WO2024056635A1 - Verfahren zur qualitativen kontrolle von stammzellen - Google Patents

Verfahren zur qualitativen kontrolle von stammzellen Download PDF

Info

Publication number
WO2024056635A1
WO2024056635A1 PCT/EP2023/074971 EP2023074971W WO2024056635A1 WO 2024056635 A1 WO2024056635 A1 WO 2024056635A1 EP 2023074971 W EP2023074971 W EP 2023074971W WO 2024056635 A1 WO2024056635 A1 WO 2024056635A1
Authority
WO
WIPO (PCT)
Prior art keywords
differentiation
cells
ipsc
stem cells
pluripotent
Prior art date
Application number
PCT/EP2023/074971
Other languages
English (en)
French (fr)
Inventor
Wolfgang Wagner
Marco Schmidt
Kira Zeevaert
Mohamed ELSAFI MARBROUK
Original Assignee
Rheinisch-Westfälische Technische Hochschule (Rwth) Aachen
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE102023105548.8A external-priority patent/DE102023105548A1/de
Application filed by Rheinisch-Westfälische Technische Hochschule (Rwth) Aachen filed Critical Rheinisch-Westfälische Technische Hochschule (Rwth) Aachen
Publication of WO2024056635A1 publication Critical patent/WO2024056635A1/de

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6881—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes

Definitions

  • the invention relates to a method for the qualitative control of at least one specific property of at least one stem cell, in particular a method for quality control for the pluripotency of pluripotent stem cells (PSCs).
  • PSCs pluripotent stem cells
  • Pluripotent stem cells can differentiate into all cells in the human body.
  • ESCs embryonic stem cells
  • iPSCs induced pluripotent stem cells
  • Pluripotent stem cells are used by the pharmaceutical industry for drug development and tested in clinical trials.
  • quality control of pluripotent stem cells and quantitative tracking of early differentiation processes represent a major hurdle.
  • Pluripotent stem cells are characterized by the fact that they can differentiate into the three embryonic germ layers: endoderm, mesoderm and ectoderm. To confirm pluripotency, cells are typically either targeted to these lineages using specific culture media or verified using untargeted multilineage differentiation assays in embryoid bodies (EBs) or teratomas (International Stem Cell, 2018). Marker genes can then be evaluated for their gene expression or at the protein level (Gifford et al., 2013; O'Shea et al., 2020).
  • ScoreCard panel based on quantitative reverse transcription PCR (RT-qPCR) measurements of 96 genes, can be used to determine early germ layer-specific differentiation (Bock et al., 2011 ; Tsankov et al., 2015).
  • Pluripotency can also be determined based on gene expression profiles by the so-called “PluriTestTM”, i.e. a bioinformatic analysis of transcriptomes of undifferentiated cells, can be predicted (Muller et al., 2011). It reflects the transcriptomic features of PSCs, but says nothing about the ability to differentiate into specific germ layers (Bouma et al., 2017).
  • DNA methylation plays an important role in cellular differentiation and manifests itself during embryonic development (Bock et al., 2011). It occurs particularly at cytosine-guanine dinucleotides (CpG sites), whereby these epigenetic modifications can be cell type-specific (Roadmap Epigenomics et al., 2015). Because each cell has two copies of DNA, DNAm is well suited to applying deconvolution algorithms to estimate the composition of different cell types. This approach has already been used for the so-called “Epi-Pluri score”, a signature that can distinguish pluripotent and non-pluripotent cells based on DNAm changes at three specific CpG sites (Lenz et al., 2015). However, this signature was only selected based on somatic cells and reprogrammed iPSCs and therefore cannot detect early differentiation changes and cotyledon-specific changes.
  • the differentiation potential into a wide variety of cell types is considered an essential quality feature of iPSCs and is often tested using complex and ethically questionable teratoma assays in mouse models.
  • immunophenotypic and gene expression-based methods are difficult to quantify and standardize.
  • a quantitative, robust and scalable assay that can estimate the germ layer-associated cell fractions in early differentiation is not yet available.
  • Current methods for detecting the pluripotency of human induced pluripotent stem cells are often not standardizable, time-consuming, and/or associated with relatively high costs.
  • robust and rapid quality control of the starting material is essential. However, these criteria can currently be used by cannot be fully met by any commercial process.
  • the object is achieved by a method of the type mentioned at the outset, which comprises the following steps:
  • the solution according to the invention is based on the epigenetic analysis of genomic DNA.
  • DNA methylation (DNAm) has significantly less variability compared to gene expression, which makes it easy to standardize and compare the results obtained.
  • the advantageous method according to the invention is therefore based on epigenetic properties of the DNA and is therefore also suitable retrospectively for samples that have already been isolated. Since DNA is relatively stable, samples for testing can easily be sent at room temperature and measured using a high-throughput process.
  • the method according to the invention enables a user to estimate the differentiation potential of the cells. This is of particular interest for the development of optimized industrially usable iPS cell lines.
  • the method according to the invention provides the user with additional information about the ability of the analyzed stem cells to differentiate into the three germ layers, which is considered an essential quality feature for pluripotent stem cells.
  • This information can be reliably generated after just a few days of cultivation using pyroseqencing, or comparable methods for targeted DNA methylation measurement. In contrast to teratoma assays, this advantageously does not require animal testing.
  • the signatures according to the invention are based on early differentiation stages during development in endo-, meso- and Ectoderm was selected.
  • publicly available methylation data from iPSCs, embryonic stem cells (ESCs) and terminally differentiated cells were used to identify specific CG dinucleotides (CpG sites) at which specific changes occur during the differentiation processes into the respective germ layers of DNA methylation occurred.
  • PSCs pluripotent stem cells
  • ENDO endoderm
  • MEO mesoderm
  • ECTO ectoderm
  • the method according to the invention is therefore based on the methylation of at least one CpG dinucleotide, which has early and characteristic changes in the context of differentiation into endoderm, mesoderm and ectoderm.
  • the method according to the invention enables both (1) the determination of a first control value based on the degree of methylation (DNAm degree) of at least one CpG, preferably at least two or three CpGs, and enables a reliable distinction between pluripotent and somatic cells (“pluripotency score”), as well as (2) the determination of a second control value, which is based on the Methylation level (DNAm level) of at least one CpG, preferably at least three CpGs, per cotyledon and enables reliable validation of the differentiation into each of the three cotyledons (“differentiation score”).
  • DNAm degree degree of methylation
  • second control value which is based on the Methylation level (DNAm level) of at least one CpG,
  • the method according to the invention can therefore be used advantageously, for example, for quality control of the pluripotency of (human) induced pluripotent stem cells by analyzing the methylation of three specific CG dinucleotides.
  • the method according to the invention can also be applied to embryonic stem cells.
  • the ability of stem cells to differentiate into the three germ layers can be estimated in early phases of differentiation.
  • the solution according to the invention thus enables, for example, both a validation of the pluripotency of reprogrammed cells as well as the validation of the differentiation or differentiability into all three lines and the composition of the germ layers in early cell aggregates, in particular so-called embryoid bodies (EBs).
  • EBs embryoid bodies
  • the method according to the invention can therefore be used for efficient, reliable, sensitive, standardizable, scalable, robust and rapid qualitative control of pluripotent stem cells and cell products derived therefrom in order to reduce costs in research and development as well as industrial production and to accelerate technological progress.
  • the method according to the invention has so far been successfully tested on public data sets as well as on a selection of our own cell preparations.
  • the specific property includes the pluripotent differentiation potential of the stem cell.
  • the control value can be determined, for example, from the sum of several specific levels of methylation.
  • the CpG dinucleotide is selected from the group consisting of the CpG dinucleotides cg00661673, cg00933813 and cg21699252. Determining the methylation of one or more of these CpGs advantageously enables a reliable distinction between pluripotent and somatic cells and thus the qualitative control of the pluripotent differentiation potential of a stem cell (“pluripotency score”).
  • the specific property includes the cotyledon-specific differentiation of the stem cell.
  • the control value can be determined, for example, from the sum of the determined methylation levels minus the corresponding averaged methylation levels of undifferentiated stem cells, with the values of the determined methylation levels being taken into account inversely in the case of hypomethylated CpG dinucleotides.
  • the CpG dinucleotide for determining the differentiation in the direction of the different germ layers comprises at least one of the following CpG dinucleotides:
  • - Endoderm cg20548013, cg14521421 and cg08913523;
  • - Endoderm/Mesoderm cg23385847, cg24919344 and cg11147278.
  • the determination of the methylation of one or more of these CpGs per germ layer advantageously enables a reliable validation of the differentiation of a stem cell into each of the three germ layers and thus the qualitative control of the differentiability of stem cells into the three germ layers (endo-, meso- and ectoderm) already in early phases of differentiation (“differentiation score”).
  • the stem cells are pluripotent stem cells (PSCs), induced pluripotent stem cells (iPSCs), embryonic stem cells (ESCs) and / or directly reprogrammed cells that were derived by direct conversion into other cell types.
  • the object is further achieved by using at least one nucleic acid molecule, which comprises at least one of the CpG dinucleotides cg00661673, cg00933813 and cg21699252, to determine the pluripotent differentiation potential of at least one stem cell.
  • the object is also achieved by using at least one nucleic acid molecule, which comprises at least one CpG dinucleotide, to determine the cotyledon-specific differentiation of at least one stem cell, the CpG dinucleotide being used to determine the differentiation in the direction of one of the different cotyledons from one of the following groups is selected:
  • - Endoderm cg20548013, cg14521421 and cg08913523;
  • - Endoderm/Mesoderm cg23385847, cg24919344 and cg11147278.
  • the identification number “cg...” refers to the position of the respective CpG dinucleotide on the “Illumina HumanMethylation450 BeadChip” or the “Illumina EPIC BeadChip”.
  • DNA methylation can be carried out cost-effectively and in a high-throughput process for the specific regions (e.g. DNA areas), for example using pyrosequencing or MassArray.
  • regions e.g. DNA areas
  • massArray e.g. DNA methylation
  • more advanced investigation techniques such as sequencing and microarray-based methods are also possible.
  • the invention further relates, for example, to a kit with a compilation of suitable reference DNAs, primer sets, and optionally instructions and Evaluation software.
  • a kit in particular a kit for determining the pluripotent differentiation potential of at least one stem cell and/or for determining the cotyledon-specific differentiation of at least one stem cell, preferably for carrying out the method according to the invention, which contains at least one oligonucleotide primer (preferably oligonucleotide -Primer pair, e.g.
  • kits according to the invention can, for example, contain at least one artificial nucleic acid molecule according to the invention and optionally at least one buffer solution and/or at least one reagent for carrying out at least one method selected from the group consisting of DNA amplification, bisulfite treatment of DNA, DNA sequencing, preferably Pyrosequencing of DNA, MassArray analysis, deep sequencing of bisulfite-converted DNA, flow cytometry based bead assays and SNP genotyping are selected.
  • the method according to the invention makes it possible to cover the following parameters for the quality control of iPSCs:
  • MDS Multidimensional scaling
  • Figure 2 Derivation of a new pluripotency score based on the DNAm of three CpGs.
  • A The DNAm profiles of pluripotent stem cells (PSCs) were compared with all other differentiated cell types (endoderm, mesoderm, and ectoderm) to identify three CpG candidates.
  • the difference in mean beta values (DNAm levels) is plotted against the combined variance within groups.
  • the parabola is part of the selection process (middle parabola parameter shown as an example).
  • FIG. 3 Selection of germ layer-specific CpG sites.
  • A Selection of candidate CpGs for endoderm (ENDO), mesoderm (MESO), ectoderm (ECTO), and endomesoderm (ENDOMESO) in the selection set.
  • the mean parabola parameter is shown as an example and the selected candidate CpGs are indicated.
  • the heatmap shows the differentiation values (“differentiation scores”) of the CpG sites for the remaining samples from data set 2.
  • the values (“scores”) are the sum of the differences in the DNAm levels from the reference stem cells (for hypomethylated CpGs, 1 - DNAm was calculated); white means no change compared to stem cells, red means a change towards specific methylation and blue vice versa.
  • Figure 4 Pluripotency and differentiation values in embryoid bodies.
  • the heatmap shows the Z-scores of the gene expression signatures for endoderm (279 genes), mesoderm (425 genes), and ectoderm (516 genes) in the corresponding EBs. These signatures were derived from a public single-cell RNA sequencing dataset for D8-EBs (Han et al., 2018). Overall, EBs with ectodermal orientation also showed higher expression of ectodermal gene expression in our epigenetic scores.
  • Figure 5 Targeted assays of selected CpGs measured using pyrosequencing.
  • iPSCs with directed differentiation towards endoderm (ENDO), mesoderm (MESO) and ectoderm (ECTO) as well as EBs are used before, after 5 days and after 15 days of spontaneous differentiation in suspension culture (DO, D5 and D15, respectively).
  • ENDO endoderm
  • MESO mesoderm
  • ECTO ectoderm
  • EBs EBs
  • C RT-qPCR results of the germ layer-specific genes.
  • the heatmap shows the ddCT values compared to the stem cells.
  • D ScoreCard results. Shown are the combined gene expression scores for each germ layer compared to the reference standard for selected iPSC lines.
  • Figure S1 Three-stage differentiation of pluripotent stem cells (related to Figure 1)
  • Figure S2 Heatmap of the most differentially methylated CpGs (related to Figure 1)
  • Venn diagrams show the number of significant hypo- and hypermethylated CpGs that overlap during differentiation toward endoderm (ENDO), mesoderm (MESO), and ectoderm (ECTO). This analysis was performed for Dataset 1 and Dataset 2 in parallel. The overlap between the data sets is indicated in parentheses.
  • Figure S4 Differentially expressed genes between the germ layers (related to Figure 1)
  • Venn diagrams show the number of significant changes in gene expression during differentiation into endoderm, mesoderm, and ectoderm. This analysis was performed for Dataset 1 and Dataset 2 separately. The overlap between the data sets is indicated in brackets.
  • Figure S5 Comparison of different pluripotency signatures (in conjunction with Figure 2)
  • PluriTest analysis was performed using the online tool PluriTest (https://www.pluritest.org/). RNA-seq FASTAQ files were uploaded to the website for preprocessing, alignment and automatic analysis using the proprietary algorithm. The results showed that most stem cells, mesoderm and endoderm samples had similar pluripotency scores. PluriTest was unable to distinguish between them and the predictions did not match the pluripotent cloud of the empirical density map. Over and beyond two of three iPSC lines from Dataset 1 and the outlier cell line SC12-040 had scores indicated as failure.
  • Epi-Pluri score analysis is based on DNAm at three specific CpGs.
  • One of these CpGs was located within the pluripotency-associated gene POU5F1 (also known as OCT4).
  • POU5F1 also known as OCT4
  • the difference in the DNAm levels of the CpGs in ANKRD46 and C14orf115 was determined and summarized as the Epi-Pluri score (Lenz et al., 2015).
  • the points in the background refer to DNAm profiles (all Illumina HumanMethylation27 BeadChip platform) from 264 pluripotent and 1,951 non-pluripotent cell preparations, respectively (Lenz et al., 2015).
  • Epi-Pluri score classified all cell preparations as pluripotent, while early differentiation events can be followed by an increase in DNAm in POU5F1.
  • the sample IDs are highlighted again (GSM2285159, Dataset 2).
  • sample SC12-040 was clearly classified as non-pluripotent, and this sample was also out of line in the MDS and PCA plots ( Figure 1A,C) and also appeared to have an aberrant karyotype (Salomonis et al., 2016).
  • Figure S6 Identification of germ layer gene signatures in EBs (related to Figure 4)
  • Figure S7 Pyrosequencing tests for CpGs according to the invention (related to Figure 5)
  • the invention relates, among other things, to the quality control of induced pluripotent stem cells.
  • To validate the pluripotent state it is crucial to determine the potential for tripartite differentiation towards endoderm, mesoderm and ectoderm.
  • DNAm site-specific DNA methylation
  • CG dinucleotides (CpGs) were identified with characteristic DNAm in the pluripotent state and after differentiation into endoderm, mesoderm and ectoderm.
  • a “pluripotency score” was derived, indicating differentiation ability, as well as lineage-specific “differentiation scores” to monitor, for example, either directed differentiation or self-organized multilinear differentiation in embryoid bodies. Additionally, pyrosequencing assays have been developed for rapid and cost-effective analysis. The method according to the invention can therefore be used advantageously for the quality control of pluripotent cells and for estimating the lineage-specific binding can be used during the first differentiation events.
  • characteristic DNAm signatures were identified for each of the three germ layers, i.e. three CpGs with characteristic DNAm for undifferentiated pluripotent cells, endoderm, mesoderm, ectoderm and endomesoderm were selected.
  • the method according to the invention was developed: a tool that consists of a “pluripotency score”, which can indicate the differentiation potential, and lineage-specific signatures to estimate the proportions of early cell fate decisions in differentiation experiments.
  • iPSCs induced pluripotent stem cells
  • RNA sequencing data revealed overall consistent changes in gene expression during differentiation of the three developmental stages (Fig. 1 D). Many genes are significantly up- or down-regulated (>2-fold; adjusted p value ⁇ 0.05; Supplementary Fig. S4A) during differentiation to endoderm, mesoderm, and ectoderm. As a trend, genes with hypomethylation in promoter regions showed upregulated gene expression and vice versa (Supplementary Fig. S4B). In analogy to the DNAm data, in data set 2 there was a strong overlap in differential gene expression during differentiation to the endoderm and mesoderm (Supplementary Fig. S4C). Canonical markers of mesodermal differentiation were particularly upregulated in data set 1 (Fig. 1 E). These results show that, depending on the differentiation scheme, the differences between endoderm and mesoderm are only marginal, which must be taken into account when identifying germ layer-specific signatures.
  • a new pluripotency score was therefore created which is based on the early DNAm changes during differentiation into the endoderm, mesoderm and ectoderm.
  • Relevant CpGs were selected using the R package CimpleG (manuscript in preparation) according to high differences in mean methylation and low variance within groups (Schmidt et al., 2020).
  • the undifferentiated and differentiated samples of the three iPSC lines from our data set 1 and three randomly selected PSC lines from data set 2 were used to achieve a balance between studies (Fig. 2A).
  • the three main candidate CpGs were: cg00661673, associated with the gene palladin (PALLD)', cg00933813, not associated with a specific gene; and cg21699252, associated with MYCN Opposite Strand (MYCNOS).
  • the DNAm levels at these sites were combined into a pluripotency score (sum of the DNAm levels and 1 - DNAm level for the hypomethylated sites), which could clearly distinguish PSCs and differentiated cells in the selection set (Supplementary Fig. S5C) . Similar results were observed when the remaining samples from Dataset 2 were used for the initial validation. Notably, the pluripotency score was also able to distinguish three samples that showed aberrations when analyzing gene expression and DNAm profiles (Fig.
  • pluripotency score could correctly distinguish PSCs and early differentiated cells in a completely independent collection of pluripotent and iPSC-derived cell types (Dataset 3; Supplementary Table S1; Fig. 2C).
  • somatic cells were examined and it was found that the pluripotency score was consistently very low in primary cell types (549 DNAm profiles compiled from 21 studies (Schmidt et al., 2020); Dataset 4; Fig. 2D) .
  • the pluripotency score according to the invention was compared with DNAm profiles of PSCs that met the criteria for pluripotency but had either a higher differentiation capacity (HDC) or a lower differentiation capacity towards the endoderm (LDC; GSE59091, data set 5) (Butcher et al ., 2016).
  • biomarker according to the invention should also reflect the specific differentiation towards endoderm, mesoderm or ectoderm, candidate CpGs were also selected for each germ layer.
  • candidate CpGs were also selected for each germ layer.
  • the same selection set was used as for the pluripotency score and the same selection method was applied for each differentiated cell type (Fig. 3A).
  • the three most important CpGs for the endoderm (ENDO) were selected: cg20548013, associated with phosphatase and actin regulator
  • PHYR1 mesoderm 1
  • DENN domain containing 2B DENN domain containing 2B
  • cg08913523 no gene
  • mesoderm mesoderm
  • DORA2B adenosine receptor A2B
  • cg11599718 associated with vacuolar protein sorting-associated protein 37B (VPS37B): for ectoderm (ECTO) the CpGs cg01907071, associated with the gene thrombospondin type 1 domain containing 4 (THSD4)', cg18118164, associated with ephrin A5 (EFNA5)' , and cg13075942, associated with RAD51 paralog B (RAD51B). Since endoderm and mesoderm in particular in data set
  • ENDOMESO endoderm and mesoderm
  • EBs were generated and DNAm profiles before (day 0), on day 4 and on day 7 after aggregation were analyzed (EB data set 1; supplementary Table S1 ).
  • EB data set 1 supplementary Table S1
  • the three CpGs specific to the undifferentiated state change already within 4 days of undirected EB differentiation, reflected in a rapid decline in pluripotency score (Fig. 4A), again suggesting this , that most cells have left the pluripotent state.
  • the differentiation scores (Fig. 4B) indicated differentiation in the three germ layers.
  • the ENDOMESO-associated CpG site cg2338547 did not exhibit the expected hypermethylation in this data set, leading to a discrepancy in deconvolution predictions (Fig. 4C).
  • RNA sequencing data derived from day 8 EBs were clustered according to germ layers (Supplementary Fig. S6) (Han et al., 2018). On this basis, gene lists most clearly associated with the endoderm, mesoderm and ectodermal clusters were selected (Supplementary Table S2). In fact, the ectodermal signatures were overall more highly expressed in EBs for which the inventive method also predicted ectodermal alignment (Fig. 4E).
  • Pyrosequencing assays were then developed for the targeted analysis of the relevant CpGs in order to be able to use the method according to the invention without Illumina BeadChip analysis.
  • DNAm levels showed little variation between the pyrosequencing and EPIC BeadChip measurements (Supplementary Fig. S7A).
  • the pyrosequencing results were used to adjust the reference matrix for deconvulation (Supplementary Fig. S7B).
  • EBs were again generated and cultured for 5 or 15 days.
  • Quality measurements of iPSC lines can be used for several purposes: 1 ) to monitor the initial reprogramming of somatic cells, 2) to determine the differentiation ability of undifferentiated cells, and 3) to monitor differentiation to ultimately validate pluripotent differentiation potential (Steeg et al., 2021 ).
  • the pluripotency score was overall higher in iPSCs with high differentiation capacity than in cells with low differentiation capacity towards the endoderm (Butcher et al., 2016), suggesting that the method according to the invention can also be used to estimate the differentiation capacity of non-differentiated iPSCs can be used.
  • the method according to the invention could therefore be an indicator of the differentiation potential of iPSCs that are already under pluripotent culture conditions. In the future, it will be important to further demonstrate that these signatures reliably capture aspects of differentiation potential and to better define thresholds.
  • Teratoma testing is a method for testing pluripotency in which PSCs are transplanted into an immunodeficient mouse, where they spontaneously form germ cell tumors with immunophenotypic features of all germ layers (International Stern Cell, 2018). This test raises animal welfare concerns, the analysis takes several months and is expensive. Furthermore, teratoma formation is highly variable and can hardly be quantified (Dolgin, 2010; Muller et al., 2010; Tsankov et al., 2015). The ScoreCard test is based on a directed or spontaneous differentiation scheme and uses a relatively large selection of reference genes.
  • the method according to the invention could track early parentage decisions during directed differentiation. Furthermore, it could be used to estimate the cellular composition in EBs. The predicted ectodermal fractions correlated with the gene expression profiles and deconvolution results. Furthermore, iPSC lines with impaired ectodermal differentiation, such as PRDM8 /_ and YAP /_ , can be identified. Handling and shipping DNA samples is easier than RNA samples.
  • the method according to the invention is based on only 12 CpGs (15 CpGs for ENDOMESO). Such small signatures are a compromise as they can be more prone to individual outliers than signatures that integrate hundreds of CpGs.
  • such targeted assays can be measured cost-effectively and robustly, independent of specific microarray platforms or bioinformatics tools. This is important if such assays are to be used for clinical validation of therapeutic cellular products, which may even require approval as in vitro diagnostics (Wagner, 2022).
  • the invention provides further insights into epigenetic changes in early cell fate decisions.
  • Candidate CpGs for assessing PSCs in the pluripotent state and for capturing early cell fate decisions towards endoderm, mesoderm and ectoderm were identified.
  • the method according to the invention offers various advantages compared to conventional methods for quality control of iPSCs. Such analysis can also be used to optimize culture conditions to maintain a larger proportion of cells in the pluripotent state or to better control differentiation into specific germ layers.
  • iPSC lines were generated from bone marrow-derived mesenchymal stromal cells (iPSC 102, iPSC 104, iPSC 106) (Goetzke et al., 2018) or dermal fibroblasts (TF11-C2.3) (Willmann et al., 2013). Reprogramming generated with episomal plasmids. All samples were collected after information and written consent in accordance with the guidelines approved by the Ethics Committee for the Use of Human Test Subjects at the University of Aachen (approval number: EK128/09).
  • the iPSC lines were cultured on tissue culture plastic coated with vitronectin (0.5 pg/cm 2 ) in StemMACS iPS-Brew XF (Miltenyi Biotec GmbH, Bergisch Gladbach, Germany). Directed differentiation toward endodermal, mesodermal, and ectodermal lineages was induced using the STEMdiff Trilineage Differentiation Kit (Stemcell Technologies, Vancouver, Canada; Supplementary Fig. S1A).
  • iPSCs Self-detaching iPSCs were generated as previously described (Elsafi Mabrouk et al., 2022). Briefly, vitronectin was printed using a microcontact method (diameter 600 pm) and iPSCs grew and organized even on these substrates. After about 6 days, when more than 50% of the colonies detached, the floating aggregates were harvested and considered as day 0 for further differentiation steps. Alternatively, spin EBs were generated as previously described (Ng et al., 2005).
  • Non-targeted multilineage differentiation of EBs was performed in ultralow attachment plates (Coming, NY, USA) with differentiation induction medium (EB medium), the Knockout DMEM/F12, 20% KnockOut serum replacement, 2 mM GlutaMAX supplement, 0.1 mM not -essential amino acids and 0.1 mM b-mercaptoethanol (all from Gibco, Carlsbad, USA).
  • EB medium differentiation induction medium
  • Knockout DMEM/F12 20% KnockOut serum replacement
  • 2 mM GlutaMAX supplement 2 mM GlutaMAX supplement
  • 0.1 mM not -essential amino acids 0.1 mM b-mercaptoethanol
  • Genomic DNA was isolated using the NucleoSpin Tissue Kit (Macherey-Nagel, Düren, Germany) and quantified using a NanoDrop 2000 spectrophotometer (Thermo Fischer Scientific, Waltham, USA). 1.2 pg of DNA were bisulfitated and analyzed using Illumina EPIC BeadChip microarrays at Life & Brain (Bonn, Germany; data set 1).
  • DNA methylation profiles were obtained from iPSC and iPSC-derived cells (PSC, ENDO, MESO, ECTO and EB) running on Illumina HumanMethylation450 BeadChips Progenitor Cell Biology Consortium (PCBC) of the National Heart, Lung and Blood Institute (Dataset 2; Supplementary Table S1) (Daily et al., 2017) from the Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov /geo; GSE85828) are used.
  • DNAm profiles of iPSC-derived cells differentiated into different cell types were used.
  • DNAm profiles from iPSCs with high differentiation capacity (HDC) or low differentiation capacity towards endoderm (LDC; GSE59091 ; Dataset 5; for samples with replicates, the average values over all corresponding replicates were always used) were used (Butcher et al., 2016 ).
  • the IDAT files of the Illumina BeadChips were loaded and preprocessed using minfi ( Aryee et al., 2014 ) in R (4.1.3). Low quality samples were removed (threshold: sum of medians of methylated and unmethylated channels ⁇ 20) and the remaining samples were normalized using ssNoob (Triche et al., 2013). For samples for which IDAT files were not available, existing beta values were used or the beta values were generated from the signal intensities. CpG sites on XY chromosomes, non-CG probes and SNP-associated CpGs were not considered for further analysis. Additionally, only CpGs represented on the 450K and EPIC BeadChip platforms were considered.
  • the R package limma (3.48.0) was used to calculate the Benjamini-Hochberg adjusted p values and MDS plots. Relevant DNAm changes were defined as at least a 20% difference in mean beta values and an adjusted p value ⁇ 0.05. Fisher's exact test was performed using the R package GeneOverlap. The R packages ggplot2, ggrepel, ggbeeswarm, reshape2, ggExtra, ggsignif, cowplot, gprofiler2, ComplexHeatmap and VennDiagram were used for graphical representation.
  • CpG sites with large differences in mean beta values and small variances within groups were selected (method: “CimpleG_parab”).
  • the pluripotency score is based on the sum of DNAm at the three pluripotency-associated CpGs cg00661673, cg00933813 and cg21699252. Since all of these CpGs have lower DNAm in pluripotent cells, for more intuitive use, the complementary percentages were calculated:
  • Pluripotency score (1 - DNAm cg00661673 ) + (1 - DNAm cg00933813 ) + (1 - DNAm cg21699252 )
  • the deconvolution approach is based on non-negative matrix factorization, as described in a previous work by the inventors (Frobel et al., 2018; Schmidt et al., 2020). Either the mean DNAm levels from the selection set or the pyrosequencing data were used as a reference matrix.
  • RNA sequencing was carried out by Life & Brain (Bonn, Germany) using the NovaSeq 6000 sequencer (100 bp/read).
  • the FASTA files were checked using FastQC and the adapter sequences were trimmed using Trimmomatic. Alignment of reads was performed using STAR (hg38 genome build).
  • the counting matrices were downloaded from the Progenitor Cell Biology Consortium (PCBC) web portal (https://www.synapse.Org/#ISynapse:syn2822494). Data were normalized using the variance stabilizing transformation (VST) from the DESeq2 package in R (Love et al., 2014).
  • VST variance stabilizing transformation
  • RNA-seq dataset was humanized Embryoid bodies used (Han et al., 2018). All runs for day 8 EBs were merged and counts normalized.
  • the Seurat package (v4) was used for quality control and filtering out cells with abnormal feature counts (Hao et al., 2021). Cells were clustered using the nearest neighbors algorithm and representative markers of each cluster were identified using MAST (Finak et al., 2015). Genes with an adjusted p value ⁇ 0.05 and a fold change > 1.5 were considered as cotyledon markers (Supplementary Table S2). The identity of each cluster was annotated using gprofiler2 using GO terms associated with marker genes ( Kolberg et al., 2020 ).
  • RNA-seq FASTAQ files were uploaded to the website, where they were automatically preprocessed, aligned and analyzed using a proprietary algorithm. The resulting pluripotency score and novelty score were recorded accordingly.
  • Genomic DNA 500 ng was bisulfitated overnight using the EZ DNA Methylation Kit (Zymo) and eluted in 20 pL elution buffer.
  • Primers Metal Organic Chemicals
  • the target sequences were amplified using the PyroMark PCR kit (Qiagen) with 2.5 mM Mg 2+ and a primer concentration of 0.3 pM.
  • Pyrosequencing was performed using a Q96 ID pyrosequencer (Qiagen).
  • Primers for OCT4, GATA6, Brachyury, PAX6 and the housekeeping gene GAPDH are listed in Supplementary Table S4. ScoreCard analysis was performed using the TaqMan hPSC ScoreCard 96-well Kit (Thermo Fischer Scientific) according to the manufacturer's instructions.
  • RNA-seq and methylation data generated are available in the Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo/).
  • NAME _ DNA SEQUENCE _ cgSCl For GGTTGGAGTGTATTGGTGTAA cgSCl Rev Biotin- AATCCCAACCTTTAT AC AT ATT AATTCTT cgSCl Seq GTTGAGATTATAGGTGTGA cgSC2 For AGGTTGGTTATGAATTTTTGGTTTTAAGTA cgSC2 Rev Biotin- ATACCCTACCTTCCTTTCATTTATATTC cgSC2 Seq TTGGGATTATAGGTGTG cg SC3 For GATGTTGAGGGTTAGGGGGTAATT cgSC3 Rev Biotin- CCTAAAACTCTAAAAATCTTTCTCCCTAAA cgSC3 Seq TGAAGGTTTTTTTTTTTGA cgEl For GAATAGTATATGGTTGGTTGGGAAAGT cgEl Rev Biotin- CCAAAAAAAAAATACCTTTACTATCACT cgEl Seq AGGAGTTATTTTATTATATTGGAG cgE2 For GA
  • OCT4 For GGGGGTTCTATTTGGGAAGGTA
  • PAX6 For TCGAAGGGCCAAATGGAGAAGAGAAG
  • Minfi a flexible and comprehensive Bioconductor package for the analysis of Infinium DNA methylation microarrays. Bioinformatics 30, 1363-1369.
  • Non-CG DNA methylation is a biomarker for assessing endodermal differentiation capacity in pluripotent stem cells. Nat Commun 7, 10458.
  • PRDM8 reveals aberrant DNA methylation in aging syndromes and is relevant for hematopoietic and neuronal differentiation. Clin Epigenetics 12, 125.
  • MAST a flexible statistical framework for assessing transcriptional changes and characterizing heterogeneity in single-cell RNA sequencing data. Genome Biol 16, 278.
  • gprofi Ier2 an R package for gene list functional enrichment analysis and namespace conversion toolset g: Profiler. FWOORes 9.
  • EBiSC Best practice: How to ensure optimal generation, qualification, and distribution of iPSC lines.
  • YAP1 regulates the self-organized fate patterning of hESC-derived gastruloids. Stem Cell Reports 17, 211-220.
  • Induced pluripotent stem cells can be generated in bulk culture. PLoS One 8, e65324.
  • CDKN1C 2.51013E-55 3.267563123 0.949 0.448 3.9404E-51 1.844362981
  • HLA-DRB1 7.22183E-19 2.682945231 0.604 0.164 1.13368E-14 0.464752564
  • VIL1 1.19692E-17 2.642148939 0.404 0.054 1.87893E-13 0.156076671
  • RNASE1 2.1543E-07 2.542024501 0.222 0.031 0.003381821 0.161777234 BMP2 l,24523E-25 2.529440206 0.829 0.264 1.95475E-21 0.595774921 VTN 3.50692E-30 2.515092887 0.593 0.063 5.50516E-26 0.129156015 FLRT3 6.12893E-30 2.513916772 0.96 0.439 9.62119E-26 1.773337685 SGIP1 6.02136E-17 2.493011632 0.378 0.065 9.45234E-13 0.143770783 F10 2.37709E-14 2.465882146 0, 356 0.033 3.73156E-10 0.115564935 EPCAM 6, 84207E-47 2.448538745 0.985 0.598 l,07407E-42 2.252605003 F2 2.88386E-12 2.401001234 0.291 0.019 4.52708E-08 0.079772596 REEP6 3
  • PPP1R14A 1.13127E-13 1.036173078 0.356 0.113L,77587E-09 0.041550274
  • TRPS1 l,53969E-06 1.019867033 0.224 0.106 0.024170094 0.108821643
  • CDH6 2.04471E-60 3.571263152 0.885 0.206 3.20978E-56 1.112776619
  • GIGYF1 l.84666E-10 1.002331621 0.512 0.329 2.89888E-06 0.160807234

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Die Erfindung betrifft ein Verfahren zur qualitativen Kontrolle mindestens einer spezifischen Eigenschaft mindestens einer Stammzelle, insbesondere ein Verfahren zur Qualitätskontrolle für die Pluripotenz von pluripotenten Stammzellen (PSCs). Die Erfindung betrifft ferner die Verwendung mindestens eines Nukleinsäuremoleküls, welches zumindest ein CpG-Dinukleotid umfasst, zur Bestimmung der keimblatt-spezifischen Differenzierung mindestens einer Stammzelle. Die erfindungsgemäße Lösung beruht dabei auf der epigenetischen Analyse genomischer DNA, wobei neben der qualitativen Pluripotenzanalyse auch die Möglichkeit besteht, das Differenzierungspotential der Zellen abzuschätzen. In Verbindung mit der Differenzierung der iPSCs liefert das erfindungsgemäße Verfahren dem Anwender zusätzlich Informationen über die Differenzierbarkeit der analysierten Stammzellen in die drei Keimblätter, was als wesentliches Qualitätsmerkmal für pluripotente Stammzellen gilt. Die erfindungsgemäßen Signaturen wurden anhand von frühen Differenzierungsstadien während der Entwicklung in Endo-, Meso- und Ektoderm ausgewählt.

Description

Verfahren zur qualitativen Kontrolle von Stammzellen
Hintergrund der Erfindung
Die Erfindung betrifft ein Verfahren zur qualitativen Kontrolle mindestens einer spezifischen Eigenschaft mindestens einer Stammzelle, insbesondere ein Verfahren zur Qualitätskontrolle für die Pluripotenz von pluripotenten Stammzellen (PSCs).
Stand der Technik
Pluripotente Stammzellen (PSCs) lassen sich in alle Zellen des menschlichen Körpers differenzieren. Dabei unterscheidet man embryonale Stammzellen (ESCs) und induzierte pluripotente Stammzellen (iPSCs), die durch die Überexpression bestimmter Transkriptionsfaktoren aus differenzierten Zellen reprogram miert werden. Pluripotente Stammzellen werden von der pharmazeutischen Industrie für die Medikamentenentwicklung verwendet und in klinischen Studien getestet. Die Qualitätskontrolle von pluripotenten Stammzellen und die quantitative Nachverfolgung früher Differenzierungsprozesse stellt jedoch eine große Hürde dar.
Pluripotente Stammzellen zeichnen sich dadurch aus, dass sie sich in die drei embryonalen Keimblätter Endoderm, Mesoderm und Ektoderm differenzieren können. Um die Pluripotenz zu bestätigen, werden die Zellen in der Regel entweder mit spezifischen Kulturmedien auf diese Linien ausgerichtet oder mit ungerichteten Multilineage-Differenzierungstests in Embryoidkörpern (EBs) oder Teratomen verifiziert (International Stem Cell, 2018). Markergene können dann hinsichtlich ihrer Genexpression oder auf Proteinebene ausgewertet werden (Gifford et al., 2013; O'Shea et al., 2020). Das sogenannte „ScoreCard-Panel“, das auf quantitativen Reverse-Transkriptions-PCR-Messungen (RT-qPCR) von 96 Genen basiert, kann zur Bestimmung der frühen keimschichtspezifischen Differenzierung verwendet werden (Bock et al., 2011 ; Tsankov et al., 2015). Pluripotenz kann auch auf der Grundlage von Genexpressionsprofilen durch den sogenannten „PluriTest™“, d.h. eine bioinformatische Analyse von Transkriptomen undifferenzierter Zellen, vorhergesagt werden (Muller et al., 2011 ). Sie spiegelt die transkriptomischen Merkmale von PSCs wider, sagt aber nichts über die Fähigkeit zur Differenzierung in bestimmte Keimschichten aus (Bouma et al., 2017).
DNA-Methylierung (DNAm) spielt eine wichtige Rolle bei der zellulären Differenzierung und manifestiert sich während der Embryonalentwicklung (Bock et al., 2011 ). Sie tritt insbesondere an Cytosin-Guanin-Dinukleotiden (CpG- Stellen) auf, wobei diese epigenetischen Modifikationen zelltypspezifisch sein können (Roadmap Epigenomics et al., 2015). Da jede Zelle zwei DNA-Kopien besitzt, eignet sich DNAm gut für die Anwendung von Entfaltungsalgorithmen zur Schätzung der Zusammensetzung verschiedener Zelltypen. Dieser Ansatz wurde bereits für den sogenannten „Epi-Pluri-Score“ genutzt, eine Signatur, mit der pluripotente und nicht-pluripotente Zellen anhand von DNAm- Veränderungen an drei spezifischen CpG-Stellen unterschieden werden können (Lenz et al., 2015). Allerdings wurde diese Signatur nur aufgrund von somatischen Zellen und reprogram mierten iPSC ausgewählt und kann somit keine frühen Differenzierungsveränderungen und keimblatt-spezifischen Veränderungen nachweisen.
Das Differenzierungspotenzial in verschiedenste Zelltypen gilt als essenzielles Qualitätsmerkmal von iPSCs und wird häufig mit aufwendigen und ethisch fragwürdigen Teratom-Assays im Mausmodell überprüft. Immunphänotypische und auf Genexpression basierende Verfahren lassen sich hingegen schwer quantifizieren und standardisieren. Ein quantitativer, robuster und skalierbarer Test, mit dem die Keimschicht-assoziierten Zellfraktionen in der frühen Differenzierung abgeschätzt werden können, ist noch nicht verfügbar. Aktuelle Methoden zum Nachweis der Pluripotenz von humanen induzierten pluripotenten Stammzellen sind häufig nicht standardisierbar, zeitintensiv, und/oder mit relativ hohen Kosten verbunden. Für die pharmazeutische Industrie, die iPSCs für die Herstellung therapeutischer Produkte verwendet oder als Zelltherapeutikum in klinischen Studien testen lässt, ist eine robuste und schnelle Qualitätskontrolle des Ausgangsmatenals unabdingbar. Zurzeit können diese Kriterien jedoch von keinem kommerziellen Verfahren in vollem Umfang erfüllt werden.
Beschreibung der Erfindung
Es ist Aufgabe der Erfindung, ein verbessertes Verfahren bereitzustellen, das eine standardisierbare, skalierbare, robuste und schnelle Qualitätskontrolle von Stammzellen ermöglicht.
Erfindungsgemäß wird die Aufgabe durch ein Verfahren der eingangs genannten Art gelöst, das die folgenden Schritte umfasst:
- Isolieren mindestens eines Nukleinsäuremoleküls der Stammzelle;
- Bestimmen des jeweiligen Methylierungsgrads von mindestens einer spezifischen Region des Nukleinsäuremoleküls, wobei die spezifische Region mindestens ein CpG-Dinukleotid umfasst;
- Ermitteln mindestens eines Kontrollwerts aus dem bestimmten Methylierungsgrad; und
- Vergleichen des Kontrollwerts mit mindestens einem Referenzwert, wobei das Ergebnis des Vergleichs die spezifische Eigenschaft der Stammzelle unmittelbar anzeigt.
Im Unterschied zu den bekannten bzw. kommerziell-erhältlichen Verfahren, beruht die erfindungsgemäße Lösung auf der epigenetischen Analyse genomischer DNA. DNA-Methylierung (DNAm) weist im Vergleich zur Genexpression eine wesentlich geringere Variabilität auf, wodurch sich die erhaltenen Ergebnisse gut standardisieren und vergleichen lassen. Das vorteilhafte erfindungsgemäße Verfahren basiert also auf epigenetischen Eigenschaften der DNA und ist somit auch retrospektiv für bereits isolierte Proben geeignet. Da DNA relativ stabil ist, können die Proben für die Untersuchungen problemlos bei Raumtemperatur versendet und im Hoch-Durchsatzverfahren gemessen werden. Zudem besteht neben der qualitativen Pluripotenzanalyse auch die Möglichkeit, dass das erfindungsgemäße Verfahren einem Anwender ermöglicht, das Differenzierungspotential der Zellen abzuschätzen. Dies ist insbesondere für die Entwicklung von optimierten industriell-verwendbaren iPS- Zelllinien von besonderem Interesse. In Verbindung mit der Differenzierung der iPSCs liefert das erfindungsgemäße Verfahren dem Anwender zusätzlich Informationen über die Differenzierbarkeit der analysierten Stammzellen in die drei Keimblätter, was als wesentliches Qualitätsmerkmal für pluripotente Stammzellen gilt. Diese Informationen können mittels Pyroseqenzierung, oder vergleichbaren Methoden für die gezielte DNA-Methylierungsmessung, bereits nach wenigen Tagen Kultivierung verlässlich generiert werden. Im Gegensatz zu Teratom-Assays sind dazu vorteilhafterweise keine Tierversuche notwendig.
Im Gegensatz zu den bereits bekannten epigenetischen Signaturen (z.B. „Epi- Pluri-Score“), die durch den Vergleich von pluripotenten Zellen mit somatischen Zellen etabliert wurden, sind die erfindungsgemäßen Signaturen anhand von frühen Differenzierungsstadien während der Entwicklung in Endo-, Meso- und Ektoderm ausgewählt worden. Zusätzlich zu den eigens generierten Datensätzen, wurden öffentlich zugängliche Methylierungsdaten von iPSCs, embryonalen Stammzellen (ESCs) und terminal differenzierten Zellen verwendet, um spezifische CG-Dinukleotide (CpG-Sites) zu identifizieren, an denen während der Differenzierungsprozesse in die jeweiligen Keimblätter spezifische Veränderungen in der DNA-Methylierung auftraten. Den vier Kategorien pluripotente Stammzellen (PSCs), Endoderm (ENDO), Mesoderm (MESO) und Ectoderm (ECTO) konnten jeweils drei spezifische CpGs zugeordnet werden, die deutliche Unterschiede in den DNAm-Graden (Grade der DNA-Methylierung), im Vergleich zu iPSC Referenzwerten, aufweisen. Da die epigenetischen Signaturen von Endoderm und Mesoderm zu Beginn der Entwicklung nur schwer zu trennen sind, wurde zusätzlich die Kategorie Endomesoderm (ENDOMESO) eingeführt. Für die Wahl der CpG-Sites für PSCs wurden Methylierungswerte von differenzierten und undifferenzierten Zellen von drei eigens reprogrammierten iPSC-Klonen verwendet und die Unterschiede in der DNA-Methylierung analysiert.
Das erfindungsgemäße Verfahren basiert also auf der Methylierung von mindestens einem CpG-Dinukleotid, das frühzeitige und charakteristische Änderungen im Rahmen der Differenzierung in Endoderm, Mesoderm und Ektoderm aufweist. Dabei ermöglicht das erfindungsgemäße Verfahren sowohl (1 ) die Bestimmung eines ersten Kontrollwerts, der auf dem Methylierungsgrad (DNAm-Grad) von mindestens einem CpG, vorzugsweise mindestens zwei oder drei CpGs, basiert und eine zuverlässig Unterscheidung zwischen pluripotenten und somatischen Zellen ermöglicht („Pluripotenz-Score“), als auch (2) die Bestimmung eines zweiten Kontrollwerts, der auf dem Methylierungsgrad (DNAm-Grad) von jeweils mindestens einem CpG, vorzugsweise jeweils mindestens drei CpGs, pro Keimblatt basiert und eine zuverlässige Validierung der Differenzierung in jedes der drei Keimblätter ermöglicht („Differenzierungs- Score“). Das erfindungsgemäße Verfahren kann somit in vorteilhafter Weise beispielsweise zur Qualitätskontrolle für die Pluripotenz von (humanen) induzierten pluripotenten Stammzellen durch die Analyse der Methylierung an drei spezifischen CG-Dinukleotiden eingesetzt werden. Das erfindungsgemäße Verfahren kann grundsätzlich aber auch auf embryonale Stammzellen angewandt werden. Darüber hinaus kann die Differenzierbarkeit von Stammzellen in die drei Keimblätter (Endo-, Meso- und Ektoderm) bereits in frühen Phasen einer Differenzierung abgeschätzt werden. Die erfindungsgemäße Lösung ermöglicht somit beispielsweise sowohl eine Validierung der Pluripotenz von reprogrammierten Zellen als auch die Validierung der Differenzierung bzw. Differenzierbarkeit in alle drei Linien und der Zusammensetzung der Keimblätter in frühen Zellaggregaten, insbesondere sogenannten Embryoid Bodies (EBs). Das erfindungsgemäße Verfahren kann folglich zur effizienten, zuverlässigen, sensitiven, standardisierbaren, skalierbaren, robusten und schnellen qualitativen Kontrolle von pluripotenten Stammzellen und daraus abgeleiteten Zellprodukten verwendet werden, um Kosten in Forschung und Entwicklung sowie industrieller Herstellung zu senken und den technologischen Fortschritt zu beschleunigen. Das erfindungsgemäße Verfahren wurde bisher erfolgreich an öffentlichen Datensätzen sowie an einer Auswahl eigener Zellpräparate getestet.
In vorteilhafter Ausgestaltung der Erfindung ist vorgesehen, dass die spezifische Eigenschaft das pluripotente Differenzierungspotenzial der Stammzelle umfasst. Zur qualitativen Kontrolle dieser spezifischen Eigenschaft kann der Kontrollwert beispielsweise aus der Summe mehrerer bestimmter Methylierungsgrade ermittelt werden. In weiterer vorteilhafter Ausgestaltung der Erfindung ist bei dieser Ausführungsform vorgesehen, dass das CpG-Dinukleotid ausgewählt ist aus der Gruppe bestehend aus den CpG-Dinukleotiden cg00661673, cg00933813 und cg21699252. Die Bestimmung der Methylierung eines oder mehrerer dieser CpGs ermöglicht in vorteilhafter Weise eine zuverlässige Unterscheidung zwischen pluripotenten und somatischen Zellen und somit die qualitative Kontrolle des pluripotenten Differenzierungspotenzials einer Stammzelle („Pluripotenz-Score“).
In vorteilhafter Ausgestaltung der Erfindung ist ferner vorgesehen, dass die spezifische Eigenschaft die keimblatt-spezifische Differenzierung der Stammzelle umfasst. Zur qualitativen Kontrolle dieser spezifischen Eigenschaft kann der Kontrollwert beispielsweise aus der Summe der bestimmten Methylierungsgrade abzüglich der entsprechenden gemittelten Methylierungsgrade undifferenzierter Stammzellen ermittelt werden, wobei die Werte der bestimmten Methylierungsgrade im Fall von hypomethylierten CpG- Dinukleotiden invers berücksichtigt werden.
In weiterer vorteilhafter Ausgestaltung der Erfindung ist bei dieser Ausführungsform vorgesehen, dass das CpG-Dinukleotid zur Bestimmung der Differenzierung in Richtung der unterschiedlichen Keimblätter jeweils zumindest eines der folgenden CpG-Dinukleotide umfasst:
- Endoderm: cg20548013, cg14521421 und cg08913523;
- Mesoderm: cg14708360, cg08826152 und cg11599718;
- Ektoderm: cg01907071 , cg18118164 und cg13075942;
- Endoderm/Mesoderm: cg23385847, cg24919344 und cg11147278.
Die Bestimmung der Methylierung jeweils eines oder mehrerer dieser CpGs pro Keimblatt ermöglicht in vorteilhafter Weise eine zuverlässige Validierung der Differenzierung einer Stammzelle in jedes der drei Keimblätter und somit die qualitative Kontrolle der Differenzierbarkeit von Stammzellen in die drei Keimblätter (Endo-, Meso- und Ektoderm) bereits in frühen Phasen einer Differenzierung („Differenzierungs-Score“). In vorteilhafter Ausgestaltung der Erfindung ist auch vorgesehen, dass die Stammzellen pluripotente Stammzellen (PSCs), induzierte pluripotente Stammzellen (iPSCs), embryonale Stammzellen (ESCs) und/oder direkt reprogram mierte Zellen, die durch direkte Konversion in andere Zelltypen abgeleitet wurden, sind.
Die Aufgabe wird ferner durch die Verwendung mindestens eines Nukleinsäuremoleküls, welches zumindest eines der CpG-Dinukleotide cg00661673, cg00933813 und cg21699252 umfasst, zur Bestimmung des pluripotenten Differenzierungspotenzials mindestens einer Stammzelle gelöst.
Die Aufgabe wird darüber hinaus auch durch die Verwendung mindestens eines Nukleinsäuremoleküls, welches zumindest ein CpG-Dinukleotid umfasst, zur Bestimmung der keimblatt-spezifischen Differenzierung mindestens einer Stammzelle gelöst, wobei das CpG-Dinukleotid zur Bestimmung der Differenzierung in Richtung eines der unterschiedlichen Keimblätter aus einer der folgenden Gruppen ausgewählt ist:
- Endoderm: cg20548013, cg14521421 und cg08913523;
- Mesoderm: cg14708360, cg08826152 und cg11599718;
- Ektoderm: cg01907071 , cg18118164 und cg13075942;
- Endoderm/Mesoderm: cg23385847, cg24919344 und cg11147278.
Die Identifizierungsnummer “cg...” bezieht sich im Sinne der Erfindung auf die Position des jeweiligen CpG-Dinukleotids auf dem „Illumina HumanMethylation450 BeadChip“ bzw. dem „Illumina EPIC BeadChip“.
Die Analyse der DNA-Methylierung (DNAm) kann beispielsweise mittels Pyrosequenzierung oder MassArray kostengünstig und im Hoch- Durchsatzverfahren für die spezifischen Regionen (z.B. DNA-Bereiche) erfolgen. Alternativ sind auch weitergehende Untersuchungstechniken wie Sequenzierungs- und Microarray-basierte Verfahren möglich.
Die Erfindung betrifft ferner beispielsweise ein Kit mit einer Zusammenstellung geeigneter Referenz-DNAs, Primer Sets, sowie optional Anleitungen und Auswertesoftware. Die Aufgabe wird also auch durch Kit gelöst, insbesondere ein Kit zur Bestimmung des pluripotenten Differenzierungspotenzials mindestens einer Stammzelle und/oder zur Bestimmung der keimblatt-spezifischen Differenzierung mindestens einer Stammzelle, vorzugsweise zur Durchführung der erfindungsgemäßen Verfahren, das mindestens einen Oligonukleotid-Primer (vorzugsweise Oligonukleotid-Primer-Paar, z.B. ein „Primer Set“, siehe unten Tabellen S3 und S4) zur Amplifizierung und/oder Sequenzierung zumindest von mindestens einem CpG-Dinukleotid mindestens einer Nukleotid-Sequenz, die mindestens eine spezifische Region im Sinne der Erfindung umfasst, und mindestens eine Referenz-Nukleinsäure umfasst. Das erfindungsgemäße Kit kann beispielsweise mindestens ein erfindungsgemäßes künstliches Nukleinsäure-Molekül und optional mindestens eine Pufferlösung und/oder mindestens ein Reagenz zur Durchführung mindestens eines Verfahrens, das aus der Gruppe bestehend aus DNA-Amplifikation, Bisulfit-Behandlung von DNA, DNA-Sequenzierung, vorzugsweise Pyrosequenzierung von DNA, MassArray- Analyse, „Deep Sequencing“ von Bisulfit-convertierter DNA, Durchflusszytometrie basierte Bead-assays und SNP-Genotypisierung ausgewählt ist, umfassen.
Das erfindungsgemäße Verfahren ermöglicht das Abdecken der folgenden Parameter für die Qualitätskontrolle von iPSCs:
1 ) Die Validierung der Reprogrammierung von somatischen Zellen in pluripotente Stammzellen,
2) eine Abschätzung der Differenzierungskapazität von Stammzellen,
3) die Detektion von ungewollten differenzierten Zellen, während die iPSCs unter pluripotenten Kulturbedingungen kultiviert werden, und
4) der Nachweis der Differenzierungsprozesse in Endoderm, Mesoderm und Ektoderm.
Die Erfindung wird im Weiteren anhand der Abbildungen bzw. Figuren, Tabellen und Beispiele beispielhaft näher erläutert.
Kurze Beschreibung der Abbildungen Abbildung 1 : Keimschicht-spezifische DNA-Methylierung während der 2D- iPSC-Differenzierung.
(A) Multidimensionale Skalierung (MDS) der Top 10.000 variabelsten CpGs aus eigenen (Datensatz 1 ) und öffentlichen DNAm-Profilen (Datensatz 2) (Daily et al., 2017). Grau dargestellt sind PSC-Linien aus Datensatz 2 ohne entsprechende differenzierte Proben. Die Namen von drei PSC-Ausreißerproben sind abgebildet.
(B) Streudiagramme der mittleren Beta-Werte (DNAm-Grade) an einzelnen CpG- Stellen für paarweise Vergleiche. Hervorgehoben sind CpGs mit einer mittleren Differenz von > 0,2 in den Beta-Werten und farbig, wenn ihre angepassten p- Werte < 0,05 sind.
(C) Ein direkter Vergleich der DNAm-Profile von Endoderm und Mesoderm zeigt, dass es nur geringe Unterschiede zwischen diesen differenzierten Zelltypen in Datensatz 2 gibt.
(D) Hauptkomponentenanalyse (PCA) der RNA-seq-Profile von Proben aus eigenen (Datensatz 1 ) und öffentlichen Daten (Datensatz 2) (Daily et al., 2017). Die Namen von drei PSC-Ausreißerproben sind abgebildet.
(E) Genexpression der kanonischen Keimschicht-Markergene (zehn für jede Linie) in Proben aus eigenen (Datensatz 1 ) und öffentlichen Datensätzen (Datensatz 2). Die Heatmap zeigt den Z-Wert („Z-Score“) der vst-transformierten Lesezahlen.
Abbildung 2: Ableitung eines neuen Pluripotenz-Scores auf der Grundlage der DNAm von drei CpGs.
(A) Die DNAm-Profile von pluripotenten Stammzellen (PSC) wurden mit allen anderen differenzierten Zelltypen (Endoderm, Mesoderm und Ektoderm) verglichen, um drei CpG-Kandidaten zu identifizieren. Die Differenz der mittleren Beta-Werte (DNAm-Grade) wird gegen die kombinierte Varianz innerhalb der Gruppen aufgetragen. Die Parabel ist Teil des Auswahlprozesses (mittlerer Parabelparameter beispielhaft dargestellt).
(B) DNAm-Grade der drei Kandidaten-CpGs und der Pluripotenz-Score der verbleibenden Proben aus Datensatz 2.
(C) DNAm-Grade an den drei Kandidaten-CpGs und der Pluripotenz-Score in verschiedenen iPSC-abgeleiteten Zelltypen (Datensatz 3; ergänzende Tabelle S1 ).
(D) DNAm-Grade an den drei Kandidaten-CpGs und der Pluripotenz-Score für eine Sammlung verschiedener somatischer Zelltypen (Datensatz 4; ergänzende Tabelle S1 )(Schmidt et al., 2020).
(E) DNAm-Grade an den drei Kandidaten-CpGs und der Pluripotenz-Score für iPSC-Proben (GSE59091 ) (Butcher et al., 2016), die in hohe Differenzierungskapazität (HDC) und niedrige Differenzierungskapazität (LDC) in Richtung Endoderm gruppiert wurden. Die primären Spenderproben (Fibroblasten und endotheliale Vorläufer) sind zum Vergleich dargestellt. Die P- Werte wurden mit dem Wilcoxon-Test berechnet (** p < 0,01 ).
Abbildung 3: Auswahl der keimschichtspezifischen CpG-Stellen.
(A) Auswahl der Kandidaten-CpGs für Endoderm (ENDO), Mesoderm (MESO), Ektoderm (ECTO) und Endomesoderm (ENDOMESO) im Auswahlsatz. Der mittlere Parabelparameter ist beispielhaft dargestellt und die ausgewählten Kandidaten-CpGs sind angegeben.
(B) Die Heatmap zeigt die Differenzierungs-Werte („Differenzierungs-Scores“) der CpG-Stellen für die verbleibenden Proben aus Datensatz 2. Die Werte („Scores“) sind die Summe der Differenzen der DNAm-Grade zu den Referenz- Stammzellen (für hypomethylierte CpGs wurde 1 - DNAm berechnet); weiß bedeutet keine Veränderung im Vergleich zu Stammzellen, rot bedeutet eine Veränderung in Richtung spezifischer Methylierung und blau umgekehrt.
(C) Ergebnisse der Dekonvulation (entweder mit ENDO und MESO in der oberen Reihe oder mit ENDOMESO in der unteren Reihe), basierend auf einem Ansatz der nicht-negativen kleinsten Quadrate.
(D) Differenzierungsscores für iPSC-abgeleitete Zellen, die in verschiedene Zelltypen differenziert wurden (Datensatz 3; ergänzende Tabelle S1 ; formatiert analog zu (B)).
(E) Ergebnisse der Dekonvulation für Datensatz 3 (Formatierung analog zu (C)).
Abbildung 4: Pluripotenz- und Differenzierungswerte in Embryoidkörpern.
(A) Pluripotenz-Score der EBs vor (Tag 0), nach 4 Tagen, nach 7 Tagen und nach 17 Tagen der Differenzierung.
(B) Differenzierungswerte für dieselben Proben zeigen, dass die meisten, aber nicht alle CpGs linienspezifische DNAm-Veränderungen aufweisen. Die Scores sind die Summe der Unterschiede der DNAm-Grade zu den Referenzstammzellen (für hypomethylierte CpGs wurde 1 - DNAm berechnet).
(C) Ergebnisse der Dekonvulation mit ENDO- und MESO-CpGs (in der oberen Reihe) oder mit ENDOMESO-CpGs (in der unteren Reihe).
(D) Differenzierungsergebnisse und Dekonvolutionsergebnisse für EBs nach 17 Tagen Kultur (Daily et al., 2017). Die Proben sind nach dem Anteil des Ektoderms in den Dekonvolutionsergebnissen geordnet.
(E) Die Heatmap zeigt die Z-Scores der Genexpressionssignaturen für Endoderm (279 Gene), Mesoderm (425 Gene) und Ektoderm (516 Gene) in den entsprechenden EBs. Diese Signaturen wurden aus einem öffentlichen Einzelzell-RNA-Sequenzierungsdatensatz für D8-EBs abgeleitet (Han et al., 2018). Insgesamt zeigten EBs mit ektodermaler Ausrichtung in unseren epigenetischen Scores auch eine höhere Expression ektodermaler Genexpression.
Abbildung 5: Gezielte Assays ausgewählter CpGs, gemessen mit Pyrosequenzierung.
(A) Mit Pyrosequenzierung gemessene Pluripotenz-Scores der Proben. Die Methylierungswerte der drei CpGs sind auch einzeln dargestellt. Hier werden iPSCs mit gerichteter Differenzierung in Richtung Endoderm (ENDO), Mesoderm (MESO) und Ektoderm (ECTO) sowie EBs vor, nach 5 Tagen und nach 15 Tagen spontaner Differenzierung in Suspensionskultur (DO, D5 bzw. D15) verwendet. Darüber hinaus wurden drei Knockout (KO)-iPSC-Linien verwendet (2 YAP /_ und PRDM8'/_).
(B) Differenzierungsscores für diese Proben, gemessen mit Pyrosequenzierung. Die Scores sind die Summe der Unterschiede der DNAm-Grade zu den Referenzstammzellen (für hypomethylierte CpGs wurde 1 - DNAm gerechnet). Die Ergebnisse der Dekonvolution mit ENDO und MESO oder den ENDOMESO- CpGs sind ebenfalls dargestellt.
(C) RT-qPCR-Ergebnisse der keimschichtspezifischen Gene. Die Heatmap zeigt die ddCT-Werte im Vergleich zu den Stammzellen. (D) ScoreCard-Ergebnisse. Dargestellt sind die kombinierten Genexpressions- Scores für jede Keimschicht im Vergleich zum Referenzstandard für ausgewählte iPSC-Linien.
Abbildung S1 : Dreistufige Differenzierung von pluripotenten Stammzellen (in Verbindung mit Abbildung 1)
(A) Trilineage-Differenzierungsprotokolle, die für eigene iPSCs (Datensatz 1 ; STEMdiff Trilineage Differentiation Kit; Stemcell Technologies) und im öffentlichen Datensatz (Datensatz 2; GSE85828) verwendet wurden (Daily et al., 2017).
(B) Immunfluoreszenzfärbung exemplarischer differenzierter Zellen (Protokolldatensatz 1 ), gefärbt mit Antikörpern gegen OCT4 (Stammzellen), GATA6 (Endoderm), Brachyury (Mesoderm) und PAX6 (Ektoderm). Zellkernfärbung mit DAPI.
Abbildung S2: Heatmap der am stärksten differenziell methylierten CpGs (bezogen auf Abbildung 1)
Dargestellt sind die 50 signifikantesten CpGs (sortiert nach der Differenz der mittleren Beta-Werte) aus den Vergleichen von Keimschichten und pluripotenten Stammzellen. Die Heatmap enthält überlappende CpGs insbesondere für ENDO und MESO in den öffentlichen Daten (GSE85828).
Abbildung S3: Überschneidung von Änderungen der DNA-Methylierung in verschiedenen Datensätzen (in Verbindung mit Abbildung 1)
(A) Venn-Diagramme zeigen die Anzahl der signifikanten hypo- und hypermethylierten CpGs, die sich während der Differenzierung in Richtung Endoderm (ENDO), Mesoderm (MESO) und Ektoderm (ECTO) überschneiden. Diese Analyse wurde für Datensatz 1 und Datensatz 2 parallel durchgeführt. Die Überlappung zwischen den Datensätzen ist in Klammern angegeben.
(B) Um die Beziehung zwischen den DNAm-Profilen der differenzierten Proben abzuschätzen, wurde ein paarweiser Vergleich der differentiell methylierten Sonden in den Datensätzen 1 und 2 durchgeführt (für hypo- und hypermethylierte Stellen, getrennt). Das Chancenverhältnis („Odds Ratio“) des Fisher-Exact-Tests gibt die Wahrscheinlichkeit an, die gemeinsamen differentiell methylierten CpGs zu erhalten, wenn man die Gesamtprobengröße (alle CpGs) berücksichtigt. Das hohe Chancenverhältnis zwischen ENDO und MESO aus Datensatz 2 deutet darauf hin, dass sich die Änderungen der DNA- Methylierung in diesen Proben stark überschneiden.
Abbildung S4: Unterschiedlich exprimierte Gene zwischen den Keimschichten (bezogen auf Abbildung 1)
(A) Venn-Diagramme zeigen die Anzahl der signifikanten Veränderungen der Genexpression während der Differenzierung in Endoderm, Mesoderm und Ektoderm. Diese Analyse wurde für Datensatz 1 und Datensatz 2 getrennt durchgeführt. Die Überschneidung zwischen den Datensätzen ist in Klammem angegeben.
(B) Integrative Analyse der Veränderungen von DNA-Methylierung und Genexpression. Es werden nur CpGs in Promotorregionen (TSS1500, TSS200) berücksichtigt. Jeder Punkt steht für ein Gen-CpG-Paar (sowohl Gene als auch CpGs können dupliziert sein). Farbige Punkte zeigen Paare mit einem signifikanten Unterschied in der DNAm und den Veränderungen der Genexpression während der Differenzierung.
C) Heatmap des paarweisen Chancenverhältnisses („Odds Ratio“) zwischen Genen mit unterschiedlicher Expression in den verschiedenen Differenzierungsmodalitäten (Fisher-Exact-Test). In Datensatz 2 überschneiden sich die Veränderungen der Genexpression während der endodermalen und mesodermalen Differenzierung erheblich.
Abbildung S5: Vergleich verschiedener Signaturen für Pluripotenz (in Verbindung mit Abbildung 2)
(A) Die PluriTest-Analyse wurde mit dem Online-Tool PluriTest (https://www.pluritest.org/) durchgeführt. RNA-seq FASTAQ-Dateien wurden zur Vorverarbeitung, zum Alignment und zur automatischen Analyse unter Verwendung des proprietären Algorithmus auf die Website hochgeladen. Die Ergebnisse zeigten, dass die meisten Stammzellen, Mesoderm- und Endoderm- Proben einen ähnlichen Pluripotenz-Score aufwiesen. PluriTest war nicht in der Lage, zwischen ihnen zu unterscheiden und die Vorhersagen stimmten nicht mit der pluripotenten Wolke der empirischen Dichtekarte überein. Darüber hinaus hatten zwei von drei iPSC-Linien aus Datensatz 1 und die Ausreißer-Zelllinie SC12-040 Scores, die als fehlgeschlagen angezeigt wurden.
(B) Die Epi-Pluri-Score-Analyse basiert auf DNAm an drei spezifischen CpGs. Eines dieser CpGs war innerhalb des Pluripotenz-assoziierten Gens POU5F1 (auch bekannt als OCT4) lokalisiert. Außerdem wurde der Unterschied in den DNAm-Graden der CpGs in ANKRD46 und C14orf115 bestimmt und als Epi- Pluri-Score zusammengefasst (Lenz et al., 2015). Die Punkte im Hintergrund beziehen sich auf DNAm-Profile (alle Illumina HumanMethylation27 BeadChip- Plattform) von 264 pluripotenten bzw. 1.951 nicht-pluripotenten Zellpräparationen (Lenz et al., 2015). Insbesondere Epi-Pluri-Score stufte alle Zellpräparate als pluripotent ein, während frühe Differenzierungsereignisse durch einen Anstieg der DNAm in POU5F1 verfolgt werden können. Für die drei iPSC-Proben, die zuvor als Ausreißer identifiziert wurden, sind die Proben-IDs erneut hervorgehoben (GSM2285159, Datensatz 2). Insbesondere die Probe SC12-040 wurde eindeutig als nicht-pluripotent eingestuft, und diese Probe fiel auch in den MDS- und PCA-Plots (Abbildung 1A, C) aus dem Rahmen und wies offenbar auch einen aberranten Karyotyp auf (Salomonis et al., 2016).
(C) Die DNA-Methylierungsgrade werden für die undifferenzierten und differenzierten Zellen des Auswahlsatzes für die drei CpGs angegeben, die für den Pluripotenz-Score ausgewählt wurden. Jedes der CpGs konnte pluripotente und nicht-pluripotente Zellen unterscheiden. Durch die Integration der drei Werte in den Pluripotenz-Score wurde der Unterschied zwischen PSC und differenzierten Zellen noch deutlicher.
Abbildung S6: Identifizierung von Gensignaturen für Keimschichten in EBs (in Verbindung mit Abbildung 4)
(A) Um Marker-Gene für die endodermale, mesodermale und ektodermale Differenzierung in der spontanen Differenzierung zu identifizieren, wurden Einzelzell-RNA-Sequenzierungsdaten von EBs am achten Tag der spontanen Differenzierung verwendet (Han et al., 2018). Die UMAP-Darstellung (Uniform Manifold Approximation and Projection) der Daten zeigte, dass die Zellen in drei verschiedene Cluster unterteilt werden konnten.
(B) Die UMAP-Darstellung der normalisierten Expressionsniveaus für Endoderm-Marker (GATA6, AFP), Mesoderm-Marker (HAND1 , SNAI1 ) und Ektoderm-Marker (PAX6, OTX2) zeigt, dass diese Cluster tatsächlich mit den jeweiligen Keimschichten assoziiert waren. Die gleichen Ergebnisse wurden auch bei der Gen-Ontologie-Analyse beobachtet (nicht dargestellt). Für jeden dieser Cluster wurden anschließend Gene ausgewählt, die signifikant stärker exprimiert werden als in den anderen Clustern: für das Endoderm 279 Gene, das Mesoderm 425 Gene und das Ektoderm 516 Gene (ergänzende Tabelle S2).
Abbildung S7: Pyrosequenzierungstests für erfindungsgemäße CpGs (bezogen auf Abbildung 5)
(A) Vergleich von DNAm-Graden, die mit Pyrosequenzierung und der Illumina EPIC BeadChip-Technologie gemessen wurden.
(B) Referenzwerte auf der Grundlage der Pyrosequenzierung für die Deconvolution der Keimschichten. Dargestellt sind die Mittelwerte der drei Zelllinien aus der gerichteten 2D-Differenzierung.
Beschreibung beispielhafter und vorteilhafter Ausführunqsformen der Erfindung
Die Erfindung betrifft unter anderem die Qualitätskontrolle von induzierten pluripotenten Stammzellen. Für die Validierung des pluripotenten Zustands ist es dabei von entscheidender Bedeutung, das Potenzial zur dreigliedrigen Differenzierung in Richtung Endoderm, Mesoderm und Ektoderm zu bestimmen. Zu diesem Zweck wird erfindungsgemäß eine Kombination aus ortsspezifischen DNA-Methylierungs-(DNAm)-Tests eingesetzt, die als Biomarker für die frühe Keimschichtspezifikation dienen. CG-Dinukleotide (CpGs) wurden mit charakteristischer DNAm im pluripotenten Zustand und nach der Differenzierung in Endoderm, Mesoderm und Ektoderm identifiziert. Auf dieser Grundlage wurde ein „Pluripotenz-Score“ abgeleitet, der auf die Differenzierungsfähigkeit hinweist, sowie linienspezifische „Differenzierungs-Scores“, um beispielsweise entweder eine gerichtete Differenzierung oder eine selbstorganisierte multilineare Differenzierung in Embryoidkörpern zu überwachen. Darüber hinaus wurden Pyrosequenzierungstests für eine schnelle und kostengünstige Analyse entwickelt. Das erfindungsgemäße Verfahren kann somit in vorteilhafter Weise für die Qualitätskontrolle pluripotenter Zellen und zur Abschätzung der linienspezifischen Bindung während der ersten Differenzierungsereignisse verwendet werden.
Es wurden daher charakteristische DNAm-Signaturen für jede der drei Keimschichten identifiziert, d.h. es wurden drei CpGs mit charakteristischer DNAm für undifferenzierte pluripotente Zellen, Endoderm, Mesoderm, Ektoderm und Endomesoderm auswählt. Auf dieser Grundlage wurde das erfindungsgemäße Verfahren entwickelt: ein Instrument, das aus einem „Pluripotenz-Score“, der auf das Differenzierungspotenzial hinweisen kann, und stammbaumspezifischen Signaturen besteht, um die Anteile früher Zellschicksalsentscheidungen in Differenzierungsversuchen abzuschätzen.
Veränderungen der DNA-Methylierung während der gerichteten Keimschichtspezifikation
Es wurden drei Linien von induzierten pluripotenten Stammzellen (iPSCs) in Richtung Endoderm, Mesoderm und Ektoderm differenziert, um ihre DNAm- Profile mit den Infinium-EPIC-BeadChips zu analysieren (ergänzende Abb. S1 ; Datensatz 1 ). Darüber hinaus wurden 114 DNAm-Profile von iPSCs und embryonalen Stammzellen (ESCs) verwendet, die mit unterschiedlichen Protokollen differenziert wurden (Datensatz 2; 450K BeadChip-Plattform, ergänzende Tabelle S1 ) (Daily et al., 2017). Die multidimensionale Skalierung (MDS) zeigte, dass iPSCs, die sich in Richtung Ektoderm ausdifferenziert hatten, sich in Clustern separierten, während Zellen, die sich in Richtung Endoderm und Mesoderm ausdifferenziert hatten, scheinbar enger verbunden waren (Abb. 1A). Die linienspezifischen DNAm-Veränderungen wurden zunächst für beide Datensätze getrennt analysiert (für Datensatz 2 nur PSCs mit entsprechenden Daten für die Keimschichtdifferenzierung) (Daily et al., 2017). Viele CpGs zeigten eine signifikante Hyper- oder Hypomethylierung während der Differenzierung in Richtung Endoderm, Mesoderm oder Ektoderm (Abb. 1 B, DNAm-Differenz > 20 %, angepasste p-Werte < 0,05; ergänzende Abb. S2). Bemerkenswert ist, dass Datensatz 2 eine sehr hohe Überlappung von DNAm-Veränderungen in Richtung Mesoderm und Endoderm zeigte (ergänzende Abb. S3). Ein direkter Vergleich der DNAm-Profile von Endoderm und Mesoderm bestätigte, dass ihre epigenetischen Veränderungen in Datensatz 2 sehr ähnlich waren (Abb. 1 C). Entsprechende RNA-Sequenzierungsdaten ergaben insgesamt konsistente Veränderungen der Genexpression während der Differenzierung der drei Entwicklungsstadien (Abb. 1 D). Viele Gene werden während der Differenzierung zum Endoderm, Mesoderm und Ektoderm signifikant hoch- oder herunterreguliert (> 2-fach; angepasster p-Wert < 0,05; ergänzende Abb. S4A). In der Tendenz zeigten Gene mit Hypomethylierung in Promotorregionen eine hochregulierte Genexpression und umgekehrt (ergänzende Abb. S4B). In Analogie zu den DNAm-Daten gab es in Datensatz 2 eine starke Überlappung der differentiellen Genexpression während der Differenzierung zum Endoderm und Mesoderm (ergänzende Abb. S4C). Kanonische Marker für die mesodermale Differenzierung waren in Datensatz 1 besonders hochreguliert (Abb. 1 E). Diese Ergebnisse zeigen, dass je nach Differenzierungsschema die Unterschiede zwischen Endoderm und Mesoderm nur marginal sind, was bei der Identifizierung keimschichtspezifischer Signaturen berücksichtigt werden muss.
Entwicklung einer epigenetischen Signatur für den pluripotenten Zustand
Die etablierten Qualitätskontrollmaßnahmen für pluripotente Zellen sollten in der Lage sein, frühe Differenzierungsereignisse zu erkennen. Die zuvor beschriebenen Verfahren PluriTest (Muller et al., 2011 ) und Epi-Pluri-Score (Lenz et al., 2015) wurden jedoch speziell zur Unterscheidung von pluripotenten und somatischen Zelltypen entwickelt, während unklar blieb, ob diese Tests auch die transkriptomischen/epigenetischen Veränderungen während der frühen Differenzierung zu den drei Keimblättern zuverlässig erfassen würden. Daher wurde die PluriTest-Analyse auf die RNA-seq-Profile der Datensätze 1 und 2 angewendet (ergänzende Abb. S5A). Bemerkenswert ist, dass die PluriTest- Ergebnisse aller Proben - sogar der pluripotenten iPSC und ESCs - nicht mit den pluripotenten Proben der Referenzkohorte übereinstimmten, was darauf zurückzuführen sein könnte, dass der Test ursprünglich für eine Microarray- Plattform entwickelt wurde, die inzwischen nicht mehr verwendet wird. Darüber hinaus wiesen die differenzierten Endoderm- und Mesoderm-Zellen ähnliche PluriTest-Ergebnisse auf wie die nicht differenzierten pluripotenten Zellen. Analog dazu stufte Epi-Pluri-Score die DNAm-Profile aller Proben als pluripotent ein, selbst derjenigen, die für einige Tage in Richtung Endoderm, Mesoderm und Ektoderm differenziert waren (ergänzende Abb. S5B). Zusammengenommen konnten PluriTest und Epi-Pluri-Score frühe Differenzierungsereignisse nicht zuverlässig erfassen.
Für die Entwicklung des erfindungsgemäßen Verfahrens wurde daher ein neuer Pluripotenz-Score erstellt, der auf den frühen DNAm-Veränderungen während der Differenzierung zum Endoderm, Mesoderm und Ektoderm basiert. Relevante CpGs wurden mit dem R-Paket CimpleG (Manuskript in Vorbereitung) nach hohen Unterschieden in der mittleren Methylierung und geringer Varianz innerhalb der Gruppen ausgewählt (Schmidt et al., 2020). Als Auswahlset wurden die undifferenzierten und differenzierten Proben der drei iPSC-Linien aus unserem Datensatz 1 und drei zufällig ausgewählte PSC-Linien aus Datensatz 2 verwendet, um ein Gleichgewicht zwischen den Studien zu erreichen (Abb. 2A). Die drei wichtigsten Kandidaten-CpGs waren: cg00661673, assoziiert mit dem Gen Palladin (PALLD)', cg00933813, nicht assoziiert mit einem spezifischen Gen; und cg21699252, assoziiert mit MYCN Opposite Strand (MYCNOS). Die DNAm- Grade an diesen Stellen wurden zu einem Pluripotenz-Score kombiniert (Summe der DNAm-Grade und 1 - DNAm-Grad für die hypomethylierten Stellen), mit dem PSC und differenzierte Zellen im Auswahlsatz klar unterschieden werden konnten (ergänzende Abb. S5C). Ähnliche Ergebnisse wurden beobachtet, als die verbliebenen Proben des Datensatzes 2 für die erste Validierung verwendet wurden. Bemerkenswerterweise konnte der Pluripotenz-Score auch drei Proben unterscheiden, die bei der Analyse der Genexpressions- und DNAm-Profile Abweichungen zeigten (Abb. 2B). Darüber hinaus konnte der Pluripotenz-Score PSCs und früh differenzierte Zellen in einer völlig unabhängigen Sammlung pluripotenter und iPSC-abgeleiteter Zelltypen korrekt unterscheiden (Datensatz 3; ergänzende Tabelle S1 ; Abb. 2C). Als Nächstes wurden somatische Zellen untersucht und es stellte sich heraus, dass der Pluripotenz-Score bei primären Zelltypen durchweg sehr niedrig war (549 DNAm-Profile, zusammengestellt aus 21 Studien (Schmidt et al., 2020); Datensatz 4; Abb. 2D). Schließlich wurde der erfindungsgemäße Pluripotenz-Score mit DNAm-Profilen von PSCs verglichen, die die Kriterien für Pluripotenz erfüllten, aber entweder eine höhere Differenzierungskapazität (HDC) oder eine geringere Differenzierungskapazität in Richtung Endoderm (LDC; GSE59091 , Datensatz 5) aufwiesen (Butcher et al., 2016). Bemerkenswerterweise war der Pluripotenz-Score bei HDC signifikant höher als bei LDC pluripotenten Zellen (p-value = 0,009; Abb. 2E), was darauf hindeutet, dass die Signatur nicht nur frühe Differenzierungsschritte erkennt, sondern auch ein Qualitätsmaß für das pluripotente Differenzierungspotenzial darstellen könnte.
Auswahl von keimschichtspezifischen CpG-Stellen
Da der erfindungsgemäße Biomarker auch die spezifische Differenzierung in Richtung Endoderm, Mesoderm oder Ektoderm widerspiegeln sollte, wurden auch Kandidaten-CpGs für jede Keimschicht ausgewählt. Zu diesem Zweck wurde der gleiche Auswahlsatz wie für den Pluripotenz-Score verwendet und für jeden differenzierten Zelltyp die gleiche Auswahlmethode angewendet (Abb. 3A). Auf dieser Grundlage wurden die drei wichtigsten CpGs für das Endoderm (ENDO) ausgewählt: cg20548013, assoziiert mit Phosphatase und Aktinregulator
1 (PHACTR1)', cg14521421 , assoziiert mit DENN domain containing 2B (DENND2B); und cg08913523 (kein Gen); für Mesoderm (MESO) die CpGs cg14708360 (kein Gen); cg08826152, assoziiert mit Adenosinrezeptor A2B (ADORA2B); und cg11599718, assoziiert mit vacuolar protein sorting-associated protein 37B (VPS37B): für Ektoderm (ECTO) die CpGs cg01907071 , assoziiert mit dem Gen thrombospondin type 1 domain containing 4 (THSD4)', cg18118164, assoziiert mit Ephrin A5 (EFNA5)', und cg13075942, assoziiert mit RAD51 Paralog B (RAD51B). Da Endoderm und Mesoderm insbesondere in Datensatz
2 eng miteinander verwandt waren, wurden auch Kandidaten-CpGs für eine Kombination aus Endoderm und Mesoderm (ENDOMESO) ausgewählt: cg23385847, assoziiert mit dem Gen Calcium/Calmodulin-abhängige Proteinkinase IV (CAMK4)', cg24919344 (kein Gen); und cg11147278 (kein Gen).
Diese CpG-Kandidaten wurden anschließend in den übrigen Proben des Datensatzes 2 validiert. Da die CpGs eine zelltypspezifische Hypo- oder Hypermethylierung aufweisen, wurden die komplementären DNAm-Grade (1 - DNAm) für hypomethylierte Stellen verwendet, um Differenzierungswerte zu ermitteln, die mit der Differenzierung zunehmen. Diese Werte wurden als Differenz zum mittleren DNAm-Grad der undifferenzierten Proben berechnet (Abb. 3B). Alternativ wurde der Anteil der stammbaumspezifischen Differenzierung in der Zellpopulation durch Dekonvolution mit einem Ansatz der nicht-negativen kleinsten Quadrate (NNLS) geschätzt - was jedoch durch die Tatsache erschwert wird, dass nach einer frühen Keimschichtspezifikation und nicht nach einem definierten Endpunkt der Differenzierung gesucht wird, sowie durch die Diskrepanz der Ergebnisse zwischen verschiedenen Keimschichtdifferenzierungsprotokollen. Wie auch immer, der Dekonvulationsansatz klassifizierte die meisten Proben korrekt in die Kategorien PSC, ENDO, MESO, ECTO und ENDOMESO (Abb. 3C). Die drei Ausreißer- PSC-Proben konnten wiederum durch höhere Differenzierungswerte unterschieden werden. Darüber hinaus klassifizierten die individuellen DNAm- Grade sowie der Dekonvulationsansatz die meisten aus iPSC gewonnenen Zellen, die in verschiedene Zelltypen differenziert wurden, korrekt (Datensatz 3; Abb. 3D, E).
DNA-Methylierungsveränderungen in Embryoidkörpern
Um festzustellen, ob das erfindungsgemäße Verfahren auch die keimschichtspezifischen epigenetischen Veränderungen während der spontanen Differenzierung erfassen würde, wurden EBs erzeugt und DNAm-Profile vor (Tag 0), an Tag 4 und an Tag 7 nach der Aggregation analysiert (EB-Datensatz 1 ; ergänzende Tabelle S1 ). Wie erwartet, verändern sich die drei CpGs, die für den undifferenzierten Zustand spezifisch sind, bereits innerhalb von 4 Tagen nach der ungerichteten EB-Differenzierung, was sich in einem schnellen Rückgang des Pluripotenz-Scores widerspiegelt (Abb. 4A), was wiederum darauf hindeutet, dass die meisten Zellen den pluripotenten Zustand verlassen haben. Außerdem wiesen die Differenzierungs-Scores (Abb. 4B) auf eine Differenzierung in den drei Keimschichten hin. Die ENDOMESO-assoziierte CpG-Stelle cg2338547 wies in diesem Datensatz jedoch nicht die erwartete Hypermethylierung auf, was zu einer Diskrepanz in den Vorhersagen der Dekonvolution führte (Abb. 4C).
Außerdem wurden öffentliche DNAm-Profile von EBs an Tag 17 verwendet (EB- Datensatz 2; ergänzende Tabelle S1 ) (Daily et al., 2017). Die Differenzierungs- Scores und Dekonvolutionsergebnisse zeigten erneut eine Verstärkung der linienspezifischen epigenetischen Muster. Die starken Veränderungen in den MESO-CpGs dominierten die Dekonvolutionsergebnisse. Insbesondere zeigten die Ergebnisse, dass sich einige der EBs mehr in Richtung ektodermaler oder endodermaler Abstammung differenzierten (Abb. 4D). Dieser Befund könnte die unterschiedliche Tendenz der einzelnen iPSC-Linien widerspiegeln, sich bevorzugt in die eine oder andere Zelllinie zu differenzieren. Es wurden dann die verfügbaren Genexpressionsdaten der EBs vom 17. Tag verwendet (Daily et al., 2017), um festzustellen, ob sich die linienspezifische Tendenz auch im Transkriptom widerspiegelt. Zu diesem Zweck wurden zunächst Gensignaturen identifiziert, die für die verschiedenen Keimblätter während der spontanen Differenzierung charakteristisch sind. Öffentliche Einzelzell-RNA-Sequenzierungsdaten, die von EBs am achten Tag stammen, wurden entsprechend den Keimschichten geclustert (ergänzende Abb. S6) (Han et al., 2018). Auf dieser Grundlage wurden Genlisten ausgewählt, die am deutlichsten mit dem Endoderm, Mesoderm und ektodermalen Cluster assoziiert sind (ergänzende Tabelle S2). Tatsächlich wurden die ektodermalen Signaturen in EBs, für die das erfindungsgemäße Verfahren ebenfalls eine ektodermale Ausrichtung vorhersagte, insgesamt stärker exprimiert (Abb. 4E).
Gezielte Assays mit Pyrosequenzierung
Anschließend wurden Pyrosequenzierungs-Assays für die gezielte Analyse der relevanten CpGs entwickelt, um das erfindungsgemäße Verfahren ohne Illumina BeadChip-Analyse anwenden zu können. Als die Proben aus der gerichteten Differenzierung erneut analysierten wurden, zeigten die DNAm-Grade nur geringe Abweichungen zwischen den Pyrosequenzierungs- und EPIC- BeadChip-Messungen (ergänzende Abb. S7A). In jedem Fall wurden die Pyrosequenzierungsergebnisse verwendet, um die Referenzmatrix für die Dekonvulation anzupassen (ergänzende Abb. S7B). Um diesen Test weiter zu überprüfen, wurden erneut EBs erzeugt und für 5 oder 15 Tage kultiviert. Es wurden auch eigene iPSC-Linien mit PRDM8-Knockout (PRDM8’/_), die nachweislich eine geringere Neuronendifferenzierung aufweisen, verwendet (Cypris et al., 2020). Darüber hinaus wurden hauseigene iPSC-Linien mit YAP1 - Knockout (YAP /_ ) verwendet, die sich kaum in Richtung Ektoderm differenzierten (Zeevaert et al, Manuskript in Vorbereitung), wobei dieser Phänotyp kürzlich auch von anderen beschrieben wurde (Stronati et al., 2022). Die Pyrosequenzierungsmessungen für das erfindungsgemäße Verfahren konnten eindeutig nicht differenzierte pluripotente Zellen von entweder gerichteter Differenzierung oder EBs unterscheiden (Abb. 5A). Darüber hinaus zeigten die Differenzierungsergebnisse deutlich, dass die EBs von PRDM8 /_ und YAP /_ nicht die typische Ektoderm-assoziierte DNAm aufweisen. Die Dekonvolutionsergebnisse für diese Knockout-Linien zeigten dementsprechend geringere Anteile an Ektoderm (Abb. 5B). Um diese Ergebnisse weiter zu überprüfen, wurde ferner die Genexpression von Keimschicht-assoziierten Genen in diesen Proben mittels RT-qPCR analysiert: OCT4 für pluripotente Zellen, GATA6 für Endoderm, Brachyury für Mesoderm und PAX6 für Ektoderm (Abb. 5C). Darüber hinaus wurden ScoreCard-Tests für ausgewählte Proben durchgeführt (Abb. 5D). Insgesamt stimmten die Vorhersagen mittels des erfindungsgemäßen Verfahrens mit den Ergebnissen der RT-qPCR und der ScoreCard für die Knockout-Zelllinien überein.
Mögliche weitere Ausführungsformen der Erfindung
Qualitätsmessungen von iPSC-Linien können für verschiedene Ziele verwendet werden: 1 ) zur Überwachung der anfänglichen Reprogrammierung somatischer Zellen, 2) zur Bestimmung der Differenzierungsfähigkeit nicht-differenzierter Zellen und 3) zur Verfolgung der Differenzierung, um letztlich das pluripotente Differenzierungspotenzial zu validieren (Steeg et al., 2021 ).
Die anfängliche Überwachung der Reprogrammierung stützt sich häufig auf die mikroskopische Beurteilung der Koloniemorphologie oder die Hochregulierung einzelner Marker durch Immunfluoreszenz oder RT-qPCR, aber diese Ansätze sind schwer zu quantifizieren und es fehlen standardisierte Schwellenwerte. Eine umfassendere Genexpressionssignatur, wie PluriTest (Muller et al., 2011 ) kann ein robusteres Maß für eine erfolgreiche Reprogrammierung liefern. Als jedoch das Online-Tool PluriTest unter Verwendung des proprietären Algorithmus für die Vorverarbeitung von RNA-seq-Ergebnissen angewendet wurde, waren die nicht differenzierten iPSCs nicht eindeutig mit dem hervorgehobenen Bereich für Pluripotenz in der empirischen Dichtekarte assoziiert und frühe Differenzierungsereignisse wurden nicht zuverlässig erkannt. Unser zuvor beschriebener Epi-Pluri-Score kann eine gute Alternative zur Validierung der Reprogrammierung in den pluripotenten Zustand sein (Lenz et al., 2015). In der Tat konnte er SC12-040 eindeutig erkennen, von dem angenommen wurde, dass es einen problematischen Karyotyp hat und offensichtlich nicht einer normalen pluripotenten Zelllinie ähnelt. Bislang gab es jedoch keinen epigenetischen Biomarker, mit dem sich frühe keimschichtspezifische Entscheidungen über das Zellschicksal nachweisen ließen. Im Rahmen der Erfindung wird hier nun ein Verfahren beschrieben, das - im Gegensatz zu den oben genannten Ansätzen - speziell für die Erkennung früher Differenzierungsereignisse entwickelt wurde. Obwohl die Signatur nicht mit somatischen Zellen entwickelt wurde, konnte sie zuverlässig zwischen somatischen und pluripotenten Zellen unterscheiden. Bemerkenswert ist, dass der Pluripotenz-Score bei iPSCs mit hoher Differenzierungskapazität insgesamt höher war als bei Zellen mit geringer Differenzierungskapazität in Richtung Endoderm (Butcher et al., 2016), was darauf hindeutet, dass das erfindungsgemäße Verfahren auch zur Abschätzung der Differenzierungskapazität von nicht differenzierten iPSCs verwendet werden kann. Somit könnte das erfindungsgemäße Verfahren ein Indikator für das Differenzierungspotenzial von iPSCs sein, die sich bereits unter pluripotenten Kulturbedingungen befinden. In Zukunft wird es wichtig sein, weiter zu zeigen, dass diese Signaturen Aspekte des Differenzierungspotenzials zuverlässig erfassen und Schwellenwerte besser zu definieren.
Bislang ist für die Validierung des Potenzials zur Differenzierung in drei Abstammungslinien eine vorgelagerte Differenzierung mit gerichteter oder spontaner Differenzierung für die anschließende Analyse erforderlich. Der Teratomtest ist eine Methode zur Prüfung der Pluripotenz, bei der PSCs in eine immundefiziente Maus transplantiert werden, wo sie spontan Keimzelltumore mit immunphänotypischen Merkmalen aller Keimblätter bilden (International Stern Cell, 2018). Dieser Test wirft Bedenken hinsichtlich des Tierschutzes auf, die Analyse dauert mehrere Monate und ist kostspielig. Außerdem ist die Teratombildung sehr variabel und kann kaum quantifiziert werden (Dolgin, 2010; Muller et al., 2010; Tsankov et al., 2015). Der ScoreCard-Test basiert auf einem gerichteten oder spontanen Differenzierungsschema und verwendet eine relativ große Auswahl an Referenzgenen. In Analogie dazu könnte das erfindungsgemäße Verfahren frühe Abstammungsentscheidungen bei gerichteter Differenzierung verfolgen. Darüber hinaus könnte es dazu verwendet werden, die zelluläre Zusammensetzung in EBs abzuschätzen. Die vorhergesagten ektodermalen Fraktionen korrelierten mit den Genexpressionsprofilen und den Ergebnissen der Dekonvolution. Darüber hinaus konnten iPSC-Linien mit beeinträchtigter ektodermaler Differenzierung, wie PRDM8 /_ und YAP /_ , identifiziert werden. Die Handhabung und der Versand von DNA-Proben ist einfacher als der von RNA-Proben. Das erfindungsgemäße Verfahren basiert nur auf 12 CpGs (bei ENDOMESO 15 CpGs). Solche kleinen Signaturen sind ein Kompromiss, da sie anfälliger für individuelle Ausreißer sein können als Signaturen, die Hunderte von CpGs integrieren. Andererseits können solche zielgerichteten Assays kostengünstig und robust gemessen werden, unabhängig von spezifischen Microarray-Plattformen oder bioinformatischen Tools. Dies ist wichtig, wenn solche Assays für die klinische Validierung therapeutischer zellulärer Produkte eingesetzt werden sollen, was sogar eine Zulassung als In-vitro-Diagnostikum erfordern kann (Wagner, 2022).
Die Erfindung war mit verschiedenen Herausforderungen verbunden:
1 ) Die Anzahl der verfügbaren Datensätze war begrenzt;
2) Es war unerwartet, dass das gerichtete Differenzierungsschema mit verschiedenen Protokollen zu ganz unterschiedlichen DNAm- und Genexpressionsprofilen führte - es war sogar schwierig, Endoderm und Mesoderm in Datensatz 2 zuverlässig zu unterscheiden. In Zukunft sollten weitere Datensätze mit alternativen Differenzierungsschemata erstellt werden, um spezifische DNAm-Veränderungen für Endoderm und Mesoderm besser identifizieren und validieren zu können;
3) Die DNAm-Veränderungen während der gerichteten Differenzierung mit Differenzierungsmedien spiegeln nicht unbedingt die spontane Differenzierung in EBs wider. Eine Sortierung der Zellen wäre von Vorteil, um die Signaturen für die spontane Differenzierung weiter anzupassen; und
4) Für die Validierung des Dekonvolutionsansatzes gibt es keinen Datensatz mit quantitativen Daten für die Abstammungszuordnung in EBs. Spezifische DNAm- Muster wurden bereits erfolgreich für die Dekonvolution von Zellpopulationen verwendet, z. B. für die Zusammensetzung von Leukozyten-Untergruppen (Frobel et al., 2018; Houseman et al., 2012; Sontag et al., 2022) oder sogar von komplexen Geweben (Moss et al., 2018; Schmidt et al., 2020) - aber alle diese Anwendungen wurden auf ausdifferenzierte Zellen angewandt. Im Gegensatz dazu ähnelt der Differenzierungsprozess von iPSCs eher einem Kontinuum ohne einen festen Endpunkt, wenn die frühe Keimschichtdifferenzierung abgeschlossen ist. Die Dekonvolutionsergebnisse des erfindungsgemäßen Verfahrens können daher nicht die absolute Zusammensetzung der verschiedenen Zelltypen widerspiegeln, sondern liefern vielmehr einen Ersatzmarker, um frühe Entscheidungen über das Zellschicksal abzuschätzen.
Insgesamt bietet die Erfindung weitere Einblicke in epigenetische Veränderungen bei frühen Entscheidungen über das Zellschicksal. Kandidaten-CpGs für die Bewertung von PSC im pluripotenten Zustand und für die Erfassung früher Zellschicksalsentscheidungen in Richtung Endoderm, Mesoderm und Ektoderm wurden ermittelt. Das erfindungsgemäße Verfahren bietet verschiedene Vorteile im Vergleich zu herkömmlichen Methoden zur Qualitätskontrolle von iPSCs. Eine solche Analyse kann auch zur Optimierung der Kulturbedingungen verwendet werden, um einen größeren Anteil der Zellen im pluripotenten Zustand zu erhalten oder die Differenzierung in bestimmte Keimschichten besser zu steuern.
Experimentelle Verfahren
Zellkultur und gezielte Differenzierung
Vier humane iPSC-Linien wurden aus aus dem Knochenmark stammenden mesenchymalen Stromazellen (iPSC 102, iPSC 104, iPSC 106) (Goetzke et al., 2018) oder dermalen Fibroblasten (TF11-C2.3) (Willmann et al., 2013) durch Reprogrammierung mit episomalen Plasmiden erzeugt. Alle Proben wurden nach Information und schriftlicher Zustimmung gemäß den von der Ethikkommission für die Verwendung von humanen Testpersonen an der Universität Aachen genehmigten Richtlinien entnommen (Genehmigungsnummer: EK128/09). Die iPSC-Linien wurden auf mit Vitronectin (0,5 pg/cm2) beschichtetem Gewebekultur-Plastik in StemMACS iPS-Brew XF (Miltenyi Biotec GmbH, Bergisch Gladbach, Deutschland) kultiviert. Die gerichtete Differenzierung in Richtung endodermaler, mesodermaler und ektodermaler Abstammung wurde mit dem STEMdiff Trilineage Differentiation Kit (Stemcell Technologies, Vancouver, Kanada; ergänzende Abb. S1A) induziert.
Bildung von Embryoidkörpern
Es wurden selbstablösende iPSCs wie zuvor beschrieben erzeugt (Elsafi Mabrouk et al., 2022). Kurz gesagt, Vitronectin wurde im Mikrokontaktverfahren gedruckt (Durchmesser 600 pm) und iPSCs wuchsen und organisierten sich selbst auf diesen Substraten. Nach etwa 6 Tagen, wenn sich mehr als 50 % der Kolonien ablösten, wurden die schwimmenden Aggregate geerntet und als Tag 0 für weitere Differenzierungsschritte betrachtet. Alternativ dazu wurden Spin- EBs wie zuvor beschrieben erzeugt (Ng et al., 2005). Die ungerichtete Multilineagendifferenzierung von EBs wurde in Ultralow-Attachment-Platten (Coming, NY, USA) mit Differenzierungsinduktionsmedium (EB-Medium) durchgeführt, das Knockout DMEM/F12, 20 % KnockOut-Serumersatz, 2 mM GlutaMAX Supplement, 0,1 mM nicht-essentielle Aminosäuren und 0,1 mM b- Mercaptoethanol (alle von Gibco, Carlsbad, USA) enthält. Für die Langzeitkultur der EBs über 15 Tage wurden die EBs nach dem 7. Tag von den Platten mit ultraniedriger Anhaftung auf mit 0,1 % Gelatine beschichtete Platten übertragen. Das Medium wurde jeden zweiten Tag gewechselt.
Immunfärbung
Die Zellen wurden 20 Minuten lang mit 4% Paraformaldehyd fixiert und anschließend 30 Minuten lang mit PBS mit 1 % Rinderserumalbumin und 0.1 % Triton X-100 (Bio-Rad, München, Deutschland) behandelt und dann über Nacht bei 4°C mit primären Antikörpern gegen OCT4 (Klon C-10; Santa Cruz, Dallas, Texas, USA), GATA6 (Klon D61 E4; Cell Signaling, Danvers, USA), Brachyury (R&D Systems, Minneapolis, USA) und PAX6 (Klon AD2.35; Santa Cruz, Dallas, USA) inkubiert. Die Färbung mit sekundären Antikörpern erfolgte bei Raumtemperatur für 1 Stunde mit Esel-Anti-Ziege (Alexa Fluor 488), Ziege-Anti- Kaninchen (Alexa Fluor 594) und Ziege-Anti-Maus (Alexa Fluor 594); alle von Invitrogen (Waltham, USA). Die Proben wurden 15 Minuten lang mit DAPI (10 ng/mL) gegengefärbt und mit einem Axioplan 2 - Fluoreszenzmikroskop von Zeiss abgebildet.
Erstellung von DNA-Methylierungsprofilen
Genomische DNA wurde mit dem NucleoSpin Tissue Kit (Macherey-Nagel, Düren, Deutschland) isoliert und mit einem NanoDrop 2000 - Spektralphotometer (Thermo Fischer Scientific, Waltham, USA) quantifiziert. 1 ,2 pg DNA wurden bisulfitiert und mit Illumina EPIC BeadChip Microarrays bei Life & Brain (Bonn, Deutschland; Datensatz 1 ) analysiert. Zusätzlich wurden 114 DNA- Methylierungsprofile von iPSC und iPSC-abgeleiteten Zellen (PSC, ENDO, MESO, ECTO und EB), die auf Illumina HumanMethylation450 BeadChips vom Progenitor Cell Biology Consortium (PCBC) des National Heart, Lung and Blood Institute (Datensatz 2; ergänzende Tabelle S1 ) (Daily et al., 2017) aus dem Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo; GSE85828) erstellt wurden, verwendet. Zum Vergleich wurden DNAm-Profile von iPSC-abgeleiteten Zellen, die zu verschiedenen Zelltypen differenziert wurden (Datensatz 3; ergänzende Tabelle S1 ), verwendet. Für die somatischen Zellen wurde eine Auswahl von DNAm-Profilen, die für frühere Arbeiten der Erfinder in vielen Studien zusammengestellt wurden (Datensatz 4; ergänzende Tabelle S1 ) (Schmidt et al., 2020), verwendet. Darüber hinaus wurden DNAm-Profile von iPSCs mit hoher Differenzierungskapazität (HDC) oder geringer Differenzierungskapazität in Richtung Endoderm (LDC; GSE59091 ; Datensatz 5; für Proben mit Replikaten wurden immer die Mittelwerte über alle entsprechenden Replikate verwendet) verwendet (Butcher et al., 2016).
Die IDAT-Dateien der Illumina BeadChips wurden geladen und mit minfi (Aryee et al., 2014) in R (4.1.3) vorverarbeitet. Proben geringer Qualität wurden entfernt (Schwellenwert: Summe der Mediane der methylierten und unmethylierten Kanäle < 20) und die verbleibenden Proben wurden mit ssNoob normalisiert (Triche et al., 2013). Für Proben, für die keine IDAT-Dateien verfügbar waren, wurden bereits vorhandene Beta-Werte verwendet oder die Beta-Werte aus den Signalintensitäten generiert. CpG-Stellen auf XY-Chromosomen, Nicht-CG- Sonden und SNP-assoziierte CpGs wurden für die weitere Analyse nicht berücksichtigt. Außerdem wurden nur CpGs berücksichtigt, die auf den Plattformen 450K und EPIC BeadChip vertreten waren. Das R-Paket limma (3.48.0) wurde für die Berechnung der Benjamini-Hochberg-bereinigten p-Werte und der MDS-Plots verwendet. Relevante DNAm-Veränderungen wurden definiert als mindestens 20 % Unterschied in den mittleren Beta-Werten und ein bereinigter p-Wert < 0,05. Der exakte Test von Fisher wurde mit dem R-Paket GeneOverlap durchgeführt. Die R-Pakete ggplot2, ggrepel, ggbeeswarm, reshape2, ggExtra, ggsignif, cowplot, gprofiler2, ComplexHeatmap und VennDiagram wurden für die grafische Darstellung verwendet.
Auswahl von epigenetischen Biomarkern
Die Auswahl der Marker-Kandidaten-CpGs basiert auf einer früheren Arbeit der
Erfinder (Schmidt et al., 2020) und ist nun als R-Paket CimpleG verfügbar (https://github.com/CostaLab/CimpleG). Es wurden CpG-Stellen mit großen Unterschieden in den mittleren Beta-Werten und geringen Varianzen innerhalb der Gruppen ausgewählt (Methode: "CimpleG_parab"). Der Pluripotenz-Score basiert auf der Summe der DNAm an den drei pluripotenz-assoziierten CpGs cg00661673, cg00933813 und cg21699252. Da alle diese CpGs in pluripotenten Zellen eine geringere DNAm aufweisen, wurden zur intuitiveren Anwendung die komplementären Prozentsätze berechnet:
Pluripotenz-Score = (1 - DNAmcg00661673) + (1 - DNAmcg00933813) + (1 - DNAmcg21699252)
Der Entfaltungsansatz basiert auf nicht-negativer Matrixfaktorisierung, wie in einer früheren Arbeit der Erfinder beschrieben (Frobel et al., 2018; Schmidt et al., 2020). Als Referenzmatrix wurden entweder die mittleren DNAm-Grade aus dem Selektionsset oder die Pyrosequenzierungsdaten verwendet.
Transkriptomische Analyse
Die RNA-Sequenzierung wurde von der Firma Life & Brain (Bonn, Deutschland) mit dem NovaSeq 6000 Sequenzer (100 bp/read) durchgeführt. Die FASTA- Dateien wurden mit FastQC überprüft und die Adaptersequenzen wurden mit Trimmomatic getrimmt. Das Alignment der Reads wurde mit STAR (hg38 genome build) durchgeführt. Alternativ dazu wurden die Zählmatrizen vom Webportal des Progenitor Cell Biology Consortium (PCBC) heruntergeladen (https://www.synapse.Org/#ISynapse:syn2822494). Die Daten wurden mit der varianzstabilisierenden Transformation (VST) aus dem DESeq2-Paket in R normalisiert (Love et al., 2014). Die differenzielle Genexpressionsanalyse wurde mit demselben Paket unter Verwendung eines Wald-Tests durchgeführt (Benjamini-Hochberg angepasster P-Wert < 0,05, absolute Fold Change > 2). Um DNAm- und Genexpressionsdaten zu korrelieren, wurden die Illumina BeadChip-Annotation verwendet und die Daten durch Abgleich mit RefSeq- Transkripten zusammengefügt, wobei nur CpGs in Promotorregionen (TSS1500 und TSS200) berücksichtigt wurden.
Zur Identifizierung von Gensätzen, die für die Keimblätter charakteristisch sind, wurde ein zuvor veröffentlichter Einzelzell-RNA-seq-Datensatz menschlicher Embryoidkörper verwendet (Han et al., 2018). Alle Läufe für Tag 8 EBs wurden zusammengeführt und die Zählungen normalisiert. Das Seurat-Paket (v4) wurde zur Qualitätskontrolle und zum Herausfiltern von Zellen mit abnormalen Merkmalszahlen verwendet (Hao et al., 2021 ). Die Zellen wurden mit dem Algorithmus der nächsten Nachbarn geclustert und repräsentative Marker der einzelnen Cluster wurden mit MAST identifiziert (Finak et al., 2015). Gene mit einem bereinigten p-Wert < 0,05 und einer Fold Change > 1 ,5 wurden als Marker für die Keimblätter betrachtet (ergänzende Tabelle S2). Die Identität jedes Clusters wurde mittels gprofiler2 mit Hilfe von GO-Terms annotiert, die mit Markergenen assoziiert sind (Kolberg et al., 2020).
Für den PluriTest-Assay wurde das Online-Tool PluriTest verwendet (https://www.pluritest.org/). RNA-seq FASTAQ-Dateien wurden auf die Website hochgeladen, wo sie mit einem proprietären Algorithmus automatisch vorverarbeitet, ausgerichtet und analysiert wurden. Der daraus resultierende Pluripotenz-Score und der Novelty-Score wurden entsprechend aufgezeichnet.
Pyrosequenzierung
Genom ische DNA (500 ng) wurde über Nacht mit dem EZ DNA Methylation Kit (Zymo) bisulfitiert und in 20 pL Elutionspuffer eluiert. Primer (Metabion) wurden mit der PyroMark Assay Design 2.0 Software (Qiagen; ergänzende Tabelle S3) entworfen. Die Zielsequenzen wurden mit dem PyroMark PCR Kit (Qiagen) mit 2,5 mM Mg2+ und einer Primerkonzentration von 0,3 pM amplifiziert. Die Pyrosequenzierung wurde mit einem Q96 ID Pyrosequenzer (Qiagen) durchgeführt.
Semi-quantitative Reverse-Transkriptase PCR
Die Gesamt-RNA wurde mit dem NucleoSpin RNA Plus Kit (Macherey-Nagel, Düren, Deutschland) isoliert, mit einem NanoDrop ND-1000 Spektrophotometer (Thermo Scientific, Waltham, USA) quantifiziert und mit dem High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, USA) in cDNA umgewandelt. Die semiquantitative RT-PCR (qPCR) wurde mit dem Power SYBR Green PCR Master Mix (Applied Biosystems, Waltham, USA) und genspezifischen Primern in einem StepOnePlus Gerät (Applied Biosystems, Waltham, USA) durchgeführt. Primer für OCT4, GATA6, Brachyury, PAX6 und das Haushaltsgen GAPDH sind in der ergänzenden Tabelle S4 aufgeführt. Die ScoreCard-Analyse wurde mit dem TaqMan hPSC ScoreCard 96-well Kit (Thermo Fischer Scientific) gemäß den Anweisungen des Herstellers durchgeführt.
Statistik
Alle statistischen Analysen wurden in R durchgeführt. Für die Analyse der differentiellen Genexpression (DEseq2, Wald-Test) und der Methylierung (Limma, moderierter t-Test) wurden die p-Werte nach dem Benjamini-Hochberg- Verfahren angepasst. Alle angepassten p-Werte, die kleiner als 0,05 waren, wurden als signifikant angesehen. Für den Vergleich der Pluripotenz-Scores von LDC- und HDC-iPSCs wurde ein Wilcoxon-Test mit dem R-Paket ggsignif durchgeführt.
Verfügbarkeit von Daten und Codes
Die erzeugten RNA-seq- und Methylierungsdaten sind im Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo/) verfügbar.
Tabelle S1 : “BeadChip” - Datensätze (siehe Anlage)
Tabelle S2: Genlisten für jedes Keimblatt (siehe Anlage)
Table S3: Pyrosequenzierungs-Primer _
NAME _ DNA-SEQUENZ _ cgSCl For GGTTGGAGTGTATTGGTGTAA cgSCl Rev Biotin- AATCCCAACCTTTAT AC AT ATT AATTCTT cgSCl Seq GTTGAGATTATAGGTGTGA cgSC2 For AGGTTGGTTATGAATTTTTGGTTTTAAGTA cgSC2 Rev Biotin- ATACCCTACCTTCCTTTCATTTATATTC cgSC2 Seq TTGGGATTATAGGTGTG cgSC3 For GATGTTGAGGGTTAGGGGGTAATT cgSC3 Rev Biotin- CCTAAAACTCTAAAAATCTTTCTCCCTAAA cgSC3 Seq TGAAGGTTTTTTTAGTTTTGA cgEl For GAATAGTATATGGTTGGTTGGGAAAGT cgEl Rev Biotin- CCAAAAAAAAAAAATACCTTTACTATCACT cgEl Seq AGGAGTTATTTTATTATATTGGAG cgE2 For GGGATGTTGTGGATGGTAAAA cgE2 Rev Biotin- ACTCCCACATCTAAACACCTAA cgE2 Seq AGGGGTGTGGGAAGT cgE3 For GGGAGAGGGATTTATTATTAGGT cgE3 Rev Biotin- ACCCCCTCCTTCAACTATAAT cgE3 Seq GGTTTGAGAAAGAAGTTAG cgMl For AGGGTAAGGTTGTTTTGTTTAGTTTAT cgMl Rev Biotin- TCATACCTTTAAAACCCACAACTAAAAT cgMl Seq ATTAGGGTTTTGGTTTTATT cgM2 For TGAGTTTGGTTAGTTTAGTTATAGGT cgM2 Rev Biotin- CATCCCTAAAACAAACAAAAAACAATT cgM2 Seq ATTTGTTGTTGAGGTTTTTAATA cgM3 For ATGGTTTGGTATAGAAAGTTTATGG cgM3 Rev Biotin- ATACTTTCATCTCTTCTAATACCTTTAAC cgM3 Seq GTTTTGTGGGTGGGG cgEMl For GAATAAGATATGGTTTTTGGATTTGAGTA cgEMl Rev Biotin- AAATTTTCCTCTCCTACATCTCTCA cgEMl Seq GTGTTATAAGGTTTTGTTAGTT cgEM2 For Biotin- AGTTTTTTGATTATAAAAGGTATAGAGTGT cgEM2 Rev ACTCAAAAAAATCACCATAAATCACTATC cgEM2 Seq ACAACTAAACTTCTTTATCATATAT cgEM3_C For TGTTAGTAAATGGGGAAGATATAAAAGTT cgEM3_C
Biotin- AATTCCTACCCAACTCAAACTCATCTA Rev cgEM3_C Seq GAGTTGATTTTGAAAGGT cgECl For GGGGTTTTGAAAGTAAATGTGT cgECl Rev Biotin- TTCCAACTCACTAAAAAACACTTC cgECl Seq AGTAAATGTGTTGAAAGTT cgEC2 For AGTGGGAGTAAATGAGTTTAGT cgEC2 Rev Biotin- CAATTTCAAAATCTCCATCTCAAAATATCA cgEC2 Seq TTTTAGGGTAAGAAAATATAGATAG cgEC3 For GGGAGATTTTAGTTTTTTTTGTAGGG cgEC3 Rev Biotin- CCCAATATTATAATTCTTAACACCTCTCAT cgEC3 Seq AGTTTTTTTTGTAGGGATTTT
Tabelle S4: RT-qPCR - Primer
NAME DNA-SEQUENZ
OCT4 For GGGGGTTCTATTTGGGAAGGTA
OCT4 Rev ACCCACTTCTGCAGCAAGGG
GATA6 For CTCAGTTCCTACGCTTCGCAT
GATA6 Rev GTCGAGGTCAGTGAACAGCA
Brachyury For CAGTGGCAGTCTCAGGTTAAGAAGGA
Brachyury Rev CGCTACTGCAGGTGTGAGCAA
PAX6 For TCGAAGGGCCAAATGGAGAAGAGAAG
PAX6 Rev GGTGGGTTGTGGAATTGGTTGGTAGA
GAPDH For GAAGGTGAAGGTCGGAGTC
GAPDH Rev GAAGATGGTGATGGGATTTC Literatur
Aryee, M.J., Jaffe, A.E., Corrada-Bravo, H., Ladd-Acosta, C., Feinberg, A.P., Hansen, K.D., and Irizarry, R.A. (2014). Minfi: a flexible and comprehensive Bioconductor package for the analysis of Infinium DNA methylation microarrays. Bioinformatics 30, 1363-1369.
Bock, C., Kiskinis, E., Verstappen, G., Gu, H., Boulting, G., Smith, Z.D., Ziller, M., Croft, G.F., Amoroso, M.W., Oakley, D.H., et al. (2011 ). Reference Maps of human ES and iPS cell variation enable high-throughput characterization of pluripotent cell lines. Cell 144, 439-452.
Bouma, M.J., van Iterson, M., Janssen, B., Mummery, C.L., Salvatori, D.C.F., and Freund, C. (2017). Differentiation-Defective Human Induced Pluripotent Stem Cells Reveal Strengths and Limitations of the Teratoma Assay and In Vitro Pluripotency Assays. Stem Cell Reports 8, 1340-1353.
Butcher, L.M., Ito, M., Brimpari, M., Morris, T.J., Soares, F.A.C., Ahrlund- Richter, L., Carey, N., Vallier, L., Ferguson-Smith, A.C., and Beck, S. (2016). Non-CG DNA methylation is a biomarker for assessing endodermal differentiation capacity in pluripotent stem cells. Nat Commun 7, 10458.
Cypris, O., Eipel, M., Franzen, J., Rosseier, C., Tharmapalan, V., Kuo, C.C., Vieri, M., Nikolic, M., Kirschner, M., Brummendorf, T.H., et al. (2020). PRDM8 reveals aberrant DNA methylation in aging syndromes and is relevant for hematopoietic and neuronal differentiation. Clin Epigenetics 12, 125.
Daily, K., Ho Sui, S.J., Schriml, L.M., Dexheimer, P.J., Salomonis, N., Schroll, R., Bush, S., Keddache, M., Mayhew, C., Lotia, S., et al. (2017). Molecular, phenotypic, and sample-associated data to describe pluripotent stem cell lines and derivatives. Sei Data 4, 170030.
Dolgin, E. (2010). Putting stem cells to the test. Nat Med 16, 1354-1357. Elsafi Mabrouk, M.H., Goetzke, R., Abagnale, G., Yesilyurt, B., Salz, L, Cypris, 0., Gluck, P., Liesenfelder, S., Zeevaert, K., Ma, Z., et al. (2022). The spatial self-organization within pluripotent stem cell colonies is continued in detaching aggregates. Biomaterials 282, 121389.
Finak, G., McDavid, A., Yajima, M., Deng, J., Gersuk, V., Shalek, A.K., Slichter, C.K., Miller, H.W., McElrath, M.J., Prlic, M., et al. (2015). MAST: a flexible statistical framework for assessing transcriptional changes and characterizing heterogeneity in single-cell RNA sequencing data. Genome Biol 16, 278.
Frobel, J., Bozic, T., Lenz, M., Uciechowski, P., Han, Y., Herwartz, R., Strathmann, K., Isfort, S., Panse, J., Esser, A., et al. (2018). Leukocyte Counts Based on DNA Methylation at Individual Cytosines. Clin Chem 64, 566-575.
Gifford, C.A., Ziller, M.J., Gu, H., Trapnell, C., Donaghey, J., Tsankov, A., Shalek, A.K., Kelley, D.R., Shishkin, A.A., Issner, R., et al. (2013).
Transcriptional and epigenetic dynamics during specification of human embryonic stem cells. Cell 153, 1149-1163.
Goetzke, R., Franzen, J., Ostrowska, A., Vogt, M., Blaeser, A., Klein, G., Rath, B., Fischer, H., Zenke, M., and Wagner, W. (2018). Does soft really matter?
Differentiation of induced pluripotent stem cells into mesenchymal stromal cells is not influenced by soft hydrogels. Biomaterials 156, 147-158.
Han, X., Chen, H., Huang, D., Chen, H., Fei, L., Cheng, C., Huang, H., Yuan, G.C., and Guo, G. (2018). Mapping human pluripotent stem cell differentiation pathways using high throughput single-cell RNA-sequencing. Genome Biol 19, 47.
Hao, Y., Hao, S., Andersen-Nissen, E., Mauck, W.M., 3rd, Zheng, S., Butler, A., Lee, M.J., Wilk, A. J., Darby, C., Zager, M., et al. (2021 ). Integrated analysis of multimodal single-cell data. Cell 184, 3573-3587 e3529. Houseman, E.A., Accomando, W.P., Koestler, D.C., Christensen, B.C., Marsit, C.J., Nelson, H.H., Wiencke, J.K., and Kelsey, K.T. (2012). DNA methylation arrays as surrogate measures of cell mixture distribution. BMC Bioinformatics 13, 86.
International Stem Cell, I. (2018). Assessment of established techniques to determine developmental and malignant potential of human pluripotent stem cells. Nat Commun 9, 1925.
Kolberg, L, Raudvere, U., Kuzmin, I., Vilo, J., and Peterson, H. (2020). gprofi Ier2 -- an R package for gene list functional enrichment analysis and namespace conversion toolset g: Profiler. FWOORes 9.
Lenz, M., Goetzke, R., Schenk, A., Schubert, C., Veeck, J., Hemeda, H., Koschmieder, S., Zenke, M., Schppert, A., and Wagner, W. (2015). Epigenetic biomarker to support classification into pluripotent and non-pluripotent cells. Scientific Reports 5, 8973.
Love, M.I., Huber, W., and Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550.
Moss, J., Magenheim, J., Neiman, D., Zemmour, H., Loyfer, N., Korach, A., Samet, Y., Maoz, M., Druid, H., Arner, P., et al. (2018). Comprehensive human cell-type methylation atlas reveals origins of circulating cell-free DNA in health and disease. Nat Commun 9, 5068.
Muller, F.J., Goldmann, J., Loser, P., and Loring, J.F. (2010). A call to standardize teratoma assays used to define human pluripotent cell lines. Cell Stem Cell 6, 412-414.
Muller, F.J., Schuldt, B.M., Williams, R., Mason, D., Altun, G., Papapetrou, E.P., Danner, S., Goldmann, J.E., Herbst, A., Schmidt, N.O., et al. (2011 ). A bioinformatic assay for pluripotency in human cells. Nat Methods 8, 315-317. Ng, E.S., Davis, R.P., Azzola, L, Stanley, E.G., and Elefanty, A.G. (2005). Forced aggregation of defined numbers of human embryonic stem cells into embryoid bodies fosters robust, reproducible hematopoietic differentiation. Blood 106, 1601-1603.
O'Shea, O., Steeg, R., Chapman, C., Mackintosh, P., and Stacey, G.N. (2020). Development and implementation of large-scale quality control for the European bank for induced Pluripotent Stem Cells. Stem Cell Res 45, 101773.
Roadmap Epigenomics, C., Kundaje, A., Meuleman, W., Ernst, J., Bilenky, M., Yen, A., Heravi-Moussavi, A., Kheradpour, P., Zhang, Z., Wang, J., et al.
(2015). Integrative analysis of 111 reference human epigenomes. Nature 518, 317-330.
Salomonis, N., Dexheimer, P.J., Omberg, L, Schroll, R., Bush, S., Huo, J., Schriml, L, Ho Sui, S., Keddache, M., Mayhew, C., et al. (2016). Integrated Genomic Analysis of Diverse Induced Pluripotent Stem Cells from the Progenitor Cell Biology Consortium. Stem Cell Reports 7, 110-125.
Schmidt, M., Maie, T., Dahl, E., Costa, I.G., and Wagner, W. (2020). Deconvolution of cellular subsets in human tissue based on targeted DNA methylation analysis at individual CpG sites. BMC biology 18, 178.
Sontag, S., Bocova, L, Hubens, W.H.G., Nüchtern, S., Schnitker, M., Look, T., Schroder, K.M., Plumakers, B., Tharmapalan, V., Wessiepe, M., et al. (2022).
Toward Clinical Application of Leukocyte Counts Based on Targeted DNA Methylation Analysis. Clin Chem.
Steeg, R., Mueller, S.C., Mah, N., Holst, B., Cabrera-Socorro, A., Stacey, G.N., De Sousa, P.A., Courtney, A., and Zimmermann, H. (2021 ). EBiSC best practice: How to ensure optimal generation, qualification, and distribution of iPSC lines. Stem Cell Reports 16, 1853-1867. Stronati, E., Giraldez, S., Huang, L, Abraham, E., McGuire, G.R., Hsu, H.T., Jones, K.A., and Estaras, C. (2022). YAP1 regulates the self-organized fate patterning of hESC-derived gastruloids. Stem Cell Reports 17, 211-220.
Triche, T.J., Jr., Weisenberger, D.J., Van Den Berg, D., Laird, P.W., and Siegmund, K.D. (2013). Low-level processing of Illumina Infinium DNA Methylation BeadArrays. Nucleic Acids Res 41 , e90.
Tsankov, A.M., Akopian, V., Pop, R., Chetty, S., Gifford, C.A., Daheron, L., Tsankova, N.M., and Meissner, A. (2015). A qPCR ScoreCard quantifies the differentiation potential of human pluripotent stem cells. Nat Biotechnol 33, 1182-1192.
Wagner, W. (2022). How to Translate DNA Methylation Biomarkers Into Clinical Practice. Front Cell Dev Biol 10, 854797.
Willmann, C.A., Hemeda, H., Pieper, L.A., Lenz, M., Qin, J., Joussen, S., Sontag, S., Wanek, P., Denecke, B., Schuler, H.M., et al. (2013). To clone or not to clone? Induced pluripotent stem cells can be generated in bulk culture. PLoS One 8, e65324.
Tabelle SI:
Sample_Name Array_Typ< Data_TypeStem_Cell_Sample_GiGSM GSE Dataset iPSC 102 ECTO EPIC IDAT iPSC ECTO GSM6276770 GSE207119 Training iPSC 102 ENDO EPIC IDAT iPSC ENDO GSM6276771 GSE207119 Training iPSC 102 MESO EPIC IDAT iPSC MESO GSM6276772 GSE207119 Training iPSC 102 undifferentiated EPIC IDAT iPSC SC GSM6276773 GSE207119 Training iPSC 104 ECTO EPIC IDAT iPSC ECTO GSM6276774 GSE207119 Training iPSC 104 ENDO EPIC IDAT iPSC ENDO GSM6276775 GSE207119 Training iPSC 104 MESO EPIC IDAT iPSC MESO GSM6276776 GSE207119 Training iPSC 104 undifferentiated EPIC IDAT iPSC SC GSM6276777 GSE207119 Training iPSC 106 ECTO EPIC IDAT iPSC ECTO GSM6276778 GSE207119 Training iPSC 106 ENDO EPIC IDAT iPSC ENDO GSM6276779 GSE207119 Training iPSC 106 MESO EPIC IDAT iPSC MESO GSM6276780 GSE207119 Training iPSC 106 undifferentiated EPIC IDAT iPSC SC GSM6276781 GSE207119 Training
Figure imgf000041_0001
Figure imgf000042_0001
Figure imgf000043_0001
Figure imgf000044_0001
Figure imgf000045_0001
Figure imgf000046_0001
Figure imgf000048_0001
Figure imgf000049_0001
DF-852 4 450K matrix Fibroblast somatic cells GSM 1427320 GSE59091
DF-852 5 450K matrix Fibroblast somatic cells GSM1427321 GSE59091
DF-627 2 450K matrix Fibroblast somatic cells GSM1427322 GSE59091
DF-627 3 450K matrix Fibroblast somatic cells GSM1427323 GSE59091
DF-700 1 450K matrix Fibroblast somatic cells GSM1427324 GSE59091
DF-700 2 450K matrix Fibroblast somatic cells GSM1427325 GSE59091
DF-700 3 450K matrix Fibroblast somatic cells GSM1427326 GSE59091
DF-700 4 450K matrix Fibroblast somatic cells GSM1427327 GSE59091
DF-700 5 450K matrix Fibroblast somatic cells GSM1427328 GSE59091
FF-832 1 450K matrix Fibroblast somatic cells GSM1427329 GSE59091
FF-832 2 450K matrix Fibroblast somatic cells GSM1427330 GSE59091
FF-832 3 450K matrix Fibroblast somatic cells GSM1427331 GSE59091
FF-832 4 450K matrix Fibroblast somatic cells GSM1427332 GSE59091
FF-832 5 450K matrix Fibroblast somatic cells GSM1427333 GSE59091
FF-832 6 450K matrix Fibroblast somatic cells GSM1427334 GSE59091
DF-IPSC-447-39-E 450K matrix IPSC LDC GSM1427335 GSE59091
EB-IPSC-685-68-S 450K matrix IPSC LDC GSM1427336 GSE59091
DF-IPSC-283-79-E 450K matrix IPSC HDC GSM1427337 GSE59091
DF-IPSC-983-15-E 450K matrix IPSC HDC GSM1427338 GSE59091
EB-IPSC-447-64-S 450K matrix IPSC HDC GSM1427339 GSE59091
EB-IPSC-283-78-S 450K matrix IPSC HDC GSM1427340 GSE59091
EB-IPSC-844-53-S 450K matrix IPSC HDC GSM1427341 GSE59091
Sample_Name Array_Type Data_Type Stem_Cell_type Sample_Gr GSM GSE iPSC 102 EB DO EPIC IDAT iPSC EB GSM6276782 GSE207119 iPSC 102 EB D4 EPIC IDAT iPSC EB GSM6276783 GSE207119 iPSC 102 EB D7 EPIC IDAT iPSC EB GSM6276784 GSE207119 iPSC 106 EB DO EPIC IDAT iPSC EB GSM6276785 GSE207119 iPSC 106 EB D4 EPIC IDAT iPSC EB GSM6276786 GSE207119 iPSC 106 EB D7 EPIC IDAT iPSC EB GSM6276787 GSE207119 iPSCC2.3 EB D0 EPIC IDAT iPSC EB GSM6276788 GSE207119 iPSCC2.3 EB D4 EPIC IDAT iPSC EB GSM6276789 GSE207119 iPSCC2.3 EB D7 EPIC IDAT iPSC EB GSM6276790 GSE207120
Sample_Name Array_Type Data_Type Stem_Cell_type Sample_Group GSM GSE
SC12-005 EB [9934089035_R05C01] 450K IDAT iPSC EB GSM2285204 GSE85828
SC11-006 EB [9341679025_R01C02] 450K IDAT IPSC EB GSM2285157 GSE85828
SC12-006 EB [9934089035_R04C01] 450K IDAT IPSC EB GSM2285202 GSE85828
SC11-007 EB [9422493126_R03C02] 450K IDAT IPSC EB GSM2285184 GSE85828
SC11-013 EB [9934089038_R03C02] 450K IDAT IPSC EB GSM2285213 GSE85828
SC11-014 EB [9934089038_R01C02] 450K IDAT IPSC EB GSM2285209 GSE85828
SC11-016 EB [9422493126_R05C02] 450K IDAT IPSC EB GSM2285188 GSE85828
SC11-017 EB [9341679025_R03C01] 450K IDAT IPSC EB GSM2285160 GSE85828
SC12-025 EB [9341679022_R04C01] 450K IDAT IPSC EB GSM2285151 GSE85828
SC12-031 EB [9422493050_R06C02] 450K IDAT IPSC EB GSM2285178 GSE85828
SC12-035 EB [9934089035_R06C01] 450K IDAT IPSC EB GSM2285206 GSE85828
SC14-066 EB [9934089035_R03C02] 450K IDAT IPSC EB GSM2285201 GSE85828
SC14-067 EB [9934089035_R02C02] 450K IDAT IPSC EB GSM2285199 GSE85828
SC14-069 EB [9934089038_R06C02] 450K IDAT IPSC EB GSM2285219 GSE85828
SC14-070 EB [3999442133_R01C02] 450K IDAT IPSC EB GSM2285107 GSE85828
SC14-072 EB [9934089038_R06C01] 450K IDAT IPSC EB GSM2285218 GSE85828
SC14-073 EB [9934089038_R05C01] 450K IDAT IPSC EB GSM2285216 GSE85828
H9 EB [9341679025_R04C02] 450K IDAT ESC EB GSM2285163 GSE85828
Tabelle S2: 54
Gene Name P value Iog2-fold pct.l pct.2 Adjusted P Average change value expression
APOA1 1,9467E-165 6,309623763 0,982 0,456 3,0559E-161 21,45099814
APOA2 3,6757E-155 6,140853514 0,978 0,346 5,7702E-151 7,275942372
APOB 1,4744E-137 5,807369232 0,916 0,28 2,3144E-133 3,407861862
AFP 4,86485E-69 5,17736088 0,647 0,165 7,63684E-65 1,431108204
FGA 2,03937E-75 5,161873598 0,578 0,079 3,2014E-71 0,823676369
IGFBP6 l,20688E-89 4,56480445 0,895 0,213 l,89456E-85 1,037321937
MTTP 5,07529E-71 4,529145641 0,804 0,114 7,96718E-67 0,727654915
CST1 9,92504E-85 4,513582066 0,793 0,173 l,55803E-80 0,772975026
S100A14 l,41023E-73 4,355984535 0,738 0,098 2,21378E-69 0,533827453
RBP4 4,3316E-34 4,314065394 0,305 0,051 6,79974E-30 0,398533459
APOM l,63756E-43 4,272837206 0,633 0,084 2,57064E-39 0,572671668
LINC00261 l,17904E-82 4,266571092 0,938 0,131 l,85085E-78 0,62982646
APOC1 8,4151E-170 4,058940748 0,978 0,641 1,321E-165 3,103037205
DPP4 l,21405E-67 3,986337221 0,731 0,071 l,90581E-63 0,370974924
S100A16 3,516E-58 3,904456126 0,891 0,31 5,51941E-54 1,784345901
FN1 l,0462E-108 3,819836508 1 0,784 l,6424E-104 20,88973054
GPX2 l,34496E-24 3,724270876 0,455 0,052 2,11131E-20 0,350105478
ALDH1A1 l,68565E-37 3,560395714 0,633 0,079 2,64614E-33 0,327158914
GSTA2 7,34627E-42 3,448474892 0,567 0,043 l,15322E-37 0,220345079
HNF4A 3,03722E-48 3,354580338 0,629 0,054 4,76783E-44 0,213903237
CUBN 3,00346E-39 3,344895334 0,542 0,054 4,71484E-35 0,220027161
CA4 l,04256E-17 3,294929731 0,469 0,075 1,6366E-13 0,39200605
SLC7A7 2,12233E-39 3,292366328 0,716 0,155 3,33163E-35 0,407406901
CDKN1C 2,51013E-55 3,267563123 0,949 0,448 3,9404E-51 1,844362981
GSTA1 6,6673E-20 3,20479552 0,407 0,029 l,04663E-15 0,19971716
FOXA2 l,85323E-52 3,194028787 0,738 0,068 2,9092E-48 0,210031079
MYL3 2,94744E-16 3,093849543 0,411 0,054 4,62689E-12 0,241963029
CYP4X1 l,10556E-31 3,074862969 0,585 0,065 l,73551E-27 0,209028897
HABP2 8,90617E-33 3,024664397 0,52 0,029 l,39809E-28 0,142008524
RASSF6 l,06872E-21 2,988549446 0,418 0,035 1,67768E-17 0,167401689
MYOF 5,00359E-30 2,871303498 0,865 0,233 7,85463E-26 0,646128815
PPFIBP2 2,29445E-28 2,856286413 0,851 0,214 3,60183E-24 0,537451419
ANKRD1 l,4019E-16 2,823545598 0,451 0,143 2,2007E-12 0,425516127
DENND2C l,77096E-23 2,797868601 0,698 0,155 2,78005E-19 0,379145467
LCP1 l,70955E-12 2,796287793 0,418 0,095 2,68365E-08 0,36142237
SAT1 7,7862E-79 2,792006593 0,971 0,717 l,22228E-74 2,825867931
CCKBR l,56113E-24 2,693681628 0,713 0,267 2,45066E-20 0,845957267
HLA-DRB1 7,22183E-19 2,682945231 0,604 0,164 1,13368E-14 0,464752564
RSP03 l,61207E-26 2,667513497 0,909 0,359 2,53064E-22 1,759270042
S100A10 3,69111E-73 2,66415085 0,996 0,855 5,79431E-69 10,38969204
EPSTI1 9,08507E-19 2,657512498 0,564 0,079 1,42617E-14 0,199734288
MGST2 6,69648E-28 2,645282833 0,804 0,213 l,05121E-23 0,398584136
VIL1 1,19692E-17 2,642148939 0,404 0,054 1,87893E-13 0,156076671
PDZK1 3,53389E-25 2,627709987 0,513 0,03 5,5475E-21 0,115214577
HSPA12A l,52016E-14 2,594787105 0,498 0,08 2,38634E-10 0,246603748
TMEM144 1,14616E-19 2,589926897 0,425 0,07 1,79924E-15 0,155790967
SERPINE2 l,74387E-59 2,589202091 0,978 0,67 2,73752E-55 2,343752228
PLA2G12B 2,14411E-17 2,567042854 0,382 0,016 3,36582E-13 0,087783834
F0LR1 l,50735E-10 2,551944745 0,367 0,057 2,36624E-06 0,203715352
RNASE1 2,1543E-07 2,542024501 0,222 0,031 0,003381821 0,161777234 BMP2 l,24523E-25 2,529440206 0,829 0,264 1,95475E-21 0,595774921 VTN 3,50692E-30 2,515092887 0,593 0,063 5,50516E-26 0,129156015 FLRT3 6,12893E-30 2,513916772 0,96 0,439 9,62119E-26 1,773337685 SGIP1 6,02136E-17 2,493011632 0,378 0,065 9,45234E-13 0,143770783 F10 2,37709E-14 2,465882146 0,356 0,033 3,73156E-10 0,115564935 EPCAM 6,84207E-47 2,448538745 0,985 0,598 l,07407E-42 2,252605003 F2 2,88386E-12 2,401001234 0,291 0,019 4,52708E-08 0,079772596 REEP6 3,29646E-20 2,380766917 0,698 0,217 5,17478E-16 0,452463962 HPX 5,7959E-10 2,37197752 0,269 0,028 9,09841E-06 0,107984145 APOE 2,3524E-160 2,371458536 1 0,92 3,6927E-156 2,29465315 GSN 2,01202E-36 2,367030398 0,905 0,429 3,15847E-32 0,812729138 CAMK2D l,53733E-27 2,366459753 0,895 0,341 2,4133E-23 0,706232367 HNF1A-AS1 2,00034E-15 2,352595114 0,36 0,021 3,14013E-ll 0,077737923 CST3 5,90747E-55 2,351865137 0,949 0,589 9,27354E-51 1,004622482 BMP6 l,91109E-22 2,320215644 0,469 0,031 3,00003E-18 0,08199699 LGALS3 2,40316E-15 2,317880296 0,56 0,168 3,77248E-11 0,304448314 APE LA 3,60215E-30 2,296553727 0,815 0,4 5,65466E-26 0,804959824 ANXA3 4,99581E-25 2,288253006 0,815 0,339 7,84243E-21 0,639803046 TMEM37 1,3637E-12 2,27498192 0,545 0,139 2,14074E-08 0,32184307 SLC22A3 3,49513E-13 2,235857244 0,415 0,06 5,48665E-09 0,128221555 UGT3A1 8,43611E-09 2,235750702 0,338 0,075 0,00013243 0,18911798 SMIM10L2A l,94658E-25 2,23026946 0,644 0,198 3,05575E-21 0,246359053 AMOT l,25852E-20 2,213174975 0,876 0,355 1,97563E-16 0,945320706 GJB1 9,61006E-10 2,193662949 0,295 0,01 l,50859E-05 0,063052609 MLXIPL 2,06107E-ll 2,177673529 0,244 0,043 3,23547E-07 0,093203878 AK4 8,46743E-32 2,172550723 0,869 0,449 l,32922E-27 0,889393971 CFTR 1,18619E-11 2,158837209 0,375 0,048 l,86208E-07 0,115676768 FRZB 7,25331E-19 2,143898451 0,873 0,382 1,13862E-14 1,181134177 SYTL5 1,52587E-13 2,122822935 0,713 0,184 2,3953E-09 0,341501965 TTN 3,7603E-18 2,120934944 0,745 0,402 5,90291E-14 1,114766012 IGSF1 4,75304E-18 2,113016475 0,571 0,251 7,46133E-14 0,350626365 CELF4 6,95691E-18 2,109567142 0,444 0,059 l,0921E-13 0,099088698 HPGD 5,64942E-09 2,096875998 0,298 0,035 8,86846E-05 0,102051572 FAM184A 9,40777E-16 2,087671338 0,647 0,211 1,47683E-11 0,371173733 DNAJC22 2,57742E-13 2,082513103 0,367 0,04 4,04603E-09 0,087961316 B4GALT4 7,32303E-22 2,067800711 0,745 0,299 1,14957E-17 0,382755769 SLC2A3 2,83614E-73 2,037813258 1 0,935 4,45217E-69 6,248630879 ANKRD55 6,23479E-09 2,034814383 0,342 0,054 9,78737E-05 0,121356488 NQO1 3,69002E-33 2,025987193 0,869 0,604 5,79259E-29 1,761741139 SULF2 2,92036E-18 2,024955843 0,756 0,288 4,58438E-14 0,472341167 FZD4 1,82967E-15 2,023475783 0,713 0,186 2,87221E-11 0,267255344 EFHD1 l,22449E-10 2,00903374 0,516 0,095 l,92221E-06 0,182393655 TMEM135 l,89025E-21 2,00322147 0,775 0,305 2,96732E-17 0,402752425 SERPINF1 4,70462E-14 2,00084925 0,615 0,227 7,38531E-10 0,392605903 SPTLC3 l,58573E-09 1,996346213 0,429 0,052 2,48928E-05 0,115984079 FTL 2,495E-230 1,986689679 1 1 3,9166E-226 72,48120121
STEAP1 5,99742E-12 1,979325543 0,393 0,104 9,41474E-08 0,154163274 CLDN19 l,4577E-10 1,964211207 0,316 0,079 2,2883E-06 0,113695763 LINC01356 3,19518E-16 1,962965489 0,742 0,429 5,01579E-12 1,952068923 AMHR2 2,27032E-06 1,956505952 0,316 0,06 0,035639461 0,157987036 LAMA1 l,37535E-32 1,955589293 0,978 0,65 2,15902E-28 2,380849969 GLYCTK 2,56402E-10 1,951862084 0,327 0,064 4,02499E-06 0,112684628 FLNB 4,1162E-28 1,950522003 0,811 0,506 6,46161E-24 0,814190319 CHST9 3,04709E-13 1,948878085 0,582 0,199 4,78333E-09 0,310516825 MPC2 9,50366E-26 1,945976242 0,92 0,609 1,49189E-21 2,583135218 S100A13 4,9035E-48 1,942584526 0,956 0,648 7,69751E-44 0,813012896 SLC22A18 3,81957E-08 1,938243203 0,298 0,09 0,000599596 0,1632273 PTGR1 2,13563E-35 1,937821497 0,851 0,482 3,35251E-31 0,492723367 GAMT 4,02103E-23 1,924778141 0,836 0,461 6,31222E-19 0,875238006 LIFR l,80796E-17 1,923996423 0,891 0,381 2,83814E-13 1,009789341 S0X17 l,85027E-08 1,898957181 0,262 0,049 0,000290455 0,090678771 B4GALT1 4,84225E-20 1,894317686 0,869 0,388 7,60136E-16 0,578438734 HDHD3 2,53407E-10 1,892431314 0,509 0,16 3,97798E-06 0,264128104 ZNF600 2,00484E-09 1,874377785 0,498 0,132 3,14719E-05 0,258293775 HPN 1,51485E-14 1,872599984 0,484 0,093 2,37801E-10 0,121128234 CLDN4 8,48264E-14 1,860523931 0,415 0,117 l,3316E-09 0,121565654 ADD3 7,72323E-34 1,858208122 0,978 0,695 l,21239E-29 1,648837502 ANXA2 8,62051E-36 1,855766234 0,982 0,829 1,35325E-31 6,516690326 SERPINF2 l,47308E-07 1,838207485 0,225 0,025 0,002312444 0,057296457 CHDH 7,53188E-07 1,836766159 0,262 0,084 0,011823545 0,161169035 PHLDA2 8,90134E-07 1,82288462 0,255 0,107 0,013973324 0,189953668 CRYM 2,45485E-09 1,813582669 0,513 0,192 3,85362E-05 0,398094292 TMC4 3,10104E-09 1,804915467 0,236 0,04 4,86801E-05 0,063186869 NEAT1 7,21425E-22 1,804732173 0,96 0,672 1,13249E-17 4,519038267 PLPP3 3,70294E-17 1,802351346 0,807 0,345 5,81288E-13 0,543232723 HLA-DRB5 2,1898E-06 1,78508251 0,433 0,135 0,034375409 0,332388188 FGFR3 4,19406E-16 1,782916169 0,836 0,36 6,58383E-12 0,665849557 0DC1 l,50512E-39 1,776249075 0,989 0,82 2,36274E-35 2,904750184 DNAJC15 l,25685E-24 1,751190817 0,895 0,598 l,973E-20 1,502846882 OVOL2 7,22793E-09 1,744077639 0,313 0,065 0,000113464 0,104781136 TPRG1L 5,64325E-13 1,736778476 0,695 0,303 8,85877E-09 0,46988839 LAM Bl 3,68577E-30 1,728372982 0,996 0,722 5,78592E-26 2,470651448 VCAN 3,45902E-59 1,727100517 1 0,977 5,42997E-55 8,289278503 ITLN2 l,69077E-07 1,720229522 0,233 0,035 0,002654167 0,06875464 AGPAT3 3,05044E-09 1,719429579 0,48 0,139 4,78858E-05 0,174377071 P4HA1 8,36618E-20 1,71849625 0,869 0,509 1,31332E-15 1,051572671 C2orf72 l,20128E-08 1,711544144 0,298 0,033 0,000188577 0,061897972 TPD52L1 5,47806E-08 1,683486304 0,36 0,101 0,000859946 0,13607453 FAM83F l,0336E-12 1,681089967 0,451 0,127 l,62254E-08 0,12883624 ABCA1 7,92794E-11 1,676478853 0,64 0,247 l,24453E-06 0,355319473 KRT19 l,45757E-26 1,66614465 1 0,834 2,28809E-22 9,349799768 TRIM38 2,12041E-07 1,665596263 0,284 0,055 0,003328624 0,0858942 PRDM1 l,04818E-07 1,665551811 0,458 0,067 0,00164543 0,123492258 PDE5A 6,224E-10 1,659551948 0,465 0,198 9,77043E-06 0,24849252 CYB5A 5,65653E-27 1,652973726 0,942 0,704 8,87962E-23 2,501363657 CAV2 5,92918E-10 1,645176232 0,32 0,04 9,30762E-06 0,060616078 ADM 4,23964E-13 1,642604591 0,665 0,426 6,65538E-09 1,36953388 NEU1 l,65032E-16 1,639665461 0,745 0,418 2,59067E-12 0,614836112 IHH 7,57689E-19 1,633399148 0,527 0,03 1,18942E-14 0,041346344 OCLN 9,24027E-14 1,633127127 0,327 0,073 l,45054E-09 0,069108563 DGAT1 2,60073E-09 1,632496574 0,596 0,255 4,08263E-05 0,457598828 FAM20C l,21471E-07 1,630827548 0,36 0,152 0,001906857 0,212261217 DYNLT3 l,52905E-10 1,629347856 0,622 0,215 2,40031E-06 0,303141227 ARHGAP18 2,21132E-06 1,624827066 0,335 0,07 0,034713282 0,123380632 LRP2 2,47527E-09 1,619496642 0,702 0,287 3,88568E-05 0,787226726 GATA5 6,35056E-10 1,599937087 0,793 0,253 9,96912E-06 0,446013956 CRB3 6,14508E-09 1,595741303 0,375 0,09 9,64655E-05 0,111782856 GSTK1 l,02979E-17 1,593750043 0,865 0,542 1,61657E-13 1,038190737 DUSP9 l,69922E-07 1,583464362 0,269 0,02 0,002667443 0,039978319 ERRFI1 3,27889E-16 1,577665582 0,855 0,48 5,1472E-12 0,76271106 ALPK3 2,03702E-08 1,57351733 0,535 0,202 0,000319771 0,308806272 SMOX l,18379E-06 1,563389424 0,382 0,135 0,018583102 0,216204189 RAB17 3,6798E-09 1,56052615 0,44 0,145 5,77655E-05 0,178458481 MARVELD2 1,99625E-11 1,555053524 0,487 0,22 3,13372E-07 0,224622512 PRR13 l,55593E-30 1,543610999 0,945 0,744 2,44249E-26 2,431696981 PITX2 l,53557E-10 1,540156456 0,909 0,318 2,41054E-06 0,662860763 HES4 2,99849E-10 1,528547743 0,411 0,077 4,70703E-06 0,084421083 ZDHHC9 9,93012E-14 1,526089179 0,796 0,418 l,55883E-09 0,711479147 TMEM141 2,27176E-16 1,521627297 0,865 0,451 3,56621E-12 0,660195978 PRR5 4,22587E-07 1,509033242 0,465 0,151 0,006633777 0,193669062 NEDD4L l,1023E-14 1,507400356 0,785 0,409 l,73039E-10 0,601434397 PPM1H 3,69901E-10 1,503815253 0,513 0,211 5,80671E-06 0,203871261 SHTN1 l,54772E-09 1,494186542 0,647 0,232 2,42962E-05 0,275764967 SPINT2 3,75086E-24 1,487684554 0,927 0,6 5,8881E-20 0,994040335 ACOX2 3,87192E-07 1,484939066 0,276 0,053 0,006078145 0,070993251 RHOC 7,38194E-22 1,483068071 0,945 0,673 1,15882E-17 1,700690841 ABO l,51931E-06 1,477794839 0,342 0,063 0,023850156 0,084418923 KIT 2,41057E-08 1,476656618 0,375 0,154 0,000378411 0,148848962 AGPAT2 9,3111E-09 1,47399236 0,553 0,274 0,000146166 0,386255625 CAMSAP3 5,4745E-11 1,468700559 0,382 0,143 8,59387E-07 0,123344373 RAB25 7,782E-08 1,464412547 0,484 0,197 0,001221618 0,28944965 ECHDC2 3,7041E-08 1,463484163 0,513 0,157 0,000581469 0,190972752 ANKMY2 l,38092E-16 1,461466006 0,847 0,482 2,16778E-12 0,536709426 FGFR4 l,07736E-22 1,460715074 0,669 0,205 1,69123E-18 0,110567097 NUDT4 2,63731E-22 1,459401957 0,891 0,554 4,14005E-18 0,574736102 GLUD1 5,24818E-15 1,456768987 0,738 0,492 8,23859E-11 0,748892395 CTSB 2,53684E-19 1,454929724 0,945 0,668 3,98234E-15 1,773360539 PCYT2 5,01399E-ll 1,447164389 0,571 0,268 7,87096E-07 0,269129385 PNPT1 2,38948E-16 1,444371366 0,796 0,513 3,75101E-12 0,761695789 RMND1 l,09488E-ll 1,444312163 0,64 0,287 l,71875E-07 0,320860501 PCBD1 3,17934E-13 1,428828744 0,775 0,401 4,99093E-09 0,536183489 GATA4 6,5295E-08 1,427626376 0,56 0,146 0,001025001 0,146048545 COBL 7,65268E-08 1,4170169 0,407 0,161 0,001201317 0,16796069 RASD1 3,47921E-09 1,412003659 0,28 0,05 5,46166E-05 0,046508851 Clorf210 2,61309E-09 1,411544988 0,258 0,048 4,10203E-05 0,041685833 MRS2 1,42384E-13 1,407689473 0,815 0,443 2,23514E-09 0,665676856 RAPGEF5 6,6849E-07 1,398221005 0,273 0,08 0,010493963 0,084889678 MBNL3 3,42885E-08 1,398061342 0,585 0,239 0,00053826 0,341882203 C12orf75 3,01795E-14 1,397470341 0,753 0,408 4,73758E-10 0,426074088 NUDT14 3,67551E-07 1,395241414 0,425 0,184 0,005769815 0,202246655 GAS6 l,52726E-09 1,392548188 0,564 0,184 2,39749E-05 0,171069369 OGFRL1 l,51597E-07 1,392391562 0,469 0,159 0,002379769 0,177933162 FAM118A 8,89541E-13 1,386790854 0,822 0,483 l,3964E-08 0,745246631 CENPA 2,55987E-10 1,381077831 0,484 0,241 4,01849E-06 0,213665365 MY09A 4,25353E-11 1,372618982 0,855 0,418 6,6772E-07 0,758144596 PEPD 6,50537E-12 1,368146847 0,8 0,487 l,02121E-07 1,073667096 S100A11 l,14885E-26 1,355052914 0,985 0,789 l,80347E-22 2,904173006
TRAK2 6,17817E-10 1,340883982 0,495 0,292 9,69849E-06 0,291229616 DDIT3 6,35812E-09 1,335954212 0,487 0,194 9,98097E-05 0,164462437 PNPLA3 6,01672E-07 1,329634052 0,327 0,115 0,009445047 0,113986109 RASGEF1B 8,18127E-07 1,311738608 0,331 0,103 0,012842964 0,09815616 SLC3A2 9,09916E-26 1,308924252 0,967 0,875 1,42839E-21 3,857162947 EPS8L2 7,16792E-11 1,305527444 0,476 0,226 l,12522E-06 0,152052678 LRRC1 l,34923E-06 1,305251333 0,455 0,173 0,021180187 0,185256014 APLP2 l,35526E-40 1,299334845 0,996 0,954 2,12749E-36 3,661156703 ARHGAP26 5,21474E-09 1,298665928 0,545 0,263 8,18609E-05 0,245335336 SHISA5 3,73253E-24 1,297856036 0,942 0,771 5,85933E-20 1,908558873 HACD1 7,1641E-08 1,287295049 0,665 0,334 0,00112462 0,552238664 GPC3 l,06916E-12 1,284894258 0,887 0,616 l,67837E-08 2,013388232 FGF13 l,28699E-06 1,279355177 0,433 0,194 0,020203203 0,233608274 FGFR1 7,38806E-37 1,276773417 0,989 0,926 l,15978E-32 3,125570496 UACA 3,70923E-14 1,272360451 0,956 0,659 5,82275E-10 2,033436176 FBXO17 l,5626E-07 1,270589067 0,615 0,243 0,002452965 0,302623099 SLC7A5 1,38646E-11 1,26354318 0,542 0,233 2,17646E-07 0,145099049 PATJ 2,26105E-ll 1,263176989 0,789 0,421 3,54939E-07 0,502756059 MCC l,26299E-08 1,250690188 0,702 0,345 0,000198264 0,442954908 COL4A1 2,06673E-13 1,248037448 0,989 0,632 3,24435E-09 1,703912578 GALM l,70287E-06 1,241833416 0,604 0,282 0,02673162 0,425991722 STX3 l,07052E-12 1,238849453 0,898 0,516 l,6805E-08 0,869509703 NENF 2,59216E-10 1,23414168 0,705 0,533 4,06917E-06 1,097639258 FRMD4A 2,51107E-06 1,231620536 0,498 0,254 0,03941878 0,30971493 HLA-B l,267E-07 1,225019092 0,578 0,294 0,001988931 0,390250318 ALDH6A1 8,79934E-09 1,217730785 0,716 0,351 0,000138132 0,439526332 RBM47 l,31586E-10 1,211764265 0,589 0,327 2,06564E-06 0,250021855 MAGEH1 2,48385E-07 1,209471532 0,596 0,239 0,003899152 0,255021468 ASPH 5,40456E-12 1,208505212 0,753 0,434 8,48408E-08 0,480060883 PCDH7 4,37647E-07 1,205191633 0,84 0,384 0,006870176 0,896227313 MOSPD1 4,61618E-07 1,203789793 0,535 0,29 0,007246475 0,401687872 FRAS1 2,8709E-09 1,200399582 0,724 0,448 4,50674E-05 0,645495154 CD99 2,26757E-22 1,194702096 0,96 0,774 3,55964E-18 1,278261287 CDH2 1,46882E-14 1,191904716 0,982 0,654 2,30576E-10 1,690101225 GPX3 2,10752E-09 1,189243717 0,6 0,339 3,30838E-05 0,323343444 TNNC1 3,32499E-12 1,188685002 0,422 0,048 5,21958E-08 0,030366038 KDM4C 3,69748E-07 1,187836834 0,327 0,124 0,005804304 0,090331396 GSTO1 1,72117E-19 1,185336326 0,982 0,817 2,70189E-15 3,382338224 CAMK2N1 2,16882E-07 1,180900406 0,662 0,24 0,003404614 0,28700461 FLRT2 2,01352E-06 1,17792784 0,778 0,366 0,031608222 0,687992434 BINI 4,17577E-12 1,176914152 0,825 0,493 6,55512E-08 0,582904962 GLUL 5,45296E-24 1,172961542 0,931 0,851 8,56006E-20 2,049673681 ESRP1 l,07489E-08 1,164961539 0,633 0,318 0,000168736 0,344798657 CIB1 3,79772E-11 1,152753959 0,869 0,574 5,96165E-07 1,207412999 PORCN l,61821E-08 1,134886644 0,302 0,109 0,000254027 0,064619453 VAMP8 2,11702E-08 1,134491432 0,698 0,438 0,00033233 0,628865951 SERPINB6 l,83303E-07 1,129004014 0,68 0,409 0,002877484 0,720554415 SLC25A44 l,29685E-06 1,116954414 0,495 0,288 0,020358009 0,308030652 FUR 1,63953E-11 1,105408984 0,836 0,527 2,57374E-07 0,620546657 DAB2 l,38453E-06 1,100173489 0,927 0,454 0,021734405 1,239959842 DST 4,25458E-19 1,08366835 0,985 0,886 6,67884E-15 3,613538471 SPATS2L 1,32881E-11 1,079432706 0,855 0,579 2,08596E-07 0,88373632
LLGL2 4,9066E-07 1,077756289 0,68 0,345 0,007702383 0,390104816
CLDN7 2,8516E-10 1,07493501 0,545 0,234 4,47645E-06 0,134453729
SNCA 4,67812E-07 1,072586649 0,429 0,169 0,007343705 0,112027009
COL18A1 8,7906E-20 1,071973805 0,993 0,816 1,37995E-15 1,255852831
ZFP36L2 5,36801E-14 1,066244711 0,92 0,676 8,4267E-10 1,048696936
COL4A6 l,50601E-07 1,065747664 0,782 0,467 0,002364142 0,828802395
SLC7A8 l,05058E-12 1,06091137 0,695 0,472 l,6492E-08 0,370180275
CKB 5,08912E-17 1,059408863 0,945 0,817 7,98891E-13 2,818433635
NFE2L2 9,21837E-08 1,046941946 0,753 0,443 0,0014471 0,53414311
MYL12B 5,14276E-19 1,041167931 0,967 0,861 8,07311E-15 3,37533087
PPP1R14A 1,13127E-13 1,036173078 0,356 0,113 l,77587E-09 0,041550274
CAPN1 l,3158E-08 1,035613614 0,727 0,442 0,000206555 0,552434031
TMED9 8,28662E-10 1,025173862 0,811 0,485 l,30083E-05 0,436495914
COL9A2 4,00668E-07 1,018274329 0,571 0,321 0,006289688 0,285858098
SLC48A1 1,1487E-11 1,013923636 0,669 0,446 l,80324E-07 0,280101495
NAB1 2,62044E-07 1,009396586 0,68 0,386 0,004113567 0,486823025
HMOX1 l,69648E-06 1,007884464 0,28 0,054 0,026631353 0,037591187
ISG15 l,47616E-07 1,004423196 0,644 0,515 0,002317269 1,069928363
TM7SF2 l,09501E-06 1,004371455 0,625 0,403 0,017189454 0,61174873
F0XP1 6,7488E-08 1,002517178 0,789 0,53 0,001059426 0,858016838 pct.l Fraction of endoderm cells expressing marker genes pct.2 Fraction of other cells expressing marker genes
Gene Name P value Iog2-fold pct.l pct.2 Adjusted P Average change value expression
COL3A1 2,6664E-170 4,07387832 0,956 0,388 4,1856E-166 3,866056568
LUM 7,3571E-140 3,942986352 0,915 0,314 1,1549E-135 2,829044581
APLNR 2,4056E-151 3,810485096 0,975 0,315 3,7763E-147 2,668094957
IGFBP3 2,5626E-114 3,730621401 0,858 0,297 4,0228E-110 2,246348223
HAPLN1 1,85E-147 3,71009579 0,972 0,4 2,9041E-143 3,87102293
POSTN 2,11678E-79 3,623453225 0,657 0,228 3,32293E-75 1,215448898
COL6A3 1,319E-114 3,391207463 0,787 0,215 2,0706E-110 0,692160798
LRRC32 4,3895E-81 3,323399633 0,688 0,151 6,89064E-77 0,640747146
RSPO2 9,30106E-76 3,319808804 0,676 0,162 l,46008E-71 0,71466252
HAND1 1,1212E-111 3,315597741 0,985 0,276 l,7601E-107 2,353707762
C0BLL1 4,68089E-97 3,257334099 0,779 0,234 7,34806E-93 0,835500994
DNAH2 l,18569E-73 3,21272246 0,66 0,155 l,86129E-69 0,594463805
ACTC1 2,8971E-104 3,197592265 0,937 0,511 4,5478E-100 4,699476701
ALPK2 3,97178E-81 3,177949396 0,704 0,18 6,2349E-77 0,605465434
MYL4 7,29751E-72 3,132116997 0,746 0,177 l,14556E-67 0,723387863
BMP4 4,2735E-102 3,110421506 0,896 0,305 6,70856E-98 1,177296498
HAS2 2,6865E-99 3,106547193 0,818 0,277 4,21732E-95 0,792039048
PMP22 3,04648E-57 3,011511302 0,667 0,217 4,78236E-53 0,841166775
COL5A2 2,4182E-104 3,009679109 0,836 0,304 3,796E-100 0,84772544
RGS4 6,6765E-68 3,000111226 0,716 0,187 l,04808E-63 0,738846043
COL5A1 2,4678E-121 2,952935417 0,918 0,386 3,8739E-117 1,020138159
FREM1 7,85152E-90 2,93241756 0,786 0,2 l,23253E-85 0,517967657
BMPER 3,09619E-61 2,931596394 0,657 0,15 4,8604E-57 0,479340811
CDH11 3,9001E-100 2,923401645 0,899 0,318 6,12242E-96 0,943181189
KDR 5,32622E-96 2,917149726 0,824 0,447 8,36109E-92 1,262620143
COL1A1 3,7594E-126 2,911059259 0,93 0,422 5,9015E-122 1,0073861
ART5 2,16554E-46 2,902132362 0,57 0,264 3,39946E-42 0,943925025
CLSTN2 9,80384E-52 2,901140428 0,391 0,079 l,53901E-47 0,219800777
SYNE1 1,32264E-61 2,863887869 0,504 0,172 2,07628E-57 0,349579217
DSC3 6,12155E-62 2,852987737 0,352 0,104 9,60961E-58 0,189091331
FAM89A l,00952E-77 2,850752913 0,782 0,197 l,58474E-73 0,577439464
PRRX1 l,34407E-67 2,837837726 0,76 0,196 2,10992E-63 0,640692167
TGFBI 2,61629E-57 2,812490877 0,496 0,166 4,10705E-53 0,327947887
DCN 2,15798E-49 2,805048253 0,299 0,074 3,3876E-45 0,169350721
SLC40A1 4,22974E-57 2,761865108 0,591 0,148 6,63984E-53 0,39225967
SEMA6D l,16351E-70 2,728412701 0,754 0,252 l,82647E-66 0,603254396
HOXB5 6,52969E-57 2,726936275 0,463 0,077 l,02503E-52 0,208209186
TMEM88 l,4181E-130 2,691081851 0,88 0,231 2,2261E-126 0,366066619
SVEP1 l,25196E-47 2,685790694 0,44 0,099 l,96532E-43 0,235778587
TNC 1,31569E-61 2,668526913 0,674 0,193 2,06537E-57 0,41983214
ADAMTS9 l,3376E-70 2,639217715 0,843 0,378 2,09976E-66 1,489895077
WNT5A 7,38245E-62 2,606849564 0,682 0,161 l,1589E-57 0,351819268
DDR2 l,38038E-43 2,59938804 0,491 0,142 2,16691E-39 0,31481718
MCOLN3 5,60946E-34 2,562539243 0,559 0,139 8,80573E-30 0,503431405
H19 4,32442E-67 2,553662936 0,623 0,144 6,78848E-63 0,263206927
COL6A1 3,4274E-127 2,529451537 0,985 0,679 5,3803E-123 2,862105997
MYL7 4,81213E-37 2,512914 0,771 0,202 7,55409E-33 1,130013214
PITX1 l,60955E-57 2,510410232 0,726 0,191 2,52668E-53 0,481995888 H0XB-AS3 2,64108E-29 2,509978785 0,416 0,075 4,14597E-25 0,270010145 SAMD4A l,22592E-50 2,50904742 0,415 0,125 l,92444E-46 0,184184206 AFAP1L2 5,04063E-58 2,49293369 0,562 0,13 7,91278E-54 0,240421641 C0LEC12 l,05225E-67 2,466355283 0,805 0,285 l,65183E-63 0,613163198 CCBE1 l,0795E-40 2,453230847 0,474 0,165 l,6946E-36 0,288474694 GPR155 5,69971E-45 2,450912096 0,346 0,087 8,94741E-41 0,147574611 BNC2 2,82414E-63 2,449358995 0,674 0,333 4,43334E-59 0,574775118 H0XB6 4,4812E-80 2,439038663 0,553 0,094 7,03459E-76 0,157132687 ARHGAP29 l,20426E-56 2,410997305 0,839 0,325 l,89044E-52 1,128596861 C0L1A2 6,68619E-93 2,407906465 0,916 0,637 l,0496E-88 2,087571055 MXRA5 l,10992E-35 2,40593622 0,424 0,121 1,74236E-31 0,24393688 PAG1 2,33754E-33 2,380314937 0,431 0,118 3,66948E-29 0,266624149 D0K4 5,11405E-94 2,3797357 0,823 0,314 8,02804E-90 0,405740375 SIPA1L2 2,70752E-66 2,360164112 0,913 0,376 4,25027E-62 1,274692101 RUNX1T1 5,7599E-60 2,346755931 0,686 0,308 9,04189E-56 0,472940601 AQP1 5,21832E-27 2,342312631 0,249 0,067 8,19171E-23 0,150506091 F0XF1 3,89676E-72 2,33646341 0,523 0,097 6,11713E-68 0,144981261 NRP1 2,48977E-53 2,320007507 0,751 0,23 3,90844E-49 0,490405036 ADAM 19 2,06713E-76 2,301808751 0,811 0,448 3,24498E-72 0,703911687 SLIT2 7,38587E-41 2,298264383 0,584 0,231 l,15943E-36 0,486068399 ZFPM2 5,90478E-39 2,296310457 0,286 0,067 9,26933E-35 0,120522626 RELN 9,51625E-33 2,295145096 0,554 0,195 l,49386E-28 0,542830113 TEK l,17697E-42 2,289316675 0,49 0,181 l,8476E-38 0,269896486 DRD2 5,90869E-23 2,263653933 0,302 0,076 9,27546E-19 0,190741378 RHOBTB3 7,46475E-56 2,263322678 0,865 0,341 1,17182E-51 1,055369354 MLLT3 2,78491E-43 2,253748805 0,66 0,286 4,37176E-39 0,643714048 SNAI2 6,15685E-55 2,241983363 0,748 0,211 9,66502E-51 0,381050307 FNIP2 3,12991E-41 2,220725523 0,639 0,248 4,91332E-37 0,475688376 ADAM 12 l,70049E-33 2,197720108 0,438 0,133 2,66943E-29 0,235622304 CPED1 l,4781E-34 2,196120545 0,321 0,081 2,32033E-30 0,138168733 IL6ST 4,48513E-61 2,18975949 0,899 0,418 7,04076E-57 1,195628402 CYP26A1 l,74369E-36 2,174348876 0,496 0,225 2,73724E-32 0,355674972 SOX6 9,61465E-31 2,152234021 0,444 0,165 l,50931E-26 0,290553499 FLNC 7,94557E-51 2,146084818 0,808 0,293 l,2473E-46 0,546583104 COL6A2 l,53624E-90 2,141445225 0,814 0,327 2,41159E-86 0,303586077 GATA6 2,27013E-36 2,129953448 0,762 0,21 3,56366E-32 0,623860369 AHNAK 4,80569E-55 2,128644042 0,968 0,468 7,54397E-51 2,890607086 ATP7B l,04309E-34 2,123887658 0,522 0,201 l,63744E-30 0,327569721 ANGPT2 1,47475E-16 2,119163555 0,299 0,089 2,31506E-12 0,203271783 HTRA1 7,80379E-32 2,111941079 0,544 0,195 l,22504E-27 0,358926305 PDGFRA 2,11606E-38 2,084850173 0,84 0,306 3,32179E-34 1,176176382 FENDRR l,33244E-23 2,081934463 0,24 0,039 2,09167E-19 0,10530039 CGNL1 l,7995E-63 2,06897596 0,871 0,543 2,82485E-59 1,345293982 CEP85L 2,57098E-29 2,052890384 0,519 0,214 4,03592E-25 0,381109632 HOXB3 3,22204E-33 2,050773258 0,496 0,127 5,05796E-29 0,207883748 MFAP4 9,00312E-32 2,049783303 0,314 0,085 l,41331E-27 0,117520396 ANXA1 l,01344E-19 2,044653955 0,519 0,166 l,5909E-15 0,435549772 RGS5 3,06996E-59 2,044566339 0,877 0,511 4,81922E-55 1,44931897 NID2 4,80683E-33 2,028949858 0,377 0,089 7,54576E-29 0,135333055 SMARCA2 8,75414E-30 2,025319198 0,466 0,165 l,37423E-25 0,25161745 CAB39L 7,5756E-25 2,015469707 0,318 0,106 l,18922E-20 0,167219437 KIFAP3 l,30678E-34 2,010667758 0,663 0,285 2,05138E-30 0,613172723 PLAT 7,73861E-20 2,009704746 0,355 0,153 1,21481E-15 0,3015844 ACKR3 l,3137E-28 2,005739448 0,522 0,157 2,06224E-24 0,309599475 HOPX 3,49074E-26 2,003611823 0,243 0,045 5,47977E-22 0,090630273 ARHGAP28 l,71689E-39 1,997036161 0,72 0,338 2,69517E-35 0,739993732 TGFBR3 l,18387E-30 1,990021907 0,512 0,204 l,85844E-26 0,364971632 LGR4 l,26253E-57 1,986933662 0,826 0,441 l,98192E-53 0,734314313 GLIPR2 6,7968E-32 1,984213309 0,732 0,299 l,06696E-27 0,921136013 BAMBI l,06414E-55 1,981696087 0,978 0,569 l,67049E-51 3,634306791 PCDH17 2,32535E-26 1,979287426 0,644 0,239 3,65033E-22 0,72785464 KIF26B 9,05874E-27 1,965539544 0,49 0,146 l,42204E-22 0,263608594 PTCHI 6,09934E-45 1,965340536 0,842 0,361 9,57474E-41 0,82608087 MSX1 2,43109E-45 1,962996422 0,881 0,44 3,81632E-41 1,400394986 PDZRN3 l,67211E-34 1,956865113 0,465 0,161 2,62488E-30 0,195492083 NAV2 l,46177E-56 1,948110127 0,849 0,458 2,29468E-52 0,741418457 FOSL2 2,58516E-35 1,935164259 0,663 0,202 4,05819E-31 0,344140886 WBP1L 2,20191E-37 1,930271138 0,633 0,287 3,45657E-33 0,432192883 TBX3 4,88759E-32 1,923045487 0,806 0,259 7,67254E-28 0,901825288 MBNL2 9,85685E-27 1,909883857 0,493 0,154 l,54733E-22 0,250914438 WIPF1 2,16028E-31 1,904635113 0,579 0,241 3,39122E-27 0,413932728 GATA6-AS1 l,05071E-25 1,894719911 0,452 0,12 1,6494E-21 0,200372787 PLOD2 2,613E-33 1,893359889 0,567 0,273 4,10189E-29 0,347589857 ADAMTS6 8,42505E-24 1,89278592 0,346 0,079 1,32256E-19 0,129736538 PPIC 6,74492E-33 1,891646237 0,623 0,254 l,05882E-28 0,394740559 LIPG 1,44388E-17 1,883755269 0,333 0,155 2,2666E-13 0,246302227 EFEMP2 l,65772E-24 1,883301294 0,501 0,181 2,60229E-20 0,335598614 AMIG02 6,49351E-24 1,876333065 0,46 0,158 l,01935E-19 0,254367156 ADAMTS12 l,05993E-38 1,87432183 0,702 0,317 l,66388E-34 0,462803928 LEF1 8,31099E-39 1,86960641 0,752 0,311 l,30466E-34 0,573148886 SLC9A3R1 9,2821E-81 1,864852026 0,925 0,777 l,4571E-76 2,502020891 CREB3L1 3,61419E-43 1,8639046 0,606 0,28 5,67356E-39 0,265854474 CHD3 3,74911E-45 1,863821706 0,749 0,364 5,88535E-41 0,518013091 ITGA11 6,22788E-26 1,862467225 0,217 0,055 9,77653E-22 0,076406674 CCDC80 3,77165E-23 1,859350024 0,563 0,251 5,92074E-19 0,554982862 RGS2 2,30727E-32 1,829501506 0,674 0,383 3,62195E-28 0,74194692 EDIL3 l,97954E-32 1,823834366 0,55 0,311 3,10748E-28 0,374310941 LGR5 4,4631E-15 1,817887159 0,267 0,079 7,00618E-ll 0,133816482 KRT8 5,3757E-104 1,817818674 0,999 0,921 8,4388E-100 7,02604942 ATF3 8,69937E-38 1,81322286 0,751 0,38 l,36563E-33 0,618451009 RAB31 l,72674E-62 1,80830266 0,925 0,646 2,71064E-58 1,976286421 TSHZ1 5,10152E-23 1,808269737 0,446 0,124 8,00836E-19 0,198113931 ARID5B 3,81463E-17 1,805777984 0,412 0,137 5,9882E-13 0,276649052 TSHZ3 2,47621E-21 1,802795035 0,453 0,149 3,88715E-17 0,23681064 FLT1 l,41514E-37 1,796740039 0,619 0,463 2,22149E-33 0,601812655 MYOCD 3,17629E-16 1,792962981 0,211 0,051 4,98614E-12 0,093020008 SERPINB9 2,93098E-34 1,792644755 0,648 0,318 4,60106E-30 0,453592641 FGFR2 2,9005E-60 1,776808811 0,859 0,633 4,55321E-56 1,318322079 ERVH48-1 9,59718E-18 1,774894688 0,387 0,172 l,50657E-13 0,266665157 EPAS1 6,27388E-16 1,760525712 0,399 0,172 9,84873E-12 0,343945234 ANKS1A 2,40322E-35 1,756253312 0,704 0,43 3,77258E-31 0,879224041 OAF 3,44481E-21 1,752668958 0,538 0,187 5,40766E-17 0,347924394 FBN1 3,26044E-23 1,747086956 0,607 0,235 5,11823E-19 0,483965407 EGFLAM 2,70085E-15 1,743977949 0,352 0,119 4,2398E-11 0,225409623 SERINC5 2,09692E-43 1,741833882 0,77 0,457 3,29175E-39 0,611597678 ADAM33 l,86238E-26 1,734560829 0,37 0,128 2,92357E-22 0,136488378 LOX 2,53933E-21 1,730145118 0,223 0,062 3,98624E-17 0,083021196 LRFN5 4,93661E-20 1,728224719 0,226 0,038 7,74949E-16 0,073684132 NCAM1 6,27398E-25 1,72475916 0,674 0,299 9,8489E-21 0,671381888 BST2 3,08047E-51 1,714973018 0,704 0,512 4,83573E-47 0,52812685 GNG11 7,36569E-18 1,714166055 0,356 0,196 1,15627E-13 0,262741156 UNC5C 1,11126E-17 1,710724529 0,393 0,112 1,74446E-13 0,191652431 KCTD12 9,27189E-26 1,705820426 0,367 0,135 1,4555E-21 0,146280463 SPARC 2,83474E-83 1,70401494 0,999 0,877 4,44998E-79 5,369804239 BMPR2 3,53012E-30 1,702173554 0,676 0,359 5,54158E-26 0,583237479 PKP2 3,26763E-31 1,699207955 0,692 0,342 5,12953E-27 0,611409016 SH3RF2 5,02024E-18 1,696776328 0,334 0,088 7,88078E-14 0,148264295 FAM114A1 5,63164E-20 1,691423415 0,516 0,223 8,84054E-16 0,412666913 GATA3 4,28386E-17 1,69009976 0,506 0,183 6,7248E-13 0,414441855 METTL7A l,90339E-27 1,689069965 0,478 0,183 2,98795E-23 0,190923692 ADAMTS2 2,30307E-18 1,687062552 0,279 0,082 3,61536E-14 0,110985793 SDC4 l,19384E-63 1,681269835 0,87 0,59 l,87409E-59 0,746933368 TPST1 l,87464E-26 1,680766976 0,61 0,286 2,94281E-22 0,441608732 TNNI1 3,74873E-18 1,676338684 0,232 0,06 5,88476E-14 0,094371893 ADAMTS1 4,00631E-22 1,675546275 0,55 0,221 6,2891E-18 0,366036282 PGF 4,31947E-16 1,673997339 0,372 0,109 6,7807E-12 0,183525218 FBN2 8,394E-36 1,668826845 0,87 0,506 1,31769E-31 1,419700866 PLXNA2 4,99008E-17 1,660450517 0,46 0,174 7,83344E-13 0,311653744 MAN1A1 1,6411E-17 1,652834246 0,331 0,097 2,57621E-13 0,13240562 MYRF 3,79061E-18 1,642278678 0,406 0,118 5,95049E-14 0,185405598 LIX1 8,04694E-19 1,63962686 0,572 0,257 1,26321E-14 0,569285598 EFNB3 6,46351E-20 1,638051709 0,487 0,259 l,01464E-15 0,403675654 VWA5A 1,31312E-19 1,635927533 0,463 0,26 2,06134E-15 0,388627772 FIBIN 3,03747E-13 1,632366044 0,22 0,047 4,76822E-09 0,103141594 HS3ST1 7,13748E-17 1,626825976 0,386 0,152 l,12044E-12 0,240029508 FGF19 8,31206E-23 1,625382742 0,416 0,221 l,30483E-18 0,23266083 DSC2 8,19749E-43 1,618259893 0,886 0,567 l,28684E-38 1,389534684 CSRNP1 8,60668E-22 1,610712203 0,312 0,126 l,35108E-17 0,119357792 SLC39A4 7,82856E-12 1,607031714 0,305 0,088 l,22893E-07 0,181198245 EMP2 4,00235E-44 1,606607951 0,811 0,621 6,28289E-40 1,402133997 TRPV2 1,34195E-12 1,605603209 0,141 0,033 2,10659E-08 0,058731799 ELK3 6,53779E-21 1,600621194 0,421 0,196 l,0263E-16 0,209666714 VIM l,14235E-86 1,595649531 0,999 0,904 l,79327E-82 8,082275493 DAB2 6,24192E-24 1,592381571 0,779 0,38 9,79857E-20 1,239959842 ATF7IP2 6,47422E-21 1,589363588 0,532 0,311 l,01632E-16 0,438263474 MMP2 l,01766E-51 1,586788244 0,736 0,325 l,59752E-47 0,212099836 BAG3 1,38968E-21 1,579214019 0,43 0,165 2,18151E-17 0,189001305 TLE3 l,12019E-44 1,57863741 0,84 0,56 l,75848E-40 0,79337837 PLEKHA6 4,63431E-17 1,564854598 0,349 0,122 7,27493E-13 0,144318059 ZMIZ1 8,74035E-41 1,561844838 0,836 0,53 l,37206E-36 0,897369046 H0XB7 1,98595E-17 1,557192931 0,22 0,037 3,11755E-13 0,066718013 RPS19P3 5,16675E-33 1,556751319 0,339 0,162 8,11077E-29 0,090875373 MPZL1 7,12336E-53 1,554474986 0,896 0,708 l,11823E-48 1,620599966 DENND4C 7,20237E-24 1,549298265 0,666 0,371 l,13063E-19 0,695175938 CYP27A1 l,20464E-14 1,546252967 0,342 0,122 l,89104E-10 0,190458934 ISL1 2,36331E-11 1,543599267 0,191 0,054 3,70992E-07 0,095312249 PTPRD 3,56711E-36 1,53755075 0,828 0,559 5,59965E-32 1,238484926 ST3GAL1 2,74021E-17 1,533751888 0,6 0,25 4,30158E-13 0,619019888 NEXN l,52992E-22 1,531732229 0,582 0,35 2,40166E-18 0,50767253 PCOLCE 5,42844E-24 1,531229912 0,478 0,233 8,52156E-20 0,19605214 ST6GALNAC3 2,7246E-23 1,530426607 0,597 0,359 4,27708E-19 0,53529511 ARHGAP42 2,01957E-17 1,526262835 0,396 0,21 3,17033E-13 0,244286082 MME 1,47567E-16 1,521852362 0,315 0,147 2,31651E-12 0,14246424 HOXB2 l,0827E-28 1,518800215 0,475 0,132 l,69962E-24 0,11677366 EHD2 5,97923E-37 1,51465551 0,425 0,161 9,38619E-33 0,093917876 CTSV 6,79964E-66 1,512411268 0,959 0,811 l,06741E-61 2,830270581 MYADM 3,52034E-56 1,510103824 0,889 0,639 5,52623E-52 0,701993451 NDRG2 l,50959E-17 1,498635614 0,353 0,142 2,36976E-13 0,162200582 PITX2 7,39745E-18 1,496970315 0,691 0,244 1,16125E-13 0,662860763 GALNT10 1,69966E-19 1,494820818 0,572 0,291 2,66812E-15 0,512743492 KCNMA1 l,16011E-14 1,494045337 0,261 0,115 l,82114E-10 0,123028121 CDK6 3,03216E-26 1,490370288 0,767 0,427 4,75988E-22 0,85284523 JUN 7,01564E-19 1,489000283 0,54 0,277 l,10131E-14 0,425610938 PARVA l,17428E-24 1,48119544 0,666 0,379 l,84338E-20 0,61035206 ARHGAP6 4,1479E-15 1,477561673 0,242 0,058 6,51138E-11 0,082618609 NTS 5,01146E-10 1,47536556 0,29 0,175 7,86699E-06 0,251631803 PAQR8 l,00065E-14 1,471153711 0,444 0,23 l,57083E-10 0,366058841 MESP1 6,42724E-11 1,463055411 0,154 0,02 l,00895E-06 0,045603203 TRIOBP l,75088E-39 1,460202977 0,858 0,616 2,74853E-35 1,11961201 SH3PXD2A 2,03873E-18 1,459981515 0,444 0,191 3,2004E-14 0,209033211 P4HA2 1,57625E-14 1,457907334 0,299 0,114 2,47439E-10 0,132253535 MEIS1 2,15964E-15 1,447176863 0,506 0,166 3,39021E-ll 0,257570914 SERINC3 2,07057E-35 1,447133223 0,845 0,586 3,25038E-31 1,190163613 BCO2 1,96151E-15 1,445972218 0,172 0,049 3,07918E-ll 0,056142548 TCEAL9 2,39184E-63 1,445335957 0,924 0,744 3,75471E-59 1,107021132 HOXAIO 9,45368E-16 1,441935166 0,194 0,035 l,48404E-ll 0,048306725 DSP 2,20394E-38 1,438953828 0,943 0,708 3,45974E-34 3,192100043 DACT3 2,9556E-18 1,438380576 0,331 0,093 4,6397E-14 0,098558081 PKN2 3,97871E-40 1,434391526 0,859 0,619 6,24578E-36 1,076253735 TERF2IP 2,73851E-18 1,434342971 0,512 0,303 4,29891E-14 0,425439116 MXRA7 1,15747E-18 1,432213825 0,496 0,273 1,817E-14 0,316384095 COL13A1 l,26705E-19 1,429367661 0,362 0,12 l,98901E-15 0,115123139 KRT19 l,00405E-34 1,426812048 0,994 0,782 l,57616E-30 9,349799768 TAN Cl 2,98912E-14 1,426775392 0,393 0,195 4,69232E-10 0,250204534 SLA 7,83059E-09 1,426372751 0,132 0,035 0,000122925 0,071571559 CDX2 4,86349E-11 1,423587134 0,374 0,148 7,63471E-07 0,251570552 FRMD4B l,53062E-14 1,414743022 0,383 0,172 2,40277E-10 0,214903628 LBH 5,14587E-19 1,413837742 0,598 0,324 8,07798E-15 0,449335784 PTGFRN 5,76449E-16 1,411010534 0,37 0,208 9,04909E-12 0,206665073 PFKP l,01683E-32 1,408216413 0,795 0,586 l,59622E-28 1,083493906 GADD45G l,81905E-13 1,403149787 0,32 0,148 2,85555E-09 0,165966913 ANGPTL2 1,73599E-13 1,390504173 0,421 0,192 2,72515E-09 0,269759319 ST3GAL6 l,06394E-19 1,389470434 0,676 0,337 l,67018E-15 0,504050124 IRS1 9,18492E-20 1,389262736 0,532 0,316 1,44185E-15 0,34475573 STK17B 3,35096E-14 1,387292872 0,276 0,098 5,26034E-10 0,096920499 GATA2 2,36806E-10 1,386605231 0,21 0,049 3,71739E-06 0,083995422 SLC12A2 9,38069E-21 1,385950446 0,645 0,39 1,47258E-16 0,576523215 NEK5 3,55307E-ll 1,380868604 0,182 0,056 5,57761E-07 0,081674712 SMAD7 6,58148E-18 1,376168363 0,43 0,174 l,03316E-13 0,167578782 STX18 1,46665E-18 1,373720908 0,563 0,413 2,30235E-14 0,668359602 TUBB6 l,20484E-30 1,372789444 0,758 0,573 l,89135E-26 0,820299844 MAML3 6,38641E-11 1,370570681 0,289 0,121 l,00254E-06 0,153597224 HTR1E l,06761E-ll 1,365114068 0,17 0,049 l,67593E-07 0,070092866 L0XL2 l,01402E-22 1,357210004 0,576 0,363 1,59181E-18 0,333376603 KLF6 l,27271E-26 1,356461843 0,897 0,621 l,99789E-22 2,545633403 KDM6B l,44312E-25 1,356110447 0,683 0,288 2,26541E-21 0,277387201 ALCAM 2,91764E-33 1,355987132 0,801 0,699 4,58011E-29 1,175538451 FURIN 5,27703E-21 1,355922426 0,488 0,223 8,28387E-17 0,188090973 L0XL1 2,98206E-17 1,353596522 0,474 0,264 4,68123E-13 0,273551904 ATP2B4 2,4326E-19 1,351176414 0,694 0,392 3,81869E-15 0,756542589 PXK 4,36741E-12 1,350047625 0,397 0,195 6,85597E-08 0,319595033 CEBPD 6,93248E-18 1,34735071 0,284 0,114 l,08826E-13 0,088860055 PAPSS1 9,53078E-39 1,340012143 0,796 0,657 l,49614E-34 0,905448865 TLN2 1,88289E-21 1,339382819 0,73 0,45 2,95576E-17 1,018834709 FLU 2,20699E-ll 1,336787473 0,144 0,032 3,46454E-07 0,037169858 TRPM7 2,92876E-18 1,333309768 0,639 0,388 4,59757E-14 0,650449276 PRNP 2,21771E-21 1,330396088 0,645 0,425 3,48136E-17 0,585980579 CHSY1 3,44957E-25 1,326246496 0,672 0,476 5,41514E-21 0,566827725 PRKCE 1,85931E-13 1,324911462 0,276 0,086 2,91875E-09 0,099642846 DSG2 l,61264E-44 1,312989557 0,95 0,796 2,53153E-40 2,465542369 ZADH2 7,30727E-13 1,312297347 0,375 0,174 l,1471E-08 0,211102937 CCDC34 l,08956E-30 1,312285016 0,783 0,594 l,7104E-26 0,871479222 FLRT2 l,08663E-14 1,310976163 0,629 0,313 l,70579E-10 0,687992434 FKBP7 1,54532E-15 1,306454148 0,411 0,22 2,42584E-11 0,235407773 RREB1 9,08797E-20 1,296288376 0,597 0,356 1,42663E-15 0,377291439 COL4A1 l,74335E-23 1,295673554 0,903 0,562 2,73671E-19 1,703912578 APOBEC3C 8,48578E-16 1,294993117 0,488 0,303 1,3321E-11 0,362479511 TENM4 9,36899E-15 1,292994045 0,591 0,299 l,47074E-10 0,57923802 TFPI 7,91311E-17 1,288361053 0,711 0,387 1,2422E-12 0,914619768 EPHA7 2,53955E-20 1,287010676 0,815 0,42 3,98658E-16 1,11805562 FOS l,09035E-29 1,285983187 0,924 0,699 l,71163E-25 2,539654413 ECE1 l,27289E-24 1,284835029 0,74 0,423 l,99818E-20 0,496655338 MYLK3 2,06679E-09 1,283531259 0,161 0,043 3,24444E-05 0,059849526 TM0D1 2,14519E-07 1,281223012 0,11 0,013 0,003367526 0,031471535 APOBEC3G l,23316E-08 1,280850358 0,133 0,022 0,000193581 0,040954979 EFNA1 4,19999E-07 1,280317516 0,245 0,146 0,006593152 0,322540007 SRC 4,14892E-33 1,278029552 0,491 0,187 6,51297E-29 0,097154648 ST3GAL5 1,18112E-11 1,274165816 0,289 0,123 l,85412E-07 0,139542402 MYLIP 7,3426E-19 1,273060486 0,562 0,411 1,15264E-14 0,562702941 EPB41L5 2,158E-21 1,271667068 0,642 0,427 3,38763E-17 0,678471058 SMAD3 9,69564E-18 1,271538523 0,532 0,341 l,52202E-13 0,345652707 TEAD1 6,01407E-28 1,270675357 0,874 0,599 9,44088E-24 1,298861558 SETD7 6,61151E-13 1,266222842 0,287 0,118 l,03788E-08 0,104458041 SMAD6 3,1376E-15 1,261809769 0,443 0,189 4,9254E-11 0,190796473 CHIC2 9,61313E-15 1,261607894 0,302 0,162 l,50907E-10 0,120591291 RPS7P10 5,77142E-33 1,259745089 0,389 0,252 9,05998E-29 0,08672318 PHLDB2 6,85453E-23 1,259261849 0,755 0,54 l,07602E-18 0,916004477 SVIL 7,52837E-15 1,258500081 0,51 0,36 l,1818E-10 0,4623384 FNDC3B 1,11134E-19 1,256930895 0,749 0,418 1,74458E-15 0,728528471 ZCCHC24 l,69765E-20 1,256522466 0,472 0,217 2,66498E-16 0,149094358 RPL10P16 3,41773E-58 1,255482219 0,685 0,453 5,36515E-54 0,126959002 HGSNAT 5,23463E-12 1,255287307 0,485 0,226 8,21733E-08 0,316148079 ASH2L 6,66258E-19 1,253528778 0,67 0,456 l,04589E-14 0,749818485 PVR l,29092E-ll 1,244379147 0,384 0,191 2,02649E-07 0,219811295 GATA5 1,31928E-11 1,243185339 0,545 0,212 2,07101E-07 0,446013956 TIMP1 l,953E-26 1,242636509 0,845 0,709 3,06582E-22 2,432518778 IGSF3 7,20089E-15 1,242444908 0,548 0,32 l,13039E-10 0,444339998 BMP1 9,09543E-13 1,240063387 0,402 0,156 l,4278E-08 0,155192268 GPRC5C l,44839E-10 1,238384182 0,513 0,242 2,27368E-06 0,44618499 SNCAIP l,29196E-08 1,226680256 0,154 0,085 0,000202812 0,077630837 ZC2HC1A 9,29417E-15 1,218257414 0,591 0,347 l,459E-10 0,48701902 COL4A2 3,94215E-23 1,215679792 0,845 0,583 6,18838E-19 1,133378578 KDM7A 3,80668E-12 1,210274011 0,538 0,265 5,97572E-08 0,427926493 ZNF516 2,86852E-35 1,202266682 0,883 0,546 4,50301E-31 0,454778031 TPM1 l,8927E-55 1,200680004 0,952 0,917 2,97115E-51 2,652374399 PARP14 7,52459E-11 1,193402468 0,372 0,207 l,18121E-06 0,261946523 ITGAV 3,63098E-19 1,192955993 0,755 0,54 5,69992E-15 1,00548803 CHN1 2,64158E-16 1,19284677 0,562 0,458 4,14675E-12 0,576127718 PKN0X1 2,01306E-15 1,191689085 0,478 0,362 3,1601E-ll 0,423834654 ST7 2,36882E-10 1,186561072 0,377 0,209 3,71857E-06 0,245772162 LYN 2,59662E-15 1,184929552 0,456 0,287 4,07617E-ll 0,253923469 AEBP1 6,63198E-16 1,180846895 0,501 0,345 l,04109E-ll 0,30269781 ATP2B1 l,69919E-35 1,176525108 0,978 0,803 2,66739E-31 4,262069965 ANXA6 4,45027E-21 1,174477044 0,76 0,415 6,98603E-17 0,473199486 SEMA5A 9,34986E-11 1,171443211 0,471 0,258 l,46774E-06 0,397981627 FBLN1 l,66161E-66 1,171370782 0,997 0,974 2,60839E-62 5,767418099 DCAF6 2,96159E-12 1,169959741 0,453 0,281 4,64911E-08 0,337533254 FZD8 2,17198E-11 1,169762332 0,292 0,125 3,40958E-07 0,121666326 KIAA1217 4,04608E-12 1,169598869 0,425 0,347 6,35154E-08 0,512216679 DACT1 8,04207E-13 1,16397839 0,437 0,225 l,26244E-08 0,254773733 PPFIBP1 5,75595E-14 1,161525648 0,575 0,38 9,0357E-10 0,48827743 AKAP12 l,79304E-35 1,161166671 0,933 0,83 2,81472E-31 2,909902875 LPGAT1 l,90562E-ll 1,160068012 0,49 0,271 2,99144E-07 0,34610082 CA2 4,09762E-09 1,157012294 0,336 0,252 6,43245E-05 0,254434661 FOSB 2,8256E-15 1,147777936 0,792 0,505 4,43563E-11 1,600144192 RBMS3 3,56049E-10 1,144794533 0,34 0,157 5,58926E-06 0,168098503 CTSL 7,44001E-18 1,144728916 0,67 0,426 1,16793E-13 0,573162648 TCF4 4,45136E-45 1,143846924 0,969 0,856 6,98775E-41 2,328548336 CAP2 8,36742E-13 1,142368605 0,557 0,333 l,31352E-08 0,491378868 GNG2 9,37196E-19 1,14216593 0,544 0,309 1,47121E-14 0,225480978 TMEM51 5,86427E-09 1,142087426 0,355 0,224 9,20573E-05 0,290499446 CBLB 2,47285E-12 1,136206615 0,501 0,361 3,88188E-08 0,461949096 JAK1 3,70284E-ll 1,134080738 0,49 0,335 5,81272E-07 0,471686871 MAGI3 3,46256E-11 1,131747075 0,452 0,281 5,43553E-07 0,351076285 VEGFB 7,93637E-12 1,130459076 0,44 0,285 l,24585E-07 0,294171393 TNFAIP8 2,6594E-11 1,125571385 0,326 0,211 4,17473E-07 0,165910555 SLC7A2 6,75778E-10 1,123165078 0,318 0,195 l,06084E-05 0,201117239 ALDH2 8,92863E-21 1,122837967 0,83 0,578 l,40162E-16 1,127165396 CMTM6 4,75143E-24 1,120633149 0,644 0,533 7,4588E-20 0,367436496 MXRA8 2,23442E-11 1,120161909 0,375 0,173 3,5076E-07 0,159374007 LYPD6 8,72077E-08 1,119451614 0,271 0,137 0,001368987 0,163590793 MAST4 2,28028E-08 1,118682295 0,282 0,169 0,000357959 0,190914287 MXD4 3,52218E-16 1,116670458 0,68 0,471 5,52912E-12 0,833177504 BAIAP2L1 1,24594E-18 1,114997499 0,651 0,534 1,95588E-14 0,692167038 SPIN4 3,83637E-21 1,113650058 0,32 0,139 6,02234E-17 0,067006756 LDB2 l,30036E-14 1,113320384 0,534 0,382 2,0413E-10 0,419422202 KCP 3,43768E-09 1,112139554 0,205 0,078 5,39648E-05 0,078613203 MDK 1,2935E-142 1,111478983 1 1 2,0305E-138 9,615669833 TSPAN5 6,72814E-15 1,107695265 0,689 0,454 l,05618E-10 0,943538151 LIFR 2,11061E-09 1,106600477 0,726 0,304 3,31323E-05 1,009789341 SLC4A8 5,22912E-11 1,104460364 0,433 0,29 8,20867E-07 0,406793102 ITGB1 5,74348E-33 1,10304317 0,903 0,783 9,01611E-29 1,327144214 EPHB2 l,72096E-15 1,099060866 0,562 0,345 2,70156E-ll 0,305458778 TNP01 2,05419E-33 1,097053298 0,886 0,758 3,22467E-29 1,185210418 ZBTB8A 2,05298E-12 1,096326192 0,409 0,275 3,22277E-08 0,238307347 WWTR1 l,32425E-10 1,096054907 0,453 0,236 2,07882E-06 0,246617247 RPL18P13 2,87475E-12 1,094420385 0,177 0,066 4,51278E-08 0,047312928 HUNK 8,41495E-09 1,086172735 0,372 0,211 0,000132098 0,267903637 PHACTR2 l,48646E-26 1,081220576 0,849 0,741 2,33344E-22 1,654278224 PLEKHG3 2,06408E-09 1,080503626 0,418 0,264 3,24019E-05 0,303482349 S1PR3 l,09662E-07 1,080397235 0,353 0,175 0,001721466 0,249966146 SLIT3 6,36505E-10 1,07872292 0,267 0,099 9,99185E-06 0,099900146 PPP2R3A 7,73331E-13 1,075716518 0,566 0,384 l,21398E-08 0,56438922 CITED2 1,81727E-17 1,073577495 0,559 0,307 2,85275E-13 0,205383533 LAMCl l,08416E-22 1,068383423 0,861 0,678 l,70192E-18 1,524067657 MAP4 2,20008E-25 1,064053247 0,864 0,732 3,45369E-21 1,420178916 ARID3A 2,51263E-36 1,063048477 0,943 0,761 3,94432E-32 1,305688918 ABTB2 4,66959E-14 1,062625233 0,224 0,073 7,33033E-10 0,052098351 LHFPL2 2,96195E-37 1,062303957 0,96 0,835 4,64966E-33 2,102958361 SC5D 3,76269E-20 1,060710369 0,716 0,607 5,90667E-16 0,799979392 CAPN2 2,80636E-15 1,059252563 0,704 0,507 4,40543E-ll 0,985578899 FKBP14 l,25552E-09 1,053897497 0,394 0,283 l,97092E-05 0,303493256 IDS 3,48674E-13 1,051996437 0,421 0,313 5,47348E-09 0,208890603 CDC42EP3 2,07178E-13 1,051586139 0,491 0,427 3,25228E-09 0,464807617 SGPP1 3,06064E-10 1,045427468 0,33 0,164 4,80459E-06 0,125735127 MALT1 4,58062E-10 1,0441236 0,491 0,327 7,19066E-06 0,418859701 PKIA 7,90795E-12 1,04364575 0,424 0,334 l,24139E-07 0,296503451 NTM 2,4442E-09 1,042366851 0,321 0,238 3,8369E-05 0,235305413 B2M 6,44486E-27 1,041294477 0,883 0,753 l,01171E-22 1,547014877 TRIM8 4,34831E-14 1,041253919 0,431 0,29 6,82598E-10 0,18392329 SLC2A13 l,69671E-07 1,039892362 0,287 0,161 0,002663491 0,164483075
ITGA5 6,10708E-13 1,038730379 0,6 0,38 9,58689E-09 0,454753247
LEPROT 6,58127E-14 1,037396868 0,626 0,441 l,03313E-09 0,599405202
NIDI 5,42733E-13 1,036135906 0,584 0,423 8,51982E-09 0,43948757
ACBD3 6,79134E-16 1,035331106 0,623 0,478 l,0661E-ll 0,536892013
LGALS1 6,65316E-09 1,032583141 0,513 0,355 0,000104441 0,485326042
PRTG 3,2283E-22 1,031570463 1 0,697 5,06778E-18 14,36123362
DGKH l,24604E-07 1,030347374 0,362 0,231 0,001956032 0,315344392
AXL 4,57456E-11 1,029395061 0,452 0,309 7,18114E-07 0,32355782
SH3BP4 l,00008E-09 1,027946062 0,412 0,288 l,56993E-05 0,319861205
MMP15 2,23079E-09 1,027617602 0,422 0,283 3,50189E-05 0,287405654
TRPS1 l,53969E-06 1,019867033 0,224 0,106 0,024170094 0,108821643
TMEM98 l,24504E-28 1,017913543 0,916 0,779 l,95447E-24 2,17380568
PALLD 7,0347E-14 1,01591375 0,689 0,453 l,10431E-09 0,77796513
CACNA2D1 7,32995E-08 1,015174322 0,264 0,165 0,001150655 0,131118482
MIDI 2,71626E-16 1,013354786 0,718 0,537 4,26398E-12 0,918310337
RBP1 9,71377E-13 1,013036523 0,622 0,471 l,52487E-08 0,763575935
COL27A1 5,15098E-14 1,012508305 0,635 0,416 8,08601E-10 0,543005283
KLF5 l,33562E-06 1,012215234 0,26 0,105 0,02096649 0,134667819
SCMH1 4,48858E-08 1,011412555 0,276 0,161 0,000704617 0,153907673
ARHGEF12 2,7885E-11 1,010778484 0,581 0,381 4,37739E-07 0,481356194
MYH10 4,59703E-55 1,010208837 0,985 0,962 7,21641E-51 3,466510881
MAP4K5 2,53989E-17 1,010057562 0,74 0,56 3,98712E-13 0,794719966
FNDC3A 2,17575E-11 1,008077571 0,603 0,445 3,4155E-07 0,659357443
GPC6 2,26595E-09 1,00693171 0,496 0,265 3,55709E-05 0,355078917
FREM2 9,8514E-11 1,006094463 0,452 0,366 l,54647E-06 0,498089528
SUCO l,14742E-20 1,004222235 0,836 0,668 l,80122E-16 1,327970134 pct.l Fraction of mesoderm cells expressing marker genes pct.2 Fraction of other cells expressing marker genes
Gene Name P value Iog2-fold pct.l pct.2 Adjusted P Average change value expression
PAX6 5,7543E-132 4,607547238 0,677 0,043 9,0331E-128 0,530598949
MAP2 8,35646E-84 3,865231406 0,818 0,127 l,3118E-79 0,60335747
PAX3 8,96809E-64 3,696168507 0,67 0,062 l,40781E-59 0,415988489
CRABP1 9,7555E-163 3,678356298 0,946 0,411 1,5314E-158 0,82769064
LHX5-AS1 7,72113E-72 3,675930468 0,508 0,025 l,21206E-67 0,241920089
ZFHX4 5,76188E-59 3,596966521 0,781 0,184 9,045E-55 0,875481717
DLK1 4,28071E-57 3,578868085 0,707 0,154 6,71987E-53 0,667215211
CDH6 2,04471E-60 3,571263152 0,885 0,206 3,20978E-56 1,112776619
ILDR2 6,59423E-54 3,551316154 0,449 0,034 l,03516E-49 0,245852427
NR2F1 2,8939E-79 3,528945627 0,649 0,079 4,54284E-75 0,302755605
SIX3 3,78877E-53 3,469693603 0,39 0,017 5,94761E-49 0,174496295
EDNRA l,70819E-44 3,398188533 0,495 0,105 2,68152E-40 0,348280993
EFNA5 l,33654E-74 3,37577454 0,79 0,249 2,0981E-70 0,663327506
FST l,86929E-82 3,348722778 0,991 0,519 2,93441E-78 4,389127097
TPBG 7,59807E-72 3,217748886 0,779 0,329 l,19274E-67 0,875662219
GFRA1 6,75438E-54 3,194101325 0,484 0,075 l,0603E-49 0,229963727
ATP1A2 8,43674E-54 3,16530538 0,672 0,16 l,3244E-49 0,428469889
PCDH8 l,03073E-45 3,100206336 0,521 0,057 l,61805E-41 0,21892764
OTX2 9,38714E-50 3,06719557 0,798 0,281 l,47359E-45 1,04941845
LGI1 8,28696E-30 3,034941656 0,377 0,041 l,30089E-25 0,204046594
PTN 2,80726E-83 2,956666477 0,948 0,532 4,40684E-79 1,837755718
LHX5 5,92433E-37 2,918731212 0,356 0,013 9,30002E-33 0,115320232
MIAT l,19278E-42 2,845034404 0,651 0,229 l,87243E-38 0,53852554
PLCHI l,97204E-31 2,823959018 0,516 0,14 3,0957E-27 0,370902967
NAV3 2,77688E-27 2,783369379 0,284 0,045 4,35915E-23 0,148734201
COL2A1 2,03852E-31 2,778490167 0,755 0,188 3,20007E-27 0,803103104
SP5 l,54122E-37 2,775261607 0,573 0,115 2,4194E-33 0,268886773
SKIDA1 9,5738E-35 2,764205108 0,555 0,107 l,50289E-30 0,261414256
SOX2 5,34274E-67 2,702462125 0,907 0,378 8,38704E-63 0,800349122
RFX4 3,47137E-24 2,692322151 0,297 0,026 5,44935E-20 0,128008027
DRAXIN l,43817E-34 2,683615565 0,599 0,167 2,25763E-30 0,348604492
EPHB1 l,63924E-27 2,665503882 0,38 0,078 2,57328E-23 0,18575004
ZIC2 2,78342E-70 2,641215348 0,855 0,467 4,36941E-66 0,958531672
PTPRZ1 9,60427E-68 2,640073329 0,876 0,466 l,50768E-63 1,037943371
SRGAP3 l,71176E-28 2,627161651 0,456 0,113 2,68712E-24 0,244394499
DPYSL5 2,55923E-38 2,624883056 0,527 0,104 4,01748E-34 0,207328623
FILIP1 7,43756E-19 2,619952011 0,33 0,06 1,16755E-14 0,196105725
TFAP2A 3,4979E-29 2,611489501 0,603 0,133 5,491E-25 0,286912363
GREB1L 2,84194E-44 2,603167695 0,909 0,383 4,46127E-40 1,246766296
NCALD 4,00151E-22 2,591577784 0,334 0,056 6,28157E-18 0,163555677
PLP1 3,33544E-41 2,534517052 0,711 0,347 5,23597E-37 0,680485457
RNF165 2,51144E-31 2,530729456 0,434 0,11 3,94245E-27 0,180986045
SYT11 6,75778E-29 2,510837188 0,486 0,163 l,06084E-24 0,285706206
SOX9 4,61774E-26 2,504073655 0,373 0,15 7,24893E-22 0,231216249
MYLK 2,43593E-27 2,485734168 0,456 0,191 3,82393E-23 0,348884283
FZD3 7,6335E-74 2,48161221 0,963 0,598 l,19831E-69 1,592586778
SOX5 6,03217E-20 2,472321473 0,438 0,127 9,4693E-16 0,287460745
HS6ST2 2,95015E-23 2,45783979 0,525 0,147 4,63115E-19 0,311224402 0LFM3 l,30925E-20 2,443760348 0,256 0,026 2,05527E-16 0,093173209 TRIL 1,49867E-17 2,394728872 0,328 0,068 2,35261E-13 0,160649855 NLRP1 l,2558E-28 2,39387912 0,49 0,144 l,97136E-24 0,217152744 CASZ1 l,73133E-24 2,382856616 0,338 0,033 2,71785E-20 0,111501727 SDK2 5,39526E-35 2,375017607 0,597 0,176 8,46947E-31 0,233754391 MYEF2 6,39992E-46 2,367315383 0,666 0,285 l,00466E-41 0,326581453 MN1 l,23916E-32 2,340781746 0,466 0,116 l,94524E-28 0,150596428 MAPK10 3,89033E-17 2,337739159 0,466 0,091 6,10704E-13 0,250912881 NRXN3 2,5796E-18 2,336062557 0,397 0,103 4,04946E-14 0,211610868 SLC35F1 8,82747E-24 2,333360986 0,393 0,119 1,38574E-19 0,185334728 NR2F2 6,11377E-23 2,307298322 0,525 0,179 9,5974E-19 0,317719363 SOX11 5,06676E-70 2,306725342 0,978 0,653 7,9538E-66 1,617563975 ENCI 3,03901E-23 2,27384721 0,692 0,276 4,77064E-19 0,759091139 RMST 2,31924E-29 2,264322023 0,328 0,103 3,64075E-25 0,129614642 ZNF521 3,99396E-23 2,263402258 0,612 0,21 6,26971E-19 0,419631572 ARL4C 6,09244E-40 2,252815593 0,905 0,486 9,56392E-36 1,48364191 LPAR4 l,2686E-29 2,224647208 0,486 0,146 l,99144E-25 0,172685765 AUTS2 7,19596E-44 2,208677858 0,831 0,475 l,12962E-39 0,85851951 IRX2 4,41041E-35 2,20328805 0,731 0,343 6,92346E-31 0,48768736 CXCR4 1,3298E-14 2,187497727 0,338 0,065 2,08753E-10 0,156857818 PMEL l,59805E-26 2,182747895 0,772 0,316 2,50861E-22 0,943668931 NRCAM 1,22427E-16 2,166343146 0,479 0,149 1,92186E-12 0,340879465 TLE4 4,83533E-46 2,164533701 0,826 0,521 7,5905E-42 0,942902581 CDH4 5,5416E-24 2,160264306 0,354 0,113 8,6992E-20 0,141852917 CELSR2 4,39826E-27 2,12986608 0,514 0,121 6,90439E-23 0,164368515 WSCD1 l,75492E-20 2,129685114 0,341 0,133 2,75487E-16 0,180714974 NR2F1-AS1 3,23893E-13 2,107106153 0,204 0,024 5,08447E-09 0,080584589 CPE l,70284E-21 2,105658884 0,651 0,287 2,67312E-17 0,575859148 POU3F2 1,21373E-14 2,105340831 0,325 0,048 l,90531E-10 0,119976565 GLI3 l,97755E-36 2,10531365 0,813 0,431 3,10435E-32 0,685898999 GRAMD1B l,04094E-21 2,09262193 0,325 0,137 l,63407E-17 0,163988882 SYNE2 7,27875E-62 2,09067868 0,965 0,739 l,14262E-57 2,324076667 CDON l,55022E-17 2,086615094 0,523 0,178 2,43354E-13 0,342977832 SLC7A11 6,9299E-35 2,084845643 0,792 0,499 l,08786E-30 1,024996872 FIGN 3,97777E-26 2,084489169 0,803 0,402 6,24431E-22 1,042025781 TMEM132C 3,41956E-14 2,077417536 0,354 0,074 5,36802E-10 0,149961601 LFNG 5,34948E-28 2,074891869 0,547 0,16 8,39762E-24 0,196127415 STOX2 7,13846E-25 2,058106965 0,505 0,254 l,12059E-20 0,31043501 COL9A1 6,24493E-19 2,044849674 0,356 0,085 9,80328E-15 0,122105713 PAX7 l,75037E-14 2,020281087 0,23 0,013 2,74772E-10 0,05576621 PPP1R9A 2,01538E-21 2,018776162 0,542 0,27 3,16375E-17 0,457864232 PEG3 2,89095E-33 2,005216491 0,898 0,523 4,53822E-29 1,243850618 KCNK1O 8,51496E-10 1,991220367 0,204 0,04 l,33668E-05 0,12054399 SHROOM3 2,72308E-19 1,987126002 0,447 0,21 4,27469E-15 0,264136671 EMX2 9,65216E-18 1,980803085 0,273 0,014 1,5152E-13 0,054169303 IGFBP5 1,36855E-15 1,976068365 0,534 0,187 2,14834E-11 0,366340827 SACS 4,15268E-30 1,972534684 0,757 0,439 6,51887E-26 0,773621256 TOX3 1,21753E-11 1,970911199 0,36 0,129 l,91128E-07 0,223190002 TTYH1 5,2154E-25 1,965469892 0,445 0,099 8,18713E-21 0,123692196 BOC 4,19675E-15 1,949013422 0,351 0,086 6,58806E-ll 0,137259997 EFR3B 2,47725E-14 1,944951711 0,397 0,133 3,88879E-10 0,226915625 FAT3 5,15332E-18 1,922192569 0,471 0,249 8,08968E-14 0,347340536 LSAMP l,09186E-13 1,919521674 0,43 0,154 l,714E-09 0,263353606 0LIG3 7,51897E-11 1,918877431 0,193 0,015 l,18033E-06 0,05573433 YPEL1 4,91375E-12 1,912173874 0,271 0,085 7,7136E-08 0,135710251 N0VA1 l,37101E-24 1,907849252 0,462 0,224 2,15221E-20 0,222992655 JAG1 4,09897E-19 1,885401144 0,573 0,266 6,43456E-15 0,421622017 FHL1 l,91089E-19 1,87424856 0,477 0,246 2,99971E-15 0,278129277 PRRT2 2,29814E-23 1,857295429 0,401 0,118 3,60762E-19 0,118190837 ANK2 8,51361E-17 1,855434203 0,568 0,271 1,33647E-12 0,45565997 FAT1 9,54402E-34 1,847112853 0,831 0,584 l,49822E-29 1,172651908 CCDC160 6,176E-13 1,839545726 0,384 0,145 9,69508E-09 0,236473385 SCUBE1 6,22124E-13 1,814606807 0,217 0,052 9,76611E-09 0,080477786 C21orf58 6,84527E-22 1,813615268 0,64 0,338 l,07457E-17 0,548352165 CRABP2 l,22759E-66 1,807370143 0,965 0,794 l,92707E-62 1,408265586 NBEA l,3601E-15 1,801259854 0,462 0,261 2,13509E-ll 0,375357553 CACHD1 7,72384E-22 1,800744547 0,633 0,365 1,21249E-17 0,495822991 E2F7 5,15499E-15 1,780291997 0,456 0,232 8,09231E-ll 0,338683402 SPHK1 1,17294E-13 1,762798801 0,252 0,065 l,84129E-09 0,087320871 VAT1L 7,89096E-15 1,762021016 0,555 0,258 l,23872E-10 0,347138453 KIF5C 3,75886E-31 1,760586131 0,783 0,518 5,90066E-27 0,872362904 NIN 1,4574E-16 1,749981198 0,629 0,318 2,28783E-12 0,551908968 ADGRL3 1,37531E-12 1,741025751 0,44 0,178 2,15896E-08 0,234787215
TIAM1 2,28507E-14 1,732685441 0,538 0,245 3,5871E-10 0,342604437 AMPH l,09805E-08 1,729800106 0,291 0,089 0,000172372 0,169459404 COL11A2 2,89672E-11 1,724220733 0,187 0,023 4,54726E-07 0,047996769 IL17RD 3,04378E-15 1,723603151 0,471 0,208 4,77813E-11 0,253012352 CNTNAP2 2,52551E-36 1,720741618 0,926 0,667 3,96455E-32 1,698353363 ASPM 4,77044E-35 1,713150905 0,913 0,691 7,48864E-31 1,982514564 GNAZ 2,22855E-16 1,701931319 0,358 0,104 3,49837E-12 0,106341997 EFNB2 5,58334E-16 1,7000324 0,72 0,379 8,76472E-12 0,762945716 SLITRK5 3,96237E-12 1,692130275 0,176 0,048 6,22013E-08 0,055575011 CD47 2,48921E-17 1,689641293 0,575 0,369 3,90757E-13 0,494363696 EPHA4 3,27439E-15 1,68775914 0,685 0,33 5,14014E-ll 0,819706409 CENPF l,10964E-81 1,686313166 1 0,959 l,74191E-77 7,369481172 NUCKS1 3,0402E-126 1,681803652 1 0,986 4,7725E-122 4,057673823 NCAN 2,7899E-13 1,675149325 0,256 0,034 4,37959E-09 0,059273715 CHML 2,38878E-17 1,650503588 0,525 0,333 3,74991E-13 0,349882732 ERBB3 2,31695E-14 1,645960014 0,538 0,333 3,63714E-10 0,575905352 LRP4 4,44338E-12 1,643790093 0,341 0,158 6,97522E-08 0,184095727 KNTC1 7,62975E-22 1,643237598 0,683 0,472 1,19772E-17 0,722275052 NR6A1 9,7155E-65 1,638185864 0,983 0,898 l,52514E-60 2,879248012 PRPF19 l,69384E-32 1,638019337 0,67 0,398 2,659E-28 0,252221989 NOG 6,29121E-16 1,631246827 0,247 0,068 9,87593E-12 0,068532769 RNF157 5,25117E-11 1,629048133 0,416 0,167 8,24329E-07 0,248159846 ZEB2 l,64402E-16 1,624708304 0,79 0,405 2,58078E-12 0,861881214 ADGRV1 7,72172E-14 1,623446188 0,536 0,305 l,21216E-09 0,482362807 WLS 7,58372E-23 1,619546781 0,839 0,486 l,19049E-18 0,90216448 PLCB4 3,71855E-11 1,616205265 0,529 0,261 5,83739E-07 0,515179124 CERKL 4,59027E-08 1,609773785 0,171 0,02 0,00072058 0,054296558 CIT 1,41221E-18 1,604221431 0,566 0,347 2,21689E-14 0,369104199 SLC6A8 l,38008E-21 1,592550464 0,603 0,355 2,16645E-17 0,317657087 CCDC152 4,21323E-13 1,592177709 0,395 0,298 6,61393E-09 0,346313032 PLEKHG1 7,32897E-07 1,590672295 0,115 0,04 0,011505021 0,065043867 ZNF462 2,71874E-36 1,590391292 0,892 0,655 4,26788E-32 0,964661971 SALL3 6,41039E-13 1,589033579 0,492 0,288 l,0063E-08 0,380819523 WNT2B 7,21364E-09 1,586075041 0,167 0,074 0,00011324 0,092892596 GPC3 1,OO22E-21 1,58205666 0,816 0,604 1,57326E-17 2,013388232 CNKSR3 8,87909E-10 1,576095915 0,443 0,175 l,39384E-05 0,259712937 ZNF829 3,88652E-11 1,575757955 0,269 0,158 6,10106E-07 0,135424935 NEBL 3,01281E-08 1,56706697 0,466 0,189 0,000472951 0,31943455 CCDC88C 3,60577E-16 1,565966094 0,369 0,217 5,66034E-12 0,160287217 ZNRF3 9,84632E-11 1,56512049 0,412 0,197 l,54568E-06 0,226005356 AXIN2 3,80355E-ll 1,561361084 0,388 0,21 5,97081E-07 0,237141525 THBS3 6,93832E-10 1,558967279 0,432 0,168 l,08918E-05 0,220217009 DRD4 l,05343E-09 1,553182002 0,187 0,024 l,65367E-05 0,043865738 S0X3 4,86019E-14 1,551588737 0,2 0,056 7,62952E-10 0,0514375 TNFRSF19 l,36552E-09 1,550179239 0,43 0,166 2,1436E-05 0,262126391 ADAMTS19 4,44469E-11 1,549808864 0,514 0,283 6,97727E-07 0,402565355 ADAM 23 7,38463E-16 1,549043969 0,443 0,223 1,15924E-11 0,210458369 RTKN2 9,37448E-16 1,547691404 0,443 0,258 1,47161E-11 0,225366361 DNER 6,14648E-11 1,545495742 0,165 0,044 9,64875E-07 0,04984088 B3GAT1 1,26278E-13 1,538416364 0,223 0,067 l,98232E-09 0,063560078 MMS22L 4,04626E-16 1,521973723 0,618 0,41 6,35181E-12 0,570947167 RFX3 3,3344E-10 1,520542561 0,458 0,21 5,23435E-06 0,254723315 HECTD2 l,09457E-09 1,515842494 0,354 0,184 l,71825E-05 0,21097732 PGAP1 l,06752E-15 1,515340152 0,675 0,411 1,67579E-11 0,578680003 EML1 l,04932E-10 1,509275307 0,403 0,224 l,64722E-06 0,266338984 MZF1 l,57537E-10 1,507876779 0,369 0,18 2,47301E-06 0,200474042 CNTRL 6,76689E-11 1,50670662 0,453 0,272 l,06227E-06 0,378248213 DYNLL2 2,21165E-24 1,49642955 0,835 0,564 3,47184E-20 0,688319142 FZD7 4,44107E-23 1,496248458 0,69 0,51 6,97159E-19 0,523107142 NCAPG 5,48402E-15 1,493923497 0,603 0,384 8,60882E-ll 0,476547336 MLLT10 2,10087E-16 1,487519358 0,553 0,417 3,29794E-12 0,522015766 EFNB1 5,73405E-10 1,486233116 0,44 0,24 9,00131E-06 0,27731167 LRIG1 8,55306E-17 1,483082517 0,323 0,195 1,34266E-12 0,121548313 EGFEM1P l,51468E-07 1,48073916 0,167 0,038 0,002377739 0,065252853 ZIC5 7,30169E-15 1,47990082 0,432 0,241 l,14622E-10 0,187147098 BTBD3 2,18556E-14 1,479505112 0,523 0,339 3,4309E-10 0,367275202 SCRG1 7,67475E-07 1,479208596 0,137 0,019 0,012047823 0,036818202 CCND1 l,06711E-19 1,472976152 0,761 0,476 1,67515E-15 0,623832255 STRA6 2,91593E-09 1,472557404 0,505 0,242 4,57743E-05 0,397539445 APLP1 1,64763E-14 1,4679279 0,406 0,241 2,58645E-10 0,201248386 CELF2 1,97614E-11 1,466242577 0,603 0,338 3,10214E-07 0,461006099 NRIP1 3,29426E-11 1,465683756 0,601 0,356 5,17133E-07 0,634847215 CDH2 3,47858E-23 1,462845753 0,931 0,629 5,46068E-19 1,690101225 CPT1C 3,13435E-11 1,462292564 0,495 0,228 4,92031E-07 0,269101878 LRP2 2,5078E-08 1,461524291 0,553 0,281 0,000393675 0,787226726 TIAM2 2,32663E-08 1,458695258 0,351 0,184 0,000365234 0,229611745 RAB11FIP2 2,63353E-11 1,454652607 0,423 0,27 4,13412E-07 0,263830495 TUBB2B l,7658E-30 1,449266378 0,918 0,681 2,77196E-26 1,162319603 TRIM2 9,33683E-16 1,447610249 0,651 0,492 1,4657E-11 0,829964874 RCBTB2 l,74358E-09 1,447103088 0,36 0,232 2,73707E-05 0,247088233 PPP1R3E l,1351E-08 1,435467682 0,167 0,071 0,000178188 0,075130329 CLYBL 5,78674E-09 1,435077392 0,356 0,166 9,08402E-05 0,214405789 ITGA6 3,65829E-14 1,429018471 0,605 0,516 5,74278E-10 0,873174712 SAS Hl 2,4202E-20 1,427706767 0,666 0,561 3,79923E-16 0,716278579 PEG10 2,33607E-22 1,427620708 0,805 0,599 3,66716E-18 0,768906101 STK33 2,69504E-08 1,422863163 0,332 0,186 0,000423068 0,241489546 ZDHHC21 l,34454E-09 1,414069657 0,321 0,173 2,11066E-05 0,1663072 TCF12 6,64433E-17 1,41137713 0,714 0,532 l,04303E-12 0,813811528 LMO4 2,19883E-20 1,407783333 0,681 0,522 3,45172E-16 0,494825691 NAVI 3,07479E-17 1,403649098 0,709 0,554 4,8268E-13 0,803608399 NOTCH3 l,03786E-27 1,403564663 0,709 0,522 l,62923E-23 0,347653574 USP49 l,14009E-09 1,402158668 0,343 0,181 l,78972E-05 0,187693936 MMP16 2,04324E-ll 1,39958221 0,445 0,345 3,20747E-07 0,377144121 ROR2 6,06736E-08 1,397580708 0,475 0,193 0,000952454 0,328214105 AFG3L1P 3,55807E-09 1,395229871 0,434 0,238 5,58546E-05 0,275223714 NUP21O 2,01358E-09 1,390944651 0,436 0,221 3,16092E-05 0,297085306 CECR2 l,21485E-23 1,390770461 0,779 0,653 l,90708E-19 0,831798563 AHDC1 2,28944E-14 1,389640804 0,534 0,269 3,59396E-10 0,198621623 PAM l,20117E-13 1,37356826 0,599 0,453 l,8856E-09 0,521936422 LRRC8B 7,24965E-08 1,372337057 0,349 0,208 0,001138051 0,252435371 CEP83 3,55963E-09 1,371487297 0,421 0,279 5,5879E-05 0,359426282 TOP2A 2,29039E-36 1,371484286 0,974 0,904 3,59546E-32 3,729253925 NRP2 7,68841E-15 1,368149016 0,748 0,503 l,20693E-10 0,887162877 NKAIN4 l,85574E-07 1,366799922 0,232 0,077 0,002913144 0,093139532 CACNA1A 1,35466E-12 1,363754434 0,477 0,212 2,12655E-08 0,158474972 EFHC1 l,40478E-08 1,361381615 0,484 0,275 0,000220523 0,425489644 CEP78 5,9896E-19 1,356378873 0,766 0,539 9,40247E-15 0,69535566 ARHGEF2 5,86886E-09 1,355410433 0,351 0,232 9,21294E-05 0,219424692 ADGRL1 2,13463E-20 1,351716854 0,696 0,414 3,35095E-16 0,312385642 BRCA1 1,9379E-14 1,351370355 0,703 0,461 3,04211E-10 0,781218787 APCDD1 l,96541E-07 1,350673336 0,243 0,116 0,003085304 0,120815214 ELK4 3,37582E-08 1,348974756 0,33 0,209 0,000529936 0,203958391 ZNF48 4,08194E-08 1,347200132 0,377 0,228 0,000640783 0,274312327 FEZF1-AS1 l,19403E-08 1,346651428 0,161 0,067 0,000187439 0,061326295 RNFT2 3,77215E-08 1,344795621 0,295 0,151 0,000592151 0,157143064 CDV3 7,08973E-62 1,342992246 0,972 0,956 l,11295E-57 1,602368044 DYNC2H1 3,71761E-11 1,342104186 0,679 0,416 5,8359E-07 0,743523206 CCDC14 3,69222E-24 1,339397281 0,866 0,672 5,79605E-20 1,200722124 CCNG2 2,61793E-11 1,338724374 0,43 0,261 4,10962E-07 0,217849959 NGFR 2,05895E-13 1,336792042 0,284 0,056 3,23215E-09 0,049603068 PDCD7 3,42715E-11 1,336518622 0,425 0,296 5,37994E-07 0,251014835 MDM4 3,41318E-19 1,336171876 0,805 0,635 5,35801E-15 1,214347092 CASP8AP2 4,28263E-15 1,336008752 0,698 0,521 6,72287E-11 0,896915725 GGA1 5,67517E-15 1,336006063 0,636 0,426 8,90888E-ll 0,440560535 ZNF117 1,47915E-11 1,333879729 0,482 0,346 2,32197E-07 0,424452387 CBX5 3,1193E-63 1,333436057 1 0,975 4,89668E-59 4,132119027 ID4 2,21333E-09 1,332958851 0,499 0,275 3,47449E-05 0,385759957 UBE3D l,50929E-08 1,326337917 0,386 0,225 0,000236928 0,251256473 MB0AT2 1,51255E-11 1,325506658 0,536 0,367 2,37441E-07 0,425841205 TARBP1 4,78569E-09 1,320982919 0,497 0,272 7,51258E-05 0,338079365 ETV1 l,40308E-12 1,320842994 0,382 0,324 2,20255E-08 0,26123894 DGCR8 4,42839E-08 1,318283399 0,306 0,171 0,000695168 0,16345614 TNRC6C 4,17474E-14 1,317244838 0,557 0,418 6,5535E-10 0,38641136 ZNF503 2,27441E-11 1,316936504 0,577 0,302 3,57038E-07 0,312278114 KMT2A 3,91356E-31 1,311624267 0,918 0,84 6,1435E-27 1,861826267 ZNF423 l,80104E-15 1,310462567 0,434 0,211 2,82727E-11 0,117753049 MCM2 2,03695E-15 1,310329027 0,703 0,515 3,19761E-11 0,690708244 ATAD5 l,92015E-20 1,310206744 0,79 0,659 3,01426E-16 0,970577573 GABBR1 8,4884E-10 1,310197214 0,538 0,314 l,33251E-05 0,378864712 ZNF704 2,12047E-07 1,309938994 0,427 0,241 0,003328714 0,315780401 LING01 1,89179E-12 1,307674687 0,341 0,201 2,96974E-08 0,128231311 NEMPl l,85917E-10 1,306382923 0,358 0,254 2,91852E-06 0,196984248 ROBO1 l,09621E-14 1,305962475 0,627 0,446 l,72082E-10 0,511180063 PNN l,81004E-44 1,305032707 0,985 0,93 2,84141E-40 3,086177543 SPC24 1,48673E-11 1,305030117 0,445 0,248 2,33387E-07 0,216071865 FANCD2 1,19729E-18 1,303828769 0,746 0,606 1,8795E-14 0,917226836 SMC4 7,2578E-33 1,301043381 0,952 0,852 l,13933E-28 2,25550162 RPIA 9,64443E-10 1,300651108 0,232 0,156 l,51398E-05 0,110961107 LUC7L3 5,08652E-97 1,297674203 1 0,998 7,98482E-93 5,352519108 RGS12 4,21457E-08 1,296396114 0,386 0,235 0,000661604 0,256825049 CEP290 2,04759E-13 1,293359731 0,694 0,483 3,21431E-09 0,82962679 UNC5D l,64042E-08 1,292767263 0,377 0,237 0,000257513 0,236069994 RRM1 8,39889E-27 1,29085699 0,866 0,724 l,31846E-22 1,181318639 VANGL2 8,38641E-20 1,289467196 0,499 0,394 1,3165E-15 0,201795179 GAS1 2,12871E-08 1,287054339 0,358 0,127 0,000334165 0,107553263 RTN 3 l,43295E-27 1,284209963 0,896 0,748 2,24945E-23 1,298401175 CEP295 5,91361E-08 1,282446464 0,434 0,32 0,000928318 0,47752304 DTX4 4,21979E-08 1,281533653 0,527 0,262 0,000662422 0,420860364 QSER1 5,82054E-22 1,28069111 0,805 0,75 9,13709E-18 1,600410945 CEP162 5,03363E-10 1,28050566 0,575 0,406 7,9018E-06 0,656519652 MAGI1 2,50775E-14 1,279833612 0,636 0,488 3,93667E-10 0,547394038 KIF14 2,76837E-10 1,276475632 0,605 0,401 4,34579E-06 0,603540077 RRN3P1 2,03194E-09 1,27479759 0,291 0,162 3,18973E-05 0,135371624 ZSWIM6 l,23946E-07 1,273820198 0,44 0,284 0,001945701 0,378022141 SSBP2 l,95945E-10 1,271619219 0,56 0,379 3,07595E-06 0,484350949 DEK 8,11366E-54 1,268448038 0,993 0,945 l,27368E-49 3,477444643 YLPMl 3,28105E-17 1,2661241 0,774 0,616 5,15059E-13 0,995488944 HNRNPAO 4,98206E-24 1,266016281 0,855 0,743 7,82084E-20 0,915029973 TTC28 4,20903E-08 1,263605921 0,434 0,276 0,000660733 0,304216419 ZFHX3 l,61103E-09 1,262353237 0,664 0,359 2,52899E-05 0,432762422 PAX2 7,5769E-07 1,257652208 0,15 0,033 0,011894216 0,039783407 MDCl 2,69822E-13 1,254620466 0,482 0,466 4,23567E-09 0,428374059 GTSE1 4,03026E-ll 1,254411091 0,588 0,421 6,3267E-07 0,634858882 MSL1 3,33746E-15 1,253495481 0,714 0,531 5,23915E-11 0,656115985 MEX3A 3,5777E-26 1,252705691 0,848 0,632 5,61627E-22 0,559438295 IRS2 6,5753E-11 1,252452778 0,451 0,309 l,03219E-06 0,307288537 FYN l,56068E-13 1,251635364 0,614 0,461 2,44995E-09 0,550691583 PASK l,52662E-06 1,250659376 0,234 0,162 0,023964938 0,147316902 FZD1 5,13046E-08 1,247818973 0,191 0,069 0,00080538 0,057952181 HELLS 2,9863E-32 1,246393633 0,957 0,849 4,6879E-28 2,214976705 BRIP1 4,42471E-08 1,242530023 0,425 0,29 0,000694591 0,365350133 ABI2 2,60256E-20 1,237525788 0,844 0,709 4,08549E-16 1,183000742 KIF15 3,15053E-ll 1,237136648 0,586 0,448 4,9457E-07 0,567798597 FUS 3,18614E-50 1,237051751 1 0,962 5,0016E-46 2,520687468 CACFD1 8,91557E-09 1,235197112 0,43 0,27 0,000139957 0,28318218 ZNF608 3,61446E-24 1,234908056 0,839 0,744 5,67397E-20 0,870376074 ZFP91 l,39084E-13 1,234742433 0,475 0,402 2,18334E-09 0,339857014 FGFBP3 2,58681E-11 1,234194678 0,475 0,331 4,06077E-07 0,27607005 ZGRF1 2,51645E-08 1,232184487 0,427 0,297 0,000395032 0,374349027 FAM20B l,44096E-09 1,230350514 0,425 0,301 2,26202E-05 0,293698893 AKAP13 2,10981E-15 1,229535758 0,781 0,594 3,31198E-11 1,212229492 CCDC88A 2,01182E-27 1,224808056 0,905 0,838 3,15816E-23 1,580400518 EZH2 5,63022E-21 1,22447595 0,818 0,676 8,83832E-17 0,876323794 CCNF 2,36056E-10 1,222565288 0,49 0,304 3,7056E-06 0,338562552 HMGN2 1,99162E-61 1,220841166 0,993 0,966 3,12645E-57 1,696454823 SPAG5 2,01459E-13 1,219989324 0,603 0,456 3,1625E-09 0,555056109 KIF11 1,1591E-12 1,214832615 0,62 0,472 l,81956E-08 0,613049832 PCMl 2,31446E-29 1,213866033 0,957 0,854 3,63324E-25 2,321467973 HNRNPH3 l,50597E-43 1,2123963 0,963 0,925 2,36408E-39 1,762191055 HNRNPUL2 2,58329E-12 1,210404443 0,497 0,365 4,05525E-08 0,299801978 ADCY1 7,07426E-07 1,20645669 0,197 0,111 0,011105175 0,092767428 RND2 8,15132E-11 1,205701987 0,527 0,356 l,27959E-06 0,328092182 GPM6B l,60278E-10 1,204784013 0,618 0,453 2,51605E-06 0,578788491 CHD1 2,08526E-18 1,202813238 0,803 0,692 3,27344E-14 1,258199561 KCTD1 7,38275E-08 1,20220885 0,289 0,166 0,001158944 0,122268651 CENPE l,03433E-17 1,201923223 0,859 0,73 1,6237E-13 1,814702046 GPAT4 l,30302E-ll 1,197122313 0,67 0,47 2,04548E-07 0,614095201 PHC2 2,94093E-09 1,194481036 0,484 0,296 4,61667E-05 0,253310052 CROCC 9,77786E-08 1,19423866 0,312 0,169 0,001534929 0,13934453 PRC1 8,70566E-14 1,191488381 0,642 0,539 l,36661E-09 0,763768711 MKI67 6,4832E-27 1,190797703 0,944 0,88 l,01773E-22 2,972961764 XRCC2 4,95788E-07 1,18861066 0,401 0,264 0,007782882 0,319488486 TRIM71 5,6411E-31 1,187167488 0,946 0,891 8,8554E-27 2,307695793 PCNT l,94238E-10 1,186123365 0,623 0,48 3,04915E-06 0,712503967 CNTFR 1,3159E-17 1,18267554 0,343 0,07 2,06571E-13 0,039178317 PHIP 3,40904E-38 1,181589782 0,989 0,955 5,3515E-34 3,69527591 NFATC4 9,67626E-10 1,179797315 0,49 0,224 l,51898E-05 0,18318687 WNK3 2,99229E-10 1,178377089 0,579 0,458 4,6973E-06 0,584955564 B4GALNT4 2,10748E-09 1,177850468 0,495 0,292 3,30832E-05 0,250152603 TTL 3,39013E-14 1,176767168 0,692 0,617 5,32183E-10 0,743847904 NCAPH2 l,91749E-07 1,174802063 0,464 0,292 0,003010081 0,322621241 FGD4 7,48487E-08 1,173228531 0,393 0,268 0,001174976 0,285558184 KPNB1 6,01163E-59 1,170191496 0,993 0,981 9,43706E-55 3,876411743 SCARNA22 2,08898E-21 1,167548861 0,653 0,435 3,27928E-17 0,215165878 ZBTB10 l,98013E-12 1,16592379 0,664 0,529 3,10841E-08 0,669326137 PAXBP1 3,41531E-17 1,165818244 0,813 0,649 5,36136E-13 0,852622947 BCL7A 4,75146E-08 1,164816495 0,369 0,27 0,000745883 0,236011222 RBBP8 l,40905E-12 1,164543618 0,592 0,54 2,21192E-08 0,679037168 CBX2 4,2325E-09 1,163251223 0,579 0,377 6,64418E-05 0,445988329 SRSF1 2,48157E-34 1,161472176 0,926 0,891 3,89557E-30 1,112216412 MSI2 7,71104E-15 1,160811487 0,627 0,548 l,21048E-10 0,476939628 MAP3K4 6,08219E-09 1,158097773 0,477 0,383 9,54783E-05 0,426526832 ANKRD36C l,98424E-09 1,156961082 0,67 0,415 3,11486E-05 0,640844994 BL0C1S6 2,01609E-12 1,15653007 0,633 0,515 3,16486E-08 0,6327899 GLI2 l,96882E-06 1,154707521 0,39 0,261 0,030906501 0,270521575 AHI1 4,71555E-09 1,154471474 0,575 0,445 7,40248E-05 0,853421457 PCDH18 l,07647E-10 1,153999004 0,497 0,412 l,68984E-06 0,348782606 ZSCAN18 l,51527E-07 1,152505297 0,416 0,304 0,002378666 0,267419278 FAM13B 2,59928E-06 1,15084293 0,414 0,272 0,040803498 0,332361311 ADGRL2 1,69476E-14 1,14988653 0,746 0,658 2,66043E-10 0,839701391 MSI1 5,89863E-11 1,149646817 0,393 0,252 9,25966E-07 0,143723163 TMPO 3,5687E-20 1,148480432 0,818 0,732 5,60214E-16 1,035004885 CDC5L 1,42687E-15 1,147791087 0,768 0,672 2,2399E-11 1,324661265 CIPC l,80772E-07 1,146922581 0,267 0,2 0,002837764 0,145520822 LARGE1 2,99244E-08 1,146124226 0,373 0,266 0,000469753 0,236877562 ARHGAP11A l,99177E-10 1,144542783 0,499 0,401 3,12668E-06 0,36288359 TYMS 3,89001E-20 1,144235646 0,835 0,711 6,10653E-16 0,989650588 EGR1 2,45376E-17 1,143251667 0,922 0,74 3,85192E-13 1,692955405 AGAP1 3,17201E-08 1,14198558 0,358 0,248 0,000497942 0,191851891 PBX3 l,63229E-07 1,141827739 0,536 0,351 0,002562365 0,477851953 BAZ2B 2,28986E-17 1,141741411 0,922 0,772 3,59462E-13 2,073236281 SFRP2 l,75616E-09 1,140887983 0,826 0,439 2,75682E-05 1,510299794 NUF2 7,81469E-10 1,138504663 0,46 0,379 l,22675E-05 0,358315051 POLA1 1,55636E-11 1,137858997 0,727 0,556 2,44317E-07 0,903207789 FKBP5 4,26758E-07 1,134040749 0,423 0,292 0,006699242 0,324620052 GJC1 3,01918E-16 1,133615769 0,805 0,648 4,73951E-12 0,85340215 USP13 3,55447E-07 1,132765805 0,518 0,359 0,005579809 0,504966647 DPY19L3 3,80273E-10 1,127348684 0,557 0,429 5,96953E-06 0,429383339 NUP214 2,3991E-08 1,127134454 0,523 0,406 0,000376611 0,539637951 MCM8 l,77224E-09 1,126186641 0,51 0,389 2,78206E-05 0,399432479 BPTF 4,5529E-35 1,125630872 0,978 0,955 7,14714E-31 3,498254252 CD99L2 4,6716E-08 1,122782878 0,403 0,186 0,000733347 0,137431936 DNAJB2 l,71216E-06 1,121622567 0,453 0,305 0,026877481 0,370944849 DENND5A l,61362E-08 1,119629638 0,451 0,394 0,000253306 0,301605656 AIF1L 9,67635E-15 1,118741313 0,751 0,569 l,51899E-10 0,658169838 RASAL2 4,10914E-08 1,117071898 0,375 0,332 0,000645053 0,281695538 CRNDE l,00116E-07 1,116954704 0,39 0,251 0,001571624 0,218858307 CTBP1 4,12051E-20 1,114714944 0,822 0,718 6,46837E-16 0,670905298 GDF11 l,0877E-07 1,113757126 0,471 0,343 0,001707478 0,377998615 CPXMl 2,12288E-09 1,113540228 0,605 0,323 3,33249E-05 0,335195275 HSP90AA1 l,7904E-lll 1,113479925 1 1 2,8106E-107 23,18319188 MIS18BP1 l,32068E-14 1,111975 0,785 0,682 2,07321E-10 1,199723777 TTBK2 1,23363E-11 1,111247808 0,397 0,396 l,93656E-07 0,225404052 ANP32A 7,93603E-25 1,109008036 0,885 0,856 l,2458E-20 1,27176426 SMC2 4,63803E-17 1,108800728 0,811 0,73 7,28077E-13 1,350837126 NHLRC3 l,24013E-06 1,10616243 0,349 0,252 0,019467578 0,28237654 KIF18A 2,02374E-07 1,106151573 0,377 0,292 0,00317687 0,277422551 PNMA1 4,94835E-08 1,104589661 0,328 0,311 0,000776792 0,21669936 BCAT1 2,65515E-29 1,104312998 0,97 0,899 4,16805E-25 2,881659103 FAM210B 5,98714E-08 1,101394971 0,527 0,406 0,000939862 0,553582128 KHDRBS3 3,68528E-09 1,100942094 0,538 0,499 5,78515E-05 0,637142803 LUC7L 8,07379E-16 1,098770753 0,82 0,709 1,26742E-11 1,177219326 FRYL l,00032E-09 1,097603902 0,616 0,479 l,57031E-05 0,728501998 MYCN 2,01335E-10 1,096139288 0,512 0,424 3,16055E-06 0,353657285 ZDHHC17 l,77621E-06 1,095569929 0,414 0,339 0,0278829 0,388510642 ADGRA3 9,45872E-09 1,095397537 0,536 0,424 0,000148483 0,487231312 PCF11 8,23881E-10 1,095229834 0,553 0,461 l,29333E-05 0,616956057 SPEN 3,92438E-14 1,094682873 0,742 0,658 6,1605E-10 1,003961518 CLSPN l,09314E-ll 1,093953858 0,707 0,569 l,71601E-07 0,907031725 EN02 l,23451E-07 1,093202268 0,477 0,38 0,001937929 0,45700228 SPDL1 2,083E-ll 1,091988087 0,588 0,517 3,26989E-07 0,584936909 HDAC5 8,98775E-08 1,091631004 0,416 0,307 0,001410898 0,258424398 NE01 2,18309E-10 1,090995917 0,586 0,464 3,42702E-06 0,497856766 HSPH1 1,1585E-19 1,09075293 0,911 0,818 1,81862E-15 2,163274306 ANKRD26 l,19639E-09 1,089130667 0,722 0,541 l,8781E-05 0,952967372 SLC25A37 3,73728E-12 1,088745981 0,694 0,571 5,86679E-08 0,745182981 CCDC18 2,37304E-08 1,088418146 0,529 0,4 0,00037252 0,515141138 TCAF1 8,56362E-10 1,087724885 0,633 0,448 l,34432E-05 0,471822346 SLC4A7 3,87577E-10 1,087304079 0,601 0,481 6,08418E-06 0,624775254 HP1BP3 7,64479E-23 1,0845503 0,946 0,845 l,20008E-18 1,9685139 FOXD3 l,53254E-09 1,081427844 0,158 0,06 2,40579E-05 0,028342467 BCORL1 3,25231E-07 1,081163725 0,291 0,161 0,005105473 0,105155743 UBN2 l,06765E-09 1,078647943 0,599 0,572 l,676E-05 0,655818627 SPRED1 3,99646E-08 1,078439207 0,482 0,418 0,000627364 0,430642673 ATM l,1924E-10 1,078159823 0,729 0,587 l,87183E-06 0,958312471 PLCG1 5,56356E-08 1,077681628 0,43 0,305 0,000873367 0,220843553 RGMB 6,2494E-09 1,076813382 0,26 0,115 9,81031E-05 0,074237938 JAKMIP2 l,47488E-06 1,074832886 0,306 0,222 0,023152645 0,196695775 RPL22 4,83006E-60 1,071264371 0,993 0,986 7,58224E-56 2,359521485 DNMT1 l,57179E-27 1,070791 0,959 0,9 2,4674E-23 2,21315659 MBD3 7,01696E-12 1,070685146 0,696 0,512 l,10152E-07 0,507852566 EP400 5,88074E-09 1,068710944 0,523 0,454 9,23158E-05 0,513096533 SUGP2 2,15362E-13 1,068182888 0,82 0,696 3,38075E-09 1,244373719 ARGLU1 7,70428E-42 1,0676824 0,991 0,962 l,20942E-37 3,562095815 APBA2 7,41743E-07 1,066562498 0,388 0,243 0,011643875 0,207284689 PDS5B 8,82562E-15 1,06639801 0,796 0,755 l,38545E-10 1,20546086 WRN 4,1708E-10 1,066136383 0,577 0,476 6,54732E-06 0,543238421 ILF3 8,74307E-44 1,064010586 1 0,983 l,37249E-39 4,086891554 DCUN1D4 l,10519E-10 1,063223306 0,51 0,476 l,73493E-06 0,479901707 NES l,90419E-21 1,062703558 0,974 0,862 2,98919E-17 2,302934399 TUBB2A 3,52046E-17 1,061749255 0,796 0,75 5,52642E-13 0,99601899 GABPB1-AS1 l,73566E-08 1,061283243 0,644 0,49 0,000272464 0,739769358 SOX12 1,77268E-14 1,060988797 0,625 0,511 2,78276E-10 0,329471744 GPCPD1 l,75332E-06 1,060653832 0,451 0,373 0,02752366 0,477960709 EFS 9,23924E-09 1,059381924 0,299 0,159 0,000145038 0,094736422 NAT14 4,78909E-07 1,058866355 0,484 0,331 0,00751791 0,347663238 VPS13C 4,09719E-07 1,058845285 0,536 0,398 0,006431763 0,565170122 TIMELESS 2,09757E-09 1,058178187 0,733 0,545 3,29276E-05 0,985147892 CCDC136 2,17058E-07 1,05803767 0,377 0,287 0,003407372 0,252757479 NUP58 2,30955E-08 1,057256495 0,492 0,42 0,000362553 0,380368494 MPDZ 2,4191E-10 1,057082292 0,672 0,518 3,7975E-06 0,690825683 PSIP1 3,48994E-32 1,055816496 0,993 0,93 5,47851E-28 3,137290183 HIP1 3,47108E-ll 1,055781362 0,694 0,559 5,4489E-07 0,7644309 CAMSAP1 2,86922E-07 1,055666329 0,453 0,398 0,0045041 0,437279887 TTK 7,99647E-09 1,055379638 0,549 0,447 0,000125529 0,507399998 NAA40 l,60608E-09 1,054062149 0,56 0,374 2,52122E-05 0,305207704 ZFP36L1 l,18906E-24 1,051596758 0,918 0,864 l,86659E-20 1,260281785 DPYSL2 3,22796E-20 1,050893243 0,883 0,805 5,06726E-16 1,143661125 RAB3B l,08635E-ll 1,050196284 0,709 0,624 l,70536E-07 1,121569452 WDHD1 4,81441E-10 1,049942753 0,638 0,51 7,55766E-06 0,668185765 MCM10 6,08979E-10 1,044798045 0,638 0,517 9,55975E-06 0,643106288 GPR161 2,31767E-07 1,044689575 0,538 0,371 0,003638278 0,470860215 NASP 9,89541E-68 1,044519153 1 0,996 l,55338E-63 6,984075082 LIN28B 4,24654E-13 1,044326724 0,722 0,69 6,66622E-09 0,963719966 POLE 3,72808E-08 1,043047729 0,566 0,417 0,000585233 0,448146592 RIC8B 7,30501E-07 1,042636563 0,358 0,276 0,0114674 0,254541902 UNG 5,20018E-ll 1,04163171 0,607 0,517 8,16324E-07 0,448862319 TNRC6B 6,63521E-21 1,040655329 0,939 0,88 l,04159E-16 1,889602889 GPATCH2L l,6861E-10 1,039866266 0,675 0,552 2,64684E-06 0,843337841 SPAG9 l,0502E-10 1,039842939 0,703 0,629 l,6486E-06 0,81348875 RHOB 4,58687E-15 1,038971031 0,525 0,299 7,20048E-ll 0,121491245 CELF5 l,61709E-06 1,038659096 0,154 0,045 0,025385011 0,035888849 VEZF1 1,81626E-11 1,038045266 0,688 0,592 2,85116E-07 0,725001554 JOSD1 2,73684E-07 1,037918334 0,445 0,396 0,004296298 0,400492754 BTG1 3,03613E-ll 1,037185334 0,722 0,639 4,76612E-07 0,892281662 ZNF518A 2,05572E-12 1,036944841 0,759 0,63 3,22706E-08 1,090575029 SPPL3 l,11378E-08 1,033853523 0,579 0,452 0,000174841 0,472626122 RIF1 2,22717E-22 1,033627428 0,933 0,898 3,49621E-18 2,34794607 TIAL1 l,05599E-12 1,032370991 0,718 0,675 l,65769E-08 0,701878094 MAPK8 4,6525E-08 1,031172748 0,362 0,372 0,000730349 0,274850805 DYRK1A l,65151E-06 1,029666469 0,486 0,417 0,025925399 0,501831074 SFPQ 8,1854E-48 1,028617131 1 0,995 l,28494E-43 5,53949714 RAD21 l,07727E-23 1,028410227 0,978 0,949 1,6911E-19 2,885103635 NRDE2 3,59834E-07 1,028166975 0,456 0,366 0,00564867 0,411043283 DNM1 2,04228E-10 1,027657708 0,373 0,215 3,20598E-06 0,097673219 KLHL42 2,04523E-06 1,027290655 0,456 0,386 0,032106047 0,432367944 SNRNP48 6,16091E-07 1,027134597 0,416 0,384 0,009671391 0,448958534 LRP6 5,68618E-10 1,027099971 0,607 0,553 8,92616E-06 0,58817473 ACVR2B 2,39835E-14 1,025970981 0,846 0,739 3,76492E-10 1,218118219 KNL1 5,43673E-08 1,024610076 0,61 0,46 0,000853457 0,704831432 PARP1 9,45154E-23 1,02176039 0,948 0,867 1,4837E-18 2,244193237 KIF4A l,93299E-07 1,020410039 0,623 0,444 0,003034413 0,733504996 SH3KBP1 3,07427E-06 1,019504557 0,419 0,34 0,048259819 0,308073378 CLU 6,60727E-15 1,019459496 0,881 0,748 l,03721E-10 1,138635231 FANCI l,64854E-09 1,017850582 0,677 0,558 2,58788E-05 0,67742258 ALDH7A1 8,30635E-22 1,014493732 0,907 0,861 l,30393E-17 1,548290099 CDK12 7,48709E-09 1,012963884 0,642 0,5 0,000117532 0,562343611 DLGAP5 1,42764E-11 1,012054664 0,764 0,655 2,24111E-07 1,29048619
FZD2 l,72049E-08 1,011951675 0,668 0,446 0,000270082 0,514253209
PHACTR4 1,84734E-12 1,010100903 0,709 0,64 2,89995E-08 0,802454305
WDR59 l,52916E-06 1,009752474 0,469 0,387 0,024004744 0,45248258
HEXIM1 3,01032E-06 1,009412197 0,338 0,217 0,047256081 0,176814462
SMCHD1 l,06658E-09 1,007808164 0,711 0,613 l,67432E-05 0,825268907
DNMT3A 2,72535E-13 1,007180961 0,839 0,728 4,27825E-09 1,206066585
PSMA3-AS1 l,02873E-07 1,007134544 0,614 0,483 0,001614903 0,651716103
SAMD1 3,97654E-15 1,007106095 0,594 0,404 6,24237E-11 0,177383761
TBL1X 6,75537E-13 1,006328541 0,87 0,75 l,06046E-08 1,3830753
TPX2 3,83759E-19 1,005941772 0,954 0,857 6,02425E-15 2,71218913
ZNF664 6,49847E-09 1,005633395 0,664 0,541 0,000102013 0,835472534
GIGYF1 l,84666E-10 1,002331621 0,512 0,329 2,89888E-06 0,160807234
BAZ1B 5,45068E-20 1,00168113 0,939 0,876 8,55648E-16 2,402258639
Ml Bl 4,08187E-09 1,00106034 0,584 0,497 6,40772E-05 0,528556222
R3HDM2 2,32733E-07 1,000677584 0,341 0,32 0,003653444 0,223950656
CCDC150 8,07384E-07 1,000329985 0,518 0,345 0,012674306 0,454183802
SDC3 l,12248E-07 1,000194923 0,371 0,189 0,001762064 0,113024214 pct.l Fraction of ectoderm cells expressing marker genes pct.2 Fraction of other cells expressing marker genes

Claims

Patentansprüche
1 . Verfahren zur qualitativen Kontrolle mindestens einer spezifischen Eigenschaft mindestens einer Stammzelle, welches umfasst:
- Isolieren mindestens eines Nukleinsäuremoleküls der Stammzelle;
- Bestimmen des jeweiligen Methylierungsgrads von mindestens einer spezifischen Region des Nukleinsäuremoleküls, wobei die spezifische Region mindestens ein CpG-Dinukleotid umfasst;
- Ermitteln mindestens eines Kontrollwerts aus dem bestimmten Methylierungsgrad; und
- Vergleichen des Kontrollwerts mit mindestens einem Referenzwert, wobei das Ergebnis des Vergleichs die spezifische Eigenschaft der Stammzelle unmittelbar anzeigt.
2. Verfahren nach Anspruch 1 , dadurch gekennzeichnet, dass die spezifische Eigenschaft das pluripotente Differenzierungspotenzial der Stammzelle umfasst.
3. Verfahren nach Anspruch 2, dadurch gekennzeichnet, dass der Kontrollwert aus der Summe der bestimmten Methylierungsgrade ermittelt wird.
4. Verfahren nach Anspruch 2 oder 3, dadurch gekennzeichnet, dass das CpG-Dinukleotid ausgewählt ist aus der Gruppe bestehend aus den CpG- Dinukleotiden cg00661673, cg00933813 und cg21699252.
5. Verfahren nach einem der Ansprüche 1 bis 4, dadurch gekennzeichnet, dass die spezifische Eigenschaft die keimblatt-spezifische Differenzierung der Stammzelle umfasst.
6. Verfahren Anspruch 5, dadurch gekennzeichnet, dass der Kontrollwert aus der Summe der bestimmten Methylierungsgrade abzüglich der entsprechenden gemittelten Methylierungsgrade undifferenzierter Stammzellen ermittelt wird, wobei die Werte der bestimmten Methylierungsgrade im Fall von hypomethylierten CpG-Dinukleotiden invers berücksichtigt werden. Verfahren nach Anspruch 5 oder 6, dadurch gekennzeichnet, dass das CpG-Dinukleotid zur Bestimmung der Differenzierung in Richtung der unterschiedlichen Keimblätter jeweils mindesteines der folgenden CpG- Dinukleotide umfasst:
- Endoderm: cg20548013, cg14521421 und cg08913523;
- Mesoderm: cg14708360, cg08826152 und cg11599718;
- Ektoderm: cg01907071 , cg18118164 und cg13075942;
- Endoderm/Mesoderm: cg23385847, cg24919344 und cg11147278. Verfahren nach einem der Ansprüche 1 bis 7, dadurch gekennzeichnet, dass die Stammzellen pluripotente Stammzellen (PSCs), induzierte pluripotente Stammzellen (iPSCs), embryonale Stammzellen (ESCs) und/oder direkt reprogrammierte Zellen, die durch direkte Konversion in andere Zelltypen abgeleitet wurden, sind. Verwendung mindestens eines Nukleinsäuremoleküls, welches zumindest eines der CpG-Dinukleotide cg00661673, cg00933813 und cg21699252 umfasst, zur Bestimmung des pluripotenten Differenzierungspotenzials mindestens einer Stammzelle. Verwendung mindestens eines Nukleinsäuremoleküls, welches zumindest ein CpG-Dinukleotid umfasst, zur Bestimmung der keimblatt-spezifischen Differenzierung mindestens einer Stammzelle, wobei das CpG-Dinukleotid zur Bestimmung der Differenzierung in Richtung eines der unterschiedlichen Keimblätter aus einer der folgenden Gruppen ausgewählt ist:
- Endoderm: cg20548013, cg14521421 und cg08913523;
- Mesoderm: cg14708360, cg08826152 und cg11599718;
- Ektoderm: cg01907071 , cg18118164 und cg13075942;
- Endoderm/Mesoderm: cg23385847, cg24919344 und cg11147278.
PCT/EP2023/074971 2022-09-14 2023-09-12 Verfahren zur qualitativen kontrolle von stammzellen WO2024056635A1 (de)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
DE102022123546.7 2022-09-14
DE102022123546 2022-09-14
DE102023105548.8A DE102023105548A1 (de) 2022-09-14 2023-03-07 Verfahren zur qualitativen Kontrolle von Stammzellen
DE102023105548.8 2023-03-07

Publications (1)

Publication Number Publication Date
WO2024056635A1 true WO2024056635A1 (de) 2024-03-21

Family

ID=88207433

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2023/074971 WO2024056635A1 (de) 2022-09-14 2023-09-12 Verfahren zur qualitativen kontrolle von stammzellen

Country Status (1)

Country Link
WO (1) WO2024056635A1 (de)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012037456A1 (en) * 2010-09-17 2012-03-22 President And Fellows Of Harvard College Functional genomics assay for characterizing pluripotent stem cell utility and safety

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012037456A1 (en) * 2010-09-17 2012-03-22 President And Fellows Of Harvard College Functional genomics assay for characterizing pluripotent stem cell utility and safety

Non-Patent Citations (38)

* Cited by examiner, † Cited by third party
Title
"Assessment of established techniques to determine developmental and malignant potential of human pluripotent stem cells", NAT COMMUN, vol. 9, 2018, pages 1925
ARYEE, M.J.JAFFE, A.E.CORRADA-BRAVO, H.LADD-ACOSTA, C.FEINBERG, A.P.HANSEN, K.D.IRIZARRY, R.A.: "Minfi: a flexible and comprehensive Bioconductor package for the analysis of Infinium DNA methylation microarrays", BIOINFORMATICS, vol. 30, 2014, pages 1363 - 1369, XP093087605, DOI: 10.1093/bioinformatics/btu049
BOCK, C.KISKINIS, E.VERSTAPPEN, G.GU, H.BOULTING, G.SMITH, Z.D.ZILLER, M.CROFT, G.F.AMOROSO, M.W.OAKLEY, D.H. ET AL.: "Reference Maps of human ES and iPS cell variation enable high-throughput characterization of pluripotent cell lines", CELL, vol. 144, 2011, pages 439 - 452, XP028203109, DOI: 10.1016/j.cell.2010.12.032
BOUMA, M.J.VAN ITERSON, M.JANSSEN, B.MUMMERY, C.L.SALVATORI, D.C.F.FREUND, C.: "Differentiation-Defective Human Induced Pluripotent Stem Cells Reveal Strengths and Limitations of the Teratoma Assay and In Vitro Pluripotency Assays", STEM CELL REPORTS, vol. 8, 2017, pages 1340 - 1353
BUTCHER, L.M.ITO, M.BRIMPARI, M.MORRIS, T.J.SOARES, F.A.C.AHRLUND-RICHTER, L.CAREY, N.VALLIER, L.FERGUSON-SMITH, A.C.BECK, S.: "Non-CG DNA methylation is a biomarker for assessing endodermal differentiation capacity in pluripotent stem cells", NAT COMMUN, vol. 7, 2016, pages 10458
CYPRIS, O.EIPEL, M.FRANZEN, J.ROSSELER, C.THARMAPALAN, V.KUO, C.C.VIERI, M.NIKOLIC, M.KIRSCHNER, M.BRUMMENDORF, T.H. ET AL.: "PRDM8 reveals aberrant DNA methylation in aging syndromes and is relevant for hematopoietic and neuronal differentiation", CLIN EPIGENETICS, vol. 12, 2020, pages 125
DAILY, K.HO SUI, S.J.SCHRIML, L.M.DEXHEIMER, P.J.SALOMONIS, N.SCHROLL, R.BUSH, S.KEDDACHE, M.MAYHEW, C.LOTIA, S. ET AL.: "Molecular, phenotypic, and sample-associated data to describe pluripotent stem cell lines and derivatives", SCI DATA, vol. 4, 2017, pages 170030
DOLGIN, E.: "Putting stem cells to the test", NAT MED, vol. 16, 2010, pages 1354 - 1357
ELSAFI MABROUK, M.H.GOETZKE, R.ABAGNALE, G.YESILYURT, B.SALZ, L.CYPRIS, O.GLUCK, P.LIESENFELDER, S.ZEEVAERT, K.MA, Z. ET AL.: "The spatial self-organization within pluripotent stem cell colonies is continued in detaching aggregates", BIOMATERIALS, vol. 282, 2022, pages 121389, XP086976452, DOI: 10.1016/j.biomaterials.2022.121389
FINAK, G.MCDAVID, A.YAJIMA, M.DENG, J.GERSUK, V.SHALEK, A.K.SLICHTER, C.K.MILLER, H.W.MCELRATH, M.J.PRLIC, M. ET AL.: "MAST: a flexible statistical framework for assessing transcriptional changes and characterizing heterogeneity in single-cell RNA sequencing data", GENOME BIOL, vol. 16, 2015, pages 278
FROBEL, J.BOZIC, T.LENZ, M.UCIECHOWSKI, P.HAN, Y.HENNRARTZ, R.STRATHMANN, K.ISFORT, S.PANSE, J.ESSER, A. ET AL.: "Leukocyte Counts Based on DNA Methylation at Individual Cytosines", CLIN CHEM, vol. 64, 2018, pages 566 - 575, XP009506301, DOI: 10.1373/clinchem.2017.279935
GIFFORD, C.A.ZILLER, M.J.GU, H.TRAPNELL, C.DONAGHEY, J.TSANKOV, A.SHALEK, A.K.KELLEY, D.R.SHISHKIN, A.A.ISSNER, R. ET AL.: "Transcriptional and epigenetic dynamics during specification of human embryonic stem cells", CELL, vol. 153, 2013, pages 1149 - 1163, XP055335662, DOI: 10.1016/j.cell.2013.04.037
GOETZKE, R.FRANZEN, J.OSTROWSKA, A.VOGT, M.BLAESER, A.KLEIN, G.RATH, B.FISCHER, H.ZENKE, M.WAGNER, W.: "Does soft really matter? Differentiation of induced pluripotent stem cells into mesenchymal stromal cells is not influenced by soft hydrogels", BIOMATERIALS, vol. 156, 2018, pages 147 - 158, XP085314418, DOI: 10.1016/j.biomaterials.2017.11.035
HAN, X.CHEN, H.HUANG, D.CHEN, H.FEI, L.CHENG, C.HUANG, H.YUAN, G.C.GUO, G.: "Mapping human pluripotent stem cell differentiation pathways using high throughput single-cell RNA-sequencing", GENOME BIOL, vol. 19, 2018, pages 47
HAO, Y.HAO, S.ANDERSEN-NISSEN, E.MAUCK, W.M.ZHENG, S.BUTLER, A.LEE, M.J.WILK, A.J.DARBY, C.ZAGER, M. ET AL.: "Integrated analysis of multimodal single-cell data", CELL, vol. 184, 2021, pages 3573 - 3587
HE WENYIN ET AL: "Defining Differentially Methylated Regions Specific for the Acquisition of Pluripotency and Maintenance in Human Pluripotent Stem Cells via Microarray", PLOS ONE, vol. 9, no. 9, 24 September 2014 (2014-09-24), US, pages e108350, XP093118369, ISSN: 1932-6203, DOI: 10.1371/journal.pone.0108350 *
HOUSEMAN, E.A.ACCOMANDO, W.P.KOESTLER, D.C.CHRISTENSEN, B.C.MARSIT, C.J.NELSON, H.H.WIENCKE, J.K.KELSEY, K.T.: "DNA methylation arrays as surrogate measures of cell mixture distribution", BMC BIOINFORMATICS, vol. 13, 2012, pages 86, XP021127800, DOI: 10.1186/1471-2105-13-86
INTERNATIONAL STEM CELL, 2018
KOLBERG, L.RAUDVERE, U.KUZMIN, I.VILO, J.PETERSON, H.: "gprofiler2 -- an R package for gene list functional enrichment analysis and namespace conversion toolset g:Profiler", F1000RES, vol. 9, 2020
LENZ MICHAEL ET AL: "Epigenetic Biomarker to Support Classification into Pluripotent and Non-Pluripotent Cells", SCIENTIFIC REPORTS, vol. 5, no. 1, 10 March 2015 (2015-03-10), US, XP093118367, ISSN: 2045-2322, Retrieved from the Internet <URL:https://www.nature.com/articles/srep08973.pdf> DOI: 10.1038/srep08973 *
LENZ, M.GOETZKE, R.SCHENK, A.SCHUBERT, C.VEECK, J.HEMEDA, H.KOSCHMIEDER, S.ZENKE, M.SCHPPERT, A.WAGNER, W.: "Epigenetic biomarker to support classification into pluripotent and non-pluripotent cells", SCIENTIFIC REPORTS, vol. 5, 2015, pages 8973
LOVE, M.I.HUBER, W.ANDERS, S.: "Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2", GENOME BIOL, vol. 15, 2014, pages 550, XP021210395, DOI: 10.1186/s13059-014-0550-8
MOSS, J.MAGENHEIM, J.NEIMAN, D.ZEMMOUR, H.LOYFER, N.KORACH, A.SAMET, Y.MAOZ, M.DRUID, H.ARNER, P. ET AL.: "Comprehensive human cell-type methylation atlas reveals origins of circulating cell-free DNA in health and disease", NAT COMMUN, vol. 9, 2018, pages 5068, XP055615527, DOI: 10.1038/s41467-018-07466-6
MULLER, F.J.GOLDMANN, J.LOSER, P.LORING, J.F.: "A call to standardize teratoma assays used to define human pluripotent cell lines", CELL STEM CELL, vol. 6, 2010, pages 412 - 414
MULLER, F.J.SCHULDT, B.M.WILLIAMS, R.MASON, D.ALTUN, G.PAPAPETROU, E.P.DANNER, S.GOLDMANN, J.E.HERBST, A.SCHMIDT, N.O. ET AL.: "A bioinformatic assay for pluripotency in human cells", NAT METHODS, vol. 8, 2011, pages 315 - 317
NG, E.S.DAVIS, R.P.AZZOLA, L.STANLEY, E.G.ELEFANTY, A.G.: "Forced aggregation of defined numbers of human embryonic stem cells into embryoid bodies fosters robust, reproducible hematopoietic differentiation", BLOOD, vol. 106, 2005, pages 1601 - 1603, XP002501115, DOI: 10.1182/BLOOD-2005-03-0987
O'SHEA, O.STEEG, R.CHAPMAN, C.MACKINTOSH, P.STACEY, G.N.: "Development and implementation of large-scale quality control for the European bank for induced Pluripotent Stem Cells", STEM CELL RES, vol. 45, 2020, pages 101773, XP086164967, DOI: 10.1016/j.scr.2020.101773
ROADMAP EPIGENOMICS, C., KUNDAJE, A., MEULEMAN, W., ERNST, J., BILENKY, M., YEN, A., HERAVI-MOUSSAVI, A., KHERADPOUR, P., ZHANG, Z: "Integrative analysis of 111 reference human epigenomes", NATURE, vol. 518, 2015, pages 317 - 330, XP055434136, DOI: 10.1038/nature14248
SALOMONIS, N.DEXHEIMER, P.J.OMBERG, L.SCHROLL, R.BUSH, S.HUO, J.SCHRIML, L.HO SUI, S.KEDDACHE, M.MAYHEW, C. ET AL.: "Integrated Genomic Analysis of Diverse Induced Pluripotent Stem Cells from the Progenitor Cell Biology Consortium", STEM CELL REPORTS, vol. 7, 2016, pages 110 - 125
SCHMIDT MARCO ET AL: "Epigenetic biomarkers to track differentiation of pluripotent stem cells", STEM CELL REPORTS, vol. 18, no. 1, 1 December 2022 (2022-12-01), United States, pages 145 - 158, XP093118371, ISSN: 2213-6711, DOI: 10.1016/j.stemcr.2022.11.001 *
SCHMIDT, M.MAIE, T.DAHL, E.COSTA, I.G.WAGNER, W.: "Deconvolution of cellular subsets in human tissue based on targeted DNA methylation analysis at individual CpG sites", BMC BIOLOGY, vol. 18, 2020, pages 178
SONTAG, S.BOCOVA, L.HUBENS, W.H.G.NUCHTERN, S.SCHNITKER, M.LOOK, T.SCHRODER, K.M.PLUMAKERS, B.THARMAPALAN, V.WESSIEPE, M. ET AL.: "Toward Clinical Application of Leukocyte Counts Based on Targeted DNA Methylation Analysis", CLIN CHEM., 2022
STEEG, R.MUELLER, S.C.MAH, N.HOLST, B.CABRERA-SOCORRO, A.STACEY, G.N.DE SOUSA, P.A.COURTNEY, A.ZIMMERMANN, H.: "EBiSC best practice: How to ensure optimal generation, qualification, and distribution of iPSC lines", STEM CELL REPORTS, vol. 16, 2021, pages 1853 - 1867
STRONATI, E.GIRALDEZ, S.HUANG, L.ABRAHAM, E.MCGUIRE, G.R.HSU, H.T.JONES, K.A.ESTARAS, C.: "YAP1 regulates the self-organized fate patterning of hESC-derived gastruloids", STEM CELL REPORTS, vol. 17, 2022, pages 211 - 220
TRICHE, T.J., JR.WEISENBERGER, D.J.VAN DEN BERG, D.LAIRD, P.W.SIEGMUND, K.D.: "Low-level processing of Illumina Infinium DNA Methylation BeadArrays", NUCLEIC ACIDS RES, vol. 41, 2013, pages e90
TSANKOV, A.M.AKOPIAN, V.POP, R.CHETTY, S.GIFFORD, C.A.DAHERON, L.TSANKOVA, N.M.MEISSNER, A.: "A qPCR ScoreCard quantifies the differentiation potential of human pluripotent stem cells", NAT BIOTECHNOL, vol. 33, 2015, pages 1182 - 1192
WAGNER, W.: "How to Translate DNA Methylation Biomarkers Into Clinical Practice", FRONT CELL DEV BIOL, vol. 10, 2022, pages 854797
WILLMANN, C.A.HEMEDA, H.PIEPER, L.A.LENZ, M.QIN, J.JOUSSEN, S.SONTAG, S.WANEK, P.DENECKE, B.SCHULER, H.M. ET AL.: "To clone or not to clone? Induced pluripotent stem cells can be generated in bulk culture", PLOS ONE, vol. 8, 2013, pages e65324

Similar Documents

Publication Publication Date Title
Girskis et al. Rewiring of human neurodevelopmental gene regulatory programs by human accelerated regions
Wang et al. CRISPR/Cas9-mediated heterozygous knockout of the autism gene CHD8 and characterization of its transcriptional networks in cerebral organoids derived from iPS cells
Wang et al. Primate-specific endogenous retrovirus-driven transcription defines naive-like stem cells
CN110582578B (zh) 用于细胞类型特异性谱分析以鉴定药物靶标的方法
WO2016103269A1 (en) Populations of neural progenitor cells and methods of producing and using same
Boland et al. Molecular analyses of neurogenic defects in a human pluripotent stem cell model of fragile X syndrome
Etchegaray et al. The histone deacetylase SIRT6 controls embryonic stem cell fate via TET-mediated production of 5-hydroxymethylcytosine
Dawlaty et al. Loss of Tet enzymes compromises proper differentiation of embryonic stem cells
Lun et al. Spatially heterogeneous choroid plexus transcriptomes encode positional identity and contribute to regional CSF production
Roost et al. DNA methylation and transcriptional trajectories during human development and reprogramming of isogenic pluripotent stem cells
Reyes et al. Differing molecular response of young and advanced maternal age human oocytes to IVM
Carosso et al. Precocious neuronal differentiation and disrupted oxygen responses in Kabuki syndrome
Isagawa et al. DNA methylation profiling of embryonic stem cell differentiation into the three germ layers
Miyoshi et al. Erasure of DNA methylation, genomic imprints, and epimutations in a primordial germ-cell model derived from mouse pluripotent stem cells
EP3600362B1 (de) Anordnung aus funktionell integrierten humanen vorderhirnsphäroiden und verfahren zur verwendung dafür
Stelzer et al. Parent-of-origin DNA methylation dynamics during mouse development
JP6948650B2 (ja) 一倍体ヒト胚性幹細胞株と体細胞株およびこれらを作製する方法
US20240000900A1 (en) Compositions and methods for treating diseases associated with an imprinting defect
Rothwell et al. Evaluation and validation of a robust single cell RNA-amplification protocol through transcriptional profiling of enriched lung cancer initiating cells
Ueda et al. Defining developmental trajectories of prosensory cells in human inner ear organoids at single-cell resolution
Mitchell et al. The future of neuroepigenetics in the human brain
WO2024056635A1 (de) Verfahren zur qualitativen kontrolle von stammzellen
Breen et al. Modeling gene x environment interactions in PTSD using glucocorticoid-induced transcriptomics in human neurons
Sainz et al. Genome-wide gene expression analysis in mouse embryonic stem cells
Marques et al. Single-cell transcriptomic profiling of progenitors of the oligodendrocyte lineage reveals transcriptional convergence during development

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23782139

Country of ref document: EP

Kind code of ref document: A1