constructs as detailed herein, or at least one component thereof, may be administered or delivered to a cell. Methods of introducing a nucleic acid into a host cell are known in the art, and any known method can be used to introduce a nucleic acid (e.g., an expression construct) into a cell.
  • Suitable methods include, for example, viral or bacteriophage infection, transfection, conjugation, protoplast fusion, polycation or lipid:nucleic acid conjugates, lipofection, electroporation, nucleofection, immunoliposomes, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct micro injection, nanoparticle- mediated nucleic acid delivery, and the like.
  • the composition may be delivered by mRNA delivery and ribonucleoprotein (RNP) complex delivery.
  • the system, genetic construct, or composition comprising the same may be electroporated using BioRad Gene Pulser Xcell or Amaxa Nucleofector IIb devices or other electroporation device.
  • Several different buffers may be used, including BioRad electroporation solution, Sigma phosphate-buffered saline product #D8537 (PBS), Invitrogen OptiMEM I (OM), or Amaxa Nucleofector solution V (N.V.).
  • Transfections may include a transfection reagent, such as Lipofectamine 2000.
  • compositions can be administered in dosages and by techniques well known to those skilled in the medical arts taking into consideration such factors as the age, sex, weight, and condition of the particular subject, and the route of administration.
  • the presently disclosed systems, or at least one component thereof, genetic constructs, or compositions comprising the same may be administered to a subject by different routes including orally, parenterally, sublingually, transdermally, rectally, transmucosally, topically, intranasal, intravaginal, via inhalation, via buccal administration, intrapleurally, intravenous, intraarterial, intraperitoneal, subcutaneous, intradermally, epidermally, intramuscular, intranasal, intrathecal, intracranial, and intraarticular or combinations thereof.
  • the system, genetic construct, or composition comprising the same is administered to a subject intramuscularly, intravenously, or a combination thereof.
  • the systems, genetic constructs, or compositions comprising the same may be delivered to a subject by several technologies including DNA injection (also referred to as DNA vaccination) with and without in vivo electroporation, liposome mediated, nanoparticle facilitated, recombinant vectors such as recombinant lentivirus, recombinant adenovirus, and recombinant adenovirus associated virus.
  • the composition may be injected into the brain or other component of the central nervous system.
  • the composition may be injected into the skeletal muscle or cardiac muscle.
  • the composition may be injected into the tibialis anterior muscle or tail.
  • the systems, genetic constructs, or compositions comprising the same may be administered as a suitably acceptable formulation in accordance with normal veterinary practice. The veterinarian may readily determine the dosing regimen and route of administration that is most appropriate for a particular animal.
  • the systems, genetic constructs, or compositions comprising the same may be administered by traditional syringes, needleless injection devices, “microprojectile bombardment gone guns,” or other physical methods such as electroporation (“EP”), “hydrodynamic method”, or ultrasound.
  • transient in vivo delivery of CRISPR/Cas-based systems by non- viral or non-integrating viral gene transfer, or by direct delivery of purified proteins and gRNAs containing cell-penetrating motifs may enable highly specific correction and/or restoration in situ with minimal or no risk of exogenous DNA integration.
  • the transfected cells may express the gRNA molecule(s) and the Cas molecule or fusion protein.
  • Cell Types Any of the delivery methods and/or routes of administration detailed herein can be utilized with a myriad of cell types. Further provided herein is a cell transformed or transduced with a system or component thereof as detailed herein. For example, provided herein is a cell comprising an isolated polynucleotide encoding a CRISPR/Cas system as detailed herein. Suitable cell types are detailed herein. In some embodiments, the cell is an immune cell. Immune cells may include, for example, lymphocytes such as T cells and B cells and natural killer (NK) cells. In some embodiments, the cell is a T cell.
  • T cells may be divided into cytotoxic T cells and helper T cells, which are in turn categorized as TH1 or TH2 helper T cells.
  • T cells may also include T regulatory cells also known as TREG cells.
  • Immune cells may further include innate immune cells, adaptive immune cells, tumor-primed T cells, NKT cells, IFN- ⁇ producing killer dendritic cells (IKDC), memory T cells (TCMs), and effector T cells (TEs).
  • the cell may be a stem cell such as a human stem cell.
  • the cell is an embryonic stem cell or a hematopoietic stem cell.
  • the stem cell may be a human induced pluripotent stem cell (iPSCs).
  • stem cell- derived neurons such as neurons derived from iPSCs transformed or transduced with a DNA targeting system or component thereof as detailed herein.
  • the cell may be a muscle cell.
  • Cells may further include, but are not limited to, immortalized myoblast cells, dermal fibroblasts, bone marrow-derived progenitors, skeletal muscle progenitors, human skeletal myoblasts, CD 133+ cells, mesoangioblasts, cardiomyocytes, hepatocytes, chondrocytes, mesenchymal progenitor cells, hematopoietic stem cells, smooth muscle cells, and MyoD- or Pax7-transduced cells, or other myogenic progenitor cells. 6.
  • kits [000143] Provided herein is a kit, which may be used to modify a genome or modulate expression of a gene.
  • the kit comprises genetic constructs or a composition comprising the same, as described above, and instructions for using said composition.
  • the kit comprises at least one Cas12a protein or Cas12a fusion protein or a polynucleotide encoding the at least one Cas12a protein or Cas12a fusion protein.
  • the kit comprises at least one gRNA or a polynucleotide encoding the at least one gRNA.
  • the kit may further include instructions for using the CRISPR/Cas-based gene editing system.
  • kits may be affixed to packaging material or may be included as a package insert. While the instructions are typically written on printed materials they are not limited to such. Any medium capable of storing such instructions and communicating them to an end user is contemplated by this disclosure. Such media include, but are not limited to, electronic storage media (e.g., magnetic discs, tapes, cartridges, chips), optical media (e.g., CD ROM), and the like. As used herein, the term “instructions” may include the address of an internet site that provides the instructions. 7. Methods a. Methods of Modulating Gene Expression [000145] Provided herein are methods of modulating gene expression of a target gene in a cell or subject.
  • the methods may include contacting the cell or subject with a DNA targeting system as detailed herein, or an isolated polynucleotide as detailed herein, or a vector as detailed herein, or a composition as detailed herein, or a pharmaceutical composition as detailed herein.
  • the gene expression of the target gene is activated relative to a control.
  • the second polypeptide domain of the Cas12a fusion protein comprises the histone acetyltransferase domain of p300 and the Cas12a fusion protein activates transcription of a target gene.
  • the gene expression of the target gene is repressed relative to a control.
  • the second polypeptide domain of the Cas12a fusion protein comprises SID and the Cas12a fusion protein represses or reduces transcription of a target gene.
  • Methods of Treating a Disease Provided herein are methods of treating a disease in a subject. The methods may include contacting the cell or subject with a DNA targeting system as detailed herein, or an isolated polynucleotide as detailed herein, or a vector as detailed herein, or a composition as detailed herein, or a pharmaceutical composition as detailed herein. 8. Examples [000149] The foregoing may be better understood by reference to the following examples, which are presented for purposes of illustration and are not intended to limit the scope of the invention.
  • Example 1 Materials and Methods [000150] Cloning/DNA Methods: dCas12a fusion proteins were cloned into a flap-Ub promoter-GFP-WRE (FUGW) backbone. A plasmid containing dAsCas12a was purchased from Addgene. The dAsCas12a ORF was then amplified via PCR using Q5 DNA polymerase and cloned into the restriction digested FUGW backbone using NEBuilder Hifi DNA Assembly Master Mix.
  • FUGW flap-Ub promoter-GFP-WRE
  • PCR was used to amplify the epigenetic domains (VPR, KRAB, 4xSID, P300) and NEBuilder Hifi DNA Assembly Master Mix to clone them into the restriction-digested dLbCas12a or dAsCas12a backbones. Mutations to create dEnAsCas12a or dHyperLb Cas12a were introduced by PCR followed by Gibson assembly. The hUbc promoter was replaced with the EF1A promoter using Gibson Assembly. As and Lb Cas12a arrays were cloned using Golden Gate assembly.
  • Cas12a activation and repression assays Initial experiments were performed in HEK 293T cells cultured in DMEM with 4.5 g/L D-Glucose, L-Glutamine, 110 mg/L Sodium Pyruvate, 10% FBs, and 1% PenStrep. For initial validation experiments (FIG.1, FIG.2, and FIG.5), 15,000293T cells were seeded in each well of a 96 well plate. These cells were then transfected in triplicate the same day with 80 ng of dCas12a expression plasmid and 50 ng of array expression plasmid using Lipofectamine 3000. After 48 hours, RNA was harvested from cells and reverse transcribed using the Cells to Ct kit.
  • the dCas12a fusion constructs were transduced into A549 cells cultured in DMEM/F12K media with 10% FBS and 1% PenStrep to from stable cell lines. These cell lines were then selected with blasticidin. To validate the P300 cell line, 1.05x10 5 cells/well were seeded in a 24 well plate and then cells were transfected in triplicate with 400 ng of array plasmid. Cells were harvested for RNA after 48 hours and assayed using qPCR as above. To validate the 4xSID cell line, lentivirus of the targeting or control arrays was generated.
  • the 4xSID cell line was then transduced with lentivirus and selected with 0.75 ⁇ g/mL puromycin for one week, after which RNA was harvested and assayed using qPCR as before.
  • Library cloning To build the library, oligonucleotides containing 3 gRNAs/oligo were designed and ordered as an oligo pool (Twist Biosciences). Two PCRs were then performed, with two different primer pairs (set 1 and set 2) using Q5 DNA polymerase. The PCR product for set 1 was purified, digested with BsaI, and ligated into the Esp3I-digested backbone using T4 DNA ligase.
  • dCas12a variants Lb-dCas12a, Lb-dHyperCas12a, As- dCas12a, or As-dEnCas12a fused to either VPR or KRAB were examined.
  • 293T cells were transfected with a plasmid encoding one of the dCas12a fusion proteins, and a plasmid encoding a gRNA targeting a gene promoter or a control gRNA. After 48 hours, RNA was collected from the cells, and transcript levels of the genes of interest were assessed using RT-qPCR. The efficacy of the different VPR or KRAB fusion proteins were compared.
  • the dCas12a-VPR fusion proteins activated HBE1 expression in 293T cells.
  • the dCas12a-KRAB fusion proteins repressed expression of RAB11A in 293T cells.
  • Lb-dCas12a-VPR was further tested.
  • expression of HBE1 was activated with 1 or 3 gRNAs using Lb-dCas12a-VPR in 293T cells.
  • FIG. 3D expression of AR and HBB were each activated with a single array of gRNAs and Lb- dCas12a-VPR in 293T cells.
  • 293T cells were transfected with a plasmid encoding one of the four dCas12a fusion proteins, and a plasmid encoding either an array of gRNAs each targeting the same gene promoter or a control array of three non-targeting gRNAs.
  • the fusion protein and the gRNA array were encoded on two separate plasmids. After 48 hours, RNA was collected from the cells, and transcript levels of the genes of interest were assessed using RT-qPCR. As shown in FIG.4A, dCas12a-p300 fusion proteins activated expression from the MYOD1 promoter.
  • dCas12a-4xSID fusion proteins repressed expression of the RAB5A promoter.
  • the effect of adding an extra direct repeat sequence downstream of the spacer for a single gRNA array was tested using Lb-dCas12a-p300 or Lb-dCas12a-VPR. 293T cells were transfected with a plasmid encoding the dCas12a fusion protein, and a plasmid encoding either an array of gRNAs each targeting the same gene promoter, with or without a second direct repeat (DR), or a control array of three non-targeting gRNAs.
  • DR direct repeat
  • Cas12a-p300 Fusion Proteins [000158] To use Cas12a to manipulate the genome, nuclease inactive versions of Cas12a (dCas12a) were fused to effector domains that modify the epigenome either via their enzymatic activity or via binding to additional proteins already present in the cell.
  • Cas12a-p300 fusion proteins were generated: Lb-dCas12a-p300, Lb- dHyperCas12a-p300, As-dCas12a-p300, and As-dEnCas12a-p300.
  • Lb-dCas12a-p300 includes a nuclease-deficient Cas12a protein (dCas12a) from Lachnospiraceae bacterium ND (“Lb”) with the histone acetyltransferase domain of p300 fused at the C-terminal end.
  • Lb-dHyperCas12a-p300 includes a modified dCas12a protein from Lachnospiraceae bacterium ND (“Lb”) with the histone acetyltransferase domain of p300 fused at the C-terminal end.
  • Lb-dHyperCas12a-p300 showed increased activity compared to Lb-dCas12a-p300.
  • As-dCas12a-P300 includes a nuclease-deficient Acidaminococcus sp.
  • BV3L6 Cas12a protein (As-dCas12a) fused at its C-terminal end to the histone acetyltransferase domain of p300.
  • As-dEnCas12a-P300 includes a modified nuclease-deficient Acidaminococcus sp.
  • BV3L6 Cas12a (As-dEnCas12a) fused at the C-terminal end to the histone acetyltransferase domain of p300.
  • dCas12a-p300 fusion proteins activated gene expression by targeting them to gene promoters.
  • 293T cells were transfected with a plasmid encoding one of the four dCas12a-p300 fusion proteins, and a plasmid encoding either an array of three gRNAs each targeting the same gene promoter or a control array of three non- targeting gRNAs.
  • the fusion protein and the gRNA array were encoded on two separate plasmids.
  • gRNA array multiple gRNAs
  • 293T cells were transfected with a plasmid encoding one of the dCas12a-p300 fusion proteins, and a plasmid encoding either an array of three gRNAs targeting the MYOD1 distal regulatory region (DRR) or a control array of three non-targeting gRNAs.
  • DRR MYOD1 distal regulatory region
  • RNA was collected, and MYOD1 transcript levels were assessed using RT-qPCR.
  • As-dEnCas12a-p300 increased MYOD1 gene expression by targeting its distal regulatory region. This demonstrated that the dCas12a-p300 fusion protein was capable of epigenetic transcriptional activation from regulatory elements in addition to gene promoters.
  • Lb-dHyperCas12a-p300 demonstrated robust and simultaneous activation of all three target genes.
  • As- dEnCas12a-p300 showed activation of one of the three target genes.
  • a stable Lb-dHyperCas12a-p300 cell line in A549 cells was created, and it was examined whether gene activation would be achieved using the same array of ten gRNAs as detailed above.
  • A549 cells were transduced with a Lb-dHyperCas12a-p300-P2A- BlasticidinR lentiviral construct. These cells were then cultured with 2.5 ⁇ g/mL Blasticidin for one week to select for cells that expressed dHyperLbCas12a-P300.
  • the Lb-dHyper-P300 cell line was then transfected with a plasmid encoding either an array of ten gRNAs targeting a gene promoter or enhancer of three different genes, or a control array of ten non-targeting gRNAs. After 48 hours RNA was collected from the cells, and transcript levels of the genes of interest were assessed using RT-qPCR. As shown in FIG.9, even in a stable cell line with lower transgene expression levels than in the transfection experiments, Lb- dHyperCas12a-p300 was able to activate two of the three target genes.
  • dCas12a-p300 fusion protein was a robust epigenetic activator capable of highly multiplexed activation in multiple cell lines.
  • Example 4 Cas12a-SID Fusion Proteins [000167] To repress regulatory element activity, three novel fusion proteins with dCas12a and four domains of the Sin3 interacting domain (SID) were created. Repression has been previously achieved via fusion of a Cas protein to the Krüppel associated box (KRAB) domain. However, there have been reports that KRAB may cause gene repression to spread across as many as 10 kb of genomic sequence, potentially leading to off-target effects.
  • KRAB Krüppel associated box
  • the SID domain was used, as it is considered to not have the widespread effect that KRAB does, thereby enabling more specific repression.
  • Three different Cas12a-SID fusion proteins were generated: Lb-dCas12a-4xSID, Lb-dHyperCas12a-4xSID, and As- dEnCas12a-4xSID. As-dCas12a-4xSID could be similarly generated. [000168] It was tested whether each of the three dCas12a-SID fusion proteins repressed gene expression.
  • 293T cells were co-transfected with a plasmid encoding one of the dCas12a-4xSID fusion proteins, and a plasmid encoding either an array of three gRNAs targeting a single gene promoter or a control array of three non-targeting gRNAs.
  • the fusion protein and the gRNA array were encoded on two separate plasmids. After 48 hours RNA was collected, and transcript levels of our genes of interest were assessed using RT-qPCR.
  • both As-dEnCas12a-4xSID and Lb-dCas12a-4xSID fusion proteins repressed four different target genes in 293T cells, indicating that the dCas12a-4xSID fusion proteins were capable of both epigenetic transcriptional repression using multiple gRNAs (gRNA array).
  • gRNA array multiple gRNAs
  • 293T cells were co-transfected with a plasmid encoding a dCas12a- 4xSID fusion protein, and a plasmid encoding an array of ten gRNAs collectively targeting gene promoters of three different genes or a control array of ten non-targeting gRNAs. After 48 hours the cells were split into media containing 5 ⁇ g/mL Blasticidin to select for cells that were transfected with the dCas12a-4xSID plasmid. 48 hours post-selection (4 days post- transfection), RNA was collected, and target gene transcript levels were assessed using RT- qPCR.
  • both Lb-dHyperCas12a-4xSID and As-dEnCas12a-4xSID drove simultaneous repression of three target genes, indicating that these tools can be used for highly multiplexed epigenetic repression.
  • a stable Lb-dHyperCas12a-4xSID cell line in A549 cells was created, and it was tested whether gene repression would be achieved using the same array of ten gRNAs as detailed above.
  • A549 cells were transduced with a Lb-dHyperCas12a-4xSID- P2A-BlasticidinR lentiviral construct.
  • dHyperLbCas12a-4xSID The dHyperLb-4xSID cell line was then transduced with lentiviral particles containing an array of ten gRNAs collectively targeting gene promoters of four different genes, or a plasmid encoding a control array of non-targeting gRNAs. After 72 hours the cells were passaged into media containing 0.75 ⁇ g/mL puromycin in order to select for cells successfully transduced with the gRNA array. One-week post-selection, RNA was collected, and transcript levels of the genes of interest were assessed using RT-qPCR. As shown in FIG.
  • RNA Pol2 promoter Cas12a crisprRNAs (gRNAs) are typically expressed using an RNA Pol3 promoter.
  • RNA Pol3 has limited processivity, and thus it is typically unable to create transcripts that are more than 1 kb in length.
  • RNA Pol2 can generate transcripts that are tens of kilobases long.
  • x An array of up to 12 gRNAs: when transcribed into RNA, Cas12a splices the array into individual gRNAs that, in turn, be used to recruit Cas12a to individual regulatory elements.
  • x A unique barcode sequence that encodes the identity of the gRNA array: this was useful for high-throughput sequencing. In these applications, the full gRNA array cannot be sequenced because the size of the array exceeds the read length of the sequencer. By including a barcode that identifies the array, only the barcode needs to be sequenced and not the full array. This enabled high-throughput multiplexed CRISPR epigenome editing screens using high-throughput sequencing data.
  • a crRNA cloning vector was created that used RNA Pol II to express a selectable marker (mCherry-P2A-puroR).
  • the crRNA cloning vector also encoded multiple gRNAs on a single transcript, allowing for direct observation of gRNA expression via FACs.
  • gRNAs were cloned into the vector along with a barcode that could be used to identify which gRNAs were included in the array.
  • An array of six gRNAs collectively targeting two different genes was used, with each gene targeted by three different gRNAs.
  • Each of the six gRNAs was identified by a unique bipartite barcode (BC) that was flanked by TruSeq primer sequences for easy amplification and shorter amplicon length (FIG.13).
  • BC bipartite barcode
  • TruSeq primer sequences for easy amplification and shorter amplicon length
  • FIG.13 The multiplexing ability of the Cas12a fusion protein system was used to enable simultaneous gene activation and repression within a single cell. To do this, a chimeric gRNA array including both As-dCas12a gRNAs and LbdCas12a gRNAs on a single transcript was created (this plasmid was referred to as the “crRNA plasmid”).
  • An array of nine gRNAs was created: four Lb-Cas12a gRNAs collectively targeting two gene promoters, four As-Cas12a gRNAs collectively targeting two different gene promoters, and one non- targeting gRNA separating the As-Cas12a gRNAs and Lb-Cas12a gRNAs.
  • 293T cells were transfected with a plasmid encoding either As-dEnCas12a-VPR, or Lb-dHyperCas12a- KRAB, or both, along with a plasmid encoding either the chimeric gRNA or a control array of ten non-targeting gRNAs.
  • “Chimeric gRNA” or “hybrid gRNA” referred to the array of multiple gRNAs that included gRNAs for two different species of Cas12a proteins. After 24 hours the cells were split into media containing 1.0 ⁇ g/mL Puromycin to select for cells that were transfected with the crRNA plasmid. 24 hours post-selection (48 hours post- transfection), RNA was collected, and target gene transcript levels were assessed using RT- qPCR.
  • As-dEnCas12a-VPR and Lb-dHyperCas12a-KRAB used the chimeric gRNA array for robust activation or repression of all target genes when transfected individually, indicating that the chimeric gRNA array could be processed by Cas12a proteins from both species.
  • As-dEnCas12a-VPR and Lb-dHyperCas12a-KRAB were co- transfected, robust activation of one target gene and robust repression of one target gene were detected. This indicated that the epigenome editing strategy could be used to induce simultaneous gene activation and repression within a single cell.
  • Each Cas12a species was still able to process and use its own gRNAs from the chimeric transcript while leaving the gRNAs for the other Cas12a species alone.
  • AsCas12a-p300 activator construct activated gene expression by targeting it to the androgen receptor (AR) promoter.
  • AR androgen receptor
  • 293T cells were transfected with either a plasmid encoding dAsCas12a-p300 alone, or with a plasmid encoding dAsCas12a-p300 and a plasmid encoding a gRNA array targeting the AR promoter. After 48 hours RNA was collected, and transcript levels of the genes of interest were assessed using RT-qPCR.
  • dAsCas12a-p300 was able to upregulate expression of AR with the gRNA array. This showed that the dAsCas12a-p300 fusion protein was capable of epigenetic transcriptional activation.
  • a plasmid in which a single gRNA array included gRNAs for both LbCas12a and AsCas12a proteins was created, and it was demonstrated that such a hybrid gRNA array was effectively spliced.
  • This approach may also be used to improve perturbation of pathways of genes in a single cell (for example, activation of one set of genes and repression of another set of genes).
  • Such pathway manipulation may create stronger phenotypes than would be possible if only perturbing a single gene or if only using one mode of perturbation (for example, only activation, or only repression).
  • Such uses may have increased potential for both discovering molecular pathways and for therapeutic manipulation of those pathways.
  • a fusion protein comprising: a first polypeptide domain comprising a Cas12a protein selected from Lb-dCas12a, Lb-dHyperCas12a, As-dCas12a, and As- dEnCas12a; and a second polypeptide domain comprising SID or the histone acetyltransferase domain of p300. [000182] Clause 2.
  • Clause 6 The fusion protein of clause 1 or 2, wherein the second polypeptide domain comprises the histone acetyltransferase domain of p300 and the fusion protein activates transcription of a target gene.
  • Clause 7. The fusion protein of clause 6, wherein the histone acetyltransferase domain of p300 comprises the sequence of SEQ ID NO: 52, or wherein the histone acetyltransferase domain of p300 is encoded by a polynucleotide comprising the sequence of SEQ ID NO: 53.
  • a DNA targeting system comprising: at least one fusion protein of any one of clauses 1-7; and at least one guide RNA (gRNA).
  • gRNA guide RNA
  • the target region comprises a non-open chromatin region, or an open chromatin region, or a transcribed region of the target gene, or a region upstream of a transcription start site of the target gene, or a regulatory element of the target gene, or a target enhancer of the target gene, or a cis- regulatory region of the target gene, or a trans-regulatory region of the target gene, or an intron of the target gene, or an exon of the target gene, or a promoter of the target gene.
  • the at least one gRNA comprises a gRNA array of 2 to 25 gRNAs, each gRNA binding to a different target region.
  • Clause 13 The DNA targeting system of clause 12, wherein the gRNA array comprises a first gRNA for a first Cas12a protein and a second gRNA for a second Cas12a protein.
  • Clause 14 The DNA targeting system of clause 12, wherein the gRNA array comprises a first gRNA for a first Cas12a protein, a second gRNA for a second Cas12a protein, and a third gRNA for a third Cas12a protein.
  • Clause 16. A vector comprising the isolated polynucleotide of clause 15.
  • Clause 17. A composition comprising at least one vector encoding the DNA targeting system of any one of clauses 9-14.
  • Clause 18. The composition of clause 17, wherein the composition comprises: a first vector encoding a first fusion protein; a second vector encoding a second fusion protein; and a third vector encoding the at least one gRNA. [000199] Clause 19.
  • composition of clause 17, wherein the composition comprises: a first vector encoding a first fusion protein and a second fusion protein; and a second vector encoding the at least one gRNA.
  • Clause 20 The composition of clause 17, wherein the composition comprises a single vector encoding the at least one fusion protein and the at least one gRNA.
  • Clause 21 The composition of any one of clauses 17-20, wherein the at least one vector encoding the at least one gRNA further encodes an RNA Pol2 promoter.
  • Clause 22 Clause 22.
  • Clause 24 The composition of clause 23, wherein the barcode is 3’ of a polynucleotide encoding the at least one gRNA.
  • Clause 25 Clause 25.
  • a pharmaceutical composition comprising the fusion protein of any one of clauses 1-8, or the DNA targeting system of any one of clauses 9-14, or the isolated polynucleotide of clause 15, or the vector of clause 16, or the composition of any one of clauses 17-24.
  • Clause 26 A method of modulating gene expression of a target gene in a cell or subject, the method comprising contacting the cell or subject with the DNA targeting system of any one of clauses 9-14, or the isolated polynucleotide of clause 15, or the vector of clause 16, or the composition of any one of clauses 17-24, or the pharmaceutical composition of clause 25.
  • Clause 27 The method of clause 26, wherein the gene expression of the target gene is activated or repressed relative to a control.
  • Clause 28 A method of activating gene expression of a target gene in a cell or subject, the method comprising contacting the cell or subject with the DNA targeting system of any one of clauses 9-14, or the isolated polynucleotide of clause 15, or the vector of clause 16, or the composition of any one of clauses 17-24, or the pharmaceutical composition of clause 25, wherein the second polypeptide domain comprises the histone acetyltransferase domain of p300 and the fusion protein activates transcription of a target gene.
  • Clause 29 Clause 29.
  • a method of reducing gene expression of a target gene in a cell or subject comprising contacting the cell or subject with the DNA targeting system of any one of clauses 9-14, or the isolated polynucleotide of clause 15, or the vector of clause 16, or the composition of any one of clauses 17-24, or the pharmaceutical composition of clause 25, wherein the second polypeptide domain comprises SID and the fusion protein represses transcription of a target gene.
  • Clause 30 A method of treating a disease in a subject, the method comprising administering to the subject the DNA targeting system of any one of clauses 9-14, or the isolated polynucleotide of clause 15, or the vector of clause 16, or the composition of any one of clauses 17-24, or the pharmaceutical composition of clause 25.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)

Abstract

L'invention divulgue des protéines de fusion Cas12a. Les protéines de fusion Cas12a peuvent comprendre, par exemple, p300 ou SID. L'invention propose en outre des constructions d'ADN codant pour au moins un ARNg, tel qu'un réseau de multiples ARNg. Les protéines de fusion Cas12a et les ARNg peuvent être utilisés pour moduler l'expression d'un gène.
PCT/US2023/076920 2022-10-13 2023-10-13 Protéines de fusion cas12a et leurs procédés d'utilisation WO2024081937A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263415784P 2022-10-13 2022-10-13
US63/415,784 2022-10-13

Publications (2)

Publication Number Publication Date
WO2024081937A2 true WO2024081937A2 (fr) 2024-04-18
WO2024081937A3 WO2024081937A3 (fr) 2024-05-30

Family

ID=90670212

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/076920 WO2024081937A2 (fr) 2022-10-13 2023-10-13 Protéines de fusion cas12a et leurs procédés d'utilisation

Country Status (1)

Country Link
WO (1) WO2024081937A2 (fr)

Also Published As

Publication number Publication date
WO2024081937A3 (fr) 2024-05-30

Similar Documents

Publication Publication Date Title
US20230159927A1 (en) Chromatin remodelers to enhance targeted gene activation
US20190345483A1 (en) AAV Split Cas9 Genome Editing and Transcriptional Regulation
EP3494997B1 (fr) Protéines de liaison à l'adn inductibles, outils de perturbation du génome et leurs applications
CN105658805B (zh) Rna指导的基因编辑和基因调节
US20230257723A1 (en) Crispr/cas9 therapies for correcting duchenne muscular dystrophy by targeted genomic integration
US20220195406A1 (en) Crispr/cas-based genome editing composition for restoring dystrophin function
US20220177879A1 (en) Crispr/cas-based base editing composition for restoring dystrophin function
US20230348870A1 (en) Gene editing of satellite cells in vivo using aav vectors encoding muscle-specific promoters
WO2023200998A2 (fr) Domaines effecteurs pour systèmes crispr-cas
EP4125350A1 (fr) Intégration génomique ciblée pour restaurer la séquence de codage de neurofibromine dans des cas de neurofibromatose de type 1 (nf1)
US20230383270A1 (en) Crispr/cas-based base editing composition for restoring dystrophin function
US20230349888A1 (en) A high-throughput screening method to discover optimal grna pairs for crispr-mediated exon deletion
US20240141341A1 (en) Systems and methods for genome-wide annotation of gene regulatory elements linked to cell fitness
US20240026352A1 (en) Targeted gene regulation of human immune cells with crispr-cas systems
CA3237337A1 (fr) Nouveaux systemes crispr-cas12i et leurs utilisations
US20230392132A1 (en) Dual aav vector-mediated deletion of large mutational hotspot for treatment of duchenne muscular dystrophy
WO2024081937A2 (fr) Protéines de fusion cas12a et leurs procédés d'utilisation
WO2022225978A1 (fr) Utilisation d'un système de protéine de fusion dcas fractionné pour l'édition épigénétique
WO2023164670A2 (fr) Compositions crispr-cas9 et méthodes faisant intervenir une nouvelle protéine cas9 pour l'édition génomique et la régulation génique
US20240058425A1 (en) Systems and methods for genome-wide annotation of gene regulatory elements linked to cell fitness
KR20190037167A (ko) 혈액응고인자 viii 유전자 역위 보정능의 유전자 가위 시스템으로 구성된 혈우병 치료용 조성물
WO2024092258A2 (fr) Reprogrammation directe d'astrocytes humains en neurones avec activation transcriptionnelle basée sur crispr
WO2024040253A1 (fr) Modulation épigénétique de cibles génomiques permettant de réguler l'expression de gènes associés au spw

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23878328

Country of ref document: EP

Kind code of ref document: A2