Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/33—Heterocyclic compounds
  • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
  • A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
  • A61K31/352—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline 
  • A61K31/353—3,4-Dihydrobenzopyrans, e.g. chroman, catechin
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P9/00—Drugs for disorders of the cardiovascular system
  • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
  • C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
  • C12Q1/06—Quantitative determination
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
  • C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
  • C12Q1/14—Streptococcus; Staphylococcus
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
  • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
  • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/15—Medicinal preparations ; Physical properties thereof, e.g. dissolubility
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
  • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses

Definitions

• the present disclosure relates to a method for testing the presence or absence of stroke or the type of stroke, a method for testing the severity of stroke, a method for testing the risk of stroke recurrence, and a testing method for predicting the prognosis of stroke.
• the present disclosure also relates to a stroke improving agent and a screening method thereof.
• Stroke is a disease in which blood circulation in the brain is impaired due to the sudden rupture or blockage of blood vessels in the brain, and is one of the major causes of death and disability worldwide. Strokes are broadly classified into hemorrhagic strokes (cerebral hemorrhage), in which blood vessels rupture, and ischemic strokes (cerebral infarction), in which blood vessels become blocked. Cerebral hemorrhage includes intracerebral hemorrhage (intracerebral hemorrhage), in which bleeding occurs in the brain tissue itself, and subarachnoid hemorrhage, in which bleeding occurs in the subarachnoid space mainly due to the rupture of a cerebral aneurysm.
• Cerebral hemorrhage includes intracerebral hemorrhage (intracerebral hemorrhage), in which bleeding occurs in the brain tissue itself, and subarachnoid hemorrhage, in which bleeding occurs in the subarachnoid space mainly due to
• cerebral infarction There are various clinical disease types of cerebral infarction, such as cardiogenic cerebral embolism, atherothrombotic cerebral infarction, and lacunar infarction, based on the cause of blood vessel blockage. It is also known that strokes have a high recurrence rate.
• strokes have been diagnosed using imaging tests such as CT scans and MRI scans, but such a diagnosis is not necessarily easy even for stroke specialists. Therefore, if it were possible to test for strokes using biomarkers that change in response to biological reactions, it is expected that the accuracy of diagnoses using imaging tests will be improved and optimal personalized medical care will be realized according to each case.
• Patent Document 1 describes that an increase in the content of vesicles derived from Collinsella and Flavobacterium bacteria and a decrease in the content of vesicles derived from Lactobacillus and Propionibacterium bacteria was observed in the blood of stroke patients, and that stroke can be diagnosed by analyzing the increase or decrease in the content of extracellular vesicles derived from these bacteria through metagenomic analysis of blood.
• Non-Patent Document 1 describes that a high proportion of patients with intracerebral hemorrhage and stroke patients accompanied by cerebral microbleeds have CNM-positive Streptococcus mutans in their oral bacterial flora.
• one object of the present disclosure is to provide a method for testing for the presence or absence of stroke or the type of stroke using the intestinal microflora or oral microflora. Another object of the present disclosure is to provide a method for testing the severity of stroke using the intestinal microflora. Yet another object of the present disclosure is to provide a method for testing the risk of stroke recurrence using the intestinal microflora. Yet another object of the present disclosure is to provide a method for testing for predicting the prognosis of stroke using the intestinal microflora. Yet another object of the present disclosure is to provide a method for screening stroke improving agents and ingredients effective in improving stroke.
• the present inventors have focused on the gut flora and oral flora of stroke patients and conducted various studies, finding that stroke patients have a disturbance in the oral flora (increase in periodontal disease bacteria and dental caries bacteria) and a shift of oral bacteria to the gut flora, causing gut microbial oralization, etc.
• the present inventors have obtained the following findings through a stroke cohort study.
• Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, and Streptococcus salivalius are bacteria that are normally present in the oral cavity and are not normally present in the intestinal flora.
• Lactobacillus fermentum is not normally present in the intestinal flora, but is found in the intestinal flora of stroke patients.
• the presence or absence of Lactobacillus fermentum in the intestinal flora can be a diagnostic indicator for stroke.
• stroke patients have increased relative abundance of Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, Streptococcus salivarius, Lactobacillus fermentum, Clostridium perfringens, Alistispes putredinis, Bacteroides fragilis, Streptococcus, Lactobacillus, Alistispes, and Streptococcaceae bacteria in the intestinal microbiota, and the relative abundance of these bacteria in the intestinal microbiota may be a diagnostic indicator for stroke.
• stroke patients had a higher abundance of Bacteroides plebeius, Anaerostipes hadrus, Ruminococcus bicirculans, Bacteroides vulgatus, Prevotella copri, Sutterella wadsworthensis, Bifidobacterium pseudocatenulatum, Bifidobacterium longum, Eubacterium rectale, and Dialister invissus in the intestinal flora.
• the relative abundance of bacteria from the genera Fusicatenibacter, Faecalibacterium, Dorea, Anaerostipes, Ruminococcus, Butyricoccus, Bifidobacterium, Bifidobacteriaceae, and Prevotellaceae in the gut microbiota is decreased, and the relative abundance of these bacteria in the gut microbiota may be a diagnostic indicator for stroke.
• patients with cardiogenic cerebral embolism have an increased relative abundance of Bacteroides flagellis, Lactobacillus fermentum, Streptococcus mutans, and Streptococci family bacteria in the intestinal flora, and a decreased relative abundance of Bifidobacterium pseudocatenulatum, Bifidobacterium longum, Bifidobacterium genus bacteria, and Bifidobacteriaceae bacteria in the intestinal flora.
• the relative abundance of these bacteria in the intestinal flora may be a diagnostic indicator for cardiogenic cerebral embolism.
• the relative abundance of these bacteria in the intestinal microbiota may be a test indicator of sarcopenia in stroke patients.
• Stroke patients who have Streptococcus anginosus in their intestinal flora have a high risk of death or recurrence of vascular disease (ischemic stroke, hemorrhagic stroke, myocardial infarction, worsening heart failure, or peripheral vascular occlusion) within two years, and the presence or absence of Streptococcus anginosus in the intestinal flora may be a test indicator for predicting the prognosis of stroke.
• ischemic stroke hemorrhagic stroke, myocardial infarction, worsening heart failure, or peripheral vascular occlusion
• stroke patients had a higher abundance of Streptococcus anginosus, Treponema denticola, Streptococcus cristatus, Prevotella loescheii, Lactobacillus fermentum, Streptococcus gordonii, Streptococcus constellatus, Campylobacter gracilis, Selenomonas sproda, Tannerella forsythia, and other oral flora.
• the relative abundance of bacteria in the oral microbiota may be an indicator of stroke.
• the present inventors analyzed serum equol concentrations in healthy subjects and stroke patients and found that serum equol concentrations in stroke patients correlate with the risk of onset of each type of stroke, the risk of stroke severity, and functional prognosis of stroke. Specifically, the present inventors obtained the following findings by investigating serum equol concentrations in stroke patients. (16) Compared to healthy subjects, patients with cardiogenic cerebral embolism have a significantly lower proportion of equol producers (those with serum equol concentration of 1 ng/mL or higher). Serum equol concentration may therefore be a useful test indicator for determining the risk of developing cardiogenic cerebral embolism.
• the present inventors have found, through experiments using stroke-prone spontaneously hypertensive rat models, that antibiotics are useful as drugs for improving stroke. Specifically, the present inventors have found the following through experiments using stroke-prone spontaneously hypertensive rat models.
• the composition of the intestinal flora was different in salt-sensitive, stroke-prone spontaneously hypertensive rat models when they were orally administered water alone, salt alone, or salt plus antibiotics. As with the aforementioned results in humans, the onset of stroke symptoms in these model rats led to changes in the intestinal flora.
• Item 1 A method for testing for the presence or absence of stroke, comprising: The method includes a step of determining the presence or absence of at least one bacterium selected from the group consisting of Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, Streptococcus salivalius, and Lactobacillus fermentum in the intestinal bacterial flora collected from the subject.
• Item 1 A method for testing for the presence or absence of stroke, comprising: The method includes a step of determining the presence or absence of at least one bacterium selected from the group consisting of Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, Streptococcus salivalius, and Lactobacillus fermentum in the intestinal bacterial flora collected from the subject.
• kits for testing the presence or absence of stroke comprising: The kit further comprises a primer capable of specifically detecting at least one bacterium selected from the group consisting of Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, Streptococcus salivalius, and Lactobacillus fermentum. Item 3.
• a method for testing the presence or absence of stroke or its type comprising: In the gut microbiota collected from the subjects, Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, Streptococcus salivalius, Lactobacillus fermentum, Clostridium perfringens, Alistispes putredinis, Bacteroides fragilis, Streptococcus bacteria, Lactobacillus bacteria, Alistispes bacteria, Streptococcus plebeius, Bacteroides ...
• Item 4 A method for testing whether a patient has suffered from sarcopenia-associated stroke, Item 4.
• the bacterium is at least one bacterium selected from the group consisting of Streptococcus mutans, Streptococcus parasanguinis, Clostridium perfringens, Alistispes putredinis, Bacteroides vulgatus, Prevotella copri, and Butyricoccus bacteria.
• Item 5 A method for testing for the presence or absence of cardiogenic cerebral embolism, Item 4.
• the bacterium is at least one selected from the group consisting of Bifidobacterium pseudocatenulatum, Bifidobacterium longum, Bacteroides fragilis, Lactobacillus fermentum, Streptococcus mutans, Bifidobacterium, bacteria of the family Streptococcaceae, and bacteria of the family Bifidobacteriaceae.
• Item 6. A method for testing the presence or absence of lacunar infarction, Item 4.
• the method according to item 3, wherein the bacterium is at least one selected from the group consisting of Sutterella wadsworthensis, bacteria of the family Streptococcaceae, and bacteria of the family Prevotellaceae.
• a method for testing for the presence or absence of atherothrombotic cerebral embolism comprising: Item 4. The method according to Item 3, wherein the bacterium is at least one selected from the group consisting of Streptococcus mutans and bacteria of the family Streptococcaceae.
• Item 8. A method for testing for the presence or absence of intracerebral hemorrhage, Item 4. The method according to Item 3, wherein the bacterium is at least one selected from the group consisting of Eubacterium rectale, Dialister invisus, and Prevotellaceae bacteria.
• a kit for testing the presence or absence of stroke or the type of stroke comprising: In the gut microbiota collected from the subjects, Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, Streptococcus salivalius, Lactobacillus fermentum, Clostridium perfringens, Alistispes putredinis, Bacteroides fragilis, Streptococcus bacteria, Lactobacillus bacteria, Alistispes bacteria, Streptococcus plebeius, Bacteroides ...
• a method for examining the severity of a stroke comprising: The method includes a step of measuring the relative abundance of at least one bacterium selected from the group consisting of Streptococcus anginosus, Anaerostipes hadrus, Bacteroides plebeius, Eubacterium rectale, Prevotella copri, and Lactobacillus fermentum in the intestinal flora collected from the subject. Item 11.
• a kit for testing the severity of a stroke comprising: The kit further comprises a primer capable of specifically detecting at least one bacterium selected from the group consisting of Streptococcus anginosus, Anaerostipes hadrus, Bacteroides plebeius, Eubacterium rectale, Prevotella copri, and Lactobacillus fermentum.
• a method for examining a risk of recurrent stroke comprising: The method further comprises a step of measuring the relative abundance of Streptococcus anginosus in the intestinal flora collected from the subject.
• a kit for testing a risk of recurrent stroke comprising: The above kit further comprises a primer capable of specifically detecting Streptococcus anginosus.
• Item 14 A method for predicting the prognosis of stroke, comprising: The method, which comprises a step of determining the presence or absence of Streptococcus anginosus in the intestinal bacterial flora collected from the subject.
• Item 15 A test kit for predicting the prognosis of stroke, comprising: The above kit further comprises a primer capable of specifically detecting Streptococcus anginosus.
• Item 16 A method for testing the presence or absence of sarcopenia in a stroke patient, comprising: The method includes a step of measuring the relative abundance of at least one bacterium selected from the group consisting of Ruminococcus torques and Veillonella in the intestinal bacterial flora collected from the subject.
• a kit for testing the presence or absence of sarcopenia in a stroke patient comprising: The above kit further comprises a primer capable of specifically detecting at least one bacterium selected from the group consisting of Ruminococcus torques and Veillonella. Item 18.
• a method for testing for the presence or absence of stroke comprising: The oral microbiota samples collected from subjects included Streptococcus anginosus, Treponema denticola, Streptococcus cristatus, Prevotella loescheii, Lactobacillus fermentum, Streptococcus gordonii, Streptococcus constellatus, Campylobacter gracilis, Selenomonas sproda, Tannerella forsythia, and others.
• Porphyromonas bacteria forsythia, Porphyromonas bacteria, Fusobacterium bacteria, Streptococcus bacteria, Capnocytophaga bacteria, Campylobacter bacteria, Streptococcus family bacteria, Eubacterium sulci, Streptococcus infantis, Haemophilus parainfluenzae, Prevotella nanceiensis, Lancefieldella parvula, Neisseria bacteria, Saccharimonadaceae TM7x TM7x bacteria, Hemophilus bacteria, Alloprevotella bacteria, Prevotellaceae bacteria, and Veillonellaceae bacteria. Item 19.
• a kit for testing the presence or absence of stroke comprising: Streptococcus anginosus, Treponema denticola, Streptococcus cristatus, Prevotella loescheii, Lactobacillus fermentum, Streptococcus gordonii, Streptococcus constellatus, Campylobacter gracilis, Selenomonas sproda, Tannerella forsythia forsythia, Porphyromonas bacteria, Fusobacterium bacteria, Streptococcus bacteria, Capnocytophaga bacteria, Campylobacter bacteria, Streptococcus family bacteria, Eubacterium sulci, Streptococcus infantis, Haemophilus parainfluenzae, Prevotella nanceiensis, Lancefieldella parvula, Neisseria bacteria, Saccharimonadaceae TM7x
• the kit further comprises a primer capable of specifically detecting at least one type of bacteria
• Item 20 An agent for improving stroke, comprising as an active ingredient a substance that normalizes the intestinal flora or oral flora of a stroke patient.
• the active ingredient is capable of suppressing the proliferation and proliferation of Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, Streptococcus salivalius, Lactobacillus fermentum, Clostridium perfringens, Alistispes putredinis, Bacteroides flagellis, and the like in intestinal flora.
• the active ingredient is capable of suppressing the proliferation and proliferation of Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, Streptococcus salivalius, Lactobacillus fermentum, Clostridium perfringens, Alistispes putredinis, Bacteroides flagellis, and the like in intestinal flora.
• the stroke improving agent according to item 20 which is a substance that reduces the relative abundance of at least one type of bacteria selected from the group consisting of Bacillus fragilis, Streptococcus bacteria, Lactobacillus bacteria, Alistispes bacteria, Streptococcaceae bacteria, and Veillonella bacteria.
• Item 22 The improving agent according to Item 21, wherein the active ingredient is an antibiotic or an antibody that exhibits binding to the bacteria.
• the active ingredient is capable of suppressing the intestinal flora of Bacteroides plebeius, Anaerostipes hadrus, Ruminococcus bicirculans, Bacteroides vulgatus, Prevotella copri, Sutterella wadsworthensis, Bifidobacterium pseudocatenulatum, Bifidobacterium longum, Eubacterium rectale, Dialister invisus, Ruminococcus torcu, and the like. Item 21.
• the stroke improving agent according to Item 20 which is a substance that increases the relative abundance of at least one bacterium selected from the group consisting of bacteria of the genus Fusicatenibacter, bacteria of the genus Faecalibacterium, bacteria of the genus Dorea, bacteria of the genus Anaerostipes, bacteria of the genus Ruminococcus, bacteria of the genus Butyricoccus, bacteria of the genus Bifidobacterium, bacteria of the family Bifidobacteriaceae, and bacteria of the family Prevotellaceae.
• Item 24 which is a substance that increases the relative abundance of at least one bacterium selected from the group consisting of bacteria of the genus Fusicatenibacter, bacteria of the genus Faecalibacterium, bacteria of the genus Dorea, bacteria of the genus Anaerostipes, bacteria of the genus Ruminococcus, bacteria of the genus Butyricoccus, bacteria of the genus Bifi
• the active ingredient is capable of suppressing the activity of Streptococcus anginosus, Treponema denticola, Streptococcus cristatus, Prevotella loescheii, Lactobacillus fermentum, Streptococcus gordonii, Streptococcus constellatus, Campylobacter gracilis, Selenomonas sproda, Tannerella forsythia, and/or other microorganisms in the oral cavity. Item 21.
• the agent for improving stroke according to Item 20 which is a substance that reduces the relative abundance of at least one type of bacteria selected from the group consisting of Porphyromonas bacteria, Fusobacterium bacteria, Streptococcus bacteria, Capnocytophaga bacteria, Campylobacter bacteria, and Streptococcaceae bacteria.
• Item 25 is a substance that reduces the relative abundance of at least one type of bacteria selected from the group consisting of Porphyromonas bacteria, Fusobacterium bacteria, Streptococcus bacteria, Capnocytophaga bacteria, Campylobacter bacteria, and Streptococcaceae bacteria.
• Item 26. Use of a substance that normalizes the intestinal flora or oral flora of a stroke patient for the manufacture of an agent for improving stroke.
• Item 27 Use of a substance that normalizes the intestinal flora or oral flora of a stroke patient for the manufacture of an agent for improving stroke.
• the substance is capable of suppressing the proliferation and proliferation of Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, Streptococcus salivalius, Lactobacillus fermentum, Clostridium perfringens, Alistispes putredinis, Bacteroides flagellis, and the like in intestinal flora.
• Item 27 The use according to Item 26, wherein the substance reduces the relative abundance of at least one bacterium selected from the group consisting of Bacillus fragilis, Streptococcus bacteria, Lactobacillus bacteria, Alistispes bacteria, Streptococcaceae bacteria, and Veillonella bacteria.
• Item 26 wherein the substance is an antibiotic or an antibody that exhibits binding to the bacterium.
• Item 29 The substance is capable of inhibiting the intestinal flora of Bacteroides plebeius, Anaerostipes hadrus, Ruminococcus bicirculans, Bacteroides vulgatus, Prevotella copri, Sutterella wadsworthensis, Bifidobacterium pseudocatenulatum, Bifidobacterium longum, Eubacterium rectale, Dialister invisus, Ruminococcus torcu, and the like.
• Item 27 Item 27.
• the substance increases the relative abundance of at least one bacterium selected from the group consisting of: Fusicatenibacter bacteria, Faecalibacterium bacteria, Dorea bacteria, Anaerostipes bacteria, Ruminococcus bacteria, Butyricoccus bacteria, Bifidobacterium bacteria, Bifidobacteriaceae bacteria, and Prevotellaceae bacteria.
• bacterium selected from the group consisting of: Fusicatenibacter bacteria, Faecalibacterium bacteria, Dorea bacteria, Anaerostipes bacteria, Ruminococcus bacteria, Butyricoccus bacteria, Bifidobacterium bacteria, Bifidobacteriaceae bacteria, and Prevotellaceae bacteria.
• the substance is capable of inhibiting the activity of Streptococcus anginosus, Treponema denticola, Streptococcus cristatus, Prevotella loescheii, Lactobacillus fermentum, Streptococcus gordonii, Streptococcus constellatus, Campylobacter gracilis, Selenomonas sproda, Tannerella forsythia, or a combination thereof in oral bacterial flora. Item 27.
• Item 26 wherein the substance increases the relative abundance of at least one type of bacteria selected from the group consisting of Eubacterium sulci, Streptococcus infantis, Haemophilus parainfluenzae, Prevotella nanceiensis, Lancefieldella parvula, Neisseria bacteria, Saccharimonadaceae TM7x bacteria, Hemophilus bacteria, Alloprevotella bacteria, Prevotellaceae bacteria, and Veillonellaceae bacteria in the oral microflora.
• Item 32 A method for improving stroke, comprising administering to a stroke patient a substance that normalizes intestinal flora or oral flora in an amount effective for improving stroke.
• Item 33 A method for improving stroke, comprising administering to a stroke patient a substance that normalizes intestinal flora or oral flora in an amount effective for improving stroke.
• the substance is capable of suppressing the proliferation and proliferation of Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, Streptococcus salivalius, Lactobacillus fermentum, Clostridium perfringens, Alistispes putredinis, Bacteroides flagellis, and the like in intestinal flora.
• Item 33 The method according to Item 32, wherein the substance reduces the relative abundance of at least one bacterium selected from the group consisting of Bacillus fragilis, Streptococcus bacteria, Lactobacillus bacteria, Alistispes bacteria, Streptococcaceae bacteria, and Veillonella bacteria.
• the substance is capable of inhibiting the intestinal flora of Bacteroides plebeius, Anaerostipes hadrus, Ruminococcus bicirculans, Bacteroides vulgatus, Prevotella copri, Sutterella wadsworthensis, Bifidobacterium pseudocatenulatum, Bifidobacterium longum, Eubacterium rectale, Dialister invisus, Ruminococcus torcu, and the like.
• Item 33 is the intestinal flora of Bacteroides plebeius, Anaerostipes hadrus, Ruminococcus bicirculans, Bacteroides vulgatus, Prevotella copri, Sutterella wadsworthensis, Bifidobacterium pseudocatenulatum, Bifidobacterium longum, Eubacterium rectale, Dialister invisus, Rum
• the method of item 32 wherein the substance increases the relative abundance of at least one bacterium selected from the group consisting of bacteria of the genus Fusicatenibacter, bacteria of the genus Faecalibacterium, bacteria of the genus Dorea, bacteria of the genus Anaerostipes, bacteria of the genus Ruminococcus, bacteria of the genus Butyricoccus, bacteria of the genus Bifidobacterium, bacteria of the family Bifidobacteriaceae, and bacteria of the family Prevotellaceae.
• the substance increases the relative abundance of at least one bacterium selected from the group consisting of bacteria of the genus Fusicatenibacter, bacteria of the genus Faecalibacterium, bacteria of the genus Dorea, bacteria of the genus Anaerostipes, bacteria of the genus Ruminococcus, bacteria of the genus Butyricoccus, bacteria of the genus Bifidobacterium, bacteria of the family Bifid
• the substance is capable of inhibiting the activity of Streptococcus anginosus, Treponema denticola, Streptococcus cristatus, Prevotella loescheii, Lactobacillus fermentum, Streptococcus gordonii, Streptococcus constellatus, Campylobacter gracilis, Selenomonas sproda, Tannerella forsythia, or a combination thereof in oral bacterial flora. 33.
• the method according to claim 32 wherein the substance reduces the relative abundance of at least one bacterium selected from the group consisting of bacteria of the genus Porphyromonas, bacteria of the genus Fusobacterium, bacteria of the genus Streptococcus, bacteria of the genus Capnocytophaga, bacteria of the genus Campylobacter, and bacteria of the family Streptococcaceae. Item 37.
• the method according to Item 32 wherein the substance increases the relative abundance of at least one bacterium selected from the group consisting of Eubacterium sulci, Streptococcus infantis, Haemophilus parainfluenzae, Prevotella nanceiensis, Lancefieldella parvula, Neisseria bacteria, Saccharimonadaceae TM7x bacteria, Hemophilus bacteria, Alloprevotella bacteria, Prevotellaceae bacteria, and Veillonellaceae bacteria in the oral microflora.
• Item 38 A substance that normalizes intestinal or oral flora, used in the treatment of improving stroke.
• Item 39 A substance that normalizes intestinal or oral flora, used in the treatment of improving stroke.
• the substance is capable of suppressing the proliferation and proliferation of Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, Streptococcus salivalius, Lactobacillus fermentum, Clostridium perfringens, Alistispes putredinis, Bacteroides flagellis, and the like in intestinal flora.
• the substance according to Item 38 which is a substance that reduces the relative abundance of at least one bacterium selected from the group consisting of Bacillus fragilis, Streptococcus bacteria, Lactobacillus bacteria, Alistispes bacteria, Streptococcaceae bacteria, and Veillonella bacteria.
• Item 40 which is a substance that reduces the relative abundance of at least one bacterium selected from the group consisting of Bacillus fragilis, Streptococcus bacteria, Lactobacillus bacteria, Alistispes bacteria, Streptococcaceae bacteria, and Veillonella bacteria.
• the substance is capable of inhibiting the intestinal flora of Bacteroides plebeius, Anaerostipes hadrus, Ruminococcus bicirculans, Bacteroides vulgatus, Prevotella copri, Sutterella wadsworthensis, Bifidobacterium pseudocatenulatum, Bifidobacterium longum, Eubacterium rectale, Dialister invisus, Ruminococcus torcu, and the like.
• the substance according to Item 38 which is a substance that increases the relative abundance of at least one bacterium selected from the group consisting of: Fusicatenibacter bacteria, Faecalibacterium bacteria, Dorea bacteria, Anaerostipes bacteria, Ruminococcus bacteria, Butyricoccus bacteria, Bifidobacterium bacteria, Bifidobacteriaceae bacteria, and Prevotellaceae bacteria.
• Fusicatenibacter bacteria Faecalibacterium bacteria
• Dorea bacteria Anaerostipes bacteria
• Ruminococcus bacteria Ruminococcus bacteria
• Butyricoccus bacteria Butyricoccus bacteria
• Bifidobacterium bacteria Bifidobacteriaceae bacteria
• Prevotellaceae bacteria Prevotellaceae bacteria.
• the substance is capable of inhibiting the activity of Streptococcus anginosus, Treponema denticola, Streptococcus cristatus, Prevotella loescheii, Lactobacillus fermentum, Streptococcus gordonii, Streptococcus constellatus, Campylobacter gracilis, Selenomonas sproda, Tannerella forsythia, or a combination thereof in oral bacterial flora. Item 39.
• the substance according to Item 38 which is a substance that reduces the relative abundance of at least one bacterium selected from the group consisting of Porphyromonas bacteria, Fusobacterium bacteria, Streptococcus bacteria, Capnocytophaga bacteria, Campylobacter bacteria, and Streptococcus family bacteria.
• Item 43 is a substance that reduces the relative abundance of at least one bacterium selected from the group consisting of Porphyromonas bacteria, Fusobacterium bacteria, Streptococcus bacteria, Capnocytophaga bacteria, Campylobacter bacteria, and Streptococcus family bacteria.
• the substance according to Item 38 which is a substance that increases the relative abundance of at least one type of bacteria selected from the group consisting of Eubacterium sulci, Streptococcus infantis, Haemophilus parainfluenzae, Prevotella nanceiensis, Lancefieldella parvula, Neisseria bacteria, Saccharimonadaceae TM7x bacteria, Haemophilus bacteria, Alloprevotella bacteria, Prevotellaceae bacteria, and Veillonellaceae bacteria in the oral microflora.
• Item 44 is a substance that increases the relative abundance of at least one type of bacteria selected from the group consisting of Eubacterium sulci, Streptococcus infantis, Haemophilus parainfluenzae, Prevotella nanceiensis, Lancefieldella parvula, Neisseria bacteria, Saccharimonadaceae TM7x bacteria, Haemophilus bacteria, Alloprevotella bacteria, Prevotellaceae bacteria, and
• a method for screening a candidate substance that may be effective in improving stroke from among test substances comprising the steps of: Regarding the test substance, the following bacteria in the intestinal flora were detected: Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, Streptococcus salivalius, Lactobacillus fermentum, Clostridium perfringens, Alistispes putredinis, Bacteroides flagellis, and Bacteroides spp.
• the screening method comprising the steps of: Item 45.
• a method for screening a candidate substance that may be effective in improving stroke from among test substances comprising the steps of: Regarding the test substance, the following bacteria in the intestinal flora were detected: Bacteroides plebeius, Anaerostipes hadrus, Ruminococcus bicirculans, Bacteroides vulgatus, Prevotella copri, Sutterella wadsworthensis, Bifidobacterium pseudocatenulatum, Bifidobacterium longum, Eubacterium rectale, Dialister invisus, Ruminococcus torque, and torques), Fusicatenibacter bacteria, Faecalibacterium bacteria, Dorea bacteria, Anaerostipes bacteria, Ruminococcus bacteria, Butyricoccus bacteria, Bifidobacterium bacteria, Bifidobacteriaceae bacteria, and Prevotellaceae bacteria; and selecting a test substance having the above-mentioned effect as the candidate substance;
• the screening method comprising the steps of: Item 46.
• a method for screening a candidate substance that may be effective in improving stroke from among test substances comprising the steps of: Regarding the test substance, the oral flora of Streptococcus anginosus, Treponema denticola, Streptococcus cristatus, Prevotella loescheii, Lactobacillus fermentum, Streptococcus gordonii, Streptococcus constellatus, Campylobacter gracilis, Selenomonas sproda, Tannerella forsythia, and a step of evaluating the effect of reducing the relative abundance of at least one type of bacteria selected from the group consisting of Porphyromonas bacteria, Fusobacterium bacteria, Streptococcus bacteria, Capnocytophaga bacteria, Campylobacter bacteria, and Streptococcus family bacteria; and a step of selecting a test substance having the effect as the candidate substance;
• the screening method comprising the steps of: Item 47.
• a method for screening a candidate substance that may be effective in improving stroke from among test substances comprising the steps of: evaluating the effect of the test substance on increasing the relative abundance of at least one bacterium selected from the group consisting of Eubacterium sulci, Streptococcus infantis, Haemophilus parainfluenzae, Prevotella nanceiensis, Lancefieldella parvula, Neisseria bacteria, Saccharimonadaceae TM7x bacteria, Hemophilus bacteria, Alloprevotella bacteria, Prevotellaceae bacteria, and Veillonellaceae bacteria in the oral microflora; and selecting the test substance having the effect as the candidate substance;
• the screening method comprising the steps of: Item 48.
• a method for examining a risk of developing a stroke by disease type comprising: The method comprises the step of measuring the equol concentration in a blood sample taken from the subject.
• the method according to Item 48 which is a method for examining the risk of developing cardiogenic cerebral embolism, atherothrombotic cerebral infarction, or atrial fibrillation.
• a method for examining the severity of a stroke comprising: The method comprises the step of measuring the equol concentration in a blood sample taken from the subject.
• a method for examining functional prognosis of stroke comprising: The method comprises the step of measuring the equol concentration in a blood sample taken from the subject.
• An agent for improving stroke comprising equol or an equol production promoter.
• the simple method of measuring bacteria in the intestinal or oral flora makes it possible to test for the presence or absence of stroke, the type of stroke, the presence or absence of sarcopenia associated with stroke, the severity of stroke, the risk of stroke recurrence, etc. Furthermore, according to the present disclosure, by measuring the equol concentration in a blood sample from a stroke patient, it becomes possible to test the risk of stroke onset by type of stroke, the functional prognosis of stroke, and the severity of stroke. Furthermore, according to the present disclosure, a stroke improving agent and a screening method for a stroke improving agent are provided.
• FIG. 1 shows an overview of the study methodology for investigating the oral and intestinal microbiota of stroke patients and non-stroke subjects.
• FIG. 1 shows a flowchart from the selection of stroke patients and non-stroke subjects to sample acquisition.
• C shows the principal coordinate analysis (PCoA) plot based on the Bray-Curtis distance for the whole gut and oral microbiota of acute stroke patients and non-stroke subjects.
• D shows the median Bray-Curtis distance between the oral microbiota and the gut microbiota.
• **** indicates a p-value ⁇ 0.001 by Mann-Whitney test, and the center line of the box, the box border, and the whiskers indicate the median, 25-75%, and 10-90%, respectively.
• A shows the alpha diversity of species in the oral microbiota of acute stroke patients and non-stroke patients divided by disease type (left panel) and the alpha diversity of Faith's phylogenetic diversity (right panel).
• CE cardiogenic cerebral embolism
• SVO lacunar infarction
• ICH intracerebral hemorrhage
• CE cardiogenic cerebral embolism
• SVO lacunar infarction
• ICH intracerebral hemorrhage
• CE cardiogenic cerebral embolism
• SVO lacunar infarction
• ICH intracerebral hemorrhage
• SVO lacunar infarction
• a to D are volcano plots of gut microbiota composition analysis (ANCOM) performed to compare acute stroke patients and non-stroke patients.
• A shows the results of gut microbiota analysis at the genus level
• B shows the results of gut microbiota analysis at the species level
• C shows the results of oral microbiota analysis at the genus level
• D shows the results of oral microbiota analysis at the species level.
• A is a diagram showing a principal coordinate analysis plot based on the Bray-Curtis distance between the intestinal and oral flora of acute stroke patients and non-stroke patients, with acute stroke patients and non-stroke patients colored.
• B is a diagram showing the principal coordinate analysis plot colored according to the presence or absence of Streptococcus anginosus.
• Principal coordinate analysis plots based on the Bray-Curtis distance between the intestinal and oral flora of acute stroke patients and non-stroke patients are color-coded according to the presence or absence of acute stroke (A), the presence or absence of Streptococcus anginosus (B), the presence or absence of Anaerotepes hadras (C), the presence or absence of Bacteroides plebeius (D), the presence or absence of Eubacterium salci (E), the presence or absence of Haemophilus parainfluenzae (F), the presence or absence of Lancefieldella parvula (G), the presence or absence of Prevotella roescheii (H), the presence or absence of Prevotella nanseiensis (I), the presence or absence of Streptococcus cristatus (J), the presence or absence of Streptococcus infantis (K), and the presence or absence of Treponema denticola (L).
• A the presence or absence of Streptococcus
• the oval regions surrounded by dotted lines are the regions of interest set when comparing the positive rates of bacteria.
• sPLS-DA sparse partial least squares discriminant analysis
• Box plots showing the relative abundance of each bacterium in the intestinal or oral flora, divided into the presence or absence of Streptococcus anginosus Box plots showing the relative abundance of each bacterium in the intestinal flora, a, Anaerotepes hadras in the intestinal flora, b, Bacteroides plebeius in the intestinal flora, c, Eubacterium salci in the oral flora, d, Haemophilus parainfluenzae in the oral flora, e, Lancefieldella parvula in the oral flora, f, Prevotella nanseiensis in the oral flora, g, Prevotella roescheii in the oral flora, h, Streptococcus cristatus in the oral flora, i, Streptococcus infantis in the oral flora, and j, Treponema denticola in the oral
• A shows the results of principal coordinate analysis based on the Bray-Curtis distance of the MetaCyc pathway abundance of oral and gut microbiota.
• the gut microbiota of acute stroke patients 109
• the oral microbiota of acute stroke patients 151
• the oral microbiota of non-stroke patients 53
• B is a box plot showing the Bray-Curtis distance of the MetaCyc pathway between the oral microbiota and gut microbiota for acute stroke patients and non-stroke patients.
• C is a heat map showing the top 50 MetaCyc pathways that can distinguish the four groups of oral and gut microbiota in acute stroke and non-stroke patients, respectively. In C, high abundance is shown in red and low abundance in blue, and the intensity of relative abundance ranges from -1.0 to 1.0 on the z-scale.
• D–F are box plots showing the relative abundance of the homolactic acid fermentation pathway (D), sugar pathway (E), and gluconeogenesis pathway (F) in the four groups of microbiota.
• Linear regression models showing the association between the relative abundance (log10 transformed) of Streptococcus anginosus in the gut microbiota of acute stroke patients and age (A), mean blood pressure (B), heart rate (C), body mass index (D), triglycerides (E), total cholesterol (F), HDL cholesterol (G), LDL cholesterol (H), and hemoglobin A1c (I).
• A shows receiver operating characteristic curves for distinguishing acute stroke patients from non-stroke patients using vascular risk factors (age, sex, smoking, hypertension, diabetes, hyperlipidemia) and the relative abundance of S. anginosus, Anaerotepes hadras, and B. plebeius in the gut microbiota.
• B shows linear regression models showing the association between the relative abundance (log10 transformed) of S. anginosus in the gut microbiota of acute stroke patients and the NIHSS score at admission.
• the box center line, box borders, and whiskers indicate the median, 25-75%, and 10-90%, respectively.
• This figure shows Kaplan-Meire curves depicting the results of 2-year composite events (all-cause mortality or major vascular events) in acute stroke patients divided into those with or without Streptococcus anginosus in their intestinal flora.
• CLR centered log ratio
• Bacteroides flagellis Lactobacillus fermentum, Streptococcus anginosus, Streptococcus mutans, Anaerotepes hadras
• Bacteroides plebeius Dialister invissus, Eubacterium rectal, Prevotella copri, and Saterella wadsworthensis in the gut microbiota of patients with acute stroke, and each clinical indicator (NIHSS severity score, age, BMI, mean blood pressure, LDL cholesterol, HgbA1c, CRP, and BNP).
• VH periventricular hemorrhage
• DWMH deep subcortical white matter hemorrhage
• CMB cerebral microbleeds
• lacunar lacunar
• a-d *, **, and *** indicate p-values ⁇ 0.05, p-values ⁇ 0.01, and p-values ⁇ 0.001, respectively, by chi-square test.
• *, **, and *** indicate p-values ⁇ 0.05, ⁇ 0.01, and ⁇ 0.001 by Mann-Whitney test, and the center line, border, and whiskers of the box indicate the median, 25-75%, and 10-90%, respectively.
• the results of an experiment were obtained by measuring the survival time of stroke-prone spontaneously hypertensive rats (SHRSP) that were given free access to standard rat diet along with water (1%NaCl- ⁇ ABXs-), 1 w/v% saline (1%NaCl+ ⁇ ABXs-), or 1 w/v% saline containing antibiotics (1%NaCl+ ⁇ ABXs+).
• A is the experimental protocol.
• B is a Kaplan-Meire curve showing the results of measuring the survival time of each group.
• the results of an experiment were obtained by giving SHRSP free access to water (1% NaCl- ABXs-), 1 w/v% saline (1% NaCl+ ABXs-), or 1 w/v% saline containing antibiotics (1% NaCl+ ABXs+) together with a standard rat diet, and measuring body weight, evaluating neuroparalytic symptoms, and performing pathological examinations of the brain.
• A is the experimental protocol.
• B is the result of measuring the change in body weight over time from 49 to 84 days of age.
• C is a Kaplan-Meire curve showing the cumulative incidence of paralytic symptoms.
• D is a diagram showing the detection frequency of HE stained images (low-power images of brain tissue) and cerebral hemorrhage (ICH) when brain pathological analysis was performed at 105 days of age. Each HE stained image in D also shows a high-power image within a square box.
• SHRSP were given ad libitum access to water (NaCl- ⁇ ABXs-), saline containing antibiotics (NaCl- ⁇ ABXs+), saline (NaCl+ ⁇ ABXs-), or saline containing antibiotics (NaCl+ ⁇ ABXs+) along with a standard rat diet, and the cerebral and cardiac vascular structures were analyzed.
• the top row in A shows the measurement results of cerebral vascular wall thickness (median ⁇ IQR; ** p ⁇ 0.01, *** p ⁇ 0.001; Holm-Sidak's multiple comparison test).
• the bottom row in A shows cross-sectional images of typical cerebral arterioles in each group (Bar: 100 ⁇ m).
• B is a scatter plot of vascular diameter (minor axis) versus vascular wall thickness.
• C shows Masson's trichrome stained images from cardiac pathological analysis (Bar: 100 ⁇ m).
• the areas marked with a ⁇ indicate areas where vascular medial thickening was observed, and the areas marked with an * indicate areas where significant narrowing of the lumen was observed.
• the upper row in D shows the measurement results of the degree of vascular stenosis (vascular lumen area/vascular external diameter area*100) (median ⁇ IQR; *p ⁇ 0.05, Holm-Sidak's multiple comparison test.).
• the lower row in D shows cross-sectional images of typical arterioles in the heart in each group (Bar: 100 ⁇ m).
• SHRSP were given ad libitum access to water (NaCl- ⁇ ABXs-), saline containing antibiotics (NaCl- ⁇ ABXs+), saline (NaCl+ ⁇ ABXs-), or saline containing antibiotics (NaCl+ ⁇ ABXs+) along with a standard rat diet, and the renal arteriole structure and small intestine structure were analyzed.
• the image on the left in A is a Masson's trichrome stained image (low-magnification image of renal tissue) obtained during renal pathology analysis.
• the Masson's trichrome stained image in A also shows a high-magnification image within a square.
• the right panel in A shows the frequency of obstructed vessels, severe vessels, and mild-moderate stenosis vessels.
• the top image in B is a Masson's trichrome stained image obtained during small intestine pathology analysis (Bar: 100 ⁇ m).
• the lower figure in B shows the measurement results of the cross-sectional length of the small intestinal villi, small intestinal fibrosis, and small intestinal muscularis submucosalis (median ⁇ IQR; ** p ⁇ 0.01, Holm-Sidak's multiple comparison test.).
• A shows the alpha diversity (observed taxonomic features) of the intestinal flora of each group at 84 days of age.
• B shows the results of clustering the intestinal flora of each group at 84 days of age using partial least squares regression (sPLS-DA) analysis.
• C shows a volcano plot created by analyzing the composition of the intestinal flora of the group given water (NaCl-, ABXs-) and the group given saline (NaCl+, ABXs-) using the -log 10 of the significant difference test (p value) between the two groups by t-test and the log 2 (FC) of the fold change (FC).
• D is a volcano plot of the gut microbiota composition of the group that ingested saline (NaCl+ ⁇ ABXs-) and the group that ingested saline containing antibiotics (NaCl+ ⁇ ABXs+), using the -log 10 of the significance test (p value) between the two groups by t-test and the log 2 (FC) of the fold change (FC).
• E is a Venn diagram created for the gut bacterial species that significantly changed between the group that ingested water (NaCl- ⁇ ABXs-) and the group that ingested saline (NaCl+ ⁇ ABXs-), and the gut bacterial species that significantly changed between the group that ingested saline (NaCl+ ⁇ ABXs-) and the group that ingested saline containing antibiotics (NaCl+ ⁇ ABXs+).
• the results of an experiment were obtained by measuring survival time in SHRSPs that were given 1% NaCl+, 1% NaCl+ABXs+, 1% NaCl+Ampicillin, 1% NaCl+Metronidazole, or 1% NaCl+Vancomycin along with a standard rat diet.
• A is the experimental protocol.
• B is a Kaplan-Meire curve showing the results of measuring survival time for each group.
• a "subject” refers to a human or non-human animal that is the subject of a test for the presence or absence of stroke, the type of stroke, the presence or absence of stroke complicated by sarcopenia, the severity of stroke, or the risk of stroke recurrence.
• non-human animals include non-human mammals such as primates, rats, mice, gerbils, guinea pigs, hamsters, ferrets, rabbits, cows, horses, pigs, goats, dogs, and cats.
• stroke refers to a disease in which blood vessels in the brain suddenly rupture or become blocked, causing disruption to blood circulation in the brain. Stroke is broadly divided into two types: ischemic stroke (cerebral infarction) and hemorrhagic stroke (cerebral hemorrhage). Ischemic stroke is further divided into types such as primary cerebral embolism, atherothrombotic cerebral infarction, and lacunar infarction, while hemorrhagic stroke is further divided into two types: intracerebral hemorrhage (intracerebral hemorrhage) and subarachnoid hemorrhage.
• severity of stroke refers to the degree of stroke symptoms.
• the severity of stroke is determined by the National Institutes of Health Stroke Scale (NIHSS) score or the Modified Rankin Scale (mRS) score.
• the NIHSS score is determined on a scale of 0 to 42 points, with the higher the score, the more severe the stroke.
• the mRS score is determined on a scale of 0 to 5, with the higher the grade, the more severe the stroke.
• sarcopenia refers to a condition in which muscle mass decreases throughout the body, resulting in reduced muscle strength and physical function.
• the "relative abundance of a specific family, genus, or species of enterobacteria in the intestinal microbiota” refers to the relative ratio (%) of the number of bacteria belonging to a specific family, genus, or species present in the intestinal microbiota when the total number of bacteria present in the intestinal microbiota is taken as 100%.
• the "relative abundance of a specific family, genus, or species of enterobacteria in the oral microbiota” refers to the relative ratio (%) of the number of bacteria belonging to a specific family, genus, or species present in the oral microbiota when the total number of bacteria present in the oral microbiota is taken as 100%.
• the relative abundance of Streptococcus family bacteria in the intestinal microbiota refers to the relative ratio of the number of bacteria belonging to Streptococcus family present in the intestinal microbiota when the total number of enterobacteria present in the intestinal microbiota is taken as 100%.
• the relative abundance of Streptococcus genus bacteria in the intestinal microbiota refers to the relative ratio of the number of bacteria belonging to Streptococcus genus present in the intestinal microbiota when the total number of enterobacteria present in the intestinal microbiota is taken as 100%.
• the relative abundance of Streptococcus anginosus in the intestinal flora is the relative ratio of the number of bacteria belonging to Streptococcus anginosus present in the intestinal flora when the total number of intestinal bacteria present in the intestinal flora is taken as 100%.
• a "stroke improving agent” is a drug used for the purposes of suppressing the onset of stroke; curing, alleviating, or inhibiting the progression of stroke pathology; preventing, curing, alleviating, or inhibiting the progression of stroke complications; or preventing the recurrence of stroke.
• test substance is a substance that is the subject of a screening method to confirm whether or not it has a desired effect.
• Test method 1 includes a step of measuring the presence or absence of at least one bacterium selected from the group consisting of Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, Streptococcus salivarius, and Lactobacillus fermentum in the intestinal flora collected from a subject.
• Streptococcus anginosus, Streptococcus parasanguinis, Streptococcus salivarius, and Streptococcus mutans are bacteria that are normally present in the oral cavity and are not usually present in the intestinal flora, but the present inventors have found that these bacteria are transferred from the oral cavity to the intestinal flora in stroke patients.
• Lactobacillus fermentum is not usually present in the intestinal flora, but is found in the intestinal flora of stroke patients. Therefore, by confirming the presence or absence of the above bacteria in the intestinal flora, the presence or absence of stroke can be examined.
• the subject may be any person who needs to be tested for the presence or absence of stroke.
• the bacteria to be measured may be one or more of Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, Streptococcus salivarius, and Lactobacillus fermentum.
• DNA can be extracted from a sample containing the intestinal flora and the DNA can be subjected to metagenomic analysis or PCR analysis.
• Samples containing intestinal flora may be feces, digestive tract contents collected from the digestive tract, etc., but feces is preferred because it can be collected non-invasively.
• DNA can be extracted from samples containing intestinal flora by known methods.
• Metagenomic analysis may be either 16SrRNA metagenomic analysis or full metagenomic analysis, and can be performed by known methods.
• PCR analysis can be performed by a known method using primers capable of specifically detecting the bacteria, and DNA extracted from a sample containing the intestinal flora as a template.
• Primers capable of specifically detecting the bacteria are known or can be designed by those skilled in the art using their ordinary creative abilities, and examples thereof include the following primers.
• Primer F capable of specifically detecting Streptococcus anginosus CAAGTAGGACGCACAGTTTA (SEQ ID NO: 1)
• R: TGTGTTACATACTGTTATGCGGT SEQ ID NO: 2
• Primer capable of specifically detecting Streptococcus mutans F: AGCCATGCGCAATCAACAGGTT (SEQ ID NO: 3)
• R: CGCAACGCGAACATCTTGATCAG SEQ ID NO: 4
• Primer F capable of specifically detecting Streptococcus parasanguinis AACAATGCGATYCCAGTATCRAG (SEQ ID NO: 5)
• R: CTACGACATTAAAGGTACCDCGG SEQ ID NO: 6)
• R: GATTCTGTCAAAGAAGCCAC SEQ ID NO: 8
• Primer F capable of specifically detecting Lactobacillus fermentum
• test method 1 of the present disclosure a subject in whom at least one type of bacteria, Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, Streptococcus salivarius, and Lactobacillus fermentum, is detected in the intestinal flora is determined to be highly likely to have a stroke.
• test method 2 Method for testing the presence or absence of stroke or its type using intestinal flora
• test method 4 Method for testing the severity of stroke using Streptococcus anginosus in the intestinal flora as an indicator
• one embodiment of the test method 1 of the present disclosure includes detecting at least one of Streptococcus parasanguinis, Streptococcus salivarius, and Streptococcus mutans from the intestinal flora in addition to Streptococcus anginosus.
• testing method 1 disclosed herein can be performed as a test to assist in the diagnosis of stroke, subjects who are determined to have a high probability of having a stroke by the testing method 1 disclosed herein can undergo further tests such as imaging tests and blood tests.
• test kit for use in carrying out the test method 1 of the present disclosure.
• the test kit may include a primer capable of specifically detecting the bacteria.
• the test kit may further include a reagent for extracting DNA from a sample containing the intestinal microflora, as necessary.
• Test method 2 Method for testing the presence or absence of stroke or its type using intestinal flora
• the method includes a step of measuring the relative abundance of at least one type of bacteria selected from the group consisting of Bacteroides vulgatus, Prevotella copri, Saterella wadsworthensis, Bifidobacterium pseudocatenulatum, Bifidobacterium longum, Eubacterium rectal, Dialister invissus, Fusicateni
• the relative abundance of these bacteria in the intestinal flora varies depending on the presence or absence of stroke or the presence or absence of a specific type of stroke, so that the relative abundance of these bacteria in the intestinal flora can be used as an indicator to test the presence or absence of stroke or the type of stroke.
• the subject may be any person who needs to be tested for the presence or absence of stroke, or for the type of stroke.
• the subject of measurement of relative abundance in the intestinal bacterial flora may be one or more of the above bacteria.
• DNA can be extracted from a sample containing the gut microbiota and the DNA can be subjected to metagenomic or PCR analysis.
• Samples containing intestinal flora may be feces, digestive tract contents collected from the digestive tract, etc., but feces is preferred because it can be collected non-invasively.
• DNA can be extracted from samples containing intestinal flora by known methods.
• Metagenomic analysis may be either 16SrRNA metagenomic analysis or full metagenomic analysis, and can be performed by known methods.
• PCR analysis can be performed by a known method using a primer capable of detecting all bacteria and a primer capable of specifically detecting the bacteria of the specific family, genus or species, and using DNA extracted from a sample containing intestinal flora as a template.
• the primer capable of detecting all bacteria and the primer capable of specifically detecting the bacteria of the specific family, genus or species are known or can be designed by a person skilled in the art by exerting normal creative ability, and for example, the primer capable of specifically detecting Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, Streptococcus salivarius, and Lactobacillus fermentum can be exemplified by those exemplified in the column of the test method 1.
• the primer capable of detecting bacteria other than these can be, for example, the following.
• Primer capable of detecting all bacteria F: AGRGTTTGATYMTGGCTCAG (SEQ ID NO: 11) R: TGCTGCCTCCCGTAGGAGT (SEQ ID NO: 12) -Primer capable of detecting Clostridium perfringens F: AAAGATGGCARCARCARRCAAC (SEQ ID NO: 13) R: TACCGTCATTATCTTCCCCAAA (SEQ ID NO: 14) Primer capable of detecting Streptococcus bacteria F: AGCTTAGAAGCAGCTATTCATTC (SEQ ID NO: 15) R: GGATACACCTTTCGGTCTCTC (SEQ ID NO: 16) Primer capable of detecting Lactobacillus bacteria F: CTTGTACACACCGCCCGTCA (SEQ ID NO: 17) R: CTCAAAACTAAACAAAGTTTC (SEQ ID NO: 18) Primer capable of detecting Streptococcus bacteria F: AGCTTAGAAGCAGCTATTCATTC (SEQ ID NO: 19) R: GGATACACC
• a subject having a high relative abundance of at least one type of bacteria selected from the group consisting of Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, Streptococcus salivarius, Lactobacillus fermentum, Clostridium perfringens, Alistipes putrediense, Streptococcus genus bacteria, Lactobacillus genus bacteria, and Alistipes genus bacteria in the intestinal flora is determined to be highly likely to have a stroke.
• the relative abundance (reference value) of the bacteria in the intestinal flora of healthy subjects and/or stroke patients can be determined in advance and compared with the reference value. For example, when the relative abundance of the bacteria in the subject is high compared to the relative abundance of the bacteria in healthy subjects, it can be determined that the subject is highly likely to have a stroke.
• the possibility of a subject suffering from stroke can be determined from the cutoff values obtained from the test data shown in the Examples section according to the following criteria: when the relative abundance of Streptococcus anginosus in the intestinal flora of the subject is 0.17% (cutoff value) or more, when the relative abundance of Streptococcus mutans is 0.11% (cutoff value) or more, when the relative abundance of Streptococcus parasanguinis is 0.45% (cutoff value) or more, when the relative abundance of Streptococcus salivarius is 0.69% (cutoff value) or more, when the relative abundance of Lactobacillus fermentum is 0.17% (cutoff value) or more.
• cutoff value indicates the intermediate value between the average value of the relative abundance of the acute stroke patient group and the average value of the relative abundance of the non-stroke patient group based on the test data shown in the Examples column, and the cutoff value is merely an example and can be set appropriately depending on the sample, test conditions, etc.
• subjects with high relative abundances of Bacteroides flagellis and Lactobacillus fermentum in the intestinal flora are determined to be highly likely to suffer from cardiogenic cerebral embolism.
• the relative abundance of Bacteroides flagellis in the intestinal flora can be determined by comparing the relative abundance (reference value) of Streptococcus bacteria in the intestinal flora of healthy subjects and/or patients with cardiogenic cerebral embolism with the reference value obtained in advance.
• subjects with a high relative abundance of Streptococcus mutans in their intestinal flora are determined to be highly likely to suffer from cardiogenic cerebral embolism or atherothrombotic cerebral embolism.
• the relative abundance of Streptococcus mutans in the intestinal flora can be determined in advance by determining the relative abundance (reference value) of Streptococcus mutans in the intestinal flora of healthy individuals and/or patients with cardiogenic cerebral embolism or atherothrombotic cerebral embolism and comparing the relative abundance with the reference value.
• the relative abundance of Saterella wadsworthensis in the intestinal flora can be determined by previously determining the relative abundance (reference value) of Saterella wadsworthensis in the intestinal flora of healthy individuals and/or patients with lacunar infarction, and comparing the relative abundance with the reference value.
• a subject having a low relative abundance of at least one type of bacteria selected from the group consisting of Eubacterium rectal and Dialister invissus in the intestinal flora is determined to be highly likely to have intracerebral hemorrhage.
• the relative abundance (reference value) of these bacteria in the intestinal flora of healthy subjects and/or patients with intracerebral hemorrhage can be determined in advance and compared with the reference value.
• a subject with a high relative abundance of Streptococcus bacteria in the intestinal flora is determined to be highly likely to suffer from cardiogenic cerebral embolism, lacunar infarction, or atherothrombotic cerebral embolism.
• the relative abundance of Streptococcus bacteria in the intestinal flora can be determined by, specifically, determining the relative abundance (reference value) of Streptococcus bacteria in the intestinal flora of healthy subjects and/or patients with cardiogenic cerebral embolism, lacunar infarction, or atherothrombotic cerebral embolism in advance, and comparing the relative abundance with the reference value.
• the cutoff value indicates the median value between the groups of the average relative abundance based on the test data shown in the Examples section, and the cutoff value is merely an example and can be set appropriately depending on the specimen, test conditions, etc.
• the relative abundance of at least one type of bacteria selected from the group consisting of Streptococcus mutans, Streptococcus parasanguinis, Clostridium perfringens, and Alistipes putredidis in the intestinal flora is higher. Therefore, in the test method 2 disclosed herein, the higher the relative abundance of the bacteria in the intestinal flora, the higher the possibility of the patient suffering from stroke accompanied by sarcopenia.
• the relative abundance (reference value) of the bacteria in the intestinal flora of a stroke patient accompanied by sarcopenia and/or a stroke patient without sarcopenia is determined in advance, and the judgment can be made by comparing with the reference value. For example, when the relative abundance of the bacteria in the subject is higher than the relative abundance of the bacteria in a stroke patient without sarcopenia, it can be determined that the subject is highly likely to suffer from stroke accompanied by sarcopenia.
• cutoff value indicates the intermediate value between the average value of the relative abundance of the stroke patient group accompanied by sarcopenia and the average value of the relative abundance of the stroke patient group without sarcopenia based on the test data shown in the Examples section, and the cutoff value is merely an example and can be set appropriately depending on the sample, test conditions, etc.
• a subject having a low relative abundance of at least one type of bacteria selected from the group consisting of Bacteroides plebeius, Anaerotepes hadras, Ruminococcus biscirculans, Bacteroides vulgatus, Prevotella copri, Saterella wadsworthensis, Fusicatenibacter, Faecalibacterium, Dorea, Anaerotipes, Ruminococcus, and Butyricoccus in the intestinal flora is determined to be highly likely to have suffered from a stroke.
• the relative abundance (reference value) of the bacteria in the intestinal flora of healthy subjects and/or stroke patients can be determined in advance and compared with the reference value.
• the relative abundance of the bacteria in a subject when the relative abundance of the bacteria in a subject is low compared to the relative abundance of the bacteria in a healthy subject, it can be determined that the subject is highly likely to suffer from a stroke. Specifically, the possibility of a subject suffering from a stroke can be determined based on the cutoff value obtained from the test data shown in the Examples section, using the following criteria: In the subject's intestinal flora, when the relative abundance of Bacteroides plebeius is less than 1.05% (cutoff value), when the relative abundance of Anaerotepes hadras is less than 1.47% (cutoff value), when the relative abundance of Ruminococcus biscirculans is less than 1.03% (cutoff value), when the relative abundance of Bacteroides vulgatus is less than 4.51% (cutoff value), when the relative abundance of Prevotella copri is less than 1.81% (cutoff value), and when the relative abundance of Saterella wadsworthensis is less than 0.19% (cutoff value).
• cutoff value indicates the intermediate value between the average value of the relative abundance of the acute stroke patient group and the average value of the relative abundance of the non-stroke patient group based on the test data shown in the Examples column, and the cutoff value is merely an example and can be set appropriately depending on the sample, test conditions, etc.
• a subject having a low relative abundance of at least one type of bacteria selected from the group consisting of Bifidobacterium pseudocatenulatum, Bifidobacterium longum, Bifidobacteria, and Bifidobacteriaceae in the intestinal flora is determined to be highly likely to have cardiogenic cerebral embolism.
• the relative abundance (reference value) of the bacteria in the intestinal flora of healthy subjects and/or patients with cardiogenic cerebral embolism can be determined in advance by comparing with the reference value.
• the cutoff value indicates the median value between the average relative abundances of each group based on the test data shown in the Examples section, and the cutoff value is merely an example and can be set appropriately depending on the
• a subject with a low relative abundance of Prevotellaceae bacteria in the intestinal flora is determined to be highly likely to suffer from lacunar infarction or intracerebral hemorrhage.
• the relative abundance of Prevotellaceae bacteria in the intestinal flora can be determined by, specifically, determining the relative abundance (reference value) of Prevotellaceae bacteria in the intestinal flora of a healthy subject and/or a subject with lacunar infarction or intracerebral hemorrhage in advance and comparing it with the reference value.
• the relative abundance of Prevotellaceae bacteria in a subject is low compared to the relative abundance of Prevotellaceae bacteria in a healthy subject, it can be determined that the subject is highly likely to suffer from lacunar infarction or intracerebral hemorrhage.
• the relative abundance of Prevotellaceae bacteria in the intestinal flora of a subject is less than 2.07% (cutoff value)
• the cutoff value is based on the test data shown in the Examples section and indicates the median value between the groups of the average relative abundance. This cutoff value is merely an example and can be set appropriately depending on the specimen, test conditions, etc.
• the relative abundance of at least one type of bacteria selected from the group consisting of Bacteroides vulgatus, Prevotella copri, and Butyricoccus bacteria in the intestinal flora is lower. Therefore, in the test method 2 disclosed herein, the lower the relative abundance of the bacteria in the intestinal flora, the higher the possibility of the patient suffering from stroke accompanied by sarcopenia. Specifically, the relative abundance (reference value) of the bacteria in the intestinal flora of a stroke patient accompanied by sarcopenia and/or a stroke patient without sarcopenia is determined in advance, and the judgment can be made by comparing with the reference value.
• the relative abundance of the bacteria in a subject is lower than the relative abundance of the bacteria in a stroke patient without sarcopenia, it can be determined that the subject is highly likely to suffer from stroke accompanied by sarcopenia.
• the cutoff value obtained from the test data shown in the Examples section if the relative abundance of Bacteroides vulgatus in the intestinal flora of the subject is less than 2.82% (cutoff value), if the relative abundance of Prevotella copri is less than 0.37% (cutoff value), or if the relative abundance of Butyricoccus bacteria is less than 0.05% (cutoff value), it can be determined that the subject is highly likely to have suffered from sarcopenia-associated stroke.
• cutoff value indicates the intermediate value between the average relative abundance of the stroke patient group with sarcopenia and the average relative abundance of the stroke patient group without sarcopenia based on the test data shown in the Examples section, and the cutoff value is merely an example and can be set appropriately depending on the sample, test conditions, etc.
• test method 2 disclosed herein can be performed as a test to assist in the diagnosis of stroke, subjects who are determined to have a high probability of having a stroke by the test method 2 disclosed herein can undergo further tests such as imaging tests and blood tests.
• test kit for use in carrying out the test method 2 of the present disclosure.
• the test kit may include a primer capable of specifically detecting the bacteria.
• the test kit may further include a reagent for extracting DNA from a sample containing the intestinal microflora, as necessary.
• Test Method 3 includes a step of measuring the relative abundance of at least one bacterium selected from the group consisting of Streptococcus anginosus, Anaerotepes hadras, Bacteroides plebius, Eubacterium rectal, Prevotella copri, and Lactobacillus fermentum in the intestinal flora collected from a subject. Since the relative abundance of these bacteria in the intestinal flora correlates with the severity of stroke, it is possible to test the severity of stroke by using the relative abundance of Streptococcus anginosus in the intestinal flora as an index.
• the subject may be anyone who requires testing for the severity of a stroke, and may be not only a stroke patient, but also anyone who requires testing for the presence or absence of a stroke.
• DNA can be extracted from a sample containing the gut microbiota and the DNA can be subjected to metagenomic or PCR analysis.
• Samples containing intestinal flora may be feces, digestive tract contents collected from the digestive tract, etc., but feces is preferred because it can be collected non-invasively.
• DNA can be extracted from samples containing intestinal flora by known methods.
• Metagenomic analysis may be either 16SrRNA metagenomic analysis or full metagenomic analysis, and can be performed by known methods.
• PCR analysis can be performed by a known method using primers capable of detecting all bacteria and primers capable of specifically detecting the bacteria, and DNA extracted from a sample containing the intestinal flora as a template.
• Primers capable of detecting all bacteria and primers capable of specifically detecting the bacteria are known or can be designed by a person skilled in the art using their normal creative abilities, and specific examples of such primers include those exemplified in the columns for Test Methods 1 and 2 above.
• the relative abundance (reference value) of these bacteria in the intestinal flora of stroke patients with different degrees of severity is determined in advance, and the severity can be judged by comparing with the reference value.
• the relative abundance (reference value) of these bacteria in the intestinal flora of stroke patients with different degrees of severity is determined in advance, and the severity can be judged by comparing with the reference value.
• test kit for use in carrying out the test method 3 of the present disclosure.
• the test kit may include a primer capable of specifically detecting the bacteria.
• the test kit may further include, as necessary, a primer capable of detecting all bacteria in the intestinal flora, and/or a reagent for extracting DNA from a sample containing the intestinal flora.
• Test 4 Method for assessing risk of stroke recurrence using Streptococcus anginosus in the intestinal flora as an indicator.
• Testing Method 4 includes a step of measuring the relative abundance of Streptococcus anginosus in the intestinal microbiota collected from a subject.
• the subject may be any person who requires testing for the risk of stroke recurrence, and may be any of acute stroke patients, convalescent stroke patients, those who are left with aftereffects after stroke recovery, and those who have recovered from stroke.
• DNA can be extracted from a sample containing the gut microbiota and subjected to metagenomic or PCR analysis.
• Samples containing intestinal flora may be feces, digestive tract contents collected from the digestive tract, etc., but feces is preferred because it can be collected non-invasively.
• DNA can be extracted from samples containing intestinal flora by known methods.
• Metagenomic analysis may be either 16SrRNA metagenomic analysis or full metagenomic analysis, and can be performed by known methods.
• PCR analysis can be performed by a known method using primers capable of detecting all bacteria and primers capable of specifically detecting Streptococcus anginosus, and DNA extracted from a sample containing intestinal flora as a template.
• Primers capable of detecting all bacteria and primers capable of specifically detecting Streptococcus anginosus are known or can be designed by a person skilled in the art using their normal creative abilities, and specific examples of such primers include those exemplified in the columns for Test Methods 1 and 2 above.
• the higher the relative abundance of Streptococcus anginosus in the intestinal flora the higher the risk of stroke recurrence is determined to be.
• the relative abundance (reference value) of Streptococcus anginosus in the intestinal flora of acute stroke first-time patients and/or acute stroke recurrence patients is obtained in advance, and the risk of stroke recurrence can be determined by comparing with the reference value. For example, when the relative abundance of Streptococcus anginosus in the subject is higher than the relative abundance of Streptococcus anginosus in acute stroke first-time patients, the risk of stroke recurrence can be determined to be high.
• the cutoff value is based on the test data shown in the Examples section and indicates the intermediate value between the average relative abundance in the group of patients with first acute stroke and the average relative abundance in the group of patients with recurrent acute stroke. This cutoff value is merely an example and can be set appropriately depending on the specimen, test conditions, etc.
• prognosis can be monitored by carefully administering medication and increasing the frequency of imaging tests so that early intervention and early treatment can be performed for predicted stroke recurrence.
• test kit for use in carrying out the test method 4 of the present disclosure.
• the test kit may include a primer capable of specifically detecting Streptococcus anginosus.
• the test kit may further include, as necessary, a primer capable of detecting all bacteria in the intestinal flora, and/or a reagent for extracting DNA from a sample containing the intestinal flora.
• Test method for predicting the prognosis of stroke using Streptococcus anginosus in the intestinal flora as an indicator (Test method 5)
• a test method for predicting the prognosis of stroke (hereinafter, sometimes referred to as "Test Method 5") is provided.
• Test Method 5 of the present disclosure includes a step of measuring the presence or absence of Streptococcus anginosus in the intestinal flora collected from a subject.
• Stroke patients who have Streptococcus anginosus in their intestinal flora have a higher risk of death or recurrence of vascular disease within two years than patients who do not have Streptococcus anginosus in their intestinal flora, so that a test for predicting the prognosis of stroke can be performed by using the presence or absence of Streptococcus anginosus in the intestinal flora as an indicator.
• the subject may be any person who requires testing to predict the prognosis of a stroke, and may be any of the following: an acute stroke patient, a convalescent stroke patient, a person who is left with aftereffects after recovery from a stroke, or a person who has recovered from a stroke.
• DNA can be extracted from a sample containing the intestinal flora and the DNA can be subjected to metagenomic or PCR analysis.
• Samples containing intestinal flora may be feces, digestive tract contents collected from the digestive tract, etc., but feces is preferred because it can be collected non-invasively.
• DNA can be extracted from samples containing intestinal flora by known methods.
• Metagenomic analysis may be either 16SrRNA metagenomic analysis or full metagenomic analysis, and can be performed by known methods.
• PCR analysis can be performed by a known method using primers capable of specifically detecting Streptococcus anginosus and DNA extracted from a sample containing intestinal flora as a template.
• Primers capable of specifically detecting Streptococcus anginosus are known or can be designed by a person skilled in the art using their normal creative abilities, and specific examples of such primers include those exemplified in the section on Test Method 1 above.
• subjects in whom Streptococcus anginosus is detected in the intestinal flora are determined to be at high risk of death or recurrence of vascular disease (ischemic stroke, hemorrhagic stroke, myocardial infarction, worsening heart failure, or peripheral vascular occlusion) within two years and are likely to have a poor prognosis.
• vascular disease ischemic stroke, hemorrhagic stroke, myocardial infarction, worsening heart failure, or peripheral vascular occlusion
• prognosis can be monitored by carefully administering medication and increasing the frequency of imaging tests so that early intervention and early treatment can be performed for the predicted poor prognosis.
• test kit for use in carrying out the test method 5 of the present disclosure.
• the test kit may include a primer capable of specifically detecting Streptococcus anginosus.
• the test kit may further include, as necessary, a primer capable of detecting all bacteria in the intestinal flora, and/or a reagent for extracting DNA from a sample containing the intestinal flora.
• Test Method 6 Method for examining the presence or absence of sarcopenia in stroke patients using intestinal flora.
• Test Method 6 includes a step of measuring the relative abundance of at least one type of bacteria selected from the group consisting of Ruminococcus torx and Veionella spp. bacteria in the intestinal flora collected from a subject.
• the subject may be any stroke patient who requires testing for sarcopenia.
• DNA can be extracted from a sample containing the gut microbiota and the DNA can be subjected to metagenomic or PCR analysis.
• Samples containing intestinal flora may be feces, digestive tract contents collected from the digestive tract, etc., but feces is preferred because it can be collected non-invasively.
• DNA can be extracted from samples containing intestinal flora by known methods.
• Metagenomic analysis may be either 16SrRNA metagenomic analysis or full metagenomic analysis, and can be performed by known methods.
• PCR analysis can be performed by a known method using primers capable of detecting all bacteria and primers capable of specifically detecting the bacteria, and DNA extracted from a sample containing intestinal flora as a template.
• Primers capable of detecting all bacteria and primers capable of specifically detecting Streptococcus anginosus are known or can be designed by a person skilled in the art using their normal creative abilities, and specific examples of primers capable of detecting all bacteria include those exemplified in the Testing Method 2 column above.
• the relative abundance of Ruminococcus torque in the intestinal flora the higher the possibility of the patient having a stroke accompanied by sarcopenia.
• the relative abundance (reference value) of Ruminococcus torque in the intestinal flora of stroke patients accompanied by sarcopenia and stroke patients without sarcopenia is determined in advance, and the judgment can be made by comparing with the reference value. For example, when the relative abundance of Ruminococcus torque in a subject is lower than the relative abundance of Ruminococcus torque in stroke patients without sarcopenia, it can be determined that the subject is highly likely to have a stroke accompanied by sarcopenia.
• cutoff value when the relative abundance of Ruminococcus torque in the intestinal flora of a subject is less than 1.16% (cutoff value), it can be determined that the subject is highly likely to have a stroke accompanied by sarcopenia. Note that the above cutoff value is an example and can be set appropriately depending on the sample, test conditions, etc.
• the higher the relative abundance of Bayonella bacteria in the intestinal flora the higher the possibility of the subject suffering from stroke accompanied by sarcopenia.
• the relative abundance (reference value) of Bayonella bacteria in the intestinal flora of stroke patients accompanied by sarcopenia and stroke patients without sarcopenia is obtained in advance, and the subject can be judged by comparing with the reference value. For example, when the relative abundance of Bayonella bacteria in a subject is higher than the relative abundance of Bayonella bacteria in stroke patients without sarcopenia, it can be judged that the subject is likely to suffer from stroke accompanied by sarcopenia.
• cutoff value obtained from the test data shown in the Examples section, when the relative abundance of Bayonella bacteria in the intestinal flora of a subject is 0.11% (cutoff value) or more, it can be judged that the subject is likely to suffer from stroke accompanied by sarcopenia.
• cutoff value is an example and can be set appropriately depending on the sample, test conditions, etc.
• test kit for use in carrying out the test method 6 of the present disclosure.
• the test kit may include a primer capable of specifically detecting the bacteria.
• the test kit may further include, as necessary, a primer capable of detecting all bacteria in the intestinal flora, and/or a reagent for extracting DNA from a sample containing the intestinal flora.
• Test Method 7 a method for testing the presence or absence of stroke.
• the method includes a step of measuring the relative abundance of at least one type of bacteria selected from the group consisting of bacteria, Capnocytophaga bacteria, Campylobacter bacteria, Streptococcus family bacteria, Eubacterium salci, Streptococcus infantis, Haemophilus parainfluenzae, Prevotella nantheiensis, Lancefieldella parvula, Neisseria bacteria, Saccharimonada TM7x bacteria, Haemophilus bacteria, Alloprevotella bacteria, Prevotellaceae bacteria, and Veillonellaceae bacteria.
• the relative abundance of these bacteria in the oral flora changes depending on the presence or absence of stroke, so that the relative abundance of these bacteria in the oral flora can be used as an indicator to test for the presence or absence of stroke.
• the subject may be any person who needs to be tested for the presence or absence of stroke.
• the subject of measurement of relative abundance in the oral bacterial flora may be one or more of the above bacteria.
• DNA can be extracted from a sample containing the oral flora and the DNA can be subjected to metagenomic analysis or PCR analysis.
• the sample containing the oral flora is preferably saliva, but may be a sample collected from the tooth surface, periodontal pocket, tongue surface, buccal mucosa, etc. Furthermore, it is preferable to collect the sample containing the oral flora before eating, brushing teeth, gargling, etc. DNA can be extracted from the sample containing the oral flora by known methods.
• Metagenomic analysis may be either 16SrRNA metagenomic analysis or full metagenomic analysis, and can be performed by known methods.
• PCR analysis can be performed by a known method using a primer capable of detecting all bacteria and a primer capable of specifically detecting the bacteria of the specific family, genus or species, and using DNA extracted from a sample containing oral flora as a template.
• the primer capable of detecting all bacteria and the primer capable of specifically detecting the bacteria of the specific family, genus or species are known or can be designed by a person skilled in the art by exerting normal creative ability.
• the primer capable of detecting all bacteria and the primer capable of specifically detecting Streptococcus anginosus, Lactobacillus fermentum, Streptococcus bacteria, Streptococcus family bacteria, and Prevotellaceae bacteria are exemplified in the columns of the test method 1 and 2.
• the primer capable of detecting bacteria other than these can be, for example, the following.
• F KGGGCTCAACMCMGTATTG (SEQ ID NO: 51)
• R TCGCGTTAGCTTGGGCGC (SEQ ID NO:52)
• Primer capable of detecting Campylobacter bacteria F: GGATGACACTTTTCGGAGC (SEQ ID NO: 53)
• Primer capable of detecting Haemophilus parainfluenza GATGAAAGTGTGGGACCTTCG (SEQ ID NO: 55)
• Primer capable of detecting Saccharimonada TM7x bacteria F: AYTGGGCGTAAAGAGTTGC (SEQ ID NO: 57)
• R: GTCCCCGTCAATTCCTTTATG SEQ ID NO: 58
• a subject having a high relative abundance of at least one type of bacteria selected from the group consisting of Streptococcus anginosus, Treponema denticola, Streptococcus cristatus, Prevotella roescheii, Lactobacillus fermentum, Streptococcus gordonii, Streptococcus constellatus, Campylovitor gracilis, Selenomonas sproda, Tannerella forsythia, Porphyromonas spp., Fusobacterium spp., Streptococcus spp., Capnocytophaga spp., Campylobacter spp., and Streptococcus spp.
• the relative abundance of the bacteria in the oral flora can be determined by comparing the relative abundance (reference value) of the bacteria in the oral flora of healthy subjects and/or stroke patients with the reference value obtained in advance. For example, when the relative abundance of the bacteria in a subject is higher than that in a healthy subject, it can be determined that the subject is likely to have a stroke. Specifically, the possibility of a subject having a stroke can be determined based on the cutoff value obtained from the test data shown in the Examples section, according to the following criteria.
• the relative abundance of Streptococcus anginosus was 0.13% (cutoff value) or more
• the relative abundance of Treponema denticola was 0.13% (cutoff value) or more
• the relative abundance of Streptococcus cristatus was 0.12% (cutoff value) or more
• the relative abundance of Prevotella roescheii was 0.15% (cutoff value) or more
• the relative abundance of Lactobacillus fermentum was 0.08% (cutoff value) or more
• the relative abundance of Streptococcus gordonii was 0.22% (cutoff value) or more
• the relative abundance of Streptococcus constellatus was 0.17% (cutoff value) or more
• the relative abundance of Campylovater gracilis was 0.13% (cutoff value).
• the cutoff value is based on the test data shown in the Examples section and indicates the intermediate value between the average relative abundance in the acute stroke patient group and the average relative abundance in the non-stroke patient group. This cutoff value is merely an example and can be set appropriately depending on the sample, test conditions, etc.
• a subject having a low relative abundance of at least one type of bacteria selected from the group consisting of Eubacterium salci, Streptococcus infantis, Haemophilus parainfluenzae, Prevotella nanseiense, Lancefieldella parvula, Neisseria genus bacteria, Saccharimonada TM7x genus bacteria, Haemophilus genus bacteria, Alloprevotella genus bacteria, Prevotellaceae family bacteria, and Veillonellaceae family bacteria in the oral bacterial flora is determined to be highly likely to have a stroke.
• the relative abundance (reference value) of the bacteria in the oral bacterial flora of healthy subjects and/or stroke patients can be determined in advance and compared with the reference value. For example, when the relative abundance of the bacteria in the subject is low compared to the relative abundance of the bacteria in healthy subjects, it can be determined that the subject is highly likely to have a stroke.
• the possibility of a subject suffering from stroke can be determined from the cutoff values obtained from the test data shown in the Examples section, according to the following criteria: when the relative abundance of Ubacterium salci in the oral flora of the subject is less than 0.40% (cutoff value), when the relative abundance of Streptococcus infantis is less than 1.05% (cutoff value), when the relative abundance of Haemophilus parainfluenzae is less than 1.49% (cutoff value), when the relative abundance of Prevotella nanseiensis is less than 1.01% (cutoff value), when the relative abundance of Lancefieldella parvula is less than 0.11% (cutoff value), when the relative abundance of Neisseria bacteria is less than 1.0 ...
• the cutoff value indicates the intermediate value between the average value of the relative abundance of the acute stroke patient group and the average value of the relative abundance of the non-stroke patient group based on the test data shown in the Examples column, and the cutoff value is merely an example and can be set appropriately depending on the sample, test conditions, etc.
• testing method 7 disclosed herein can be performed as a test to assist in the diagnosis of stroke, subjects who are determined to have a high probability of having a stroke by the testing method 7 disclosed herein can undergo further tests such as imaging tests and blood tests.
• test kit for use in carrying out the test method 7 of the present disclosure.
• the test kit may include a primer capable of specifically detecting the bacteria.
• the test kit may further include a reagent for extracting DNA from a sample containing oral bacterial flora, as necessary.
• a stroke improving agent (hereinafter, sometimes referred to as “improving agent 1") is provided, which contains as an active ingredient a substance that normalizes the intestinal flora or oral flora of a stroke patient.
• improving agent 1 contains as an active ingredient a substance that normalizes the intestinal flora or oral flora of a stroke patient.
• the present inventors have found that the bacterial composition in the intestinal flora or oral flora changes between stroke patients and healthy subjects, between first-time stroke patients and recurrent stroke patients, between stroke patients with poor prognosis and those without, and between stroke patients with sarcopenia and those without.
• a substance that normalizes the intestinal flora of a stroke patient is a substance that reduces the relative abundance of at least one type of bacteria selected from the group consisting of Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, Streptococcus salivarius, Lactobacillus fermentum, Clostridium perfringens, Alistipes putredines, Bacteroides flagellis, Streptococcus, Lactobacillus, Alistipes, Streptococcus family, and Veillonella.
• the relative abundance of Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, Streptococcus salivarius, Lactobacillus fermentum, Clostridium perfringens, Alistipes putrediense, Streptococcus spp. bacteria, Lactobacillus spp. bacteria, and Alistipes spp. bacteria in the intestinal flora of stroke patients is increased compared to that of healthy subjects, so by reducing the relative abundance of at least one of these bacteria, it is possible to prevent stroke, alleviate the pathology, or inhibit the progression.
• the relative abundance of Bacteroides flagellis and Lactobacillus fermentum in the intestinal flora of cardiogenic cerebral embolism patients is increased compared to that of healthy subjects, so by reducing the relative abundance of at least one of these bacteria, it is possible to prevent cardiogenic cerebral embolism, alleviate the pathology, or inhibit the progression.
• the relative abundance of Streptococcus mutans in the intestinal flora of patients with cardiogenic cerebral embolism or atherothrombotic cerebral embolism is increased compared to healthy subjects, so by reducing the relative abundance of at least one of these bacteria, it is possible to prevent cardiogenic cerebral embolism or atherothrombotic cerebral embolism, alleviate the pathology, or inhibit the progression.
• the relative abundance of Streptococcus family bacteria in the intestinal flora of patients with cardiogenic cerebral embolism, lacunar infarction, or atherothrombotic cerebral embolism is increased compared to healthy subjects, so by reducing the relative abundance of Streptococcus family bacteria, it is possible to prevent cardiogenic cerebral embolism, lacunar infarction, or atherothrombotic cerebral embolism, alleviate the pathology, or inhibit the progression.
• the relative abundance of Streptococcus anginosus in the intestinal flora of patients with recurrent stroke is increased compared to patients with a first stroke, so stroke recurrence can be suppressed by decreasing the relative abundance of Streptococcus anginosus in the intestinal flora.
• Streptococcus anginosus is present in the intestinal flora of stroke patients who are at high risk of death or recurrence of vascular disease (ischemic stroke, hemorrhagic stroke, myocardial infarction, aggravation of heart failure, or peripheral vascular occlusion) within two years, poor prognosis of stroke can be improved by reducing the relative abundance of Streptococcus anginosus in the intestinal flora.
• the relative abundance of Streptococcus mutans, Streptococcus parasanguinis, Clostridium perfringens, Alistipes putredines, and Bayonella spp. in the intestinal flora of stroke patients with sarcopenia is increased compared to stroke patients without sarcopenia. Therefore, by decreasing the relative abundance of at least one of the above bacteria in the intestinal flora, it is possible to reduce the risk of stroke patients developing sarcopenia, or to cure, alleviate, or suppress the worsening of sarcopenia occurring in stroke patients.
• a substance that normalizes the intestinal flora of stroke patients is a substance that increases the relative abundance of at least one type of intestinal bacteria selected from the group consisting of Bacteroides plebeius, Anaerotepes hadras, Ruminococcus biscirculans, Bacteroides vulgatus, Prevotella copri, Saterella wadsworthensis, Bifidobacterium pseudocatenulatum, Bifidobacterium longum, Eubacterium rectal, Dialister invissus, Ruminococcus torx, Fusicatenibacter, Faecalibacterium, Dorea, Anaerotipes, Ruminococcus, Butyricoccus, Bifidobacterium, Bifidobacteriaceae, and Prevotellaceae.
• the relative abundance of Bacteroides plebeius, Anaerotepes hadras, Ruminococcus biscirculans, Bacteroides vulgatus, Prevotella copri, Saterella wadsworthensis, Fusicatenibacter, Faecalibacterium, Dorea, Anaerotipes, Ruminococcus, and Butyricoccus in the intestinal flora of stroke patients is reduced compared to healthy individuals, and therefore, by increasing the relative abundance of at least one of these bacteria, it is possible to prevent stroke, alleviate the pathology, or inhibit progression.
• the relative abundance of Bifidobacterium pseudocatenulatum, Bifidobacterium longum, Bifidobacteria, and Bifidobacteriaceae in the intestinal flora of patients with cardiogenic cerebral embolism is lower than that of healthy subjects, so increasing the relative abundance of at least one of these bacteria can prevent cardiogenic cerebral embolism, alleviate pathology, or inhibit progression.
• the relative abundance of Saterella wadsworthensis in the intestinal flora of patients with lacunar infarction is lower than that of healthy subjects, so increasing the relative abundance of Saterella wadsworthensis can prevent lacunar infarction, alleviate pathology, or inhibit progression.
• the relative abundance of Eubacterium rectal and Dialister invissus in the intestinal flora of patients with intracerebral hemorrhage is lower than that of healthy subjects, so increasing the relative abundance of at least one of these bacteria can prevent cerebral hemorrhage, alleviate pathology, or inhibit progression.
• the relative abundance of Prevotellaceae bacteria in the intestinal flora of patients with lacunar infarction or intracerebral hemorrhage is lower than that of healthy individuals, so by increasing the relative abundance of Prevotellaceae bacteria, it is possible to prevent lacunar infarction or intracerebral hemorrhage, alleviate the pathology, or inhibit the progression of the disease.
• a substance that normalizes the oral bacterial flora of stroke patients is a substance that reduces the relative abundance of at least one type of bacteria selected from the group consisting of Streptococcus anginosus, Treponema denticola, Streptococcus cristatus, Prevotella roescheii, Lactobacillus fermentum, Streptococcus gordonii, Streptococcus constellatus, Campylovitor gracilis, Selenomonas sproda, Tannerella forsythia, Porphyromonas bacteria, Fusobacterium bacteria, Streptococcus bacteria, Capnocytophaga bacteria, Campylobacter bacteria, and Streptococcus family bacteria in the oral bacterial flora.
• the relative abundance of these bacteria in the oral cavity of stroke patients is increased compared to that of healthy individuals, so by reducing the relative abundance of at least one of these bacteria, it is possible to prevent stroke, alleviat
• a substance that normalizes the oral flora of stroke patients is a substance that increases the relative abundance of at least one type of bacteria selected from the group consisting of Eubacterium salci, Streptococcus infantis, Haemophilus parainfluenzae, Prevotella nanseiense, Lancefieldella parvula, Neisseria bacteria, Saccharimonada TM7x bacteria, Haemophilus bacteria, Alloprevotella bacteria, Prevotellaceae bacteria, and Veillonellaceae bacteria in the oral flora.
• the relative abundance of these bacteria is reduced in the oral cavity of stroke patients compared to healthy individuals, so increasing the relative abundance of at least one type of these bacteria makes it possible to prevent stroke, alleviate the pathology, or inhibit progression.
• the "substance that normalizes the intestinal flora or oral flora of stroke patients" used as an active ingredient may be appropriately selected depending on the type of bacteria to be targeted for increasing or decreasing the relative abundance in the intestinal flora or oral flora, and examples thereof include antibiotics, antibodies, phages, intestinal bacteria (probiotics), prebiotics, etc.
• antibiotics used as the active ingredient may be any that exhibit antibacterial properties against the intestinal bacteria whose relative abundance is to be reduced.
• antibiotics used as the active ingredient include penicillin antibiotics such as methicillin, oxacillin, nafcillin, cloxacillin, dicloxacillin, flucloxacillin, timocillin, amoxicillin, piperacillin, talampicillin, bacampicillin, ampicillin, ticarcillin, benzylpenicillin, and carbenicillin; nitroimidazole antibiotics such as metronidazole; glycopeptide antibiotics such as vancomycin and teicoplanin; neomycin, amikacin, gentamicin, kanamycin, capreomycin, and the like.
• Aminoglycoside antibiotics such as mycobacterium purpura, netilmicin, streptomycin, and tobramycin; cephalothin, cefazolin, cefotiam, cefmetazole, cefotaxime, cefmenoxime, cefodizime, ceftriaxone, ceftazidime, cefoperazone, cefminox, latamoxef, flomoxef, cefpirome, cefepime, cefozopran, and cephalexin; penem antibacterial compounds such as faropenem; imipenem, panipenem, meropenem, biapenem, doripenem, ertapenem, tebinen, Carbapenem antibiotics such as penem; macrolide antibiotics such as azithromycin, clarithromycin, dirithromycin, erythromycin, troleandomycin; lincomycin antibiotics such as lincomycin, clindamycin,
• antibiotics a suitable example is a combination of one or more, preferably two or more, more preferably three of the following: penicillin antibiotics, nitroimidazole antibiotics, and glycopeptide antibiotics.
• Another suitable example of antibiotics is a combination of penicillin antibiotics, nitroimidazole antibiotics, glycopeptide antibiotics, and aminoglycoside antibiotics.
• antibiotics used as active ingredients include one or more of ampicillin, metronidazole, and vancomycin, preferably two or more of these, and more preferably a combination of these three.
• a suitable antibiotic is a combination of ampicillin, metronidazole, vancomycin, and neomycin.
• the ratios are not particularly limited, but examples include 10 to 1000 parts by weight of nitroimidazole antibiotics and 5 to 500 parts by weight of glycopeptide antibiotics per 100 parts by weight of penicillin antibiotics; preferably, 50 to 500 parts by weight of nitroimidazole antibiotics and 10 to 250 parts by weight of glycopeptide antibiotics per 100 parts by weight of penicillin antibiotics; and more preferably, 75 to 150 parts by weight of nitroimidazole antibiotics and 25 to 75 parts by weight of glycopeptide antibiotics per 100 parts by weight of penicillin antibiotics.
• the ratio of these is not particularly limited, but for example, 10 to 1,000 parts by weight of nitroimidazole antibiotics, 5 to 500 parts by weight of glycopeptide antibiotics, and 100 parts by weight of aminoglycoside antibiotics per 100 parts by weight of penicillin antibiotics may be used.
• 10 to 1000 parts by weight of antibiotics preferably, 50 to 500 parts by weight of nitroimidazole antibiotics, 10 to 250 parts by weight of glycopeptide antibiotics, and 50 to 500 parts by weight of aminoglycoside antibiotics per 100 parts by weight of penicillin antibiotics; more preferably, 75 to 150 parts by weight of nitroimidazole antibiotics, 25 to 75 parts by weight of glycopeptide antibiotics, and 75 to 150 parts by weight of aminoglycoside antibiotics per 100 parts by weight of penicillin antibiotics.
• the antibody used as the active ingredient may be any antibody capable of binding to the intestinal bacteria whose relative abundance in the intestinal flora is to be reduced.
• the antibody isotype is not particularly limited and may be any of IgA, IgM, IgD, IgG, or IgE, or two or more isotypes may be used in combination. Among these isotypes, IgA is a suitable example.
• the phage used as the active ingredient may be one that exhibits bacteriolytic activity against the intestinal bacteria whose relative abundance is to be reduced.
• Phages that exhibit bacteriolytic activity against specific bacteria are known to be obtained by genetic engineering techniques or methods of isolating and culturing them from the environment (Trends Biotechnol. 2010 Dec;28(12):591-595. doi:10.1016/j.tibtech.2010.08.001. Epub 2010 Aug 31, Bacteriophage. 2011 Mar-Apr;1(2):111-114. doi:10.4161/bact.1.2.14590), and the improvement agent 1 disclosed herein can use phages produced or obtained by known techniques.
• the intestinal bacteria used as an active ingredient may be any bacteria whose relative abundance is to be increased.
• the bacteria may be live bacteria or attenuated or inactivated bacteria.
• the intestinal bacteria used as an active ingredient may be intestinal flora (e.g., feces) collected from a healthy individual, and a method for administering intestinal flora collected from a healthy individual (e.g., fecal transplant method) is publicly known or can be easily conceived by a person skilled in the art from publicly known techniques.
• the prebiotics used as active ingredients may be any that can promote the growth of the bacteria whose relative abundance is to be increased.
• prebiotics There are no particular limitations on the type of prebiotics, but examples include oligosaccharides such as galactooligosaccharides, fructooligosaccharides, soybean oligosaccharides, lactose oligosaccharides, xylooligosaccharides, isomaltulose oligosaccharides, raffinose, and lactulose; dietary fibers such as polydextrose and inulin; and the like. These prebiotics may be used alone or in combination of two or more types.
• the improving agent 1 disclosed herein can be provided in the form of a medicine or food.
• the active ingredient may be mixed with a pharma- ceutically acceptable carrier or additive to prepare a desired dosage form.
• pharma- ceutically acceptable carriers or additives include sterile water, physiological saline, stabilizers, excipients, antioxidants, buffers, preservatives, surfactants, chelating agents, binders, and the like.
• dosage forms of pharmaceutical products include oral preparations such as capsules, tablets, pills, sachets, liquids, powders, granules, fine granules, film coatings, pellets, lozenges, sublingual preparations, chewable preparations, buccal preparations, pastes, syrups, suspensions, elixirs, or emulsions; suppositories, enemas, and the like.
• the content of the active ingredient in the pharmaceutical product may be appropriately set according to the dosage amount, dosage form, and the like.
• the active ingredient may be mixed with food ingredients to prepare the desired form.
• the food form include supplements, health foods, functional foods, foods for specified health uses, and foods for the sick, but general foods may also be used.
• the content of the active ingredient in the food product may be appropriately set according to the intake amount, form, etc.
• the target of the improving agent 1 of the present disclosure is a person who is seeking prevention of stroke or a stroke patient.
• the improving agent 1 of the present disclosure in a person who is seeking prevention of stroke, it is possible to reduce the risk of stroke.
• the route of administration of the improving agent 1 of the present disclosure is not particularly limited and may be set appropriately depending on the type of active ingredient used, but examples include oral administration, rectal administration, and oral ingestion.
• the dosage of the improving agent 1 of the present disclosure may be any amount effective for preventing or treating stroke, and may be set appropriately depending on the type of active ingredient used, the age, weight, and severity of symptoms of the subject, etc.
• the total amount of the antibiotic administered per day should be set at about 1-300 mg/kg body weight, preferably about 10-200 mg/kg body weight, and should be administered 1-3 times a day for about 3-20 days, preferably about 5-16 days. More specifically, if a penicillin antibiotic (such as ampicillin) is used alone or in combination with other antibiotics, the total amount of the penicillin antibiotic administered per day should be set at about 10-80 mg/kg body weight, preferably about 20-40 mg/kg body weight, and should be administered 1-3 times a day for about 4-10 days, preferably about 7 days.
• a penicillin antibiotic such as ampicillin
• nitroimidazole antibiotics e.g., metronidazole
• the total amount of nitroimidazole antibiotics administered per day should be set at about 7-120 mg/kg body weight, preferably about 15-60 mg/kg body weight, and should be administered 1-3 times a day for about 5-20 days, preferably about 14 days.
• glycopeptide antibiotics e.g., vancomycin
• the total amount of glycopeptide antibiotics administered per day should be set at about 5-30 mg/kg body weight, preferably about 10-15 mg/kg body weight, and should be administered 1-3 times a day for about 4-10 days, preferably about 7 days.
• the total amount of aminoglycoside antibiotics administered per day should be set at about 10-60 mg/kg of body weight, preferably about 20-30 mg/kg of body weight, and should be administered 1-3 times a day for about 4-10 days, preferably about 7 days.
• the total amount of antibody administered per day should be set at about 1-100 mg/kg body weight, preferably about 5-20 mg/kg body weight, and should be administered 1-3 times a day for about 3-14 days, preferably about 5-10 days.
• Method for screening stroke improving agents (1) in another embodiment of the present disclosure, there is provided a method for screening test substances for a candidate substance that may be effective in improving stroke, the screening method including the following steps (hereinafter, also referred to as "screening method 1"): A step of evaluating the effect of the test substance on reducing the relative abundance of at least one type of bacteria selected from the group consisting of Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, Streptococcus salivarius, Lactobacillus fermentum, Clostridium perfringens, Alistipes putredines, Bacteroides flagellis, Streptococcus, Lactobacillus, Alistipes, Streptococcus, and Veillonella in the intestinal flora; and A step of selecting a test substance having the effect as the candidate substance.
• test substances include antibiotics, antibodies, phages, bacteria, peptides, proteins, dietary fiber, oligosaccharides, organic compounds, inorganic compounds, cell extracts, cell culture supernatants, plant extracts, culture products, and mixtures of these.
• the method for evaluating the effect of reducing the relative abundance of the bacteria in the intestinal flora is not particularly limited, and a person skilled in the art can set appropriate conditions within the scope of normal creative ability.
• the method can be performed in vivo or in vitro by adding an appropriate amount of a test substance to a sample containing an intestinal flora containing the bacteria, and measuring the change in the relative abundance of the bacteria.
• a test substance that has been shown to have an effect of reducing the relative abundance of at least one type of bacteria selected from the group consisting of Streptococcus anginosus, Streptococcus parasanguinis, Streptococcus salivarius, Clostridium perfringens, Alistipes putredines, Streptococcus bacteria, Lactobacillus bacteria, and Alistipes bacteria in the intestinal flora can also be selected as a candidate substance for a stroke recurrence prevention agent.
• a test substance that has been shown to have an effect of reducing the relative abundance of at least one type of bacteria selected from the group consisting of Bacteroides flagellis and Lactobacillus fermentum in the intestinal flora can be selected as a candidate substance for a cardiogenic cerebral embolism improvement agent.
• a test substance that has been shown to have the effect of reducing the relative abundance of Streptococcus mutans in the intestinal flora can be selected as a candidate substance for an improving agent for cardiogenic cerebral embolism or atherothrombotic cerebral embolism.
• a test substance that has been shown to have the effect of reducing the relative abundance of Streptococcus bacteria in the intestinal flora can be selected as a candidate substance for an improving agent for cardiogenic cerebral embolism, lacunar infarction, or atherothrombotic cerebral embolism.
• a test substance that has been shown to have the effect of reducing the relative abundance of Streptococcus anginosus can also be selected as a candidate substance for a preventive agent for stroke recurrence.
• a test substance that has been shown to have the effect of reducing the relative abundance of at least one type of bacteria selected from the group consisting of Streptococcus mutans, Streptococcus parasanguinis, Clostridium perfringens, Alistipes putredines, and Bayonella genus bacteria can also be selected as a candidate substance for an agent for improving sarcopenia that occurs concomitantly in stroke patients.
• Screening method for stroke improving agents In another embodiment of the present disclosure, there is provided a method for screening test substances for a candidate substance that may be effective in improving stroke, the screening method including the following steps (hereinafter, also referred to as "screening method 2"): A step of evaluating the effect of the test substance on increasing the relative abundance of at least one type of bacteria selected from the group consisting of Bacteroides plebeius, Anaerotepes hadras, Ruminococcus biscirculans, Bacteroides vulgatus, Prevotella copri, Saterella wadsworthensis, Bifidobacterium pseudocatenulatum, Bifidobacterium longum, Eubacterium rectal, Dialister invissus, Ruminococcus torx, Fusicatenibacter, Faecalibacterium, Dorea, Anaerotipes, Ruminococcus, Butyricoccus, Bifidobacterium, Fibromyaceae, and Prevotellaceae in the group
• test substance used in screening method 2 of the present disclosure is as described in the section for screening method 1 above.
• the method for evaluating the effect of increasing the relative abundance of the bacteria in the intestinal flora is not particularly limited, and a person skilled in the art can set appropriate conditions within the scope of normal creative ability.
• the method can be performed in vivo or in vitro by adding an appropriate amount of a test substance to a sample containing an intestinal flora containing the bacteria, and measuring the change in the relative abundance of the bacteria.
• a test substance evaluated to have the effect of increasing the relative abundance of at least one type of bacteria selected from the group consisting of Bacteroides plebeius, Anaerotepes hadras, Ruminococcus biscirculans, Bacteroides vulgatus, Prevotella copri, Saterella wadsworthensis, Fusicatenibacter, Faecalibacterium, Dorea, Anaerotipes, Ruminococcus, and Butyricoccus in the intestinal flora is selected as a candidate substance for a stroke improving agent.
• a test substance evaluated to have an effect of increasing the relative abundance of at least one type of bacteria selected from the group consisting of Bifidobacterium pseudocatenulatum, Bifidobacterium longum, Bifidobacteria genus bacteria, and Bifidobacteriaceae family bacteria in the intestinal flora is selected as a candidate substance for a cardiogenic cerebral embolism improving agent.
• a test substance evaluated to have an effect of increasing the relative abundance of Saterella wadsworthensis in the intestinal flora is selected as a candidate substance for a lacunar infarction improving agent.
• a test substance evaluated to have an effect of increasing the relative abundance of at least one type of bacteria selected from the group consisting of Eubacterium rectal and Dialister invissus in the intestinal flora is selected as a candidate substance for a cerebral hemorrhage improving agent.
• a test substance evaluated to have the effect of increasing the relative abundance of Prevotellaceae bacteria in the intestinal flora is selected as a candidate substance for an agent for improving lacunar infarction or cerebral hemorrhage.
• Method for screening stroke improving agents in another embodiment of the present disclosure, there is provided a method for screening test substances for a candidate substance that may be effective in improving stroke, the screening method including the following steps (hereinafter, also referred to as "screening method 3"): A step of evaluating the effect of the test substance on reducing the relative abundance of at least one type of bacteria selected from the group consisting of Streptococcus anginosus, Treponema denticola, Streptococcus cristatus, Prevotella roescheii, Lactobacillus fermentum, Streptococcus gordonii, Streptococcus constellatus, Campylovitor gracilis, Selenomonas sproda, Tannerella forsythia, Porphyromonas bacteria, Fusobacterium bacteria, Streptococcus bacteria, Capnocytophaga bacteria, Campylobacter bacteria, and Streptococcus family bacteria in the oral bacterial f
• test substance used in Screening Method 3 of the present disclosure is as described in the Screening Method 1 section above.
• the method for evaluating the effect of reducing the relative abundance of the bacteria in the oral flora is not particularly limited, and a person skilled in the art can set appropriate conditions within the scope of normal creative ability.
• the evaluation can be performed in vivo or in vitro by adding an appropriate amount of a test substance to a sample containing an oral flora containing the bacteria, and measuring the change in the relative abundance of the bacteria.
• test substance that has been confirmed to have the above-mentioned effect can also be selected as a candidate substance for a preventive agent for stroke recurrence.
• Screening method for stroke improving agents (4)
• a method for screening test substances for a candidate substance that may be effective in improving stroke including the following steps (hereinafter, also referred to as "Screening Method 4"): A step of evaluating the effect of the test substance on increasing the relative abundance of at least one type of bacteria selected from the group consisting of Eubacterium salci, Streptococcus infantis, Haemophilus parainfluenzae, Prevotella nanseiense, Lancefieldella parvula, Neisseria bacteria, Saccharimonada TM7x bacteria, Haemophilus bacteria, Alloprevotella bacteria, Prevotellaceae bacteria, and Veillonellaceae bacteria in the oral bacterial flora; and A step of selecting a test substance having the above effect as the candidate substance.
• test substance used in Screening Method 4 of the present disclosure is as described in the Screening Method 1 section above.
• the method for evaluating the effect of increasing the relative abundance of the bacteria in the oral flora is not particularly limited, and a person skilled in the art can set appropriate conditions within the scope of normal creative ability.
• the method can be performed in vivo or in vitro by adding an appropriate amount of a test substance to a sample containing an oral flora containing the bacteria, and measuring the change in the relative abundance of the bacteria.
• test substance that has been confirmed to have the above-mentioned effect can also be selected as a candidate substance for a preventive agent for stroke recurrence.
• Test Method 8 Another embodiment of the present disclosure provides a method for testing the risk of developing stroke by disease type (hereinafter, also referred to as "Testing Method 8").
• Testing Method 8 of the present disclosure includes a step of measuring the equol concentration in a blood sample collected from a subject. Since the equol concentration in the blood of a stroke patient correlates with the type of stroke, it is possible to test the risk of developing stroke by disease type by using the equol concentration in a blood sample collected from a subject as an indicator.
• the subject may be any person who requires testing for the risk of developing a specific type of stroke, such as a healthy individual or a person suspected of developing a stroke.
• a "blood sample” refers to a sample derived from blood, and includes whole blood, serum, and plasma.
• the blood sample used in the testing method 8 of the present disclosure may be any of whole blood, serum, or plasma, with serum being a preferred example.
• the concentration of equol in a blood sample can be measured using a known equol measurement method such as liquid chromatography mass spectrometry.
• the lower the equol concentration in the blood sample the higher the risk of developing cardiogenic cerebral embolism, atherothrombotic cerebral infarction, or atrial fibrillation is judged to be.
• the equol concentration in the subject's serum is less than 1 ng/mL, it can be judged that there is a risk of developing cardiogenic cerebral embolism (particularly cardiogenic cerebral embolism accompanied by atrial fibrillation), atherothrombotic cerebral infarction, or atrial fibrillation.
• the reference value for the equol concentration in serum is one example, and can be set appropriately depending on the specimen, testing conditions, etc.
• the testing method 8 of the present disclosure For subjects who are determined to be at risk of developing cardiogenic cerebral embolism, atherothrombotic cerebral infarction, or atrial fibrillation by the testing method 8 of the present disclosure, it is desirable to carry out preventive measures for these diseases and careful follow-up monitoring through diagnosis so that cardiogenic cerebral embolism, atherothrombotic cerebral infarction, or atrial fibrillation can be prevented or treated early.
• Test Method 9 includes a step of measuring the equol concentration in a blood sample collected from a subject. Since the equol concentration in the blood of a stroke patient correlates with the severity of stroke, it is possible to test the severity of stroke by using the equol concentration in a blood sample collected from a subject as an indicator.
• the subject may be anyone who requires testing for the severity of a stroke, and may be not only a stroke patient, but also anyone who requires testing for the presence or absence of a stroke.
• the blood sample used and the method for measuring the equol concentration in the blood sample are the same as those in the test method 8.
• the lower the equol concentration in the blood sample the higher the severity of the stroke is judged to be.
• the severity of the stroke can be judged to be high.
• the reference value for the equol concentration in serum is one example, and can be set appropriately depending on the sample, testing conditions, etc.
• testing method 10 includes a step of measuring the equol concentration in a blood sample collected from a subject. Since the equol concentration in the blood of a stroke patient correlates with the functional prognosis of stroke, it is possible to test the functional prognosis of stroke by using the equol concentration in a blood sample collected from a subject as an indicator.
• the subject may be anyone who requires testing for functional prognosis of stroke, and may be not only a stroke patient, but also anyone who requires testing for the presence or absence of stroke.
• the blood sample used and the method for measuring the equol concentration in the blood sample are the same as those in the test method 8 described above.
• the testing method 10 disclosed herein it is determined that the lower the equol concentration in a blood sample, the more likely the functional prognosis is to be poor. Specifically, from the test data shown in the Examples section, it can be determined that when the equol concentration in the subject's serum is less than 1 ng/mL, the functional prognosis is likely to be poor. Note that the reference value for the equol concentration in serum is one example, and can be set appropriately depending on the specimen, testing conditions, etc.
• prognosis can be monitored by carefully administering medication and increasing the frequency of imaging tests so that early intervention and early treatment can be performed for the predicted poor functional prognosis.
• a stroke improving agent (hereinafter sometimes referred to as “improving agent 2”) is provided that contains equol or an equol production promoter as an active ingredient.
• improving agent 2 a stroke improving agent
• the present inventors have found that when blood equol concentrations in stroke patients are low, the severity of the condition is high and functional prognosis is likely to be poor, and therefore increasing equol concentrations in the body can be effective in preventing and improving stroke.
• administration or ingestion of equol or an equol production promoter can suppress the onset of stroke, cure, alleviate, or suppress the worsening of stroke pathology; or prevent recurrence in stroke patients.
• the active ingredient is equol itself or an equol production promoter.
• an equol production promoter is a substance that can promote equol production in the body.
• An example of an equol production promoter is equol-producing bacteria.
• Equol-producing bacteria are bacteria that have the activity of converting daidzein, daidzin, dihydrodaidzein, genistein, glycitein, and at least one of their derivatives into equol.
• Examples of equol-producing microorganisms used as equol production promoters include Bifidobacterium bacteria and Lactococcus bacteria. Suitable examples of Bifidobacterium bacteria include Bifidobacterium pseudocatenulatum and Bifidobacterium longum.
• isoflavone Another example of an equol production promoter is isoflavone, which is used as a substrate in the production of equol.
• isoflavones include daidzein, daidzin, dihydrodaidzein, genistein, glycitein, and derivatives thereof.
• black soybean seed coat extract JP Patent Publication No. 2021-155374
• yeast mannan WO Publication No. 2020/004568
• these substances can also be used in the improving agent 2 disclosed herein.
• the improving agent 2 disclosed herein can be provided in the form of a medicine or food.
• the active ingredient may be mixed with a pharma- ceutically acceptable carrier, additive, etc. to prepare a desired dosage form.
• a pharma-ceutically acceptable carrier or additive is the same as in the case of improving agent 1 of the present disclosure.
• the active ingredient and food ingredients may be mixed together to prepare the desired form.
• the form of the food product is the same as that of improvement agent 1 of the present disclosure.
• the target of the improving agent 2 of the present disclosure is a person who is required to prevent stroke or a stroke patient.
• the improving agent 2 of the present disclosure for a person who is required to prevent stroke, it is possible to reduce the risk of stroke.
• the improving agent 2 of the present disclosure is used for a stroke patient, it is possible to cure, alleviate, or inhibit the progression of stroke pathology; prevent, cure, alleviate, or inhibit the progression of sarcopenic complications in stroke patients; or prevent recurrence in stroke patients, depending on the type of active ingredient used.
• the type of stroke to which the improving agent 2 of the present disclosure is applied is not particularly limited and may be any type, but suitable examples include cerebral infarction, more preferably cardiogenic cerebral embolism and atherothrombotic cerebral infarction, and even more preferably cardiogenic cerebral embolism.
• the route of administration of the improving agent 2 of the present disclosure is not particularly limited and may be set appropriately depending on the type of active ingredient used, but examples include oral administration, rectal administration, and oral ingestion.
• the dosage of the improving agent 2 of the present disclosure may be an amount effective for preventing or treating stroke, and may be appropriately set depending on the type of active ingredient used, the age, weight, and severity of symptoms of the subject.
• the daily dosage of equol for an adult may be set to about 1 to 100 mg, preferably about 5 to 30 mg, and administered in 1 to 3 divided doses per day.
• the daily dosage of equol-producing bacteria for an adult may be set to about 1 ⁇ 10 5 to 1 ⁇ 10 15 cfu, preferably about 1 ⁇ 10 8 to 1 ⁇ 10 12 cfu, and administered in 1 to 3 divided doses per day.
• the daily dosage of the equol production promoter (other than equol-producing bacteria) for an adult may be set to about 0.1 to 20 g, preferably about 1 to 10 g, and administered in 1 to 3 divided doses per day.
• Stroke cohort study Acute stroke patients were diagnosed based on clinical symptoms of acute neuroparalysis and findings from CT or MRI brain images (Nishimura, K. et al., J Atheroscler Thromb 21, 784-798, doi:10.5551/jat.19356 (2014)). Patient selection criteria were (i) patients aged 20 years or older, (ii) patients hospitalized within 7 days of onset, and (iii) patients who could provide written informed consent from the patient or their relatives. Patients were excluded if they had received or taken antibiotics within the past 3 months, or (ii) had a bowel movement after hospitalization and before screening sampling.
• Patients were defined as having "diabetes” if they met any of the following criteria: (i) fasting plasma glucose ⁇ 126 mg/dL and (ii) HgbA1c value ⁇ 6.5%, or (iii) taking antidiabetic drugs or insulin.
• "Hypercholesterolemia” was defined as (i) low-density lipoprotein cholesterol level ⁇ 140 mg/dL, (ii) high-density lipoprotein cholesterol level ⁇ 40 mg/dL, (iii) triglyceride level ⁇ 150 mg/dL, or (iv) taking lipid-lowering drugs.
• "Atrial fibrillation” was defined based on the findings of 12-lead electrocardiogram or the underlying disease if there was a history of anticoagulant use.
• Brain magnetic resonance imaging was performed using a 3.0 Tesla scanner (Magneton Verio or Spectra; Siemens Medical Solutions, Erlangen, Germany). Diffusion-weighted, FLAIR, T2-weighted, T2*-weighted, and magnetic resonance vascular images were obtained according to a standard clinical protocol. Cerebral microbleeds (CMBs) were assessed using T2*-weighted images. Anatomical extent and severity were classified according to the Microbleed Anatomical Rating Scale (MARS) (Gregoire, S. M. et al., Neurology 73, 1759-1766, doi:10.1212/WNL.0b013e3181c34a7d (2009)).
• MARS Microbleed Anatomical Rating Scale
• Lacunar infarcts and white matter hyperintensities were assessed using FLAIR images. Lacunar infarcts were defined as hypointense lesions with a hyperintense rim, 3–15 mm in diameter. Cerebral white matter lesions were scored according to the Fazekas scale for periventricular hyperdensity (PVH) and deep white matter hyperdensity (DWMH) (Fazekas, F. et al., AJR Am J Roentgenol 149, 351-356, doi:10.2214/ajr.149.2.351 (1987)). The presence or absence of CMB, lacunar lesions, and severe cerebral white matter lesions was verified by multiple neurologists.
• PVH periventricular hyperdensity
• DWMH deep white matter hyperdensity
• Sample collection In the acute stroke cohort, saliva and stool samples were collected within a few days after admission. Saliva samples were collected in the morning (before brushing teeth or eating) using a self-collection kit (OMNIgene-ORAL, OM-501, DNA Geneotek, Canada) or an alternative collection kit (Salimetric Children's Swab, Salimetrics, LLC.USA) according to the protocol provided by the product manufacturer. Fecal samples were collected immediately after defecation using a stool collection container (SARSTEDT AG & Co.KG, Germany) and a guanidine thiocyanate solution kit (Techno Suruga Laboratory Co., Ltd., Shizuoka Prefecture, Japan).
• Acute stroke samples were frozen in a freezer at -20°C immediately after collection, and then aliquoted and frozen for storage in a deep freezer at -80°C.
• saliva samples were collected in the morning (before brushing teeth or eating) using a self-collection kit (OMNIgene-ORAL OM501), and fecal samples were collected using a guanidine thiocyanate solution kit (Techno Suruga Laboratories, Shizuoka Prefecture, Japan). All samples were transported to the laboratory at room temperature within one week of collection, and after aliquoting, were frozen and stored in a deep freezer at -80°C.
• Alpha and beta diversity analysis The alpha and beta diversity of the bacterial flora were analyzed. Alpha diversity is an index of the abundance of bacterial species within a sample, and beta diversity is an index of the difference in bacteria between samples.
• the alpha diversity of the bacterial flora was evaluated by species-based diversity and Faith's phylogenetic diversity, and statistically compared between groups using the Kruskal-Wallis pairwise test.
• the beta diversity of the bacterial flora was evaluated by investigating the association between the composition of the bacterial flora and the pathway abundance ratio of the bacterial flora by PERMANOVA (Permutational multivariate analysis of variance) using 10,000 p-values. The median distance of the bacterial flora composition or pathway abundance ratio was calculated based on the Bray-Curtis distance, and compared using the Mann-Whitney test.
• ANCOM central log ratio
• W value which shows the regression coefficient to the null hypothesis
• sPLS-DA was used to improve the discrimination of bacteria. Relative abundance at species level was normalized (log10 scale transformation and autoscaling) before sPLS-DA.
• the 3D scores were ranked by the top 10 bacterial species (loading taxonomies) contributing to each dimension (comports 1–3).
• the top 50 metabolic pathways distinguishable based on Ward's clustering were extracted to generate a heatmap. High relative abundance is depicted in red, and low relative abundance in blue.
• the intensity of relative abundance ranges from 0 to 3 on the Z-scale.
• sPLS-DA and heatmap clustering were calculated using the MetaboAnalyst tool in the R package (Chong, J. et al., Bioinformatics 34, 4313-4314, doi:10.1093/bioinformatics/bty528 (2016); KA, L. C. et al., BMC Bioinformatics 12, 253, doi:10.1186/1471-2105-12-253 (2011)).
• Acute stroke patients were classified according to disease type (atherothrombotic cerebral infarction, cardiogenic cerebral embolism, lacunar infarction, and intracerebral hemorrhage), and the relative abundance of bacteria at the family level in the oral and intestinal flora was displayed using stacked bar graphs.
• the relative abundance of Streptococci was increased in patients with atherothrombotic cerebral embolism; the relative abundance of Streptococci and the relative abundance of Bifidobacteria were increased in patients with cardiogenic cerebral embolism; the relative abundance of Streptococci and the relative abundance of Prevotellaceae were increased in patients with lacunar infarction; and the relative abundance of Prevotellaceae was decreased in patients with intracerebral hemorrhage (Fig. 5 and Table 3). From these results, it became clear that the relative abundance of Streptococci in the intestinal flora can be a test indicator for atherothrombotic cerebral embolism.
• carrier rate refers to the proportion of people carrying a particular bacterium relative to the total number of people in each group.
• the intestinal flora contains Alistipes, Streptococcus, Lactobacillus, Alistipes, Fusicatenibacter, Faecalibacterium, Dorea, Anaerotipes, Ruminococcus, Butyricoccus, Streptococcus anginosus, Streptococcus mutans, Streptococcus parasanguinis, and Streptomyces.
• the oral flora contains Porphyromonas, Fusobacterium, Streptococcus, Capnocytophaga, Campylobacter, Neisseria, Saccharimonada TM7x, Haemophilus, Alloprevotella, Treponema denticola, Streptococcus cristatus, Prevotella roescheii, Streptococcus anginosus, and Eubacterium saponaria.
• Streptococcus anginosus, Streptococcus parasanguinis, Streptococcus salivarius, and Streptococcus mutans are bacteria that normally reside in the oral cavity and are not normally present in the intestinal flora of healthy individuals. Therefore, it was found that in stroke patients, these bacteria migrate from the oral cavity to the intestinal flora, resulting in a change in the intestinal flora. In addition, Lactobacillus fermentum is not normally present in the intestinal flora of healthy individuals.
• Streptococcus anginosus is a microaerophilic Gram-positive coccus that constitutes the normal oral flora.
• the detection of Streptococcus anginosus in the gut microbiota of acute stroke patients is consistent with recent microbiome studies that have reported Streptococcus anginosus as a candidate for gastrointestinal carcinogenesis and atherosclerosis (Coker, O. O. et al., Gut 67, 1024-1032, doi:10.1136/gutjnl-2017-314281 (2016); Jie, Z. et al., Nat Commun 8, 845, doi:10.1038/s41467-017-00900-1 (2017)).
• a principal coordinate analysis (PCoA) plot based on the Bray-Curtis distance of the intestinal and oral flora of acute stroke patients and non-stroke patients was colored separately for carriers and non-carriers of each bacterial species.
• PCoA principal coordinate analysis
• sPLS-DA sparse partial least squares discriminant analysis
• Streptococcus anginosus is originally a normal bacterium in the oral cavity, and it was found that in stroke patients, Streptococcus anginosus migrates from the oral cavity to the intestine and contributes to the transformation of the gut microbiota.
• Streptococcus anginosus Analysis of the relative abundance of oral and intestinal flora in the presence or absence of Streptococcus anginosus revealed that the presence of Streptococcus anginosus suppresses Bacteroides plebeius in the intestine, and suppresses Eubacterium salci, Streptococcus infantis, and Prevotella nanseiensis in the oral cavity, while increasing Streptococcus cristatus and Treponema denticola.
• the oral microbiota of acute stroke patients contained 11 species, namely Streptococcus anginosus, Streptococcus mutans, Lactobacillus fermentum, Streptococcus gordonii, Streptococcus constellatus, Treponema denticola, Prevotella roescheii, Campylovitor gracilis, Selenomonas sproda, Streptococcus cristatus, and Tannerella forsythia;
• the oral microbiota of non-stroke patients contained 11 species, namely Streptococcus infantis, Eubacterium purpuratum, and Lactobacillus subtilis.
• Streptococcus anginosus three species of bacteria, Streptococcus anginosus, Streptococcus mutans, and Lactobacillus fermentum, were found to form the core of the communities in both the oral and gut microbiota of acute stroke patients. Furthermore, in the gut microbiota, Streptococcus anginosus was found to be in a promoting relationship with these acute stroke-related bacterial species, while being in an inhibitory relationship with non-stroke-related bacterial species, and to be a hub between the communities ( Figure 14, Tables 13 and 14).
• a heat map was created showing the top 50 MetaCyc pathways that could distinguish between the four groups of oral and intestinal microbiota in acute stroke patients and non-stroke patients (Figure 15C).
• the proportion of glycolysis and lactate fermentation pathways was increased, and the proportion of gluconeogenesis pathways was decreased, in the oral and intestinal microbiota of acute stroke patients compared to non-stroke patients ( Figure 16D-F).
• the lactate fermentation pathway is a metabolic pathway that is widely seen not only in Streptococcus bacteria but also in Lactobacillus, Lactococcus, and Bifidobacterium bacteria.
• the results of the predictive metagenomic analysis showed that the relative abundance of Streptococcus anginosus was high in the gut microbiota of acute stroke patients, which was associated with an increase in the gut microbiota of Streptococcus parasanguinis, Streptococcus salivarius, and Streptococcus mutans, as well as Lactobacillus fermentum.
• the decrease in the biosynthetic pathway of branched chain fatty acids in the gut reflects the suppression of bacteria such as Prevotella copri, Anaerotepes hadras, and Eubaikuterium rectal, which are involved in the breakdown of dietary fiber and the production of butyric acid.
• Streptococcus anginosus in the gut microbiota was associated with stroke even after adjusting for age, sex, and vascular risk factors (smoking, hypertension, diabetes, and hyperlipidemia) (adjusted odds ratio (95% confidence interval: CI) 3.66 (1.44-9.76), p ⁇ 0.01) (Model 2 in Table 14).
• the presence of Streptococcus anginosus in the gut microbiota was associated with stroke even after adjusting for age, sex, vascular risk factors, and major bacteria (Anaerotepes hadras, Bacteroides plebeius) (adjusted odds ratio (95% CI) 4.48 (1.51-14.78), p ⁇ 0.01) (Model 3 in Table 16).
• ROC curves were created to distinguish between acute stroke patients and non-stroke patients using vascular risk factors (age, sex, smoking, hypertension, diabetes, and hyperlipidemia) and the relative abundances of Streptococcus anginosus, Anaerotepes hadras, and Bacteroides plebius in the gut microbiota.
• the areas under the receiver operating characteristic curves (95% CI) were 0.87 (0.80 - 0.93) for vascular risk factors alone, 0.89 (0.83 - 0.95) for vascular risk factors and the relative abundance of Streptococcus anginosus in the gut microbiota, and 0.93 (0.88 - 0.98) for vascular risk factors and the three bacterial species.
• Stroke patients were divided into those with and without detection of Streptococcus anginosus in the intestinal flora during the acute stroke phase (at the time of registration), and the results of composite events over a two-year period were plotted using Kaplan-Meire curves and compared using the log-rank test.
• these results indicate that stroke patients who have Streptococcus anginosus in their intestinal flora have a relatively poor prognosis and a relatively high risk of all-cause mortality or major vascular events.
• NIHSS score based on the relative abundance of bacterial species in the intestinal microbiota related to stroke and non-stroke as revealed by network analysis, standardized values using CLR (centered log ratio) were calculated and a comprehensive analysis was conducted on the correlation between NIHSS score at admission and vascular risk factors (age, BMI, mean blood pressure, LDL cholesterol, hemoglobin A1c, CRP, BNP) and important bacterial species in the intestine.It was found that there was a significant inverse correlation between a decrease in the standardized relative abundance of Anaerotepes hadras, Bacteroides plebeius, Prevotella copri, and Eubacterium rectale and an increase in NIHSS.
• Acute stroke patients were classified according to disease type (atherothrombotic cerebral infarction, cardiogenic cerebral embolism lacunar infarction, intracerebral hemorrhage) and the relative abundance of Streptococcus anginosus, Streptococcus mutans, Lactobacillus fermentum, Bacteroides flagellis, Anaerotepes hadras, Bacteroides plebeius, Saterella wadsworthensis, Prevotella copri, Eubacterium rectal, and Diaryster invissus in the gut microbiota was analyzed (Figure 23 and Table 21).
• patients with cardiogenic cerebral embolism showed increased relative abundance of Bacteroides flagellis, Lactobacillus fermentum, and Streptococcus mutans
• patients with intracerebral hemorrhage showed decreased relative abundance of Eubacterium rectal and Dialister invissus
• patients with lacunar infarction showed decreased relative abundance of Saterella wadsworthensis
• patients with atherothrombotic cerebral embolism showed increased relative abundance of Streptococcus mutans.
• biomarkers of microvascular disease based on brain MRI findings and the prevalence of Streptococcus anginosus, Streptococcus mutans, Lactobacillus fermentum, Bacteroides flagellis, Anaerotepes hadras, Bacteroides plebeius, Saterella wadsworthensis, Prevotella copri, Eubacterium rectal, and Diaryster invissus in the gut microbiota (Table 22).
• stroke patients with severe cerebral white matter lesions had significantly higher rates of Lactobacillus fermentum and Streptococcus anginosus in the gut microbiota.
• Stroke patients with lacunar lesions tended to have a lower rate of Bacteroides flagellis and a higher rate of Dialister invissus in the gut microbiota.
• stroke patients with cerebral microbleeds had significantly higher rates of Eubacterium rectale and Streptococcus anginosus in the gut microbiota (Table 22).
• Streptococcus anginosus and Lactobacillus fermentum which are commonly increased in the oral and intestinal flora of stroke patients, may also be related to the severity of cerebral white matter lesions, which are biomarkers of cerebral small vessel disease in brain MRI.
• the inclusion criteria for stroke patients were (i) patients whose serum was stored in the National Cerebral and Cardiovascular Center Biobank with their consent, and (ii) stroke patients who were hospitalized due to lacunar infarction, atherothrombotic cerebral infarction, cardiogenic cerebral embolism, cerebral embolism of unknown embolic source, intracerebral hemorrhage, or cerebral infarction due to other causes.
• the exclusion criteria were: (i) patients with malignant tumors, (ii) patients who had a fasting period of 24 hours or more at the time of biobank blood collection, and (iii) patients whose biobank blood collection took place more than 6 months after the onset of stroke.
• NIHSS National Institute of Health Stroke Scale
• cerebral infarction patients cardiac cerebral embolism, atherothrombotic cerebral infarction, cardiogenic cerebral embolism, and cerebral embolism of unknown origin
• equol producers had a significantly milder functional prognosis at the time of discharge.
• the concentration of equol in blood samples can be used as a testing indicator for the risk of developing different types of stroke, and in particular, being a non-equol producer can be used as a testing indicator for the risk of developing cardiogenic cerebral embolism, atherothrombotic cerebral infarction, and atrial fibrillation. It has also been shown that the concentration of equol in blood samples can be used as a testing indicator for the risk of stroke becoming severe, and furthermore, it has been shown that it can be used as a testing indicator for the functional prognosis of stroke.
• Equol-producing bacteria are known to produce equol using soy isoflavones such as daidzein and genistein as substrates. It is said that 30-50% of Japanese people possess equol-producing bacteria, and not everyone is able to produce equol in their bodies.
• this Example confirmed that, among acute stroke patients, cardiogenic cerebral embolism patients had a low relative abundance of Bifidobacterium bacteria, which are known to produce equol.
• Bifidobacterium bacteria Bifidobacterium pseudocatenulatum and Bifidobacterium longum may have a major impact on cardiogenic cerebral embolism.
• this Example confirmed that in the group of patients with cardiogenic cerebral embolism, there were significantly more equol non-producers than equol producers.
• the results shown in this disclosure indicate that equol itself, or equol production-promoting substances such as Bifidobacterium bacteria, may be used as a preventive or therapeutic agent for cardiogenic cerebral embolism.
• SHRSP Stroke prone spontaneously hypertensive rats
• CLEA Tokyo, Japan
• SP-SHR/Izm is a rat model that develops hypertension and spontaneously develops stroke due to salt loading. This test was conducted in an SPF environment under the approval of the animal experiment plan (Approval number 21068) of the National Cerebral and Cardiovascular Center (NCVC; Suita, Japan).
• 70-day-old SHRSP were divided into three groups as shown in Table 36 and reared under the conditions shown in Table 36.
• the outcome was death events, and the survival time was observed (Figure 28A).
• Table 37 shows the median survival time (IQR) for each group.
• IQR median survival time
• 70-day-old SHRSP were divided into three groups as shown in Table 38 and kept under the conditions shown in Table 38.
• Body weights and neurological symptoms were measured over time, and the animals were euthanized at 105 days of age (35 days after breeding) (Figure 29A).
• 70-day-old SHRSP were divided into four groups as shown in Table 39 and reared under the conditions shown in Table 39, and euthanized at 105 days of age (35 days after rearing).
• kidneys were sampled and fixed in 4% formaldehyde for 2 days, after which short-axis cross sections of the kidneys were cut out, embedded in paraffin, and thin sections were prepared.
• the renal glomerular structure and afferent arterioles were identified by microscopic examination using hematoxylin-eosin and Masson's trichrome staining.
• SHRSPs aged 63 days were fed standard rat diet (Funahashi SP diet) and water ad libitum for 7 days. After that, SHRSPs aged 70 days were divided into 3 groups as shown in Table 43 and kept for 14 days under the conditions shown in Table 43.
• 16SrRNA data was prepared from 84-day-old fecal samples from each group, and clustering was performed using partial least squares regression (sPLS-DA) analysis based on Level 7 (species level) information. As a result, it was found that the characteristics of the bacterial flora in each group were differentiated by clustering using sPLS-DA ( Figure 32B).
• sPLS-DA partial least squares regression
• the 84-day-old fecal samples were compared between the group that ingested water (group A) and the group that ingested saline (group B).
• the "relative amount of each bacterium in group B/relative amount in group A” was calculated as Fold change (FC), and the value of the ANOVA test between each group was calculated as a p-value.
• a volcano plot showing the difference in the relative amount of bacterial species was created using the -log10 value of p-value and the log2 (FC) value of Fold change (FC).
• bacteria of the genus Lactobacillus Alistipes, Frisingicoccus, Corynebacterium steathonis, Streptococcus, Monoglobus, Eubacterium siraelum, Butyricoccus, and Blautia were identified as bacteria that increased in the group that ingested saline (group B) (Table 45, Figure 32C).
• Clostridium, Lactospiracae UCG001, Richenellacea, and Lachnospiracae NK4A136 were identified as bacteria that decreased in the group that ingested saline (group B) (Table 45, Figure 32C).
• a Venn diagram was created to identify the bacterial species that increased or decreased in common between the two groups, focusing on the intestinal bacterial species that changed significantly between groups A and B, and between groups B and C.
• bacteria of the genus Lactobacillus, Alistipes, Frisingicoccus, Streptococcus, and Monoglobus were identified ( Figure 32E).
• 70-day-old SHRSP were divided into 5 groups as shown in Table 47 and reared under the conditions shown in Table 47.
• the outcome was death events, and the survival time was observed ( Figure 33A).
• Reference Test Example A By conducting the tests described below, the effects of oral administration of antibiotics to stroke-prone spontaneously hypertensive rat models on the intestinal flora, as well as the effects on the brain, heart, kidneys, and small intestine, can be verified, and the preventive or therapeutic effects of antibiotics on stroke can be confirmed.
• SHRSP Male, CLEA, Tokyo, Japan
• SHRSP Male, CLEA, Tokyo, Japan
• a standard rat diet Fenahashi SP diet
• the SHRSP will be divided into 6 groups as shown in Table 48 and kept under the conditions shown in Table 48 ( Figure 34) when they reach 70 days of age.
• feces will be collected and intestinal flora analysis will be performed (Figure 34).
• the animals will be euthanized and tissues of the brain, heart, kidney and small intestine will be sampled and stained with hematoxylin-eosin and Masson's trichrome to compare and analyze the state of blood vessels and the degree of fibrosis in each tissue.
• Reference Test Example B By conducting the tests described below, the effects of oral administration of IgA antibody to stroke-prone spontaneously hypertensive rat models on the intestinal flora, as well as the effects on the brain, heart, kidneys, and small intestine, can be verified, and the preventive or therapeutic effects of antibiotics on stroke can be confirmed.
• SHRSP Male, CLEA, Tokyo, Japan
• SHRSP Male, CLEA, Tokyo, Japan
• a standard rat diet Fenahashi SP diet
• the SHRSP will be divided into 4 groups as shown in Table 49 and kept under the conditions shown in Table 49 ( Figure 35) when they reach 70 days of age.
• feces will be collected and intestinal flora analysis will be performed (Figure 35).
• the animals will be euthanized and tissues of the brain, heart, kidney and small intestine will be sampled and stained with hematoxylin-eosin and Masson's trichrome to compare and analyze the state of blood vessels and the degree of fibrosis in each tissue.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• Organic Chemistry (AREA)
• Immunology (AREA)
• Molecular Biology (AREA)
• General Health & Medical Sciences (AREA)
• Analytical Chemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biomedical Technology (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Physics & Mathematics (AREA)
• Biotechnology (AREA)
• Biochemistry (AREA)
• Urology & Nephrology (AREA)
• Microbiology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Medicinal Chemistry (AREA)
• Hematology (AREA)
• Genetics & Genomics (AREA)
• General Engineering & Computer Science (AREA)
• Biophysics (AREA)
• Food Science & Technology (AREA)
• General Physics & Mathematics (AREA)
• Pathology (AREA)
• Pharmacology & Pharmacy (AREA)
• Cell Biology (AREA)
• Animal Behavior & Ethology (AREA)
• Veterinary Medicine (AREA)
• Toxicology (AREA)
• Public Health (AREA)
• Tropical Medicine & Parasitology (AREA)
• Cardiology (AREA)
• Heart & Thoracic Surgery (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Vascular Medicine (AREA)

Priority Applications (1)

Applications Claiming Priority (2)

Publications (1)

Family

ID=90608415

Family Applications (1)

Country Status (2)

Citations (5)

• 2023
  • 2023-09-29 JP JP2024555779A patent/JPWO2024075662A1/ja active Pending
  • 2023-09-29 WO PCT/JP2023/035817 patent/WO2024075662A1/ja not_active Ceased

Patent Citations (5)

Non-Patent Citations (4)

Also Published As

Similar Documents

Legal Events