WO2024050589A1 - Compositions et procédés de production d'arômes de type viande - Google Patents

Compositions et procédés de production d'arômes de type viande Download PDF

Info

Publication number
WO2024050589A1
WO2024050589A1 PCT/AU2023/050407 AU2023050407W WO2024050589A1 WO 2024050589 A1 WO2024050589 A1 WO 2024050589A1 AU 2023050407 W AU2023050407 W AU 2023050407W WO 2024050589 A1 WO2024050589 A1 WO 2024050589A1
Authority
WO
WIPO (PCT)
Prior art keywords
composition
food
biomass
feedstuff
acid
Prior art date
Application number
PCT/AU2023/050407
Other languages
English (en)
Inventor
James Robertson Petrie
Surinder Pal Singh
Anna EL TAHCHY
Pushkar Shrestha
Rosangela Aparecida DEVILLA
Hanh Nguyen
Venkat KONASANI
Original Assignee
Nourish Ingredients Pty Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2022902577A external-priority patent/AU2022902577A0/en
Application filed by Nourish Ingredients Pty Ltd filed Critical Nourish Ingredients Pty Ltd
Publication of WO2024050589A1 publication Critical patent/WO2024050589A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L27/00—Spices; Flavouring agents or condiments; Artificial sweetening agents; Table salts; Dietetic salt substitutes; Preparation or treatment thereof
    • A23L27/20—Synthetic spices, flavouring agents or condiments
    • A23L27/26—Meat flavours
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L27/00—Spices; Flavouring agents or condiments; Artificial sweetening agents; Table salts; Dietetic salt substitutes; Preparation or treatment thereof
    • A23L27/20—Synthetic spices, flavouring agents or condiments
    • A23L27/21—Synthetic spices, flavouring agents or condiments containing amino acids
    • A23L27/215—Synthetic spices, flavouring agents or condiments containing amino acids heated in the presence of reducing sugars, e.g. Maillard's non-enzymatic browning
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/145—Fungal isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/02—Oxygen as only ring hetero atoms
    • C12P17/04—Oxygen as only ring hetero atoms containing a five-membered hetero ring, e.g. griseofulvin, vitamin C
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/42—Hydroxy-carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6436—Fatty acid esters
    • C12P7/6445—Glycerides
    • C12P7/6481—Phosphoglycerides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C12N2500/36—Lipids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/72—Candida
    • C12R2001/73—Candida lipolytica
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/785—Mucor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/85—Saccharomyces
    • C12R2001/865—Saccharomyces cerevisiae

Definitions

  • the present invention broadly relates to use of microbial biomass (e.g. Mortierella spp. biomass), or extracted lipid therefrom, comprising or in combination with one or more lactones and/or one or more 4-hydroxy fatty acids in a food product, beverage product or feedstuff, to compositions comprising biomass and one or more lactones, and to food products, beverage products or feedstuffs comprising the biomass.
  • microbial biomass e.g. Mortierella spp. biomass
  • extracted lipid therefrom comprising or in combination with one or more lactones and/or one or more 4-hydroxy fatty acids in a food product, beverage product or feedstuff
  • compositions comprising biomass and one or more lactones
  • food products, beverage products or feedstuffs comprising the biomass.
  • the present invention further relates to said compositions and food products, beverage products or feedstuffs for producing food-like aromas and/or flavours when heated, in particular for undergoing Maillard reactions.
  • the present invention further relates to
  • the aroma and flavour characteristics of cooked meat are important factors for the eating quality of meat, correlating highly with acceptance and preference by consumers.
  • the aroma and flavour characteristics come from a large number of volatile and non-volatile compounds which are produced during heating of the meat such as by cooking or roasting (see, for example, the reviews by Dashdorj et al. (2015) and Mottram (1998)).
  • These compounds result from several types of chemical reactions, namely Maillard reactions of amino acids or peptides with reducing sugars, lipid oxidation, the interaction between the Maillard reaction products with the lipid-oxidation products, and degradation of other compounds such as some sulphur-containing compounds during cooking or roasting.
  • reaction products are organic and of low molecular weight, including aldehydes, ketones, alcohols, esters, aliphatic hydrocarbons, thiazoles, oxazoles and pyrazines as well as oxygenated heterocyclic compounds such as lactones and alkylfurans. Many of these compounds do not arise during the cooking of meat-substitutes made with plant proteins and fats such as coconut, soy and palm oils, leading to less consumer acceptance of these non-animal products.
  • the present invention is predicated on, at least in part, the unexpected determination that certain biomasses or lipid extracts therefrom comprising or combined with a lactone, in particular a y- lactone, can impart a strong and pleasant food-like, and in particular meat -like, aroma and/or flavour to a food.
  • a lactone in particular a y- lactone
  • This can be achieved using relatively little amounts of biomass or extracted lipid, thus provided an efficient and cost-effective way to enhance the aroma and flavour of food, feedstuff and beverages.
  • the inventors have demonstrated that various yeast and fungal isolates, and in particular Mortierella spp., are effective as flavour and aroma enhancers.
  • compositions capable of producing a food-like aroma and/or flavour when heated comprising: a) Mortierella spp. biomass or extracted lipid therefrom; b) one or more lactones and/or one or more 4-hydroxy fatty acids; c) one or more sugars, sugar alcohols, sugar acids, or sugar derivatives; and d) one or more amino acids or derivatives or salts thereof, or a compound comprising an amino group (e.g. thiamine).
  • the one or more lactones comprise one or more y-lactones.
  • Suitable y-lactones include, for example, y-hexalactone, y-heptalactone, y-octalactone, y- nonalactone, y-decalactone, y-docecalactone and y-undecalactone.
  • the one or more 4-hydroxy fatty acids may be selected from 4 -hydroxyhexanoic acid, 4-hydroxyheptanoic acid, 4-hydroxyoctanoic acid, 4-hydroxynonanoic acid, 4-hydroxydodecanoic acid, 4-hydroxyundecanoic acid and 4-hydroxydecanoic acid.
  • the biomass comprises the lactones and/or the one or more 4-hydroxy fatty acids, while in other examples the biomass is combined with the lactones.
  • the composition comprises less than 5% by weight protein, other than protein provided by the Mortierella spp. biomass.
  • the composition comprises at least about 0.05 mg/mL or mg/g dry Mortierella spp. biomass, based on the volume or weight of the composition excluding the Mortierella spp. biomass. In one example, the composition comprises at least about 1 mg/mL or mg/g dry Mortierella spp. biomass, based on the volume or weight of the composition excluding the Mortierella spp. biomass. In other examples, the composition comprises from about 1 mg/mL or mg/g to about 50 mg/mL or mg/g dry Mortierella spp. biomass or an equivalent amount of wet biomass, based on the volume or weight of the composition excluding the Mortierella spp. biomass. In particular embodiments, the food-like aroma and/or flavour is a meaty aroma and/or flavour.
  • the Mortierella spp. is Mortierella alpina, Mortierella elongata or Mortierella isabellina.
  • the biomass or extracted lipid comprises phospholipids, optionally wherein those phospholipids comprise one or more esterified co6 fatty acids, e.g. arachidonic acid (ARA), dihomo-gammalinolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-co6 (DPA-co6) or y-linolenic acid (GLA).
  • ARA arachidonic acid
  • DGLA dihomo-gammalinolenic acid
  • EDA eicosadienoic acid
  • DTA docosatetraenoic acid
  • DPA-co6 docosapentaenoic acid-co6
  • GLA y-linolenic acid
  • the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives and the one or more amino acids or derivatives or salts thereof are present in the composition in amounts sufficient to produce a food-like aroma and/or flavour when the composition is heated.
  • the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives and the one or more amino acids or derivatives or salts thereof are present in the composition in amounts sufficient to produce one or more volatile compounds selected from 1,3 -dimethyl benzene; p-xylene; ethylbenzene; 2-Heptanone; 2-pentyl furan; Octanal; 1,2-Octadecanediol; 2,4-diethyl-l-Heptanol; 2-Nonanone; Nonanal; l-Octen-3-ol; 2-Decanone; 2-Octen-l-ol, (E)-; 2,4-dimethyl-Benzaldehyde; 2, 3,4,5- Tetramethylcyclopent-2-en-l-ol, 1-octanol, 2-heptanone, 3-octanone, 2, 3 -octanedione, 1-pentanol, 1- hexanol, 2-eth
  • the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives and the one or more amino acids or derivatives or salts thereof are present in the composition in amounts sufficient to produce one or more volatile compounds selected from 2- heptanone, 3-octanone, 2,3-octanedione, 1 -pentanol, 1 -hexanol, 2 -ethyl- 1 -hexanol, 1 -octanol, trans-2- octen-l-ol and 1 -nonanol when the composition is heated.
  • the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives are present in the composition in an amount of from about 5 mmol to about 100 mmol per kg or per L of composition, based on the volume or weight of the composition excluding the Mortierella spp. biomass or extracted lipid.
  • the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives are present in the composition in an amount of at least about 15 mmol per kg or per L of composition, based on the volume or weight of the composition excluding the Mortierella spp. biomass or extracted lipid.
  • the one or more amino acids or derivatives or salts thereof are present in the composition in an amount of from about 5 mmol to about 100 mmol, based on the volume or weight of the composition excluding the Mortierella spp. biomass or lipid. In one example, the one or more amino acids or derivatives or salts thereof are present in the composition in an amount of at least about 15 mmol per kg or per L of composition, based on the volume or weight of the composition excluding the Mortierella spp. biomass or lipid.
  • the one or more sugars, sugar alcohols, sugar acids or sugar derivatives comprise glucose and/or ribose.
  • the one or more sugars, sugar alcohols, sugar acids or sugar derivatives comprise ribose and glucose.
  • the one or more amino acids or derivatives or salts thereof comprise cysteine and/or cystine.
  • the one or more amino acids may also, or alternatively, comprise glutamic acid or a salt thereof.
  • the composition comprises glutamic acid or a salt thereof and a further amino acid, derivative or salt thereof.
  • compositions may also comprise any one or more of, or any combination of, a source of iron, a yeast extract, thiamine, herbs and/or spices and an aqueous component.
  • the composition does not comprise a yeast extract.
  • the composition comprises: a) Mortierella spp. biomass or extracted lipid therefrom; b) one or more lactones and/or one or more 4-hydroxy acids; c) glucose and/or ribose; d) cysteine and/or cystine; e) yeast extract; f) glutamic acid or a salt thereof; g) thiamine; and h) an aqueous component.
  • the composition produces a meaty aroma and/or flavour when heated.
  • the composition is in the form of a food product, beverage product or feedstuff. Accordingly, the food product, beverage product or feedstuff produces a meaty aroma and/or flavour when heated.
  • the composition may be mixed with, or added to, a food product, beverage product or feedstuff, for example wherein the composition is in the form of a powder, particulate or granulated mix.
  • the composition may be mixed with, or be added to, the food product, beverage product or feedstuff prior to heating, after heating the composition, and/or after heating the food product, beverage product or feedstuff.
  • a meaty aroma and/or flavour may be produced.
  • a food product, beverage product or feedstuff comprising a combination of Mortierella spp. biomass or extracted lipid therefrom and one or more lactones and/or one or more 4-hydroxy acids, or a composition or the invention, optionally wherein the food product, beverage product or feedstuff comprises less than 5% dry Mortierella spp. biomass by weight, or an equivalent amount of wet biomass.
  • the food product, beverage product or feedstuff has a meaty aroma and/or flavour.
  • the food product, beverage product or feedstuff produces a meaty aroma and/or flavour when heated.
  • the Mortierella spp. is Mortierella alpina, Mortierella elongata or Mortierella exigua.
  • the phospholipids comprise one or more esterified co6 fatty acids, e.g. arachidonic acid (ARA), dihomo-gammalinolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-co6 (DPA-co6) or y-linolenic acid (GLA).
  • ARA arachidonic acid
  • DGLA dihomo-gammalinolenic acid
  • EDA eicosadienoic acid
  • DTA docosatetraenoic acid
  • DPA-co6 docosapentaenoic acid-co6
  • GLA y-linolenic acid
  • the food product, beverage product or feedstuff is a meat or meat-like product, e.g.
  • the food product, beverage product or feedstuff is free from any animal or animal-derived ingredients.
  • the food product, beverage product or feedstuff comprises an animal or animal -derived ingredient, optionally wherein the animal or animal -derived ingredient is meat.
  • the food product, beverage product or feedstuff comprises one or more sugars, sugar alcohols, sugar acids, or sugar derivatives; and one or more amino acids or derivatives or salts thereof, or a compound comprising an amino group (e.g. thiamine).
  • the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives and the one or more amino acids or derivatives or salts thereof are present in the food product, beverage product or feedstuff in amounts sufficient to produce a food-like aroma and/or flavour when the food product, beverage product or feedstuff is heated.
  • the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives and the one or more amino acids or derivatives or salts thereof are present in the food product, beverage product or feedstuff in amounts sufficient to produce one or more volatile compounds selected from 1,3-dimethyl benzene; p-xylene; ethylbenzene; 2-Heptanone; 2-pentyl furan; Octanal; 1,2-Octadecanediol; 2, 4-diethyl-l -Heptanol; 2-Nonanone; Nonanal; l-Octen-3-ol; 2- Decanone; 2-Octen-l-ol, (E)-; 2,4-dimethyl-Benzaldehyde; 2,3,4,5-Tetramethylcyclopent-2-en-l-ol, 1- octanol, 2-heptanone, 3-octanone, 2,3-octanedione, 1 -pentanol
  • the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives and the one or more amino acids or derivatives or salts thereof are present in the food product, beverage product or feedstuff in amounts sufficient to produce one or more volatile compounds selected from 2-heptanone, 3-octanone, 2,3-octanedione, 1-pentanol, 1-hexanol, 2-ethyl-l -hexanol, 1- octanol, trans-2-octen-l-ol and 1-nonanol when the food product, beverage product or feedstuff is heated.
  • the food product, beverage product or feedstuff comprises an extracted lipid from Mortierella spp. comprising phospholipids.
  • the food product, beverage product or feedstuff may comprise about 2.5% or less dry Mortierella spp. biomass by weight, or an equivalent amount of wet biomass.
  • a method of producing a food product, beverage product or feedstuff comprising combining a) a combination of Mortierella spp. biomass or extracted lipid therefrom and one or more lactones and/or one or more 4-hydroxy acids, or b) a composition of the present invention; with one or more additional consumable ingredients.
  • a method of imparting a food-like aroma and/or flavour to a food product, beverage product or feedstuff comprising contacting the food product, beverage product or feedstuff with a combination of Mortierella spp. biomass or extracted lipid therefrom and one or more lactones and/or one or more 4-hydroxy acids, or a composition of the invention, and heating the food product, beverage product or feedstuff and the combination or composition.
  • a method of increasing food-like aromas and/or flavours associated with a food product, beverage product or feedstuff comprising contacting the food product, beverage product or feedstuff with a combination of Mortierella spp. biomass or extracted lipid therefrom and one or more lactones and/or one or more 4-hydroxy acids, or a composition of the invention, and heating the food product, beverage product or feedstuff and the combination or composition.
  • the food product, beverage product or feedstuff is a meat or meat-like product.
  • the Mortierella spp. biomass is present in the food product, beverage product or feedstuff or is contacted with the food product, beverage product or feedstuff in an amount of less than 5% dry Mortierella spp. biomass by weight, or an equivalent amount of wet biomass.
  • the food-like aroma and/or flavour is a meaty aroma and/or flavour.
  • the composition, food product, beverage product or feedstuff is heated to at least about 130°C and/or for at least about 1 hour.
  • the use is for imparting a food-like (e.g. a meaty or meat-like) aroma and/or flavour to said composition, food product, beverage product or feedstuff.
  • the Mortierella spp. is Mortierella alpina, Mortierella elongata or Mortierella exigua.
  • the biomass or extracted lipid comprises phospholipids, optionally wherein the phospholipids comprise one or more esterified co6 fatty acids (e.g. arachidonic acid (ARA), dihomo-gammalinolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-co6 (DPA-co6) or y-linolenic acid (GLA)).
  • esterified co6 fatty acids e.g. arachidonic acid (ARA), dihomo-gammalinolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-co6 (DPA-co6) or y-linolenic acid (GLA)
  • the food product, beverage product or feedstuff is a meat or meat -like product, e.g. a burger, sausage, hot dog, mince or ground meat, steak, streak, strip, fillet, roast, breast, thigh, wing, meatloaf, finger, nugget, cutlet, cube, bacon, soup, gravy, sliced meat, meatballs, fish, fried fish or seafood or imitation thereof.
  • the food product, beverage product or feedstuff is free from any animal or animal -derived ingredients.
  • the food product, beverage product or feedstuff comprises an animal or animal-derived ingredients, optionally wherein the an animal or animal -derived ingredient is meat.
  • the food product, beverage product or feedstuff comprises: one or more sugars, sugar alcohols, sugar acids, or sugar derivatives; and one or more amino acids or derivatives or salts thereof, or a compound comprising an amino group (e.g. thiamine).
  • the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives and the one or more amino acids or derivatives or salts thereof (or the compound comprising an amino group) are present in the composition, food product, beverage product or feedstuff in amounts sufficient to produce a food-like aroma and/or flavour when the composition, food product, beverage product or feedstuff is heated.
  • the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives and the one or more amino acids or derivatives or salts thereof are present in the food product, beverage product or feedstuff in amounts sufficient to produce one or more volatile compounds selected from 1,3-dimethyl benzene; p-xylene; ethylbenzene; 2-Heptanone; 2-pentyl furan; Octanal; 1,2-Octadecanediol; 2, 4-diethyl-l -Heptanol; 2-Nonanone; Nonanal; l-Octen-3-ol; 2-Decanone; 2- Octen-l-ol, (E)-; 2,4-dimethyl-Benzaldehyde; 2,3,4,5-Tetramethylcyclopent-2-en-l-ol, 1-octanol, 2- heptanone, 3-octanone, 2,3-octanedione, 1-pentanol, 1-hex
  • the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives and the one or more amino acids or derivatives or salts thereof are present in the composition, food product, beverage product or feedstuff in amounts sufficient to produce one or more volatile compounds selected from 2-heptanone, 3-octanone, 2,3-octanedione, 1-pentanol, 1-hexanol, 2- ethyl- 1-hexanol, 1-octanol, trans-2-octen-l-ol and 1-nonanol when the composition, food product, beverage product or feedstuff is heated.
  • composition, food product, beverage product or feedstuff that comprise Mortierella spp. biomass further comprises an extracted lipid from Mortierella spp. comprising phospholipids.
  • the composition, food product, beverage product or feedstuff comprises about 2.5% or less dry Mortierella spp. biomass by weight, or an equivalent amount of wet biomass.
  • an isolated strain of Mortierella sp. selected from: i) yNI0125 deposited under V21/019953 on 12 October 2021 at the National Measurement Institute Australia; ii) yNI0126 deposited under V21/019951 on 12 October 2021 at the National Measurement Institute Australia; iii) yNI0127 deposited under V21/019952 on 12 October 2021 at the National Measurement Institute Australia; and iv) yNI0132 deposited under V21/019954 on 12 October 2021 at the National Measurement Institute Australia.
  • Figure 1 shows polyunsaturated fatty acid biosynthesis pathways.
  • Figure 2 shows a schematic of the pathways for phospholipid synthesis.
  • Figure 3 shows the profile of volatile compounds released by heating extracted lipids with a mixture of ribose and cysteine as in Example 5, Experiment 3, as measured by gas chromatographymass spectrometry (GC-MS). levels of each of the identified compounds are shown as the area percentage (%) of total identified compounds.
  • GC-MS gas chromatographymass spectrometry
  • Figure 4 shows the profile of volatile compounds released by Maillard reactions of mixtures comprising 2.5 or 5.0 mg of 18:0/18:1- phosphatidylcholine (PC) or ARA-PC as described in Example 5, Experiment 5, as measured by gas chromatography-mass spectrometry (GC-MS).
  • PC phosphatidylcholine
  • ARA-PC ARA-PC
  • Figure 5 shows the results of a sensory evaluation of meatiness of food samples comprising textured vegetable protein and varying amounts of Mortierella alpina biomass.
  • Figure 6 shows the results of a sensory evaluation of pleasantness of food samples comprising textured vegetable protein and varying amounts of Mortierella alpina biomass.
  • Figure 7 shows the combined meatiness and pleasantness results of a sensory evaluation of food samples comprising textured vegetable protein and varying amounts of Mortierella alpina biomass.
  • Figure 8 shows the meatiness results of a sensory evaluation of samples comprising a Maillard reaction matrix at varying concentrations and Mortierella alpina biomass.
  • Figure 9 shows the pleasantness results of a sensory evaluation of samples comprising a Maillard reaction matrix at varying concentrations and Mortierella alpina biomass.
  • Figure 10 shows the combined meatiness and pleasantness results of a sensory evaluation of samples comprising a Maillard reaction matrix at varying concentrations and Mortierella alpina biomass.
  • Figure 11 shows the combined meatiness and pleasantness results of a sensory evaluation of samples comprising a Maillard reaction with Mortierella alpina biomass or Mortierella isabellina biomass.
  • Figure 12 shows the results of a sensory evaluation of samples comprising a Maillard reaction with Mortierella alpina biomass and varying amounts of cystine.
  • Figure 13 shows the results of a sensory evaluation of food samples comprising a Maillard reaction with Mortierella alpina biomass and varying amounts of cystine.
  • Figure 14 shows the results of a sensory evaluation of samples comprising a Maillard reaction with Mortierella alpina biomass and varying amounts of dextrose.
  • Figure 15 shows the results of a sensory evaluation of food samples comprising a Maillard reaction with Mortierella alpina biomass and varying amounts of dextrose.
  • Figure 16 shows the results of a sensory evaluation of food samples comprising a Maillard reaction with Mortierella alpina biomass and varying combinations of cysteine, cystine, ribose and dextrose.
  • Figure 17 illustrates relative amounts of 57 volatile compounds identified by GC-MS in 8 samples (SI to S8, as defined in Table 37) as described in Example 17.
  • Figure 18 shows the results of a sensory evaluation of food samples comprising Mortierella alpina biomass and lactones, as described in Example 21.
  • a and “an” refer to one or to more than one (i.e. to at least one) of the grammatical object of the article.
  • an element means one element or more than one element.
  • a “lipid” is any of a class of organic compounds that are or comprise fatty acids, which may be esterified or non-esterified, or their derivatives and are insoluble in water but soluble in organic solvents, for example in chloroform.
  • the term "extracted lipid” refers to a lipid composition which has been extracted from a microbial cell.
  • the extracted lipid can be a relatively crude composition obtained by, for example, lysing the cells and separating the lipid, or a more purified composition where most, if not all, of one or more or each of the water, nucleic acids, proteins and carbohydrates derived from the cells have been removed. Examples of purification methods are described below.
  • An extracted lipid may comprise, for example, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% (w/w) lipid by weight of the composition.
  • an extracted lipid comprises between about 10% and 95% lipid by weight, for example between about 10% and about 50%, or about 50% and 95%, lipid by weight.
  • the lipid may be solid or liquid at room temperature (25°C), or a mixture of the two; when liquid it is considered to be an oil, when solid it is considered to be a fat.
  • extracted lipid has not been blended with another lipid produced from another source, for example, animal lipid.
  • the extracted lipid may be blended with a different lipid.
  • An extracted lipid may contain all lipids initially present in a microbial cell, or may contain only a fraction of lipids initially present in a microbial cell; for example, an extracted lipid may have been processed to remove some or all of a particular type of lipid, for example to remove some or all neutral lipid (such as triacylglycerols (triglycerides, ‘TAG’) and to retain polar lipids (such as phospholipids).
  • neutral lipid such as triacylglycerols (triglycerides, ‘TAG’
  • TAG triacylglycerols
  • polar lipid refers to amphipathic lipid molecules having a hydrophilic head and a hydrophobic tail, including phospholipids (e.g. phosphatidylcholine, phosphatidylethanolamine, phosphatidylinositol, phosphatidylserine, phosphatidylglycerol, diphosphatidylglycerols), cephalins, sphingolipids (sphingomyelins and glycosphingolipids), phosphatidic acid, cardiolipin and glycoglycerolipids.
  • phospholipids e.g. phosphatidylcholine, phosphatidylethanolamine, phosphatidylinositol, phosphatidylserine, phosphatidylglycerol, diphosphatidylglycerols
  • cephalins e.g. phosphatidylcholine, phosphatidylethanolamine, phosphatid
  • Phospholipids are composed of the following major structural units: fatty acids, glycerol, phosphoric acid, and amino alcohols. They are generally considered to be structural lipids, playing important roles in the structure of the membranes of plants, microorganisms and animals. Because of their chemical structure, polar lipids exhibit a bipolar nature, exhibiting solubility or partial solubility in both polar and non-polar solvents.
  • phospholipid refers to an amphipathic molecule, having a hydrophilic head and a hydrophobic tail, that has a glycerol backbone esterified to a phosphate “head” group and two fatty acids which provide the hydrophobic tail.
  • the phosphate group can be modified with simple organic molecules such as choline, ethanolamine or serine. Due to their charged headgroup at neutral pH, phospholipids are polar lipids, having some solubility in solvents such as ethanol in addition to solvents such as chloroform. Phospholipids are a key component of all cell membranes. They can form lipid bilayers because of their amphiphilic characteristic.
  • phospholipids include phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI), phosphatidylserine (PS), phosphatidic acid (PA), phosphatidylglycerol (PG), diphosphatidylglycerols and cardiolipin.
  • PC phosphatidylcholine
  • PE phosphatidylethanolamine
  • PI phosphatidylinositol
  • PS phosphatidylserine
  • PA phosphatidic acid
  • PG phosphatidylglycerol
  • diphosphatidylglycerols diphosphatidylglycerols and cardiolipin.
  • non-polar lipid refers to fatty acids and derivatives thereof which are soluble in organic solvents but insoluble in water.
  • the fatty acids may be free fatty acids and/or in an esterified form.
  • esterified forms include, but are not limited to, triacylglycerol (TAG), diacylyglycerol (DAG), monoacylglycerol (MAG).
  • Non-polar lipids also include sterols, sterol esters and wax esters.
  • Non-polar lipids are also known as “neutral lipids” or in some contexts referred to as “oils”.
  • Non-polar lipid may be a liquid at room temperature, or a solid, depending on the degree of unsaturation of the fatty acids in the non-polar lipid. Typically, the more saturated the fatty acid content, the higher the melting temperature of the lipid.
  • fatty acid refers to a carboxylic acid consisting of an aliphatic hydrocarbon chain and a terminal carboxyl group.
  • the hydrocarbon chain can be either saturated or unsaturated.
  • Unsaturated fatty acids include monounsaturated fatty acids having only one carboncarbon double bond and polyunsaturated fatty acids (PUFA) having at least two carbon-carbon double bonds, typically between 2 and 6 carbon-carbon double bonds.
  • a fatty acid may be a free fatty acid (FFA) or esterified to a glycerol or glycerol-phosphate molecule (for example as a phospholipid), Co A molecule or other headgroup as known in the art.
  • total fatty acid (TFA) content refers to the total amount of fatty acids in, for example, an extracted lipid or microorganism cell, on a weight basis.
  • the TFA may be expressed as a percentage of the weight of the cell or other fraction, e.g., as a percentage of the polar lipid.
  • the weight with regard to the cell weight is the dry cell weight (DCW).
  • TFA content is measured by conversion of the fatty acids to fatty acid methyl esters (FAME) or fatty acid butyl esters (FABE) and measurement of the amount of FAME or FABE by GC, using addition of a known amount of a distinctive fatty acid standard as a quantitation standard in the GC.
  • FAME fatty acid methyl esters
  • FABE fatty acid butyl esters
  • the amount and fatty acid composition of lipids or compositions comprising only fatty acids in the range of C10-C24 are determined by conversion to FAME
  • lipids or compositions comprising fatty acids in the range of C4-C10 are determined by conversion to FABE.
  • TFA therefore represents the weight of just the fatty acids, not the weight of the fatty acids and their linked moieties in the lipid or composition.
  • saturated fatty acids do not contain any double bonds or other functional groups along the acyl chain.
  • saturated refers to hydrogen, in that all carbons (apart from the carboxylic acid [-COOH] group) contain as many hydrogens as possible.
  • the two next carbon atoms in the chain that are bound to either side of the double bond can occur in a cis or trans configuration, preferably in the cis configuration.
  • the term "monounsaturated fatty acid” refers to a fatty acid which comprises at least 12 carbon atoms in its carbon chain and only one alkene group (carbon-carbon double bond) in the chain.
  • Monounsaturated fatty acids include C12: 1A9, C14: 1A9, C16: 1A9 (palmitoleic acid), C18: 1 A9 (oleic acid) and Cl 8: 1 Al 1 (vaccenic acid).
  • polyunsaturated fatty acid refers to a fatty acid which comprises typically at least 12 carbon atoms in its carbon chain and at least two alkene groups (carboncarbon double bonds).
  • PUFA polyunsaturated fatty acid
  • the number of carbon atoms in the carbon chain of the fatty acids refers to an unbranched carbon chain. Unless stated otherwise, if the carbon chain is branched, the number of carbon atoms excludes those in side groups.
  • ‘co6 fatty acids’, ‘omega 6 fatty acids’ or ‘n-6 fatty acids’ have a final desaturation (carbon-carbon double bond) in the sixth carbon-carbon bond from the methyl end of the fatty acid.
  • co6 fatty acid examples include, but are not limited to, arachidonic acid (ARA, C20:4A5,8,l l,14; co6), dihomo-gammalinolenic acid (DGLA, C20:3A8, 11,14; co6), eicosadienoic acid (EDA, C2O:2A11,14; co6), docosatetraenoic acid (DTA, C22:4A7,10,13,16; co6), docosapentaenoic acid-co6 (DPA-co6, C22:5A4,7,10,13,16; co6), y-linolenic acid (GLA, C18:3A6,9,12; co6) and linoleic acid (LA, C18:2A9,12; co6).
  • arachidonic acid ARA, C20:4A5,8,l l,14; co6
  • DGLA dihomo-gammalinolenic acid
  • EDA eicos
  • co3/omega 3/n-3 fatty acids have a final desaturation (carbon-carbon double bond) in the third carbon-carbon bond from the methyl end of the fatty acid.
  • co3 fatty acids include, for example, a-linolenic acid (ALA, C18:3A9,12,15; co3), hexadecatrienoic acid (C16:3co3), eicosapentaenoic acid (EPA, C20:5A5,8,l l,14,17; co3), docosapentaenoic acid (DPA, C22:5A7,10,13,16,19, co3), docosahexaenoic acid (DHA, 22:6A4,7,10,13,16,19, co3), eicosatetraenoic acid (ETA, C20:4A8, 11,14,17; co3) and eicosatrienoic acid (ETrA, C2O:3A11,14,17; co3)
  • C12:0 refers to lauric acid.
  • C14:0 refers to myristic acid.
  • Cl 5:0 refers to n-pentadecanoic acid.
  • Cl 6:0 refers to palmitic acid.
  • C17: l refers to heptadecenoic acid.
  • C16: lA9 refers to palmitoleic acid, or-hexadec-9-enoic acid.
  • Cl 8:0 refers to stearic acid.
  • Cl 8: 1 A9 refers to oleic acid.
  • C18: 1 Al T refers to vaccenic acid.
  • C20:0 refers to eicosanoic acid.
  • C20: 1 refers to eicosenoic acid.
  • C22:0 refers to docosanoic acid.
  • C22: 1 refers to erucic acid.
  • C24:0 refers to tetracosanoic acid.
  • Triacylglyceride is a glyceride in which the glycerol is esterified with three fatty acids which may be the same (e.g. as in tri-olein) or, more commonly, different. All three of the fatty acids may be different, or two of the fatty acids may be the same and the third is different.
  • DAG is formed as described below, and then a third acyl group is esterified to the glycerol backbone by the activity of a diglyceride acyltransferase (DGAT).
  • DGAT diglyceride acyltransferase
  • TAG is a form of non-polar lipid.
  • the three acyl groups esterified in a TAG molecule are referred to as being esterified in the sn-1, sn-2 and sn-3 positions, referring to the positions in the glycerol backbone of the TAG molecule.
  • the sn-1 and sn-3 positions are chemically identical, but biochemically the acyl groups esterified in the sn-1 and sn-3 positions are distinct in that separate and distinct acyltransferase enzymes catalyse the esterifications.
  • DAG is glyceride in which the glycerol is esterified with two fatty acids which may be the same or, preferably, different.
  • DAG comprises a hydroxyl group at a sn-1, 3 or sn-2 position, and therefore DAG does not include phosphorylated glycerolipid molecules such as PA or PC.
  • the precursor .OT-glycerol-3-phosphate (G3P) is esterified to two acyl groups, each coming from a fatty acid coenzyme A ester, in a first reaction catalysed by a glycerol-3-phosphate acyltransferase (GPAT) at position sn-1 to form LysoPA, followed by a second acylation at position sn-2 catalysed by a lysophosphatidic acid acyltransferase (LPAAT) to form phosphatidic acid (PA).
  • GPAT glycerol-3-phosphate acyltransferase
  • LPAAT lysophosphatidic acid acyltransferase
  • This intermediate is then de -phosphorylated by PAP to form DAG.
  • an “oil” is a composition comprising predominantly lipid and which is a liquid at room temperature.
  • an “oleaginous” cell or microorganism is one that is capable of storing at least 20% lipid, such as for example 20% to 70%, of its cell mass on a dry weight basis.
  • the lipid content may depend on culture conditions, as is known in the art. It is understood that so long as the microorganism is capable of synthesizing and accumulating at least 20% lipid on a dry cell weight basis under at least one set of culture conditions it is regarded as an oleaginous cell, even if under different conditions it accumulates less than 20% lipid.
  • a “heterotrophic” cell is one that is capable of utilizing organic materials as a carbon source for metabolism and growth. Heterotrophic organisms may also be able to grow autotrophically under suitable conditions.
  • a “meat-like flavour and/or aroma”, or a “meat-associated flavour and/or aroma” or a “meaty flavour and/or aroma” refers to flavours and/or aromas that are the same as or are similar to one or more meats, such as beef, steak, chicken, for example roasted chicken or chicken skin, pork, lamb, duck, venison, chicken or other meat soup, meat broth or liver.
  • Such aromas are typically detected by human volunteers, for example by a qualified sensory panel.
  • Meat -like or meat-associated flavours and/or aromas can also be detected by assessing volatile compounds arising after the cooking of the composition or food.
  • Volatile compounds indicative of meat -like or meat-associated aromas and flavours are known in the art and include those exemplified herein, including but not limited to 1,3- dimethyl benzene; p-xylene; ethylbenzene; 2-Heptanone; 2-pentyl furan; Octanal; 1,2 -Octadecanediol; 2, 4-diethyl-l -Heptanol; 2-Nonanone; Nonanal; l-Octen-3-ol; 2-Decanone; 2-Octen-l-ol, (E)-; 2,4- dimethyl-Benzaldehyde; 2,3,4,5-Tetramethylcyclopent-2-en-l-ol, 1 -octanol, 2-heptanone, 3-octanone, 2,3-
  • compositions for food and beverage products and feedstuff s
  • the present invention relates to the use of microbial biomass comprising phospholipids, for example Mortierella spp. biomass, or extracted lipid therefrom, in a composition, food product, beverage product or feedstuff.
  • the present invention further relates to a composition, food product, beverage product or feedstuff comprising the microbial biomass, such as Mortierella spp. biomass, or extracted lipid therefrom,.
  • the present invention also relates to a composition that is capable of producing a food-like aroma when heated, wherein the composition comprises a microbial biomass, one or more sugars, sugar alcohols, sugar acids, or sugar derivatives; and one or more amino acids or derivatives thereof.
  • compositions of the invention may include food products, beverage products or feedstuffs.
  • compositions encompasses non-food compositions and compositions that are food products, beverage products or feedstuffs.
  • the compositions are concentrated liquid or solid “flavouring compositions”, which can be added to other ingredients to produce a food product, beverage product or feedstuff with a desired flavour.
  • the term composition is used interchangeably with food product, beverage product or feedstuff.
  • the invention relates to a composition that is capable of producing a food-like aroma and/or flavour when heated, the composition comprising: a) biomass, e.g. Mortierella spp. biomass, or extracted lipid therefrom; b) one or more lactones and/or one or more 4-hydroxy fatty acids; c) one or more sugars, sugar alcohols, sugar acids, or sugar derivatives; and d) one or more amino acids or derivatives thereof, or a compound comprising an amino group (e.g. thiamine).
  • an optional additional extracted lipid is included in the composition.
  • the optional additional extracted lipid may be from the same microorganism as the biomass (e.g. the composition comprises biomass and extracted lipid therefrom) or may be from a different microorganism (e.g. the composition comprises biomass from a first microorganism and lipid extracted from a second and different microorganism).
  • the one or more lactones and/or 4-hydroxy fatty acids may be exogenous to the biomass or extracted lipid, and may be separately added to the composition.
  • the microorganism that is the source of the biomass may produce, or be engineered to produce one or more lactones and/or 4-hydroxy fatty acids.
  • the biomass or extracted lipid in the composition may comprise the one or more lactones and/or 4-hydroxy fatty acids.
  • compositions, food products, beverage products or feedstuffs of the present disclosure are suitable for human or animal consumption, typically at least human consumption.
  • the present invention relates to compositions as well as to food products, beverage products or feedstuffs, including food products, beverage products or feedstuffs comprising compositions of the present invention.
  • the compositions of the present invention may be incorporated into food products, beverage products or feedstuffs to provide a desired food-like aroma.
  • the food products, beverage products or feedstuff are suitable for human or animal consumption, typically at least human consumption.
  • a food product, beverage product or feedstuff is a preparation for human or animal consumption which when taken into the body (a) serves to nourish or build up tissues or supply energy; and/or (b) maintains, restores or supports adequate nutritional status or metabolic function.
  • a “food product” may be generally considered to include solid, semi-solid, or savoury liquid products
  • a “beverage product” may be generally considered to include liquid drinkable products
  • feedstuff’ may be considered to generally include animal, such as livestock food. It will be appreciated that there is overlap in the meaning of the terms “food product”, “beverage product” and “feedstock” and the terms may, in some circumstances, be used interchangeably.
  • the food or beverage product or feedstuff is a meat or fish substitute product, i.e. a food or beverage product intended to imitate a food or beverage product which typically would contain meat or fish, for example for use in a vegetarian or vegan diet.
  • the food or beverage product or feedstuff may be a product which includes meat or fish, and a composition of the present invention may be included to provide additional or alternative flavours or aromas to the product.
  • the food or beverage product or feedstuff product may comprise meat obtained from an animal and/or cultivated or cultured meat (i.e. meat that has been produced by cultivating animal cells in vitro).
  • the food or beverage product or feedstuff product is a blend of meat (e.g. meat obtained from an animal and/or cultivated or cultured meat) and non-animal protein (e.g. plant or mcrobial protein).
  • Suitable food or beverage products or feedstuffs include but are not limited to meat or fish substitutes or meat or fish-based products, soup bases, stew bases, snack foods, bouillon powders, bouillon cubes, flavour packets, seasoning or frozen food products.
  • the food or beverage product may be, or may be intended to imitate, for example, burgers, sausages, hot dogs, mince or ground meat, steaks, streaks, strips, fillets, roasts, breasts, thighs, wings, meatloaf, fingers, nuggets, cutlets, cubes, bacon, soup, gravy, sliced meat, meatballs, fish, fried fish or seafood.
  • the food product is a meat or meat-like product.
  • a “meat-like product” is readily understood as referring to a product which resembles a meat product but which may not necessarily contain any meat, for example meat-alternative burgers, sausages, ground mince, meatballs, strips or other products.
  • the meat -like product comprises no animal products.
  • the meat or meat-like product comprises cultivated meat (i.e. meat produced by cultivating animal cells in vitro).
  • Biomass and/or lipids extracted from the biomass disclosed herein and/or compositions of the present invention may be used to modulate the flavour and/or aroma of a food or beverage product or feedstuff, by enhancing or altering the flavour and/or aroma of the food or beverage product or feedstuff.
  • biomass and/or any extracted lipids disclosed herein and/or compositions of the present disclosure may enhance or alter the flavour and/or aroma of a food or beverage product or feedstuff, such as by enhancing meaty, fishy or vegetable flavour and/or aromas or by introducing such flavour and/or aromas to food or beverage products or feedstuffs.
  • the biomass and/or extracted lipids disclosed herein, or the compositions, food or beverage products or feedstuffs of the present disclosure are intended to be added as an ingredient to a separate product to enhance or modulate the taste and/or aroma of the separate product to which it is added, for example by enhancing the meatiness or fishiness of the separate product or by altering the aroma or flavour of a product.
  • Biomass and/or extracted lipids disclosed herein, or compositions, food or beverage products or feedstuffs of the present disclosure can be used to modulate, by enhancing or altering, the taste and/or aroma profile of, for example, meat replicas, meat substitutes, tofu, instantan, mock duck or a gluten based vegetable product, textured vegetable protein such as textured soy protein, pork, fish, lamb, or poultry products such as chicken or turkey products, and can be applied to the other food product before or during cooking.
  • using the biomass and/or extracted lipids disclosed herein, or compositions, food or beverage products or feedstuffs described herein can provide a particular meaty taste and smell, for example, the taste and smell of beef, to a non-meat product or to a poultry product.
  • compositions e.g. concentrated flavouring compositions of the present disclosure comprise less than 20% protein derived from a source other than the Mortierella spp. (or other microbial) biomass of the invention, optionally less than 15%, less than 10%, less than 5% or no protein other than protein provided by the Mortierella spp. (or other microorganism) biomass.
  • food products, beverage products and feedstuffs of the present disclosure may optionally comprise added protein in an amount of greater than 5%, 10%, 15%, 20%, 25%, 30%, 35% or 40%.
  • microbial biomasses including Mortierella spp. biomass, or extracted lipid therefrom, in the context of compositions, food products, beverage products or feedstuffs of the invention, produces food-like aromas when heated, especially meaty aromas, thought to be due to occurrence of a Maillard reaction.
  • the biomass e.g. Mortierella spp.
  • biomass or extracted lipid therefrom finds use in imparting aroma and/or flavours to, or enhancing aromas and/or flavours of food and beverage products and feedstuffs, especially meaty and fishy aromas and/or flavours, for example in meat- or fish-substitute food products which may be free of animal-derived meat, fish or other animal products. It has been found that the inclusion of the biomass (e.g. Mortierella spp. biomass) or extracted lipid therefrom in such compositions or food products, beverage products or feedstuffs is especially effective in producing the food-like aromas such as meaty aromas.
  • biomass e.g. Mortierella spp. biomass
  • extracted lipid therefrom is especially effective in producing the food-like aromas such as meaty aromas.
  • the biomass typically comprises whole cells of the microorganism and may be a crude mixture of cells and cell -derived compounds such as lipids, proteins, carbohydrates such as sugars and glucans, and nucleic acids.
  • the biomass comprises whole cells, wherein the whole cells have been processed to have reduced levels of TAG compared to whole cell biomass (i.e. the biomass has been processed to remove some, most or all of the TAG).
  • the cells may be alive, inactivated or dead, or a mixture thereof.
  • the extracted lipid may comprise polar lipids (e.g. phospholipids) and/or non-polar lipids (e.g.TAG, DAG, MAG, etc.).
  • the extracted lipid comprises phospholipid.
  • compositions e.g. Mortierella spp.or Yarrowia spp.
  • extracted lipid e.g., lipid-derived lipid-derived lipid-derived lipid-derived lipid-derived lipid-derived lipid-derived lipid-derived lipid-derived lipid-derived lipid-derived lipid-derived lipid-derived lipid-derived lipid-derived lipid-derived lipid-derived lipid-derived lipid-derived lipid, and/or extracted lipid, in a composition of the present disclosure may be varied depending on, for example, the identity of the microorganism, the form and moisture content of the biomass of the microorganism, the total lipid or phospholipid content and profile contained in the microorganism, the intensity of the desired flavour and/or aroma and the intended use of the composition.
  • the compositions e.g.
  • concentrated flavouring compositions comprise at least or about 1%, 2%, 3%, 4%, 5%, 5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14% 15%, 16%, 17%, 18%, 19%, 20% or 25% dry biomass, or an equivalent amount of wet biomass.
  • the compositions of the present invention comprise between 1% and 50%, between 1% and 40%, between 1% and 30%, between 1% and 20%, between 5% and 30%, between 5% and 20%, or between 5% and 15% dry biomass by weight, or an equivalent amount of wet biomass
  • food products, beverage products or feedstuffs of the present invention comprise less than 5% dry biomass (e.g. less than 5% dry Mortierella spp.
  • the food products, beverage products or feedstuffs of the present invention comprise less than or about 4.5%, 4%, 3.5%, 3%, 2.5%, 2%, 1.5%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2% or 0.1% dry biomass (e.g. dry Mortierella spp. biomass) by weight, or an equivalent amount of wet biomass.
  • dry biomass e.g. dry Mortierella spp. biomass
  • compositions e.g. concentrated flavouring compositions
  • the compositions comprise per gram of dry compositions or slurries, or per mL in the case of liquid compositions, at least about 1 mg wet microorganism (e.g. Mortierella spp.) biomass, in particular at least about 5 mg, preferably at least about 10 mg, more preferably at least about 15 mg wet biomass, for example at least about 20 mg, at least about 25 mg, at least about 30 mg, or at least about 40 mg wet biomass.
  • wet microorganism e.g. Mortierella spp.
  • the compositions of the present disclosure comprise per gram of dry compositions or slurries, or per mL in the case of liquid compositions, at least about 0.25 mg, at least about 0.5 mg, at least about 1 mg, at least about 1.25 mg, at least about 1.5 mg, at least about 2 mg, at least about 3 mg, at least about 5 mg, at least about 7 mg or at least about 10 mg dry biomass, the weight or volume being measured based on the weight or volume of the composition excluding/before addition of biomass and any extracted lipid.
  • the compositions e.g.
  • concentrated flavouring compositions of the present disclosure comprise from about 1 mg to about 200 mg wet biomass, for example from about 5 mg to about 200 mg, from about 7 mg to about 200 mg, from about 10 mg to about 200 mg, from about 20 mg to about 200 mg, from about 25 mg to about 200 mg, from about 30 mg to about 200 mg, from about 40 mg to about 200mg, from about 30 mg to about 175 mg, or from about 40 mg to about 175 mg wet biomass per gram of dry compositions or slurries, or per mL in the case of liquid compositions.
  • the compositions e.g.
  • concentrated flavouring compositions may comprise per gram of dry compositions or slurries, or per mL in the case of liquid compositions, from about 0.25 mg to about 100 mg, for example from about 0.5 mg to about 100 mg, for example from about 1 mg to about 100 mg, for example from about 5 mg to about 100 mg, for example from about 10 mg to about 100 mg, for example from about 10 mg to about 80 mg, for example from about 10 mg to about 70 mg, for example from about 15 mg to about 60 mg, for example from about 10 mg to about 50 mg dry biomass.
  • the compositions may comprise per gram of dry compositions or slurries, or per mL in the case of liquid compositions, for example, at least about 0.1 mg of lipid, extracted from a microorganism (e.g. Mortierella spp.), at least about 1 mg of lipid, extracted from a microorganism (e.g. Mortierella spp. ). 5 mg of lipid, extracted from a microorganism (e.g. Mortierella spp. ). for example at least about 10 mg or at least about 15 mg of lipid, extracted from a microorganism, the weight or volume being measured based on the weight or volume of the composition excluding/before addition of extracted lipid.
  • a microorganism e.g. Mortierella spp.
  • 5 mg of lipid, extracted from a microorganism e.g. Mortierella spp.
  • the weight or volume being measured based on the weight or volume of the composition excluding/before addition of extracted lipid.
  • the composition comprises from about 0.1 mg to about 1000 mg, 0.5 mg to about 500 mg, 1 mg to about 100 mg, 10 mg to about 100 mg, for example from about 10 mg to about 80 mg, for example from about 10 to about 70 mg, for example from about 10 to 60 mg, particularly about 10 to about 50 mg extracted lipid, extracted from a microorganism.
  • the compositions of the present disclosure provide at least about 15 mg, for example at least about 20 mg lipid, extracted from a microorganism.
  • compositions comprising food products, beverage products and feedstuffs
  • Food products, beverage products and feedstuffs of the present disclosure may comprise, according to preferred embodiments, less than about 5% dry biomass (e.g. Mortierella spp. biomass) by weight, or less than about 20% wet biomass by weight.
  • dry biomass e.g. Mortierella spp. biomass
  • the food product, beverage product or feedstuff of the present disclosure comprises about 4.5% or less, about 4.0% or less, about 3.5% or less, about 3% or less, about 2.5% or less, about 2 % or less, about 1.5% or less, about 1% or less, or about 0.5% or less dry biomass by weight, or about 18% or less, about 16% or less, about 15% or less, about 14% or less, about 12% or less, about 10% or less, about 8% or less, about 6% or less, about 5% or less, about 4% or less, about 3% or less, about 2% or less, or about 1% or less wet biomass by weight.
  • the food product, beverage product or feedstuff of the present disclosure, especially a meat or meat -like food product comprises about or less than 2.5% dry biomass by weight, or about or less than 10% or less wet biomass by weight.
  • Food products, beverage products and feedstuffs of the present disclosure may comprise, according to some embodiments, at least about 0.005%, at least about 0.01%, at least about 0.025%, at least about 0.05%, at least about 0.1%, at least about 0.5%, at least about 1%, or at least about 1.25% dry biomass (e.g. Mortierella spp. biomass) by weight, or at least about 0.05%, at least about 0.1%, at least about 0.25%, at least about 0.5%, at least about 1%, at least about 2.5% or at least about 5% wet biomass by weight.
  • the food product, beverage product or feedstuff of the present disclosure, especially a meat or meat-like food product comprises about at least about 0.025% dry biomass by weight, or at least about 0.1% wet biomass by weight.
  • Food products, beverage products and feedstuffs of the present disclosure may comprise, according to some particular embodiments, from about 0.005% to about 5% (or less than about 5%, such as about 4% or 3% or 2% or 1%), from about 0.001% to about 5% (or less than about 5%, such as about 4% or 3% or 2% or 1%), from about 0.025% to about 5% (or less than about 5%, such as about 4% or 3%, or 2% or 1%), for example from about 0.05% to about 5% (or less than about 5%, such as about 4% or 3%, or 2% or 1%), for example from about 0.1% to about 5% (or less than about 5%, such as about 4% or 3%, or 2% or 1%) dry biomass (e.g.
  • Mortierella spp. biomass by weight, or from about 0.05% to about 20% (or less than about 20%), 0.1% to about 20% (or less than about 20%), for example from about 0.25% to about 20% (or less than about 20%), for example from about 1% to about 20% (or less than about 20%) wet biomass by weight.
  • the food products, beverage products and feedstuffs of the present disclosure, especially meat or meat-like food products comprise from about 0.025% to about 5%, from about 0.025% to about 4%, or from about 0.025% to about 3% dry biomass by weight; or from about 0.1% to about 20%, from about 0.1% to about 15%, or from about 0.1% to about 10% wet biomass by weight.
  • compositions of the present invention comprise microbial biomass, and in particular Mortierella spp. biomass, or extracted lipid therefrom; one or more sugars, sugar alcohols, sugar acids, or sugar derivatives; and one or more amino acids or derivatives or salts thereof, or a compound comprising an amino group (e.g. thiamine).
  • microbial biomass and in particular Mortierella spp. biomass, or extracted lipid therefrom
  • one or more sugars, sugar alcohols, sugar acids, or sugar derivatives and one or more amino acids or derivatives or salts thereof, or a compound comprising an amino group (e.g. thiamine).
  • the presence of one or more sugars, sugar alcohols, sugar acids, or sugar derivatives; and one or more amino acids or derivatives or salts thereof, or a compound comprising an amino group (e.g. thiamine) are thought to assist in Maillard reactions which occur when the composition (or food product, beverage product or feedstuff in which the composition is present) is heated.
  • biomass and/or an extracted lipid is used in a food product, beverage product or feedstuff and one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and one or more amino acids or derivatives or salts thereof or a compound comprising an amino group (e.g. thiamine) are provided by the other ingredients of the food product, beverage product or feedstuff.
  • one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and one or more amino acids or derivatives or salts thereof or a compound comprising an amino group e.g. thiamine
  • references to preferred features of one or more sugars, sugar alcohols, sugar acids, or sugar derivatives, and one or more amino acids or derivatives or salts thereof when used in a composition of the invention below may be applied to sugars, sugar alcohols, sugar acids, or sugar derivatives, and amino acids or derivatives or salts thereof when present in a food product, beverage product or feedstuff according to the present invention mutatis mutandis.
  • Suitable sugars, sugar alcohols, sugar acids, or sugar derivatives will be well known to a person skilled in the art.
  • the sugars, sugar alcohols, sugar acids, or sugar derivatives are suitable for use in Maillard reactions for food, beverage or feed uses.
  • the sugars, sugar alcohols, sugar acids, or sugar derivatives are a component other than the microorganism or a component thereof, and the amino acids or derivatives or salts thereof, even if the biomass or component thereof itself comprises sugars, sugar alcohols, sugar acids, or sugar derivatives.
  • Suitable sugars, sugar alcohols, sugar acids, and sugar derivatives include glucose, fructose, ribose, sucrose, arabinose, glucose-6-phosphate, fructose-6-phosphate, fructose 1,6-diphosphate, inositol, maltose, molasses, maltodextrin, glycogen, galactose, lactose, ribitol, gluconic acid and glucuronic acid, amylose, amylopectin, or xylose.
  • the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives comprise one or more of ribose, glucose (dextrose), a combination of glucose and fructose, and xylose.
  • the compositions, food products, beverage products or feedstuffs of the present invention comprise ribose.
  • the compositions, food products, beverage products or feedstuffs of the present invention comprise glucose (i.e. dextrose).
  • the compositions, food products, beverage products or feedstuffs of the present disclosure comprise both glucose and ribose.
  • the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives are present in the composition at an amount of per kg of dry compositions or slurries, or per L in the case of liquid compositions, from about 1 mmol to about 1000 mmol, for example from about 5 mmol to about 500 mmol, about 5 mmol to about 300 mmol, about 20 mmol to about 500 mmol, about 20 mmol to about 300 mmol, about 5 mmol to about 200 mmol, about 5 mmol to about 100 mmol, about 5 mmol to about 80 mmol, from about 5 mmol to about 70 mmol, about 10 mmol to about 70 mmol, about 15 mmol to about 70 mmol, or about 30 mmol to about 60 mmol, the amount being measured based on the weight or volume of the composition excluding/before addition of biomass or any extracted lipids.
  • the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives are present in the composition at an amount of per kg of dry compositions or slurries, or per L in the case of liquid compositions, of at least about 5 mmol, at least about 10 mmol, at least about 15 mmol, at least about 20 mmol, or at least about 30 mmol, the amount being measured based on the weight or volume of the composition excluding/before addition of biomass or any extracted lipids.
  • the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives comprise ribose and/or glucose.
  • the one or more sugars, sugar alcohols, sugar acids or sugar derivatives are present in the food, feedstuff or beverage at a total amount of, per kg of dry food or slurry, or per L in the case of liquid foods (e.g.
  • beverages from about 0.1 mmol to about 100 mmol, from about 0.5 mmol to about 30 mmol, from about 0.5 mmol to about 50 mmol, from about 1 mmol to about 50 mmol, from about 2 mmol to about 40 mmol, from about 2 mmol to about 30 mmol, from about 1 mmol to about 25 mmol, from about 1 mmol to about 20 mmol, from about 1 mmol to about 10 mmol, from about 7 mmol to about 20 mmol, from about 7 mmol to about 15 mmol, the amount being measured based on the weight or volume of the food, feedstuff or beverage excluding/before addition of the microbial biomass and/or lipids.
  • the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives are present in the food, feedstuff or beverage at an amount of per kg of dry food, feedstuff or beverage, or per L in the case of liquid food, feedstuff or beverage, of at least about 0.5 mmol, at least about 1 mmol, at least about 1.5 mmol, at least about 2 mmol, or at least about 3 mmol, the amount being measured based on the weight or volume of the composition excluding/before addition of biomass or any extracted lipids.
  • the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives comprise ribose and/or glucose.
  • a sugar “derivative” is intended to encompass sugars which includes a modification from a naturally occurring sugar, for example by modification of substituents, such as hydroxyl groups.
  • sugar derivatives may have been modified to include alternative substituents such as amino groups, acid groups, phosphate groups, acetate groups etc.
  • Sugar derivatives include, but are not limited to, amino sugars, deoxy sugars, glycosylamines, and sugar phosphates.
  • amino acids or derivatives or salts thereof used in the present invention are suitable for use in Maillard reactions for food, beverage or feed uses.
  • the amino acids or derivatives or salts thereof are a component other than the microorganism (e.g. Mortierella spp. biomass) or a component thereof, and the sugar, sugar alcohol, sugar acid, or sugar derivative, even if the biomass or component thereof itself comprises amino acids or derivatives or salts thereof.
  • the one or more amino acids or derivatives or salts thereof contain a free amino group.
  • reference to an amino acid or derivative means a free amino acid that is not present in the context of a peptide or protein.
  • Suitable amino acids and derivatives thereof include cysteine, cystine, homocysteine, selenocysteine, a cysteine sulfoxide, allicin, selenocysteine, methionine, isoleucine, leucine, lysine, phenylalanine, threonine, tryptophan, 5-hydroxytryptophan, valine, arginine, histidine, alanine, asparagine, aspartate, glutamate or glutamic acid, glutamine, monosodium glutamate, glycine, proline, serine, taurine and tyrosine.
  • the amino acid is cysteine and/or cystine.
  • compositions comprise cysteine.
  • the composition, food product, beverage product or feedstuff comprises glutamic acid or a salt thereof.
  • the composition, food product, beverage product or feedstuff comprises glutamic acid or a salt thereof (e.g. monosodium glutamate, or MSG) in addition to the one or more amino acids or derivatives or salts thereof; for example, compositions, food products, beverage products or feedstuffs comprise, according to some embodiments, glutamic acid or a salt thereof and cysteine (or cystine) or a salt thereof.
  • the one or more amino acids or derivatives or salt thereof comprises a sulfur-containing amino acid (e.g.
  • cysteine methionine, homocysteine, or taurine
  • Salts of amino acids which are suitable for human or animal consumption and therefore for incorporation into compositions, food products, beverage products or feedstuffs of the present disclosure will be familiar to and readily selected by a person skilled in the art.
  • amino acid “derivative” is intended to encompass amino acids which include a chemical modification, for example by introducing a group in a side chain of an amino acid, such as a nitro group in tyrosine or iodine in a tyrosine, by conversion of a free carboxylic group to an ester group or to an amide group, by converting an amino group to an amide by acylation, by acylating a hydroxy group rendering an ester, by alkylation of a primary amine rendering a secondary amine, or linkage of a hydrophilic moiety to an amino acid side chain.
  • Other derivatives may be obtained by oxidation or reduction of the side -chains of the amino acid.
  • Modification of an amino acid may also include derivation of an amino acid by the addition and/or removal of chemical groups to/from the amino acid, and may include use of an amino amino acid analog (such as a phosphorylated amino acid) or a non- naturally occurring amino acid such as a N-alkylated amino acid (e.g. N-methyl amino acid), D-amino acid, P-amino acid or y-amino acid.
  • exemplary derivatives may include derivatives obtained by attachment of a derivative moiety, i.e. a substituent group, to an amino acid.
  • the term “derivative” in the context of amino acids will be readily understood by a skilled person.
  • each of the one or more amino acids or derivatives or salts thereof are present in the composition at an amount of, per kg of dry compositions or slurries, or per L in the case of liquid compositions, from about 1 mmol to about 500 mmol, from about 1 mmol to about 300 mmol, from about 1 mmol to about 200 mmol, from about 2 mmol to about 200 mmol, from about 2 mmol to about 100 mmol, from about 2 mmol to about 200 mmol, from about 5 mmol to about 100 mmol, from about 5 mmol to about 80 mmol, from about 5 mmol to about 70 mmol, from about 10 mmol to about 70 mmol, from about 15 mmol to about 70 mmol, from about 30 mmol to about 60 mmol, from about 1 mM to about 50 mM, or from about 1 30 mM, the amount being calculated based on the weight or volume of the composition excluding/before
  • the one or more amino acids or derivatives or salts thereof are present in the composition at an amount of per kg of dry compositions or slurries, or per L in the case of liquid compositions, of at least about 1 mmol, for example at least about 5 mmol, for example at least about 10 mmol, for example at least about 15 mmol, for example at least about 20 mmol, the amount being measured based on the weight or volume of the composition excluding/before addition of biomass and/or any extracted lipids.
  • the one or more amino acids comprises cysteine or cystine.
  • each of the one or more amino acids or derivatives or salts thereof are present in the food, feedstuff or beverage at a total amount of, per kg of dry composition or slurry, or per L in the case of liquid foods (e.g.
  • the one or more amino acids comprises cysteine and/or cystine.
  • the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives and one or more amino acids or derivatives or salts thereof or a compound comprising an amino group are present in the compositions of the present disclosure or the food products, beverage products or feedstuffs of the present disclosure in amounts sufficient to product food-like aromas, such as meat-like aromas, when heat is applied to the compositions, food products, beverage products or feedstuffs.
  • a compound comprising an amino group e.g. thiamine
  • the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives and one or more amino acids or derivatives or salts thereof are present in the compositions of the present disclosure or the food products, beverage products or feedstuffs of the present disclosure in amounts sufficient to produce one or more volatile compounds selected from 1,3-dimethyl benzene; p-xylene; ethylbenzene; 2-Heptanone; 2-pentyl furan; Octanal; 1,2-Octadecanediol; 2,4-diethyl-l -Heptanol; 2- Nonanone; Nonanal; l-Octen-3-ol; 2-Decanone; 2-Octen-l-ol, (E)-; 2,4-dimethyl-Benzaldehyde; 2,3,4,5-Tetramethylcyclopent-2-en-l-ol, 1-octanol, 2-heptanone, 3-octanone, 2,3-octaned
  • the one or more sugars, sugar alcohols, sugar acids, or sugar derivatives and one or more amino acids or derivatives or salts thereof are present in the compositions of the present disclosure or the food products, beverage products or feedstuffs of the present disclosure in amounts sufficient to produce one or more volatile compounds selected from 2-heptanone, 3-octanone, 2,3- octanedione, 1 -pentanol, 1 -hexanol, 2 -ethyl- 1 -hexanol, 1 -octanol, trans-2-octen-l-ol and 1 -nonanol when heat is applied to the composition, food product, beverage product or feedstuff.
  • the composition comprises comprise glutamic acid or a salt or derivative thereof (e.g. MSG) in addition to the one or more amino acids or derivatives or salts thereof.
  • the glutamic acid or salt thereof is present in an amount of, per kg of dry compositions or slurries, or per L in the case of liquid compositions, from about 1 mmol to about 200 mmol or from about 2 mmol to about 100 mmol, for example 2 mmol to about 50 mmol, for example from about 2 mmol to about 40 mmol, for example from about 2 mmol to about 40 mmol, for example from about 5 mmol to about 40 mmol, for example from about 5 mmol to about 30 mmol, the amount being calculated based on the volume of the composition excluding/before addition of biomass and/or any extracted lipid.
  • the glutamic acid or salt thereof is present in an amount of, per kg of dry compositions or slurries, or per L in the case of liquid compositions, at least about 1 mmol, for example at least about 2 mmol, for example at least about 3 mmol, for example at least about 4 mmol, for example at least about 5 mmol, for example at least about 7 mmol, for example at least about 10 mmol, the amount being measured based on the weight or volume of the composition excluding/before addition of biomass and/or any extracted lipids.
  • the glutamic acid salt is monosodium glutamate.
  • the food or beverage product or feedstuff of the invention comprises glutamic acid or a salt or derivative thereof (e.g. MSG) in addition to one or more other amino acids or derivatives or salts thereof, and the glutamic acid is present in an amount of, per kg of dry composition or slurry, or per L in the case of liquid compositions (e.g.
  • beverages from about 0.1 mmol to about 20 mmol, about 0.1 mmol to about 15 mmol, about 0.3 mmol to about 15 mmol, about 0.5 mmol to about 10 mmol, about 0.5 mmol to about 5 mmol, or about 1 mmol to about 5 mmol, the amount being calculated based on the volume of the food, feedstuff or beverage excluding/before addition of microbial biomass and/or lipids.
  • the composition comprises glutamic acid or a salt thereof and a further amino acid or salt or derivative thereof selected from cysteine and cystine (or a salt or derivative therof), wherein the glutamic acid or salt thereof is present in an amount of, per kg of dry compositions or slurries, or per L in the case of liquid compositions, from about 1 mmol to about 200 mmol or from about 2 mmol to about 100 mmol, for example 2 mmol to about 50 mmol, for example from about 2 mmol to about 40 mmol, for example from about 2 mmol to about 40 mmol, for example from about 5 mmol to about 40 mmol, for example from about 5 mmol to about 30 mmol; and the cysteine or cystine (or a salt or derivative therof) is present in an amount of from about 5 mmol to about 200 mmol or from about 5 mmol to about 100 mmol, for example from about 5 mmol to about 80 m
  • the composition comprises glutamic acid or a salt thereof and a further amino acid or salt or derivative thereof selected from cysteine and cystine, wherein the glutamic acid or salt thereof is present in an amount of, per kg of dry compositions or slurries, or per L in the case of liquid compositions, at least about 1 mmol, for example at least about 2 mmol, for example at least about 3 mmol, for example at least about 4 mmol, for example at least about 5 mmol, for example at least about 7 mmol, for example at least about 10 mmol, and the cysteine or cystine (or a salt or derivative therof) is present in an amount of at least about 5 mmol, for example at least about 10 mmol, for example at least about 15 mmol, for example at least about 20 mmol, the amount being calculated based on the weight or volume of the composition excluding/before addition of biomass and/or any extracted lipid.
  • the food or beverage product or feedstuff comprises glutamic acid or a salt thereof and a further amino acid or salt or derivative thereof selected from cysteine and cystine (or a salt or derivative therof), wherein the glutamic acid or salt thereof is present in an amount of, per kg of dry compositions or slurries, or per L in the case of liquid compositions, from about 0.1 mmol to about 20 mmol or from about 0.2 mmol to about 10 mmol, for example 0.2 mmol to about 5 mmol, for example from about 0.2 mmol to about 4 mmol, for example from about 0.5 mmol to about 4 mmol, for example from about 0.5 mmol to about 3 mmol; and the cysteine or cystine (or a salt or derivative therof) is present in an amount of from about 0.5 mmol to about 50 mmol or from about 0.5 mmol to about 20 mmol, for example from about 0.5 mmol to about 10
  • the composition comprises glutamic acid or a salt thereof and a further amino acid or salt or derivative thereof selected from cysteine and cystine (or a salt or derivative therof), wherein the glutamic acid or salt thereof is present in an amount of, per kg of dry compositions or slurries, or per L in the case of liquid, at least about 0.1 mmol, for example at least about 0.2 mmol, for example at least about 0.3 mmol, for example at least about 0.4 mmol, for example at least about 0.5 mmol, for example at least about 0.7 mmol, for example at least about 1 mmol, and the cysteine or cystine (or a salt or derivative therof) is present in an amount of at least about 0.5 mmol, for example at least about 1 mmol, for example at least about 1.5 mmol, for example at least about 2 mmol, the amount being calculated based on the weight or volume of the composition excluding/before addition of biomass and/or any extracted lipid.
  • Compositions, food products, beverage products or feedstuffs of the present invention may, according to some preferred embodiments, comprise a source of iron.
  • Iron may enhance the meaty flavour and/or aromas produced by compositions, food products, beverage products or feedstuffs of the present invention.
  • the source of iron is an iron salt, preferably a ferrous salt. Any iron salt suitable for consumption may be used, and such salts will be familiar to a person skilled in the art, for example a chelated form of iron.
  • the source of iron is iron (II) fumarate. Iron (II) fumarate is available, for example, as iron tablets from APOHEALTH Pty Ltd (NSW, Australia).
  • the source of iron is a component other than the biomass or a component thereof, the amino acid or salt or derivative thereof, and the sugar, sugar alcohol, sugar acid, or sugar derivative, even if the biomass or component thereof itself comprises iron.
  • the compositions of the present invention comprise a source of iron in an amount equivalent to, per kg of dry compositions or slurries, or per L in the case of liquid compositions, up to about 100 mg of elemental iron.
  • the compositions comprise a source of iron in an amount equivalent to up to about 50 mg, for example from about 20 to about 50 mg, for example from about 30 to about 40 mg, the concentration being calculated based on the volume of the composition excluding/before addition of biomass and/or any extracted lipid.
  • compositions, food products, beverage products or feedstuffs of the present disclosure comprise an aqueous component. Presence of some moisture in the compositions facilitates production of food-like flavour and/or aromas upon heating.
  • An aqueous component may be water.
  • the aqueous component may be, for example, an aqueous buffer such as a phosphate buffer.
  • the compositions, food products, beverage products or feedstuffs of the present disclosure comprise an aqueous component aside from any water contained incidentally in other components, such as any moisture present in microorganism biomass.
  • Compositions of the present disclosure are, in some preferred embodiments, not dry or substantially dry.
  • the composition, food product, beverage product or feedstuff is a dry composition.
  • the composition, food product, beverage product or feedstuff is a liquid composition.
  • the composition, food product, beverage product or feedstuff is in the form of a powder, solution, suspension, slurry or emulsion.
  • the composition, food product, beverage product or feedstuff is provided excluding an aqueous component (i.e. a dry composition), and an aqueous component (such as water) is added to the composition, food product, beverage product or feedstuff prior to or together with heating.
  • compositions, food products, beverage products or feedstuffs of the present disclosure may further comprise an aqueous buffer.
  • a buffer maintains the pH of the composition, and provides moisture to the composition, food product, beverage product or feedstuff which, as discussed above, facilitates production of food-like flavour and/or aromas upon heating.
  • the buffer may be a phosphate buffer.
  • the buffer may be a buffer at a pH of from about 5.0 to about 7, for example from about 5 to about 6, for example at about 5.3 or about 6.0.
  • the buffer is a phosphate buffer at a pH of about 6.0.
  • compositions, food products, beverage products or feedstuffs of the present invention may further comprise one or more additional components.
  • additional components may include oils (for example vegetable oils), free fatty acids, alpha-hydroxy acids, dicarboxylic acids, nucleosides, nucleotides, vitamins, peptides, protein hydrolysates, extracts, phospholipids, lecithin, carbohydrates, and organic molecules.
  • the compositions of the present invention which may be flavouring compositions (e.g.
  • a food-like flavour such as a meat-like flavour
  • a food-like flavour such as a meat-like flavour
  • the compositions, food products, beverage products or feedstuffs comprise thiamine or derivatives thereof.
  • the thiamine can be present as the compound containing an amino group and thus enable the Maillard reaction.
  • the compositions, food products, beverage products or feedstuffs of the present invention may comprise the a) the biomass, b) sugars, sugar alcohols, sugar acids, or sugar derivatives and c) thiamine.
  • the compositions, food products, beverage products or feedstuffs of the present invention may comprise a) the biomass, b) sugars, sugar alcohols, sugar acids, or sugar derivatives, c) one or more amino acids or derivatives or salts thereof, and d) thiamine.
  • Thiamine may therefore enhance the meaty aroma and/or flavour produced by compositions, food products, beverage products or feedstuffs of the present invention.
  • thiamine may be present in the compositions, per kg of dry compositions or slurries, or per L in the case of liquid compositions, in an amount of from about 0.1 to about 20 mmol, for example from about 0.1 to about 10 mmol, for example from about 0.5 to about 5 mmol, for example from about 0.5 to about 3 mmol.
  • thiamine is present in an amount of at least about 0.1 mmol, for example at least about 0.2 mmol, for example at least about 0.3 mmol, for example at least about 0.4 mmol, for example at least about 0.5 mmol, for example at least about 0.7 mmol, the concentration being calculated based on the weight or volume of the composition excluding/before addition of biomass and/or any extracted lipid.
  • thiamine may be present in the food, feedstuffs or beverages, per kg of dry composition or slurry, or per L in the case of liquid compositions (e.g.
  • beverages in an amount of from about 0.01 to about 2 mmol, for example about 0.01 to about 1 mol, for example from about 0.05 to about 0.5 mmol, or about 0.1 to about 0.3 mmol, the amount being calculated based on the weight or volume of the food, feedstuff or beverage excluding/before addition of microbial biomass and/or lipids.
  • thiamine is present in the food, feedstuff or beverages in an amount of at least about 0.01 mmol, for example at least about 0.02 mmol, for example at least about 0.03 mmol, for example at least about 0.04 mmol, for example at least about 0.05 mmol, for example at least about 0.07 mmol, the concentration being calculated based on the weight or volume of the food, feedstuff or beverage excluding/before addition of biomass and/or any extracted lipid.
  • the compositions, food products, beverage products or feedstuffs further comprise a yeast extract.
  • a “yeast extract” is generally understood to refer to the water-soluble portion of autolyzed yeast and is available commercially from various suppliers; see, for example Sigma Aldrich, Catalog No. Y1625 Yeast Extract.
  • a yeast extract does not contain yeast whole cell biomass. Presence of a yeast extract may enhance meaty aromas and/or flavours produced by the composition, food product, beverage product or feedstuff when heated.
  • the yeast extract may be a general unflavoured yeast extract, or may be, for example, a beef flavoured or roast chicken skin flavoured yeast extract.
  • the composition, food product, beverage product or feedstuff is suitable for producing food-like aromas and/or flavours which are meat-like aromas and/or flavours
  • the composition, food product, beverage product or feedstuff comprises a yeast extract.
  • the presence of a yeast extract may enhance meaty aromas and/or flavours produced by compositions, food products, beverage products or feedstuffs of the present disclosure, as observed in the Examples below.
  • the yeast extract is present in the composition in an amount of, per kg of dry compositions or slurries, or per L in the case of liquid compositions, from about 10 g to about 200 g, for example from about 15 g to about 200g, for example from about 20 g to about 200g, for example from about 30 g to about 200g, for example from about 40 g to about 200g, for example from about 50 g to about 200g, for example from about 50 g to about 180 g, for example from about 60 g to about 180 g, the amount being calculated based on the volume of the composition excluding/before addition of biomass and/or any extracted lipid from microorganisms.
  • the yeast extract is present in the composition in an amount of, per kg of dry compositions or slurries, or per L in the case of liquid compositions, at least about 5g, for example at least about 7 g, for example at least about 10 g, for example at least about 15 g, for example at least about 20 g, for example at least about 25 g, for example at least about 30 g, for example at least about 40 g, for example at least about 50 g, for example at least about 60 g.
  • the yeast extract is present in the composition in an amount of, per kg of dry compositions or slurries, or per L in the case of liquid compositions, at least about 30 g.
  • the yeast extract is present in the composition in an amount of, per kg of dry compositions or slurries, or per L in the case of liquid compositions, at least about 5g, for example at least about 7 g, for example at least about 10 g, for example at least about 15 g, for example at least about 20 g, for example at least about 25 g, for example at least about 30 g, for example at least about 40 g, for example at least about 50 g, for example at least about 60 g.
  • the yeast extract is present in the composition in an amount of, per kg of dry compositions or slurries, or per L in the case of liquid compositions, at least about 30 g.
  • the yeast extract is present in the food, feedstuff or beverage in an amount of, per kg of dry compositions or slurries, or per L in the case of liquid, at least about 0.5g, for example at least about 0.7 g, for example at least about 1 g, for example at least about 1.5 g, for example at least about 2 g, for example at least about 2.5 g, for example at least about 3 g, for example at least about 4 g, for example at least about 5 g, for example at least about 6 g.
  • the yeast extract is present in the food, feedstuff or beverage in an amount of, per kg of dry compositions or slurries, or per L in the case of liquid compositions, at least about 3 g.
  • the composition, food product, beverage product or feedstuff does not comprise a yeast extract. Since the presence of a yeast extract may enhance meaty aromas and/or flavours produced by the composition, food product, beverage product or feedstuff, a yeast extract maybe omitted when, for example, an alternative food-like flavour and/or aroma is desired, such as a fishy or a vegetable or herby aroma and/or flavour. The absence of a yeast extract may prevent the potential masking of the desired aroma and/or flavour such as a fish-like aroma and/or flavour by meatlike aromas and/or flavours enhanced by the presence of a yeast extract.
  • the food-like aroma and/or flavour is a fish-like aroma and/or flavour, a vegetable, and/or a herby aroma and/or flavour
  • the composition, food product, beverage product or feedstuff does not comprise a yeast extract.
  • the compositions, food products, beverage products or feedstuffs further comprise one or more herbs and/or spices.
  • compositions comprising herbs such as for example Fenugreek (Trigonella foenum-graecum), were found in some instances to enhance vegetable, soupy and/or herby flavour and/or aromas produced by the compositions of the present invention.
  • a herb and/or spice is understood in the art to refer to a plant part or extract possessing aromatic properties.
  • a herb is understood to refer to leafy, green or flowering parts of a plant
  • a spice is typically understood to refer to other parts of a plant (usually dried), including seeds, bark, roots and fruit.
  • the herb or spice may be in the form of whole plant parts, or chopped, ground or rolled plant parts, or dried, for example as a powder.
  • the one or more herbs and/or spices comprise Fenugreek.
  • Fenugreek has also been claimed to contain several bioactive components and can bring health benefits to consumers.
  • the one or more herbs and/or spices comprise Fenugreek leaf.
  • compositions, foods, feedstuffs or beverages comprise: a) Mortierella spp. biomass (or other microbial biomass) or extracted lipid therefrom; b) one or more lactones and/or one or more 4-hydroxy fatty acids; c) glucose and/or ribose; d) cysteine and/or cystine and/or methionine and/or thiamine; and e) an aqueous component.
  • compositions, foods, feedstuffs or beverages comprise: a) Mortierella spp. biomass (or other microbial biomass) or extracted lipid therefrom; b) one or more lactones and/or one or more 4-hydroxy fatty acids; c) glucose and/or ribose; d) cysteine and/or cystine and/or methionine and/or thiamine; e) glutamic acid or a salt thereof; and f) an aqueous component.
  • the compositions comprise: a) Mortierella spp. biomass (or other microbial biomass) or extracted lipid therefrom; b) one or more lactones and/or one or more 4-hydroxy fatty acids; c) glucose and/or ribose; d) cysteine and/or cystine; e) yeast extract; f) glutamic acid or a salt thereof; g) thiamine; and h) an aqueous component.
  • the compositions comprise: a) Mortierella spp. biomass (or other microbial biomass) or extracted lipid therefrom; b) one or more lactones and/or one or more 4-hydroxy fatty acids; c) glucose and/or ribose; d) cysteine and/or cysteine; e) a source of iron, for example an iron salt; f) glutamic acid or a salt thereof; g) thiamine; h) an aqueous component, for example as an aqueous buffer, for example a phosphate buffer, for example having a pH of from about 5 to about 6, for example of about 5.3 or about 6.0; and i) optionally a yeast extract.
  • the compositions comprise: a) Mortierella spp. biomass (or other microbial biomass) or extracted lipid therefrom; b) one or more lactones and/or one or more 4-hydroxy fatty acids; c) ribose; d) cysteine; e) a source of iron, for example an iron salt; f) glutamic acid or a salt thereof; g) thiamine; h) an aqueous component, for example as an aqueous buffer for example a phosphate buffer, for example having a pH of from about 5 to about 6, for example of about 5.3 or about 6.0; and i) optionally a yeast extract.
  • the composition comprises (aside from the biomass and/or any extracted lipid) the components set out in “matrix A” or “matrix B” in Table 1 below, or “matrix C” in Table 2 below (as prepared from the stock ingredients set out below), or the components of Matrix A, B or CB in equivalent concentrations if otherwise prepared.
  • matrix A or “matrix B” in Table 1 below
  • matrix C in Table 2 below
  • the present disclosure further relates to a method of producing a food product, beverage product or feedstuff comprising combining biomass and/or any extracted lipid therefrom disclosed herein, optionally with a lactone and/or a 4-hydroxy fatty acid, with one or more additional consumable ingredients; or a composition of the present disclosure with one or more additional consumable ingredients.
  • Suitable additional ingredients which may be included in such food products, beverage products or feedstuffs are discussed below.
  • the biomass and any optional extracted lipids comprising phospholipids disclosed herein or composition can be combined with the other consumable ingredient by mixing, applying it to the surface of the other ingredient, or by soaking/marinating the other ingredient.
  • the food, feedstuff or beverage product is prepared by (a) heating biomass and/or any extracted lipid therefrom with a lactone and/or 4-hydroxy fatty acid, or a composition of the invention and (b) mixing the products from (a) with other food, feedstuff or beverage consumable ingredients, or by (a) mixing biomass and/or extracted lipid therefrom with a lactone and/or 4-hydroxy fatty acid; or a composition of the present disclosure with other food, feedstuff or beverage consumable ingredients and (b) heating the mixture resulting from (a).
  • the food product, beverage product or feedstuff may either be in a solid or liquid form, and may be intended to be kept frozen, refrigerated or at room temperature prior to cooking.
  • the food product, beverage product, feedstuff or composition is provided as a dry product excluding an aqueous component, and an aqueous component (such as water) is added to the food product, beverage product or feedstuff or composition prior to, during or subsequent to heating, especially prior to heating.
  • the composition may be in a solid or liquid form, to be admixed with, or added to a food or beverage product or feedstuff pror to heating, or after heating one or both of the composition and the food or beverage product or feedstuff.
  • the compositon may be in solid or liquid form, and may represent, for a example, a concentrated mix, to be mixed with or added to a food or beverage product or feedstuff.
  • the mix may be, for example, in the form of a powder, particulate or granulated mix.
  • the food or beverage product or feedstuff may include edible macronutrients, protein, carbohydrate, vitamins, and/or minerals in amounts desired for a particular use.
  • the amounts of these ingredients will vary depending on whether the composition is intended for use with normal individuals or for use with individuals having specialized needs, such as individuals suffering from metabolic disorders and the like.
  • the food or beverage product or feedstuff of the present invention contains no components derived from an animal.
  • at least some of the ingredients are plant material or material derived from a plant.
  • Such embodiments are advantageously suitable for a vegan or vegetarian diet.
  • the food or beverage product or feedstuff can be soy-free, wheat-free, yeast-free, MSG-free, and/or free of protein hydrolysis products.
  • the food or beverage product or feedstuff preferably has a food-like taste or aroma, such as a meaty or fishy aroma, as imparted by the biomass and any extracted lipids comprising phospholipids disclosed herein or composition of the present disclosure.
  • suitable additional ingredients with nutritional value include, but are not limited to, macronutrients such as edible fats, carbohydrates and proteins.
  • suitable additional ingredients with nutritional value include, but are not limited to, macronutrients such as edible fats, carbohydrates and proteins.
  • suitable edible fats other than phospholipids contained in compositions of the present disclosure include, but are not limited to, palm oil, canola oil, corn oil, sunflower oil, safflower oil, coconut oil, borage oil, fungal oil, black current oil, soy oil, blends thereof and mono- and diglycerides.
  • examples of carbohydrates include (but are not limited to): glucose, edible lactose, and hydrolyzed starch.
  • proteins include (but are not limited to) soy proteins, mycoproteins (e.g Rhiza my coproteins), instantan, pea protein, potato protein, electrodialysed whey, electrodialysed skim milk, milk whey, or the hydrolysates of these proteins.
  • the protein is a textured or structured protein product, which comprises protein fiber networks and/or aligned protein fibers that produce meat -like textures.
  • vitamins and minerals may be added to the food or beverage product or feedstuff of the present invention: calcium, phosphorus, potassium, sodium, chloride, magnesium, manganese, iron, copper, zinc, selenium, iodine, and Vitamins A, E, D, C, and the B complex. Other such vitamins and minerals may also be added.
  • Additional ingredients which may be included in food or beverage products or feedstuffs include food-grade oils such as canola, corn, sunflower, soybean, olive or coconut oil, seasoning agents such as edible salts (e.g., sodium or potassium chloride) or herbs (e.g., rosemary, thyme, basil, sage, or mint), flavouring agents, proteins (e.g., soy protein isolate, wheat gluten, pea vicilin, and/or pea legumin), protein concentrates (e.g., soy protein concentrate), emulsifiers (e.g., lecithin), gelling agents (e.g., k-carrageenan or gelatin), fibers (e.g., bamboo filer or inulin), or minerals (e.g., iodine, zinc, and/or calcium).
  • seasoning agents such as edible salts (e.g., sodium or potassium chloride) or herbs (e.g., rosemary, thyme, basil, sage, or mint), flavouring
  • Food and beverage products and feedstuffs described herein also can include a natural coloring agent such as turmeric or beet juice, or an artificial coloring agent such as azo dyes, triphenylmethanes, xanthenes, quinines, indigoids, titanium dioxide, red #3, red #40, blue #1, or yellow #5.
  • a natural coloring agent such as turmeric or beet juice
  • an artificial coloring agent such as azo dyes, triphenylmethanes, xanthenes, quinines, indigoids, titanium dioxide, red #3, red #40, blue #1, or yellow #5.
  • Food and beverage products and feedstuffs described herein also can include meat shelf-life extenders such as carbon monoxide, nitrites, sodium metabisulfite, Bombal, vitamin E, rosemary extract, green tea extract, catechins and other anti-oxidants.
  • meat shelf-life extenders such as carbon monoxide, nitrites, sodium metabisulfite, Bombal, vitamin E, rosemary extract, green tea extract, catechins and other anti-oxidants.
  • the components utilized in the food or beverage product or feedstuff of the present invention can be of semi-purified or purified origin.
  • semi-purified or purified is meant a material which has been prepared by purification of a natural material or by de novo synthesis.
  • Food products, feedstuffs, beverage products and compositions described herein can be packaged in various ways, including being sealed within individual packets or shakers, such that the composition can be sprinkled or spread on top of a food product before or during cooking.
  • compositions, food products, beverage products and feedstuffs described herein can be assessed for flavour and aroma using human panelists. It will be appreciated that assessment of aromas by panellists will involve a certain degree of subjectivity, and that precise descriptions of aromas and whether they are appealing/unappealing may differ somewhat between panellists. Nonetheless, trends and the general nature of aromas can be effectively assessed by panellists.
  • the evaluations can involve eyeing, feeling, chewing, smelling and tasting of the product to judge product appearance, color, integrity, texture, flavour, and mouth feel, etc., preferably at least smelling the composition, food or beverage product or feedstuff to assess aroma. Panelists can be served samples under red or under white light. A scale can be used to rate the overall acceptability or quality of the food or specific quality attributes such meatiness, texture, and flavour.
  • the compositions, food products, beverage products and feedstuffs can also be presented to animals such as pet animals to assess their attractiveness to those animals.
  • a food product, beverage product or feedstuff or composition described herein can be compared to another product (e.g., meat or meat substitute) based upon olfactometer readings.
  • the olfactometer can be used to assess odor concentration and odor thresholds, odor suprathresholds with comparison to a reference gas, hedonic scale scores to determine the degree of appreciation, or relative intensity of odors.
  • volatile chemicals identified using GCMS can be evaluated. For example, a human can rate the experience of smelling the chemical responsible for a certain peak. This information could be used to further refine the profile of flavour and aroma compounds produced by the food products, beverage products, feedstuffs or compositions of the present invention.
  • the present invention further relates to methods of producing a composition, food product, beverage product or feedstuff, by combining a biomass with any one or more of the ingredients described above, optionally in the amounts as described above.
  • compositions, food products, beverage products or feedstuffs of the present disclosure produce a food-like flavour and/or aroma, preferably a meat-like flavour and/or aroma, when heated.
  • Heating refers to increasing the temperature of the composition, food products, beverage products or feedstuffs, for example to above room temperature, to any temperature and for any amount of time sufficient to produce food-like flavour and/or aromas.
  • the temperature is raised high enough and long enough for Maillard reactions to occur between amino groups and sugars in the composition, with additional reactions occurring with lipids, preferably phospholipids, in the composition, food products, beverage products or feedstuffs to produce the food-like flavour and/or aromas.
  • a suitable temperature and period of time may be readily carried out by the skilled person.
  • “heated” or “heating” or similar is to be understood as meaning heating under conditions sufficient for producing a food-like aroma, unless otherwise specified.
  • the heat may be applied to the composition of the invention prior to it being contacted with the food product, beverage product or feedstuff or after the application to the food product, beverage product or feedstuff or both.
  • Such heating of the composition, or the food product, beverage product or feedstuff may take place for example in an oven, frypan, wok or similar, or in a barbeque.
  • compositions or food products, beverage products or feedstuffs Whilst the precise temperature to which a composition, food product, beverage product or feedstuff should be heated to produce a food-like flavour and/or aroma, preferably a meat -like flavour and/or aroma, may vary depending on, for example, the precise composition and the time for which the composition is heated and the amount of composition being heated, in some embodiments, the compositions or food products, beverage products or feedstuffs produce a food-like flavour and/or aroma when heated to a temperature of at least about 100°C, for example at least about 110°C, for example at least about 120°C or at least about 130°C, or at least about 140°C. In particular embodiments, the compositions or food products, beverage products or feedstuffs produce a food-like flavour and/or aroma when heated to about 140°C.
  • compositions and food products, beverage products or feedstuffs of the present disclosure may produce a food-like flavour and/or aroma, preferably a meat-like flavour and/or aroma when heated for varying amounts of time, depending on, for example, the temperature to which the compositions or food products, beverage products or feedstuffs are heated, the precise nature of the composition, food product, beverage product or feedstuff and the amount of composition, food product, beverage product or feedstuff being heated. Nonetheless, in some embodiments the compositions, food products, beverage products or feedstuffs may produce a food-like flavour and/or aroma when heated for at least 5 or at least 10 minutes, for example at least 15 minutes.
  • the compositions, food products, beverage products or feedstuffs may produce a food-like flavour and/or aroma when heated for at least about 30 minutes, for example at least about 45 minutes. In some embodiments, the compositions, food products, beverage products or feedstuffs may produce a food like flavour and/or aroma when heated for at least about 1 hour, for example about 1 hour. Preferably, the heat is applied for a length of time whereby a burnt flavour and/or aroma is not produced, as is understood by a person of skill in the art.
  • the compositions, food products, beverage products or feedstuffs of the present invention may produce a food-like flavour and/or aroma, preferably a meat-like flavour and/or aroma, when heated for at least 5 or at least 10 minutes at a temperature of at least about 100°C.
  • the compositions, food products, beverage products or feedstuffs of the present invention may produce a food-like flavour and/or aroma when heated for at least 30 minutes at a temperature of at least about 100°C.
  • the compositions, food products, beverage products or feedstuffs of the present invention may produce a food-like flavour and/or aroma when heated for at least 30 minutes at a temperature of at least about 120°C.
  • the compositions, food products, beverage products or feedstuffs of the present invention may produce a food-like flavour and/or aroma when heated for at least 30 minutes at a temperature of at least about 130°C. In some embodiments, the compositions, food products, beverage products or feedstuffs of the present invention may produce a food-like flavour and/or aroma when heated for at least 1 hour at a temperature of at least about 130°C. In some embodiments, the compositions, food products, beverage products or feedstuffs of the present invention may produce a food-like flavour and/or aroma when heated for at least 1 hour at a temperature of at least about 140°C. In some particular embodiments, the compositions, food products, beverage products or feedstuffs may produce a food-like flavour and/or aroma when heated for about 1 hour at about 140°C.
  • compositions, food products, beverage products or feedstuffs of the present invention may, according to some embodiments, produce food-like flavours and/or aromas when heated to temperatures and for time periods different to those outlined above, but that, in some embodiments, stronger and/or more desirable food-like flavours and/or aromas may be produced when the compositions, food products, beverage products or feedstuffs are heated to the temperatures discussed above and/or for the time periods discussed above.
  • the food-like flavours and/or aromas produced by compositions, food products, beverage products or feedstuffs of the present disclosure may, according to preferred embodiments, include a meat-like flavour and/or aroma.
  • the food-like flavour and/or aroma may be an aroma of cooked meat or meat-based foods.
  • the food-like flavour and/or aroma may be of beef, steak, chicken, for example roasted chicken or chicken skin, pork, lamb, duck, venison, chicken or other meat soup, meat broth, liver, or generally “meaty”.
  • the meat -like flavour or arma is a chicken (e.g. roast chicken or pan-fried chicken), beef (e.g. roast or pan-fried beef), or pork (e.g.
  • roast or pan-fried pork flavour or aroma.
  • aromas are typically detected by human volunteers, for example by a qualified sensory panel.
  • a composition, food product, beverage product or feedstuff is said to produce a food-like or meat-like flavour and/or aroma when at least one third, for example at least one half, of the number of volunteers on a tasting/smelling panel detect a food-like or meat -like flavour and/or aroma in a double-blind test of the composition, food product, beverage products or feedstuff.
  • the food-like flavours and/or aromas produced by compositions, food products, beverage products or feedstuffs of the present disclosure may, according to some embodiments, include a fishlike flavour and/or aroma, for example a cooked fish flavour and/or aroma, for example a fried fish flavour and/or aroma.
  • the food-like flavours and/or aromas produced by compositions, food products, beverage products or feedstuffs of the present disclosure may include a vegetable and/or herbal flavour and/or aroma, for example a cooked vegetable and/or herby flavour and/or aroma, for example a soup, mushroom, onion, vegetable, herbal or roasted vegetable flavour and/or aroma.
  • the composition, food product, beverage product or feedstuff includes ribose and the food-like flavour and/or aroma includes a meaty, for example cooked meat -like flavour and/or aroma, and/or a fishy, for example a cooked or fried fish-like flavour and/or aroma.
  • volatile compounds indicative of meat-like or meat-associated aromas and flavours include, for example volatile compounds such as 1,3-dimethyl benzene; p-xylene; ethylbenzene; 2-Heptanone; 2-pentyl furan; Octanal; 1,2-Octadecanediol; 2,4-diethyl-l -Heptanol; 2- Nonanone; Nonanal; l-Octen-3-ol; 2-Decanone; 2-Octen-l-ol, (E)-; 2,4-dimethyl-Benzaldehyde; 2,3,4,5-Tetramethylcyclopent-2-en-l-ol, 1-octanol, 2-heptanone, 3-octanone, 2,3-octanedione, 1- pentanol, 1-hexanol, 2-ethyl-l -hexanol, trans-2-octen-l-
  • volatile compounds indicative of meat-like or meat-associated aromas and flavours include 2-heptanone, 3-octanone, 2,3-octanedione, 1-pentanol, 1-hexanol, 2-ethyl-l -hexanol, 1-octanol, trans-2-octen-l-ol and 1-nonanol are produced.
  • volatile compounds indicative of meat-like or meat-associated aromas and flavours include 1-pentanal, 3-octanone, 2- octen-l-ol, 1-nonanol and 1-octanol, and optionally 1, 3 -bis( 1,1 -dimethylethyl) -benzene are produced.
  • the composition, food product, beverage product or feedstuff includes glutamic acid, for example glutamic acid in addition to a further amino acid or salt or derivative thereof such as cysteine, and the food-like flavour and/or aroma includes a meaty, for example cooked meat-like, and/or a fishy, for example a cooked or fried fish-like flavour and/or aroma.
  • the composition, food product, beverage product or feedstuff includes a yeast extract and the food-like flavour and/or aroma includes a meaty, for example cooked meat-like flavour and/or aroma.
  • the composition, food product, beverage product or feedstuff does not include a yeast extract and the food -like flavour and/or aroma includes a fish-like, for example cooked fish or fried fish-like, vegetable and/or herby aroma and/or flavour.
  • the microorganism is Mortierella spp., for example Mortierella alpina
  • the food-like flavour and/or aroma includes a meat -like flavour and/or aroma, for example a chicken-like flavour and/or aroma for example a cooked chicken flavour and/or aroma, for example a roast chicken, chicken skin or chicken broth flavour and/or aroma.
  • the microorganism is Mortierella spp., for example Mortierella alpina, Mortierella elongata or Mortierella exigua and the food-like flavour and/or aroma includes a meat-like flavour and/or aroma, such as a beef-like flavour and/or aroma.
  • the composition, food product, beverage product or feedstuff includes one or more herbs and/or spices, for example fenugreek, for example fenugreek leaf, and the food-like flavour and/or aroma includes a vegetable, soupy and/or herby flavour and/or aroma.
  • herbs and/or spices for example fenugreek, for example fenugreek leaf
  • the food-like flavour and/or aroma includes a vegetable, soupy and/or herby flavour and/or aroma.
  • compositions, food products, beverage products or feedstuffs of the present disclosure may produce food-like flavours as well as food-like aromas.
  • Such food-like flavours may be flavours corresponding to the food-like aromas disclosed herein.
  • reference to aromas herein may be understood, according to certain aspects, to also refer to aromas and/or flavours where appropriate.
  • the combination of biomass or extracted lipid therefrom and one or more lactones and/or one or more 4-hydroxy fatty acids, or composition of the present invention is incorporated into the food or beverage product or feedstuff prior to or during heating, such that when the food or beverage product is heated (for example during cooking), the biomass and lactone combination and any optional extracted lipids comprising phospholipids disclosed herein or composition produces the associated food-like aromas (by way of Maillard and associated reactions).
  • heating causes cyclisation of the 4- hydroxy fatty acids to form lactones for the production of said food-like aromas.
  • the biomass or extracted lipid therefrom and lactone and/or 4-hydroxy fatty acid combination, or composition of the present invention is heated prior to incorporation in or addition to a food or beverage product or feedstuff.
  • the biomass or extracted lipid therefrom and lactone and/or 4- hydroxy fatty acids combination have been heated prior to incorporation into the food, such as in the presence of a sugar and an amino acid or derivative, under conditions suitable to produce one or more (e.g.
  • volatile compounds indicative of meat-like or meat-associated aromas and flavours for example volatile compounds such as 1,3-dimethyl benzene; p-xylene; ethylbenzene; 2- Heptanone; 2-pentyl furan; Octanal; 1,2-Octadecanediol; 2,4-diethyl-l -Heptanol; 2-Nonanone; Nonanal; l-Octen-3-ol; 2-Decanone; 2-Octen-l-ol, (E)-; 2,4-dimethyl-Benzaldehyde; 2, 3,4,5- Tetramethylcyclopent-2-en-l-ol, 1-octanol, 2-heptanone, 3-octanone, 2, 3 -octanedione, 1-pentanol, 1- hexan
  • one or more (e.g. 2, 3, 4, 5, 6, 7, 8 or 9) volatile compounds selected from 2-heptanone, 3-octanone, 2, 3 -octanedione, 1-pentanol, 1-hexanol, 2-ethyl-l -hexanol, 1-octanol, trans-2-octen-l-ol and 1-nonanol are produced.
  • one or more (e.g. 2, 3, 4, 5, 6, 7, 8 or 9) volatile compounds selected from 2-heptanone, 3-octanone, 2, 3 -octanedione, 1-pentanol, 1-hexanol, 2-ethyl-l -hexanol, 1-octanol, trans-2-octen-l-ol and 1-nonanol are produced.
  • volatile compound(s) selected from 1-pentanal, 3-octanone, 2-octen-l-ol, 1-nonanol and 1-octanol, and optionally 1,3- bis(l,l-dimethylethyl)-benzene are produced.
  • various fatty acids and in particular the co6 fatty acids (e.g. ARA, GLA, DGLA, EDA, DTA and/or DPA-co6) in the biomass or extracted microbial lipid may change when one or more of these volatile compounds are produced from the reaction between the fatty acids on the polar lipids, the sugar and the amino acid.
  • co6 fatty acids e.g. ARA, GLA, DGLA, EDA, DTA and/or DPA-co6
  • a food, beverage or feedstuff of the invention comprises biomass or extracted lipid wherein the biomass and lipids are a product of a reaction between a combination of a microbial biomass, e.g. a Mortierella spp biomass, (or extracted microbial lipid) and one or more lactones and/or one or more 4-hydroxy fatty acids, an amino acid or derivative, and a sugar under conditions suitable to produce at least two compounds which have a meat -associated flavour and/or aroma.
  • a microbial biomass e.g. a Mortierella spp biomass, (or extracted microbial lipid)
  • lactones and/or one or more 4-hydroxy fatty acids e.g. a lactones and/or one or more 4-hydroxy fatty acids, an amino acid or derivative, and a sugar under conditions suitable to produce at least two compounds which have a meat -associated flavour and/or aroma.
  • the conditions include heating, such as at a temperature of at least about 100°C, 110°C, 120°C, 130°C or 140°C, over a period of time (e.g. as described further below) and with sufficient quantities or concentrations of the sugar and amino acid or derivative to produce the volatile compounds.
  • heating the composition, food product, beverage product or feedstuff of the present disclosure results in the production of one or more compound(s) which have a food-like aroma, such as a meat-like aroma, preferably volatile compounds.
  • a food-like aroma such as a meat-like aroma, preferably volatile compounds.
  • such heating results in production of a greater amount of said one or more compound(s) than heating a food product, beverage product or feedstuff which does not comprise biomass comprising phospholipids disclosed herein or a composition according to the present disclosure.
  • applying heat to the composition, food product, beverage product or feedstuff results in the production of two or more (e.g. at least or about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 26, 28, 29, 30 or 31) volatile compound(s) selected from 1,3-dimethyl benzene; p-xylene; ethylbenzene; 2-Heptanone; 2-pentyl furan; Octanal; 1,2- Octadecanediol; 2, 4-diethyl-l -Heptanol; 2-Nonanone; Nonanal; l-Octen-3-ol; 2-Decanone; 2-Octen-l- ol, (E)-; 2,4-dimethyl-Benzaldehyde; 2,3,4,5-Tetramethylcyclopent-2-en-l-ol, 1-octanol, 2-heptanone, 3-octanone, 2,3-oc
  • production of three or more, four or more or five or more of the aforesaid compounds result from the application of heat to the composition, food product, beverage product or feedstuff.
  • one or more (e.g. 2, 3, 4, 5, 6, 7, 8 or 9) volatile compounds selected from 2-heptanone, 3-octanone, 2,3-octanedione, 1-pentanol, 1- hexanol, 2-ethyl-l -hexanol, 1-octanol, trans-2-octen-l-ol and 1-nonanol are produced.
  • volatile compound(s) selected from 1-pentanal, 3-octanone, 2-octen-l-ol, 1-nonanol and 1-octanol, and optionally l,3-bis(l,l-dimethylethyl)-benzene are produced upon heating the composition, food product, beverage product or feedstuff.
  • Characteristic flavour and fragrance components are mostly produced during the cooking process by chemical reactions molecules including amino acids, fats and sugars which are found in plants as well as meat. Therefore, in some embodiments, a food product, beverage product or feedstuff is tested for similarity to meat during or after cooking. In some embodiments human ratings, human evaluation, olfactometer readings, or GC-MS measurements, or combinations thereof, are used to create an olfactory map of the food or beverage product or feedstuff, for a meat replica. Similarly, an olfactory map of a comparison product, such as meat, can be created. These maps can be compared to assess how similar the cooked food, beverage or feedstuff is to meat.
  • the present invention further relates to a method of producing food-like flavour and/or aromas, comprising heating a food or beverage product or feedstuff, comprising a combination of biomass or extracted lipid therefrom and one or more lactones and/or one or more 4-hydroxy fatty acids, and any optional extracted lipids comprising phospholipids as disclosed herein, or comprising a composition of the present invention.
  • the present invention further relates to a method of imparting, or increasing, a food-like flavour and/or aroma to a food product, beverage product or feedstuff comprising contacting the food product, beverage product or feedstuff with a combination of biomass or extracted lipid and one or more lactones and/or one or more 4-hydroxy fatty acids, and any optional extracted lipids as disclosed herein, or a composition according to the present invention and heating the food product, beverage product or feedstuff and composition or combination and any optional extracted lipids.
  • the present invention further relates to a method of preparing a food product, beverage product or feedstuff for consumption, the method comprising heating a food product, beverage product or feedstuff of the invention to produce a food-like flavour and/or aroma, for example meaty or fishy flavour and/or aromas.
  • the present invention further relates to a method of increasing food-like flavours and/or aromas, especially meaty or fishy flavours and/or aromas, such as meaty flavours and/or aromas associated with a food product, beverage product or feedstuff, comprising heating a food product, beverage product ingredient and a composition according to the present invention or a combination of biomass or extracted lipid therefrom and one or more lactones and/or one or more 4-hydroxy fatty acids, and any optional extracted lipids as disclosed herein, under conditions sufficient to produce a food-like flavour and/or aroma.
  • meaty or fishy flavours and/or aromas such as meaty flavours and/or aromas associated with a food product, beverage product or feedstuff
  • the present invention further relates to a method of increasing food-like flavour and/or aromas, especially meaty or fishy flavour and/or aromas, such as meaty flavour and/or aromas associated with a food product, beverage product or feedstuff, comprising contacting the food product, beverage product or feedstuff with a composition according to the present invention or with a combination of biomass or extracted lipid therefrom and one or more lactones and/or one or more 4- hydroxy fatty acids, and any optional extracted lipids comprising phospholipids as disclosed herein, and heating under conditions sufficient to produce a food-like flavour and/or aroma.
  • meaty or fishy flavour and/or aromas such as meaty flavour and/or aromas associated with a food product, beverage product or feedstuff
  • the composition of the present disclosure or the combination is added to or incorporated into a food or beverage product or feedstuff before heating, and the food or beverage product or feedstuff including the composition or combination is subsequently heated to product a food-like flavour and/or aroma.
  • a combination of biomass or extracted lipid therefrom and one or more lactones and/or one or more 4-hydroxy fatty acids, and any optional extracted lipids comprising phospholipids, or a composition of the present disclosure is heated before addition to a food or beverage product or feedstuff.
  • the combination or composition of the present disclosure may optionally be allowed to cool after heating and before contacting the food product, beverage product or feedstuff.
  • the present disclosure further provides a method of increasing food-like aromas and/or flavours associated with a food product, beverage product or feedstuff, comprising: a) heating a composition of the present invention; and b) contacting a food product, beverage product or feedstuff with the composition obtained in step a).
  • compositions, food or beverage product or feedstuff should be heated to produce a food-like flavour and/or aroma will depend on various factors, including the nature of the composition, the nature of the food or beverage product or feedstuff, and the amount of composition or combination of biomass or extracted lipid therefrom and one or more lactones and/or one or more 4-hydroxy fatty acids, and any optional additional extracted lipids comprising phospholipids, incorporated in the food or beverage product or feedstuff.
  • methods of producing food-like flavour and/or aromas may comprise heating the composition, food or beverage product or feedstuff to a temperature of at least about 100°C, for example at least about 110°C, for example at least about 120°C or at least about 130°C.
  • the methods comprise heating the composition, food or beverage product or feedstuff to a temperature of about 140°C.
  • methods of producing food-like flavour and/or aromas may, according to some embodiments, comprise heating the composition, food or beverage product or feedstuff for at least 10 minutes, for example at least 15 minutes. In some embodiments, methods of producing food-like aromas may comprise heating the composition, food or beverage product or feedstuff for at least about 30 minutes, for example at least about 45 minutes. In some embodiments, methods of producing food-like aromas may comprise heating the composition, food or beverage product or feedstuff for at least about 1 hour, for example about 1 hour.
  • methods of producing food-like aromas may comprise heating the composition, food or beverage product or feedstuff for at least 10 minutes at a temperature of at least about 100°C. In some embodiments, methods of producing food-like aromas may comprise heating the composition, food or beverage product or feedstuff for about 1 hour at about 140°C.
  • Wagyu beef shows a characteristic rich and sweet aroma which is also an essential indicator of meat quality.
  • Intramuscular fat (also known as marbling) of Wagyu beef contributes to this characteristic sweet aroma with a specific y-lactone composition.
  • These y-lactones such as y- hexalactone, y-decalactone, and y-undecalactone are key lactones that contribute to the Wagyu beef aroma and hence are quality markers.
  • the combination of y-hexalactone with a biomass or lipid of the disclosure results in compositions that can impart a meat -like flavour and fatty mouthfeel, with a sweet and buttery aftertaste.
  • a composition of the present invention comprises a biomass and/or lipid as described herein and one or more lactones, such as a y- hexalactone, y-decalactone, and/or y-undecalactone.
  • the y-lactone is a purified y- lactone that is combined (e.g. admixed) with the biomass and/or lipid.
  • the biomass produces the y-lactone, such as by biotransformation.
  • compositions of the present invention may comprise one or more lactones, e.g. y- hexalactone, in a concentration from about 10 ppm to about 100,000 ppm (v/v).
  • lactones e.g. y-hexalactone
  • the lactone, e.g. y-hexalactone may be present in the composition at a conmcetration of about 10 ppm, 50 ppm, 100 ppm, 500 ppm, 1,000 ppm, 5,000 ppm, 10,000 ppm, 50,000 ppm or 100,000 ppm (v/v).
  • the concentration of the one or more lactones in the resulting product or feedstuff may be from about 0.1 ppm to about 10,000 ppm (v/v), for example about 0.1 ppm, 0.5 ppm, 1 ppm, 5 ppm, 10 ppm, 50 ppm, 100 ppm, 500 ppm, 1,000 ppm, 5,000 ppm or 10,000 ppm (v/v).
  • Hydroxy-fatty acids such as ricinoleic acids are commonly used as raw substrates in the biotransformation to convert to y-lactones using beta-oxidation machinery of the host cells.
  • Ricinoleic acid is metabolised through four beta-oxidation cycles to form 4-hydroxydecanoic acid. The hydroxyl group at the fourth position and the carboxyl group are then joined together to form y-decalactone.
  • Saturated fatty acids have also been explored to make shorter lactones like y-hexalactone.
  • Hexanoic acid was transformed to y-hexalactone using filamentous fungi Mortierella isabellina and Aspergillus niger (as described in EP1038971).
  • This bioconversion involves the initial conversion of hexanoic acid to 4-hydroxyhexanoic acid followed by the lactone ring formation between the -hydroxyl and the - carboxyl group.
  • Such biotransformation methods are contemplated in the present invention for generating biomass that produces y-lactones.
  • the lactones in the compositions, food products, beverage products, and feedstuff may be present in the context of the biomass (i.e. produced by the biomass), or may be admixed with the biomass to form the compositions, food products, beverage products, and feedstuff.
  • C6 fatty acid e.g. hexanoic acid
  • C6 fatty acid supplementation of the culture media could result in catabolism by the peroxisomal beta-oxidation pathway.
  • the betaoxidation cycle catalyzes the complete oxidation of a fatty acid molecule, removing two carbon atoms (in the form of acetyl-CoA) with each turn of the cycle resulting in net production of acetyl CoA.
  • the acetyl-CoA molecule produced via the beta-oxidation cycles is available for anabolic pathways including de novo synthesis of fatty acids.
  • C6 fatty acid feeding could therefore increase fatty acid synthesis in the cells.
  • free C6 fatty acid upon entering the fungal cell, can be activated with coenzyme A by the acyl-CoA synthases Fatlp and Faalp-Faa4p.
  • the C6-C0A can serve as a substrate for glycerolipid pathway acyl transferase enzymes like glycero-3-phosphate acyltransferase, 1- acylglycerol-3- phosphate acyltransferase, diacylglycerol acyltransferase, phospholipid diacylglycerol acyltransferase and be incorporated into triglycerides or phospholipids.
  • the biomass may contain one or more 4- hydroxy acids, or the biomass may be admixed with one or more 4-hydroxy acids.
  • 4-hydroxyacids may circularise to form y-lactones, a process which may be driven by low pH or heat.
  • 4-hydroxy acids present in or admixed with the biomass may therefore generate lactones, for example y-decalactone or y-hexalactone, during a cooking process.
  • the 4-hydroxy fatty acids comprise 4-hydroxydecanoic acid, 4- hydroxyheptanoic acid, 4-hydroxyoctanoic acid, 4-hydroxynonanoic acid, 4-hydroxydodecanoic acid, 4-hydroxyundecanoic acid, and/or 4-hydroxyhexanoic acid.
  • the microorganism which is the source of the biomass may be produced by fermentation with feeding of one or more fatty acids.
  • Said fatty acids used to feed the microorganism may biotransform to a 4-hydroxy fatty acid, to produce biomass containing one or more 4-hydroxy faty acids.
  • the microorganism may be feremented in the presence of ricinoleic acid (such as present in castor oil), oleic acid, palmitoleic acid or hexanoic acid.
  • the biomass comprises both one or more lactones and one or more 4- hydroxy fatty acids.
  • microorganism refers to an organism that is capable of living and reproducing in a single -celled form.
  • the single cells may clump together or associate with other cells in clusters, or may remain attached to sibling or progeny cells, for example as a hyphal or mycelial form for fungi such as moulds.
  • the terms “microorganism” and “microbial cell” may be used interchangeably herein.
  • microorganisms can be used in the present invention, whether as microorganism biomass or as a source of phospholipids.
  • the microorganism is suitable for fermentation, although it can also be cultured under ambient oxygen concentrations.
  • the microorganism is an oleaginous microorganism, preferably an oleaginous eukaryotic microorganism, or is preferably derived from a progenitor oleaginous microorganism such as a progenitor eukaryotic oleaginous microorganism.
  • the microorganism is a heterotrophic microorganism, preferably a heterotrophic eukaryotic microorganism.
  • the microorganism may, according to some embodiments, have at least two of these features, or may be characterised by all of these features.
  • the microrganim to be used as a source of biomass in accordance with the present invention may be alive, inactivated or dead, or a combination of live inactivated or dead microbial cells may be used.
  • Microorganisms may be inactivated or killed using any technique well known to those skilled in the art, including, for example, heating, pasteurisation and fermentation.
  • the microorganism used in accordance with the present invention may be a Mortierella spp.
  • the microorganism may be Mortierella elongata, Mortierella alpina, Mortierella exigua or Mortierella isabellina.
  • Other Mortierella spp. include M. humilis, M. camargensi, M. lignicola, M. zonata, M. sepedonioides, M. stylospora, M. polycephala, M. alliacea, M. claussenii, M. globalpina, M. globulifera, M. pusilia, M. strangulata, M. rostafinskii, M. bainieri, M.
  • the microorganism is not Mortierella isabellina, which has low or undetectable levels of arachidonic acid.
  • the microorganism is Mortierella alpina, Mortierella exigua or Mortierella elongata.
  • the microorganism is Mortierella alpina.
  • M. alpina, M. elongata and M. exigua have been incorporated into a composition which is effective in providing food-like aromas, especially meat-like aromas, for example beefy aromas.
  • the Mortierella spp. used in the present invention may be a wild-type Mortierella spp., for example wild-type Mortierella alpina.
  • the Mortierella spp. used in the present invention may be a genetically modified Mortierella spp.
  • the Mortierella spp., or other microorganism used in the present invention as described hereinbelow includes phospholipids.
  • the Mortierella spp. biomass (or other microbial biomass) comprises at least about 1%, for example at least about 2% phospholipids by weight (as a percentage of dry cell weight).
  • the biomass comprises at least about 3%, for example at least about 4%, for example about 5% phospholipids or greater.
  • the total fatty acid content of the phospholipids in the microorganism biomass e.g.
  • Mortierella spp biomass and/or extracted lipid comprises at least 10% by weight of co6 fatty acids excluding linoleic acid (LA), more preferably at least 10% by weight co6 fatty acids having 20 or 22 carbons in their acyl chains. More preferably, the total fatty acid content of the phospholipids in the microorganism (e.g.
  • Mortierella spp) biomass and/or extracted lipid comprises between 10% and 70%, or between 10% and 60%, or between 20% and 70%, or between 20% and 60%, by weight of co6 fatty acids excluding linoleic acid (LA), even more preferably between 10% and 70%, or between 10% and 60%, or between 20% and 70%, or between 20% and 60%, by weight of co6 fatty acids having 20 or 22 carbons in their acyl chains.
  • LA co6 fatty acids excluding linoleic acid
  • the amount of phospholipid contained in a microorganism may be measured by extracting the phospholipids as described hereinbelow, and measuring the amount of phospholipid as a proportion of dry cell weight of the microorganism.
  • biomass from a microorganism other than Mortierella spp., and/or an extracted lipid from a microorganism other than Mortierella spp. is used instead of Mortierella spp.
  • a variety of microorganisms may be used, whether as microorganism biomass or from which to extract phospholipids.
  • the microorganism is a single -celled organism.
  • microorganisms which may be used in the present invention include bacterial cells and eukaryotic cells such as fungal cells and algal cells. Eukaryotic microorganisms are preferred over bacterial (prokaryotic) microorganisms.
  • the microorganism may be a yeast, such as, but not limited to, Yarrowia spp. such as Yarrowia lipolytica.
  • the yeast has been genetically engineered to synthesise arachidonic acid or has been cultured in arachidonic acid such that arachidonic acid is present in an amount of at least or about 10%, 20%, 30%, 40% or 50% of the total fatty acid content of the polar lipid of the yeast.
  • Other yeasts that can be engineered or cultured in such a way include, but are not limited to, Pichia spp. such as Pichia pastoris, Candida spp. such as Candida rugosa, Aspergillus spp.
  • Trichosporon fermentans such as Aspergillus niger, Cryptococcus spp. such as Cryptococcus curvatus, Lipomyces spp. such as Lipomyces starkeyi, Rhodosporidium spp. such as Rhodosporidium toruloides, Rhodotorula spp. such as Rhodotorula glutinis and Trichosporon spp. such as Trichosporon fermentans.
  • the microorganism is a fungus other than a Mortierella spp., and in particular a fungus having arachidonic acid present in an amount of at least or about 10%, 20%, 30%, 40% or 50% of the total fatty acid content of the polar lipid of the yeast.
  • fungi include Pithium spp., such as Pithium ultimum, Pithium debaryanum, and Pithium insidiosum.
  • the microorganism is Yarrowia lipolytica strain W29 or genetically- modified derivatives thereof. As demonstrated by the Examples below, such microorganisms are particularly effective in producing food-like, in particular meaty, aromas.
  • the microorganism is an alga, such as a microalga, or Bacillariophyceae. More particularly, the microorganism is an algae with arachidonic acid esterified in polar lipids, preferably esterified in phospholipids, e.g. where arachidonic acid is present in an amount of at least or about 10%, 20%, 30%, 40% or 50% of the total fatty acid content of the polar lipid.
  • Nonlimiting examples of such algae include Porphyridium purpureum, Euglena gracilis, Parietochloris incisa, Pavlova lutheri, Porphyridium cruentum, Ceramium rubrum and Rodomella subfusca.
  • the microrganisms utilised in the present invention comprise arachidonic acid.
  • the arachidonic acid is esterified in polar lipids, preferably esterified in phospholipids.
  • the microorganism, such as the Mortierella spp comprises arachidonic acid esterified in polar lipids, preferably esterified in phospholipids, where arachidonic acid is present in an amount of at least or about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% or 50% of the total fatty acid content of the polar lipid.
  • arachidonic acid is present in an amount of about 10% to about 60% (e.g. 20% to 50%), or is present as at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% or at least about 55%) of the total fatty acid content of the polar lipid.
  • co6 fatty acids such as y-linolenic acid (GLA), dihomo-y-linolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA) and/or docosapentaenoic acid-co6 (DPA-co6)
  • GLA y-linolenic acid
  • DGLA dihomo-y-linolenic acid
  • EDA eicosadienoic acid
  • DTA docosatetraenoic acid
  • DPA-co6 docosapentaenoic acid-co6
  • DGLA is present in an amount of at least 0.1% (e.g. at least 0.2%, 0.5%, 1%, 1.5%, 2%, or 2.5%), or about 0.1 % to about 5%, of the total fatty acid content of the polar lipid
  • GLA is present in an amount of at least 1% (e.g. at least 2%, 3%,
  • the microorganisms used in the present invention may be prepared by any suitable culture process and conditions.
  • Effective culture conditions are known to those skilled in the art and include, but are not limited to, suitable media, bioreactor, temperature, pH and oxygen conditions that permit desirable phospholipid production.
  • a suitable medium refers to any medium in which a cell is cultured to produce microorganisms as defined herein.
  • Such medium typically comprises an aqueous medium having assimilable carbon, nitrogen and phosphate sources, and appropriate salts, minerals, metals and other nutrients, such as vitamins.
  • Cells defined herein can be cultured in conventional fermentation bioreactors, shake flasks, test tubes, microtiter dishes, and petri plates.
  • Culturing can be carried out at a temperature, pH and oxygen content appropriate for a recombinant cell. Such culturing conditions are within the expertise of one of ordinary skill in the art.
  • the microorganism e.g. Mortierella spp.
  • the microorganism has been cultured by a process comprising feeding with an co6 fatty acid, to enhance the amount of said co6 fatty acid incorporated into phospholipids in the microorganism.
  • the microorganism such as Yarrowia spp (e.g. Yarrowia lipolyticci) may be cultured by a culturing process, for example a fermentation process, comprising introducing a feed of arachidonic acid (as demonstrated in the examples). Feeding is typically carried out by culturing cells in a medium comprising the co6 fatty acid, for example one or more of LA, GLA, DGLA, EDA, ARA, DTA or DPAco6.
  • the feed co6 fatty acids are free fatty acids or fatty acid salts.
  • the microorganism biomass or microorganism from which the extracted lipid is extracted may be Yarrowia lipolytica, for example strain W29, and may be prepared by a culturing process, in particular a fermentation process comprising feeding with arachidonic acid.
  • compositions, food products, beverage products and feedstuffs of the present disclosure comprise biomass of two or more different microorganisms, for example two Mortierella species, or a Mortierella spp and another microorganism.
  • the present invention involves the use of microorganism biomass, such that compositions, food products, beverage products and feedstuffs of the present invention comprise microorganism biomass.
  • the microorganisms typically Mortierella spp.
  • dry biomass may be approximately 25% of the mass of “wet” biomass).
  • biomass encompasses matter containing at least some whole cells of the microorganisms, rather than only components which have been separated therefrom, but may contain both whole cells and cell components.
  • biomass also encompasses "low- TAG biomass", as described below.
  • Microorganisms/biomass such as obtained by a fermentation process, may have been processed by, for example, washing, drying, heat inactivation, freezing and/or freeze drying, but typically will still contain at least some, preferably most, of the whole cell material of the microorganism.
  • biomass may be referred to as “whole cell biomass”, but it will be appreciated that the microorganism cells contained in compositions of the present invention may be present in a disrupted form, for example having undergone physical or chemical lysis; the biomass/microorganism will typically still contain substantially all of the cell material.
  • biomass and “microorganism” do not refer to, for example, oils or proteins extracted or isolated from microorganisms and separated from the other components of the cells.
  • compositions comprising microorganisms comprising phospholipids i.e. microorganism biomass
  • have been found to be particularly effective in producing an enhanced foodlike aroma such as meaty or fishy aromas when heated.
  • the biomass used herein is low-TAG biomass.
  • the term “low-TAG biomass” refers to biomass from a microorganism (e.g. Mortierella spp.), wherein the biomass has been processed to remove some, most, substantially all, or all of the triacylglycerol (TAG) (e.g. at least about 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 95% of the TAG has been removed), while retaining most, substantially all, or all of the polar lipids (including phospholipids) and other cellular material (e.g. proteins and carbohydrates).
  • TAG triacylglycerol
  • low-TAG biomass can be produced by delipidating whole cell biomass, and then adding most, substantially all, or all of the polar lipids (including phospholipids) back to the delipidated biomass (as demonstrated herein).
  • “low-TAG biomass” is typically equivalent to whole cell biomass but without all, substantially all or most of the TAG that is present in the whole cell biomass.
  • the low-TAG biomass comprises less than about 20%, 15%, 10%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, 0.01%, or 0.005% (w/w), triacylglycerol TAG.
  • “low-TAG biomass’” encompasses an absence of all or substantially all of the TAG present in whole cell biomass (i.e. “TAG-free biomass”).
  • TAG-free biomass refers to biomass from a microorganism, wherein the biomass does not include TAG or includes less than about 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, 0.01%, or 0.005% (w/w) TAG.
  • the microorganism included in compositions of the present disclosure may be in suspension, frozen, dried or any other suitable form.
  • the microorganism cells may be alive or dead, or a mix of living and dead cells, for example at least 99% of the cells being dead.
  • the cells may have been heat- treated in order to render them incapable of replicating.
  • the extracted lipid can be a relatively crude composition obtained by, for example, lysing the microbial cells (e.g. Mortierella sp.) and separating the lipid, or a more purified composition where most, if not all, of one or more or each of the water, nucleic acids, proteins and carbohydrates derived from the cells have been removed.
  • microbial cells e.g. Mortierella sp.
  • a more purified composition where most, if not all, of one or more or each of the water, nucleic acids, proteins and carbohydrates derived from the cells have been removed.
  • Lipid extraction and purification methods are well known in the art.
  • An extracted lipid may comprise, for example, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% (w/w) lipid by weight of the composition.
  • an extracted lipid comprises between about 10% and 95% lipid by weight, for example between about 10% and about 50%, or between about 50% and 95%, lipid by weight.
  • the lipid may be solid or liquid at room temperature (25 °C), or a mixture of the two; when liquid it is considered to be an oil, when solid it is considered to be a fat.
  • the extracted lipid may comprise only the lipid extracted from the microorganism (e.g. Mortierella sp.), or may be blended with another lipid. In an embodiment, extracted lipid has not been blended with another lipid produced from another source, for example, animal lipid.
  • the microorganism e.g. Mortierella sp.
  • extracted lipid has not been blended with another lipid produced from another source, for example, animal lipid.
  • the extracted lipid may contain all lipids initially present in the microbial cell, or may contain only a fraction of lipids initially present in the microbial cell.
  • an extracted lipid may have been processed to remove some or all of a particular type of lipid, for example to remove some or all neutral lipid (such as triacylglycerols (triglycerides, ‘TAG’) and to retain polar lipids (such as phospholipids, and/or other polar lipids such as cephalins, sphingolipids (sphingomyelins and glycosphingolipids).
  • the extracted lipid may have been processed to remove some or all of polar lipids (such as phospholipids) and retain only or mostly neutral lipid (such as triacylglycerols (triglycerides, ‘TAG’).
  • the extracted lipid comprises one or more sterols such as, for example from yeast cells, ergosterol and/or ergosterol esters.
  • the extracted lipid comprising polar lipids and non-polar lipids.
  • the non-polar lipids are present in the extracted lipid in a lower amount than the polar lipids.
  • the extracted lipid comprises polar lipids, and in particular, phospholipids.
  • Phospholipids are amphipathic molecules, having a hydrophilic head and a hydrophobic tail, comprising a glycerol backbone esterified to a phosphate “head” group and two fatty acids which provide the hydrophobic tail.
  • the phospholipids of the present invention comprise one or more esterified co6 fatty acids. Biosynthesis of co6 fatty acids in organisms such as microalgae, mosses and fungi usually occurs as a series of oxygen -dependent desaturation and elongation reactions ( Figure 1).
  • co6 faty acid examples include, but are not limited to, arachidonic acid (ARA, C20:4A5,8,l l,14; co6), dihomo -gammalinolenic acid (DGLA, C20:3A8,l 1,14; co6), eicosadienoic acid (EDA, C2O:2A11,14; co6), docosatetraenoic acid (DTA, C22:4A7,10,13,16; co6), docosapentaenoic acid-co6 (DPA-co6, C22:5A4,7,10,13,16; co6), y-linolenic acid (GLA, C18:3A6,9,12; co6) and linoleic acid (LA, C18:2A9,12; co6).
  • ARA arachidonic acid
  • DGLA dihomo -gammalinolenic acid
  • EDA eicosadienoic acid
  • DTA docosate
  • the phospholipids comprise esterified arachidonic acid (ARA, C20:4A5,8,l l,14; co6).
  • the phospholipids comprise esterified docosapentaenoic acid-co6 (DPA-co6, C22:5A4,7,10,13,16; co6).
  • the phospholipids comprise one or more esterified co6 faty acids other than linoleic acid (LA, C18:2A9,12; co6).
  • the co6 faty acids comprise arachidonic acid (ARA), dihomo-gammalinolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-co6 (DPA-co6) or y-linolenic acid (GLA).
  • ARA arachidonic acid
  • DGLA dihomo-gammalinolenic acid
  • EDA eicosadienoic acid
  • DTA docosatetraenoic acid
  • DPA-co6 docosapentaenoic acid-co6
  • GLA y-linolenic acid
  • the co6 faty acids comprise two, three or four of arachidonic acid (ARA), dihomo-gammalinolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-co6 (DPA-co6) or y- linolenic acid (GLA).
  • ARA arachidonic acid
  • DGLA dihomo-gammalinolenic acid
  • EDA eicosadienoic acid
  • DTA docosatetraenoic acid
  • DPA-co6 docosapentaenoic acid-co6
  • GLA y- linolenic acid
  • the co6 faty acids comprise one or two or all three of eicosadienoic acid (EDA), docosatetraenoic acid (DTA) and docosapentaenoic acid-co6 (DPA-co6).
  • EDA eicosadienoic acid
  • DTA docosatetraenoic acid
  • DPA-co6 docosapentaenoic acid-co6
  • the co6 faty acids comprise arachidonic acid (ARA), or ARA is the predominant co6 faty acid in the phospholipid.
  • ARA arachidonic acid
  • ARA is present in an amount of about 10% to about 60% of the total fatty acid content of the polar lipid
  • DGLA is present in an amount of about 0.1% to about 5% of the total fatty acid content of the polar lipid
  • GLA is present in an amount of about 1% to about 10% of the total fatty acid content of the polar lipid.
  • ARA is present in an amount of about 20% to about 50% of the total fatty acid content of the polar lipid
  • DGLA is present in an amount of about 1% to about 5% of the total fatty acid content of the polar lipid
  • GLA is present in an amount of about 3% to about 10% of the total fatty acid content of the polar lipid.
  • the phospholipid contains at least about 5% co6 fatty acids, for example at least about 7%, for example at least about 10%, for example at least about 12%, for example at least about 15%, for example at least about 17%, for example at least about 20% by weight, each as a weight percentage of the total fatty acid content of the phospholipid.
  • the phospholipid contains at least about 30%, for example at least about 40%, for example at least about 50% 06 fatty acids.
  • amounts of co6 fatty acids refers to co6 fatty acids excluding linoleic acid (LA, C18:2A9,12; co6).
  • the sum of the amounts of ARA, DGLA, EDA, DTA, DPA-co6 and GLA, each as a weight percentage of the total fatty acid content of the phospholipid, in the total fatty acid content of the phospholipids in the microorganism (e.g. Mortierella spp.) biomass and/or the extracted lipid is at least about 5%, for example at least about 10% by weight of the TFA content of the phospholipids.
  • the sum of the amounts of ARA, DGLA, EDA, DTA, DPA-06 and GLA in the phospholipids is between about 10% and about 70%, or between about 10% and about 75% or between about 10% and about 80% by weight of the total fatty acid content of the phospholipid.
  • These amounts of the co6 fatty acids in the phospholipids of the microorganism or extracted lipid may also apply to the TAG in the microorganism or extracted lipid.
  • the phospholipids comprise at least two, preferably three or all four, of phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI) and phosphatidylserine (PS), each comprising one or more of ARA, DGLA, EDA, DTA, DPA-06 and GLA, and optionally one or more of phosphatidic acid (PA), phosphatidylglycerol (PG) and cardiolipin (Car), each comprising one or more of ARA, DGLA, EDA, DTA, DPA-06 and GLA.
  • PC phosphatidylcholine
  • PE phosphatidylethanolamine
  • PI phosphatidylinositol
  • PS phosphatidylserine
  • ARA phosphatidylcholine
  • PE phosphatidylethanolamine
  • PI phosphatidylinositol
  • PS phosphatidyl
  • PC, PE, PI and PS content of phospholipids may be determined by two-dimensional thin layer chromatography (TLC) analysis using two solvent systems as described in Zhou et al (2014), ‘Lipidomic analysis of Arabidopsis seed genetically engineered to contain DHA’, Frontiers in Plant Science, 5, 419 (https://doi.org/10.3389/fpls.2014.00419).
  • TLC thin layer chromatography
  • the content of 06 fatty acids in the phospholipid which are (i) C20 or C22 fatty acids is about 5% to about 60%, preferably about 10% to about 60% of the total fatty acid content of the phospholipid, and/or (ii) 06 fatty acids which have 3, 4 or 5 carbon-carbon double bonds, is about 5% to about 70%, preferably about 10% to about 70%, more preferably about 40% to about 70% or about 45% to about 70% or about 50% to about 70% of the total fatty acid content of the phospholipid.
  • the phospholipid contains at least about 10%, for example at least about 15%, for example at least about 20%, for example at least about 25%, for example at least about 30%, for example at least about 35%, for example at least about 40%, for example at least about 45%, for example at least about 50% arachidonic acid (ARA) by weight. In some embodiments, the phospholipid contains at least about 20% of ARA by weight.
  • ARA arachidonic acid
  • the amounts of individual fatty acids in a total fatty acid content in a microorganism sample or a lipid sample is preferably determined by GC analysis of fatty acid methyl esters (FAME) as described in Example 1.
  • the phospholipids form part of a polar lipid (whether contained within microorganism (e.g. Mortierella spp.) biomass or extracted from a microorganism as an extracted polar lipid or broader lipid), which may comprise, consist essentially of or consist of phospholipids, wherein:
  • the polar lipid comprises a total fatty acid (TFA) content which comprises co6 fatty acids, wherein at least some of the co6 fatty acids are esterified in the form of phospholipids in the polar lipid, and wherein the co6 fatty acids comprise two, three, four or more fatty acids selected from the group consisting of arachidonic acid (ARA), dihomo-gammalinolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-co6 (DPA-co6) and y-linolenic acid (GLA),
  • ARA arachidonic acid
  • DGLA dihomo-gammalinolenic acid
  • EDA eicosadienoic acid
  • DTA docosatetraenoic acid
  • DPA-co6 docosapentaenoic acid-co6
  • GLA y-linolenic acid
  • the phospholipids in the polar lipid comprise at least two, preferably three or all four, of phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI) and phosphatidylserine (PS), each comprising one or more of ARA, DGLA, EDA, DTA, DPA-co6 and GLA, and optionally one or more of phosphatidic acid (PA), phosphatidylglycerol (PG) and cardiolipin (Car), each comprising one or more of ARA, DGLA, EDA, DTA, DPA-co6 and GLA,
  • PC phosphatidylcholine
  • PE phosphatidylethanolamine
  • PI phosphatidylinositol
  • PS phosphatidylserine
  • ARA ARA
  • DGLA phosphatidylethanolamine
  • PI phosphatidylinositol
  • PS phosphat
  • the polar lipid comprises a total saturated fatty acid content comprising palmitic acid and stearic acid,
  • the polar lipid comprises a total monounsaturated fatty acid content comprising oleic acid and palmitoleic acid (Cl 6: 1 A9cis), and
  • co3 fatty acids are either absent from the polar lipid or are present in a total amount of less than about 3% by weight of the TFA content of the polar lipid, and/or wherein the polar lipid lacks C16:2, C16:3co3, EPA and DHA.
  • the phospholipids form part of a polar lipid (whether contained within microorganism biomass or extracted from a microorganism as an extracted polar lipid or broader lipid), which may comprise, consist essentially of or consist of phospholipids, wherein:
  • the polar lipid comprises a total fatty acid (TFA) content which comprises co6 fatty acids, wherein at least some of the co6 fatty acids are esterified in the form of phospholipids in the polar lipid, the co6 fatty acids comprising arachidonic acid (ARA), dihomo-gammalinolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-co6 (DPA-co6) or y- linolenic acid (GLA), or any combination thereof,
  • the phospholipids in the polar lipid comprise phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI) and phosphatidylserine (PS), each comprising one or more of ARA, DGLA, EDA, DTA, DPA-co6 and GLA, and optionally one or more
  • the polar lipid comprises a total saturated fatty acid content comprising palmitic acid and stearic acid
  • the polar lipid comprises a total monounsaturated fatty acid content comprising oleic acid and palmitoleic acid (Cl 6: 1 A9cis).
  • the phospholipids form part of a polar lipid (whether contained within microorganism biomass or extracted from a microorganism as an extracted polar lipid or broader lipid) , which may comprise, consist essentially of or consist of phospholipids, wherein:
  • the polar lipid comprises a total fatty acid (TFA) content which comprises co6 fatty acids, wherein at least some of the co6 fatty acids are esterified in the form of phospholipids in the polar lipid, the co6 fatty acids comprising arachidonic acid (ARA), dihomo -gammalinolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-co6 (DPA-06) or y- linolenic acid (GLA), or any combination thereof,
  • ARA arachidonic acid
  • DGLA dihomo -gammalinolenic acid
  • EDA eicosadienoic acid
  • DTA docosatetraenoic acid
  • DPA-06 docosapentaenoic acid-co6
  • GLA y- linolenic acid
  • the polar lipid comprises a total saturated fatty acid content comprising palmitic acid and stearic acid,
  • the polar lipid comprises a total monounsaturated fatty acid content comprising oleic acid and palmitoleic acid (Cl 6: 1 A9cis),
  • co3 fatty acids are either absent from the polar lipid or are present in a total amount of less than about 3% by weight of the TFA content of the polar lipid, and/or wherein the polar lipid lacks C16:2, C16:3 co3, EPA and DHA.
  • the phospholipids form part of a polar lipid (whether contained within microorganism biomass or extracted from a microorganism as an extracted polar lipid or broader lipid), which may comprise, consist essentially of or consist of phospholipids, wherein:
  • the polar lipid comprises a total fatty acid (TFA) content which comprises co6 fatty acids, wherein at least some of the co6 fatty acids are esterified in the form of phospholipids in the polar lipid, the co6 fatty acids comprising arachidonic acid (ARA), dihomo -gammalinolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-co6 (DPA-06) or y- linolenic acid (GLA), or any combination thereof,
  • ARA arachidonic acid
  • DGLA dihomo -gammalinolenic acid
  • EDA eicosadienoic acid
  • DTA docosatetraenoic acid
  • DPA-06 docosapentaenoic acid-co6
  • GLA y- linolenic acid
  • the phospholipids in the polar lipid comprise phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI) and phosphatidylserine (PS), each comprising one or more of ARA, DGLA, EDA, DTA, DPA -06 and GLA, and optionally one or more of phosphatidic acid (PA), phosphatidylglycerol (PG) and cardiolipin (Car), each comprising one or more of ARA, DGLA, EDA, DTA, DPA-co6 and GLA,
  • PC phosphatidylcholine
  • PE phosphatidylethanolamine
  • PI phosphatidylinositol
  • PS phosphatidylserine
  • the polar lipid comprises a total saturated fatty acid content comprising palmitic acid and stearic acid
  • the polar lipid comprises a total monounsaturated fatty acid content comprising oleic acid and palmitoleic acid (Cl 6: 1 A9cis).
  • the phospholipids form part of a polar lipid (whether contained within microorganism biomass or extracted from a microorganism as an extracted polar lipid or broader lipid), which may comprise, consist essentially of or consist of phospholipids, wherein:
  • the polar lipid comprises a total fatty acid (TFA) content which comprises co6 fatty acids, wherein at least some of the co6 fatty acids are esterified in the form of phospholipids in the polar lipid, and wherein the co6 fatty acids comprise one or two or all three of eicosadienoic acid (EDA), docosatetraenoic acid (DTA) and docosapentaenoic acid-co6 (DPA-06),
  • EDA eicosadienoic acid
  • DTA docosatetraenoic acid
  • DPA-06 docosapentaenoic acid-co6
  • y-linolenic acid is either absent from the polar lipid or is present in the polar lipid
  • the polar lipid comprises a total saturated fatty acid content comprising palmitic acid and stearic acid
  • the polar lipid comprises a total monounsaturated fatty acid content comprising oleic acid and palmitoleic acid (Cl 6: 1 A9cis).
  • the phospholipids form part of a polar lipid (whether contained within microorganism biomass or extracted from a microorganism as an extracted polar lipid or broader lipid), which may comprise, consist essentially of or consist of phospholipids, wherein:
  • the polar lipid comprises a total fatty acid (TFA) content which comprises 06 fatty acids, wherein at least some of the 06 fatty acids are esterified in the form of phospholipids in the polar lipid, and wherein the 06 fatty acids comprise two, three, four or more fatty acids selected from the group consisting of arachidonic acid (ARA), dihomo-gammalinolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-06 (DPA-06) and y-linolenic acid (GLA),
  • ARA arachidonic acid
  • DGLA dihomo-gammalinolenic acid
  • EDA eicosadienoic acid
  • DTA docosatetraenoic acid
  • DPA-06 docosapentaenoic acid-06
  • GLA y-linolenic acid
  • the polar lipid comprises a total saturated fatty acid content comprising palmitic acid and stearic acid,
  • the polar lipid comprises a total monounsaturated fatty acid content comprising oleic acid and palmitoleic acid (Cl 6: 1 A9cis), and
  • the polar lipid lacks Cl 6:2, C16:3o3, EPA and DHA.
  • the phospholipids form part of a polar lipid (whether contained within microorganism biomass or extracted from a microorganism as an extracted polar lipid or broader lipid), which may comprise, consist essentially of or consist of phospholipids, wherein:
  • the polar lipid comprises a total fatty acid (TFA) content which comprises co6 fatty acids, wherein at least some of the co6 fatty acids are esterified in the form of phospholipids in the polar lipid, and wherein the co6 fatty acids of the polar lipid comprise an amount of arachidonic acid (ARA), dihomo-gammalinolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-co6 (DPA-co6) or y-linolenic acid (GLA), or any combination thereof, each amount being expressed as a weight percentage of the total fatty acid content of the polar lipid, whereby the sum of the amounts of ARA, DGLA, EDA, DTA, DPA-06 and GLA is at least about 10%,
  • the polar lipid comprises a total saturated fatty acid content comprising palmitic acid and stearic acid
  • the polar lipid comprises a total monounsaturated fatty acid content comprising oleic acid and palmitoleic acid (Cl 6: 1 A9cis).
  • the phospholipids form part of a polar lipid (whether contained within microorganism biomass or extracted from a microorganism as an extracted polar lipid or broader lipid), which may comprise, consist essentially of or consist of phospholipids, wherein:
  • the polar lipid comprises a total fatty acid (TFA) content which comprises the 06 fatty acids, wherein at least some of the 06 fatty acids are esterified in the form of phospholipids in the polar lipid, and wherein the 06 fatty acids of the polar lipid comprise an amount of arachidonic acid (ARA), dihomo-gammalinolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-06 (DPA-06) or y-linolenic acid (GLA), or any combination thereof, whereby the sum of the amounts of ARA, DGLA, EDA, DTA, DPA-06 and GLA is preferably at least about 5%, more preferably at least about 10%, by weight of the TFA content of the polar lipid,
  • TFA total fatty acid
  • the polar lipid comprises a total saturated fatty acid content comprising palmitic acid and stearic acid
  • the polar lipid comprises a total monounsaturated fatty acid content comprising oleic acid and palmitoleic acid (Cl 6: 1 A9cis).
  • the phospholipids form part of a polar lipid (whether contained within microorganism biomass or extracted from a microorganism as an extracted polar lipid or broader lipid), which may comprise, consist essentially of or consist of phospholipids, wherein:
  • the polar lipid comprises a total fatty acid (TFA) content which comprises the 06 fatty acids, wherein at least some of the 06 fatty acids are esterified in the form of phospholipids in the polar lipid, and wherein the 06 fatty acids comprise one, two, three, four or more fatty acids selected from the group consisting of arachidonic acid (ARA), dihomo-gammalinolenic acid (DGLA), eicosadienoic acid (EDA), docosatetraenoic acid (DTA), docosapentaenoic acid-co6 (DPA-co6) and y-linolenic acid (GLA),
  • ARA arachidonic acid
  • DGLA dihomo-gammalinolenic acid
  • EDA eicosadienoic acid
  • DTA docosatetraenoic acid
  • DPA-co6 docosapentaenoic acid-co6
  • GLA y-linolenic acid
  • the polar lipid comprises a total saturated fatty acid content comprising palmitic acid and stearic acid
  • the polar lipid comprises a total monounsaturated fatty acid content comprising oleic acid and palmitoleic acid (Cl 6: 1 A9cis).
  • the polar lipid comprises DPA-06
  • one or more or all of GLA, DGLA, EDA, ARA and DTA are also present.
  • the polar lipid comprises EDA and one, two or all three of arachidonic acid (ARA), dihomo-gammalinolenic acid (DGLA) and y-linolenic acid (GLA) esterified in the polar lipid, and wherein the level of EDA in the polar lipid is at least about 1 % of the total fatty acid content of the polar lipid.
  • ARA arachidonic acid
  • DGLA dihomo-gammalinolenic acid
  • GLA y-linolenic acid
  • the polar lipid lacks one, two, three or all four of C16:2, C16:3co3, EPA and DHA. In a preferred embodiment, the polar lipid lacks C16:3co3, EPA and DHA. In a further embodiment, the polar lipid also lacks ALA or has less than 1 % ALA.
  • the extracted lipid comprises three, four or more fatty acids selected from the group consisting of ARA, DGLA, EDA, DTA, DPA-06 and GLA, such as a combination of ARA, DGLA and GLA, or a combination of fatty acids other than ARA, DGLA and GLA, preferably a combination of ARA, DGLA, GLA and at least one of EDA, DTA and DPA-06.
  • the sum total of the amounts of ARA, DGLA, EDA, DTA, DPA -06 and GLA is between about 10% and about 70%, or between about 10% and about 75% or between about 10% and about 80%, each amount being expressed as a percentage of the total fatty acid content of the polar lipid.
  • the 06 fatty acid that is present in the greatest amount in the total fatty acid content of the polar lipid is not LA, or not ARA.
  • the polar lipid comprises one or more of EDA, DTA or DPA-06.
  • the phospholipids comprise at least two, at least three or all four of phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI) and phosphatidylserine (PS), each comprising one, two, three or more than three of ARA, DGLA, EDA, DTA, DPA-06 and GLA, and optionally one or more or all of phosphatidic acid (PA), phosphatidylglycerol (PG) and cardiolipin (Car), each comprising one, two, three or more than three of ARA, DGLA, EDA, DTA, DPA-06 and GLA.
  • PC phosphatidylcholine
  • PE phosphatidylethanolamine
  • PI phosphatidylinositol
  • PS phosphatidylserine
  • PA phosphatidic acid
  • PG phosphatidylglycerol
  • Car cardiolipin
  • the polar lipid comprises myristic acid (C14:0) in an amount of less than about 2% by weight of the total fatty acid content of the polar lipid. In a preferred embodiment, the polar lipid comprises myristic acid (C14:0) in an amount of less than about 1% by weight of the total fatty acid content of the polar lipid.
  • stearic acid is present at a level of less than about 14% or less than about 12% or less than about 10% of the total fatty acid content of the polar lipid. In preferred embodiments, stearic acid is present at a level of less than about 7% or less than about 6% or less than about 5%, preferably less than 4% or less than 3%, of the total fatty acid content of the polar lipid.
  • ARA is present in an amount of about 10% to about 60%, about 10% to about 30%, about 10% to about 25%, about 15% to about 60%, about 20% to about 60%, or about 30% to about 60%, by weight of the TFA content of the polar lipid. In preferred embodiments, ARA is present in an amount of about 20% to about 60%, or about 30% to about 60%, or about 40% to about 60%, or about 50% to about 60%, by weight of the TFA content of the polar lipid. In some embodiments, ARA is present in an amount of at least or about 10%, 15%, 20%, 25% or 30% by weight of the TFA content of the polar lipid.
  • the polar lipid comprises one or more or all of EDA, DTA and DPA- 06.
  • the polar lipid comprises DGLA and ARA, or GLA, DGLA and ARA, then at least one of the following apply:
  • the ratio of PC to PE or to phospholipids other than PC is less than 3:1, less than 2:1, less than 1.5:1, less than 1.25:1, less than 1:1, between 3:1 and 1:1, between 2:1 and 1:1, or between 3:1 and 0.5:1.
  • GLA is present in the polar lipid in an amount which is (i) less than the sum of the amounts of ARA, DGLA, EDA, DTA and DPA-co6 in the polar lipid, or (ii) one or more of: less than the amount of ARA, less than the amount of DGLA, less than the amount of EDA, less than the amount of DTA and less than the amount of DPA-co6, or any combination thereof, in the polar lipid.
  • the saturated fatty acid content of the polar lipid comprises one or more or all of lauric acid (C12:0), myristic acid (C14:0), a C15:0 fatty acid, C20:0, C22:0 and C24:0, preferably comprising C14:0 and C24:0 or C14:0, C15:0 and C24:0, more preferably comprising C14:0, C15:0 and C24:0 but not C20:0 and C22:0.
  • lauric acid and myristic acid are absent from the polar lipid, or lauric acid and/or myristic acid is present in the polar lipid, whereby the sum of the amounts of lauric acid and myristic acid in the polar lipid is less than about 2%, or less than about 1%, preferably less than about 0.5%, more preferably less than about 0.2%, of the total fatty acid content of the polar lipid.
  • Cl 5:0 is absent from the polar lipid, or C15:0 is present in the polar lipid in an amount of less than about 3%, preferably less than about 2% or less than about 1%, of the total fatty acid content of the polar lipid.
  • palmitic acid is present in the polar lipid in an amount of about 3% to about 45%, or about 10% to about 40%, or about 20% to about 45%, of the total fatty acid content of the polar lipid.
  • palmitoleic acid is present in the polar lipid in an amount of about 3% to about 45%, or about 3% to about 25%, or about 3% to about 20%, or about 3% to about 15%, of the total fatty acid content of the polar lipid.
  • oleic acid is present in the polar lipid in an amount of about 3% to about 60%, or about 3% to about 40%, or about 3% to about 25%, or about 20% to about 60%, of the total fatty acid content of the polar lipid.
  • vaccenic acid is absent from the polar lipid, or vaccenic acid is present in the polar lipid in an amount of less than about 2%, preferably less than about 1% or about 0.5%, of the total fatty acid content of the polar lipid.
  • linoleic acid is present in the polar lipid in an amount of about 3% to about 45%, or about 3% to about 30%, or about 3% to about 20%, of the total fatty acid content of the polar lipid.
  • y-linoleic acid is absent from the polar lipid, or y-linoleic acid is present in the polar lipid in an amount of about 3% to about 12%, or about 3% to about 8%, or about 3% to about 6%, or less than about 3% of the total fatty acid content of the polar lipid.
  • eicosadienoic acid is absent from the polar lipid, or eicosadienoic acid is present in the polar lipid in an amount of about 3% to about 12%, or about 3% to about 8%, or about 3% to about 6%, or less than about 3% of the total fatty acid content of the polar lipid.
  • dihomo-gammalinolenic acid is absent from the polar lipid, or dihomo-gammalinolenic acid is present in the polar lipid, preferably in an amount of less than about 2%, 0.1% to about 2%, or about 10% to about 60%, of the total fatty acid content of the polar lipid.
  • C20:0 and C22:0 are absent from the polar lipid, or C20:0 and/or C22:0 is present in the polar lipid, whereby the sum of the amounts of C20:0 and C22:0 in the polar lipid is less than about 1.0% or less than about 0.5%, preferably less than 0.2%, of the total fatty acid content of the polar lipid.
  • C24:0 is absent from the polar lipid, or C24:0 is present in the polar lipid in an amount of less than about 1.0%, less than about 0.5%, preferably less than 0.3% or less than 0.2%, of the total fatty acid content of the polar lipid.
  • C17:l is absent from the polar lipid, or C 17:1 is present in the polar lipid in an amount of less than about 5%, preferably less than about 4% or less than about 3%, more preferably less than about 2% of the total fatty acid content of the polar lipid.
  • monounsaturated fatty acids which are C20 or C22 fatty acids are absent from the polar lipid, or C20:l and/or C22:l is present in the polar lipid, whereby the sum of the amounts of C20:l and C22:l in the polar lipid is less than about 1.0%, less than about 0.5%, preferably less than 0.2%, of the total fatty acid content of the polar lipid.
  • the content of co6 fatty acids in the polar lipid which are (i) C20 or C22 fatty acids is about 5% to about 60%, preferably about 10% to about 60% of the total fatty acid content of the polar lipid, and/or (ii) co6 fatty acids which have 3, 4 or 5 carbon-carbon double bonds, is about 5% to about 70%, preferably about 10% to about 70%, more preferably about 40% to about 70% or about 45% to about 70% or about 50% to about 70% of the total fatty acid content of the polar lipid.
  • C16:3co3 is absent from the polar lipid, or both C16:2 and C16:3 co 3 are absent from the polar lipid.
  • the polar lipid or broader extracted microbial lipid comprises PC and/or lacks cyclopropane fatty acids, preferably lacks C15:0c, C17:0c and C19:0c.
  • the co6 faty acid content of phospholipids/polar lipids may be measured, for example, by lipid derivatisation to fatty acid methyl esters (FAME) and subsequent gas chromatography (GC) analysis, as described in Example 1 below.
  • FAME fatty acid methyl esters
  • GC gas chromatography
  • Lipids may be extracted from microorganisms such as Mortierella spp. for use in the present invention according to any suitable process known to a person skilled in the art. Exemplary methods of such extraction are disclosed in Example 1 below. Extraction of the phospholipid from microorganisms disclosed herein, including as a component of a broader lipid fraction, may use analogous methods to those known in the art for lipid extraction from oleaginous microorganisms, such as for example described in Patel et al. (2016) Molecules 23:1562.
  • extraction may be performed by solvent extraction where an organic solvent (e.g., hexane or a mixture of hexane and ethanol, chloroform and/or a mixture of chloroform and methanol) is mixed with at least the biomass of the microorganism, preferably after the biomass is dried and ground, but it can also be performed under wet conditions.
  • the solvent dissolves the lipid in the cells, which solution may then be separated from the biomass by a physical action (e.g., ultrasonication). Ultrasonication is one of the most extensively used pre treatment methods to disrupt the cellular integrity of microbial cells.
  • pre treatment methods can include microwave irradiation, high-speed homogenization, high-pressure homogenization, bead beating, autoclaving, and thermolysis.
  • the solvent/lipid solution may be separated from the biomass by, for example, filtration (e.g., with a filter press or similar device) or centrifugation etc.
  • the organic solvent can then be separated from the non-polar lipid (e.g., by distillation). This second separation step yields non-polar lipid from the cells and can yield a re-usable solvent if conventional vapor recovery is employed.
  • Phospholipids may be separated from a broader lipid fraction extracted from microorganisms by any suitable method, for example by use of solvent extraction as described in Example 2 below.
  • lipids may be extracted from a lipid source by dissolving in ethanol or another alcohol such as isopropanol, evaporating the ethanol or other alcohol, and phospholipids then further separated from neutral lipids by precipitation of phospholipids from cold acetone.
  • Lipid extracted from the microbial cells may be subjected to normal oil processing procedures.
  • the term "purified" when used in connection with lipids disclosed herein means that that the extracted lipid has been subjected to one or more processing steps of increase the purity of the lipid component.
  • a purification step may comprise one or more or all of the group consisting of: degumming, deodorising, decolourising, drying and/or fractionating the extracted oil, as described below.
  • the term “purified” does not include a transesterification process or other process which alters the fatty acid composition of the lipid or oil of the invention so as to change the fatty acid composition of the total fatty acid content.
  • the fatty acid composition of the purified lipid is essentially the same as that of the unpurified lipid.
  • Degumming is an early step in the refining of lipids in a liquid form (oil) and its primary purpose is the separation of most of the phospholipids from the oil, which may be present as approximately 1-2% of the total extracted lipid. Addition of ⁇ 2% of water, typically containing phosphoric acid, at 70-80°C to the crude oil results in the separation of most of the phospholipids accompanied by trace metals and pigments.
  • the insoluble material that is removed is mainly a mixture of phospholipids and is also known as lecithin.
  • Degumming can be performed by addition of concentrated phosphoric acid to a crude extracted lipid to convert non-hydratable phosphatides to a hydratable form, and to chelate minor metals that are present. Gum is separated from the oil by centrifugation. If the purified phospholipids are the desired end product, the insoluble material containing the phospholipids may be dried such as, for example, by spray drying.
  • Alkali refining is one of the refining processes for treating lipid in the form of an oil, sometimes also referred to as neutralization. It usually follows degumming and precedes bleaching. Following degumming, the oil can be treated by the addition of a sufficient amount of an alkali solution to titrate all of the fatty acids and phosphoric acids, and removing the soaps thus formed.
  • Suitable alkaline materials include sodium hydroxide, potassium hydroxide, sodium carbonate, lithium hydroxide, calcium hydroxide, calcium carbonate and ammonium hydroxide. This process is typically carried out at room temperature and removes the free fatty acid fraction.
  • Soap is removed by centrifugation or by extraction into a solvent for the soap, and the neutralised oil is washed with water. If required, any excess alkali in the oil may be neutralized with a suitable acid such as hydrochloric acid or sulphuric acid.
  • a suitable acid such as hydrochloric acid or sulphuric acid.
  • Bleaching is a refining process in which oils are heated at 90-120°C for 10-30 minutes in the presence of a bleaching earth (0.2-2.0%) and in the absence of oxygen by operating with nitrogen or steam or in a vacuum. This step in oil processing is designed to remove unwanted pigments and the process also removes oxidation products, trace metals, sulphur compounds and traces of soap.
  • Deodorization is a treatment of oils and fats at a high temperature (200-260°C) and low pressure (0.1-1 mm Hg). This is typically achieved by introducing steam into the oil at a rate of about 0.1 ml/minute/100 ml of oil. After about 30 minutes of sparging, the oil is allowed to cool under vacuum.
  • the oil is typically transferred to a glass container and flushed with argon before being stored under refrigeration. This treatment improves the colour of the oil and removes a majority of the volatile substances or odorous compounds including any remaining free fatty acids, monoacylglycerols and oxidation products.
  • transesterification means a process that exchanges the fatty acids within and between TAGs (interesterification) or phospholipids, or transfers the fatty acids to another alcohol to form an ester. This may initially involve releasing fatty acids from the TAGs or PL as free fatty acids or it may directly produce fatty acid esters, preferably fatty acid methyl esters or ethyl esters. In a transesterification reaction of the TAG or PL with an alcohol such as methanol or ethanol, the alkyl group of the alcohol forms an ester linkage with the acyl groups (including the SCFA) of the TAG.
  • an alcohol such as methanol or ethanol
  • both Mortierella spp. biomass (or other microbial biomass) containing phospholipids and an extracted lipid from a microorganism such as Mortierella spp. comprising phospholipids are used in compositions, food products, beverage products and feedstuffs in accordance with the present invention. Such embodiments may provide an enhanced food-like, for example meaty or fishy, aroma.
  • the Mortierella spp. biomass present in the composition is the same as the Mortierella spp. from which the phospholipid is extracted.
  • the Mortierella spp. biomass present in the composition is different from the microorganism, such as the Mortierella spp., from which the extracted lipid comprising phospholipids is extracted.
  • yeast extract is understood in the art to generally refer to the water-soluble portion of autolyzed yeast and typically does not contain phospholipid fractions (see, for example, Sigma Aldrich, Catalog No. Y1625 Yeast Extract).
  • yeast extract includes a composition that is sold commercially and labelled as a yeast extract. These are water-soluble fractions of yeast cells comprising amino acids, carbohydrates, vitamins and minerals and are typically sold in a dry powdered form.
  • microorganisms may be genetically modified by suitable methods, to contain a desired amount or profile of phospholipids, for example increased amounts of phospholipids/polar lipids and/or increased amounts of co-6 fatty acid esterified in phospholipids.
  • the microorganism may comprise one or more genetic modifications providing for: synthesis of, or increased synthesis of, one or more co6 fatty acids; an increase in total fatty acid synthesis and/or accumulation in the microorganism; an increase in total polar lipid synthesis and/or accumulation in the microorganism; a decrease in TAG synthesis and/or accumulation in the microorganism, or an increase in TAG catabolism, such as an increase in TAG lipase activity; or a reduction in catabolism of total fatty acids.
  • the genetic modifications may include the introduction of an exogenous polynucleotide, a mutation or a deletion of a gene or regulatory sequence, or any other known genetic modification.
  • Suitable techniques for genetically modifying microorganisms are well known to those in the art. For example, suitable recombinant DNA techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D.M. Glover and B.D.
  • polynucleotides encoding desaturase and elongase enzymes can be used to genetically engineer microorganisms to produce lipids for use in the present invention.
  • the desaturase and elongase proteins, and genes encoding them, that may be used in the invention are any of those known in the art or homologues or derivatives thereof. Reference is also made to international patent application no. PCT/AU2022/050177, the discosure of which is incorporated herein in tis entirety.
  • the term "desaturase” refers to an enzyme which is capable of introducing a carbon-carbon double bond into the acyl group of a fatty acid substrate which is typically in an esterified form such as, for example, acyl-CoA esters.
  • the acyl group may be esterified to a phospholipid such as phosphatidylcholine (PC), or to acyl carrier protein (ACP), or preferably to CoA.
  • PC phosphatidylcholine
  • ACP acyl carrier protein
  • the desaturase enzymes that have been shown to participate in co6 fatty acid biosynthesis belong to the group of so- called “front-end” desaturases.
  • Fatty acid elongation consists of 4 steps: condensation, reduction, dehydration and a second reduction.
  • an “elongase” refers to the polypeptide that catalyses the condensing step in the presence of the other members of the elongation complex, under suitable physiological conditions. It has been shown that heterologous or homologous expression in a cell of only the condensing component ("elongase") of the elongation protein complex is required for the elongation of the respective acyl chain.
  • This invention may also be said broadly to consist in the parts, elements and features referred to or indicated in the specification of the application, individually or collectively, and any or all combinations of any two or more said parts, elements or features, and where specific integers are mentioned herein which have known equivalents in the art to which this invention relates, such known equivalents are deemed to be incorporated herein as if individually set forth.
  • YPD medium is a rich medium which contains 10 g/L yeast extract (Sigma Aldrich, Catalog No. Y1625), 20 g/L peptone (Sigma Aldrich, Catalog No. P0556) and 20 g/L glucose (Sigma Aldrich, Catalog No. G7021).
  • YPD plates contain, in addition, 20 g/L agar.
  • SD-Ura medium contained Yeast Synthetic Drop-out Medium (Sigma Catalog No. Y1501) at the recommended amount per litre. This medium was supplemented with uracil as required.
  • SD agar plates contained 6.7 g/L yeast nitrogen base, 20 g/L glucose and 20 g/L agar.
  • the medium used for preparing seed cultures for larger scale yeast cultures was a defined medium (DM-Gluc), having a base medium (BM) containing per litre 10.64 g potassium di-hydrogen orthophosphate (KH2PO4), 4.0 g di-ammonium hydrogen orthophosphate ((NFLOzHPO ⁇ and 1.7 g citric acid (monohydrate). These ingredients were dissolved in about 70% of the required volume of water that had been purified by reverse osmosis, adjusted to pH 6.0 with 2 M NaOH, and made up to the required volume using purified water.
  • the BM was sterilised at 121°C for 20 min and cooled to room temperature.
  • the fermentation medium (FM) for yeast cultures of 2 L or more in volume also used the BM as base medium unless otherwise stated.
  • the required volume was added to the bioreactor and sterilised at 121 °C for a 60 min fluid cycle for an autoclavable bioreactor or 30 min for a steam-in-place bioreactor, and cooled to 30°C.
  • the following ingredients were added, per litre of base medium: 121 ml of 660 g/L glucose (autoclaved), giving a final concentration of 80 g/L, 5 ml of IM magnesium sulphate heptahydrate (autoclaved), 5 ml of Trace metal solution (see below, filter sterilised), 5 ml 15 g/L thiamine hydrochloride (filter sterilised) and 50 ml of 200 g/L ammonium chloride (filter sterilised).
  • the glucose, magnesium, trace metal solution and thiamine solution were mixed and added to the bioreactor together.
  • the pH was checked, normally slightly less than 6.0.
  • a pH controller was used to add ammonia solution to the medium and bring the pH to 6.0.
  • Small scale (50 ml) and larger scale yeast cultures of 2 L or more for inducing more TAG synthesis were also grown in a defined medium containing glycerol at 8% (w/v) and having a lower nitrogen content (DM-Glyc-LowN).
  • This medium was the same as DM-Gluc except that the glucose was replaced with 80 g/L glycerol (final concentration) as carbon source and the (NH4)2HPO4 content was reduced to 2.0 g/L or even 0.5 g/L, as stated.
  • starter cultures were grown in either YPD medium or SD-Ura medium, with addition of uracil and any amino acids if required, for 24-48 h. A sample of the starter culture was centrifuged and the cells used to inoculate the larger culture. These cultures were incubated for 48-96 h and the pH maintained at 6.0 unless otherwise stated.
  • the Trace metal stock solution (TMS) used in the media described above contained, per litre: 2.0 g CuSO 4 .5H 2 O, 0.08 g Nal, 3.0 g MnSO 4 .H 2 O, 0.2 g NaMoO 4 .2H 2 O, 0.02 g H3BO3, 0.5 g COC1 2 .6H 2 O, 7.0 g ZnCl 2 , 22.0 g FeSO 4 .7H 2 O, 0.50 g CaSO 4 .2H 2 O, and 1 ml of sulphuric acid.
  • the reagents were added in the listed order. Addition of the sulphuric acid resulted in dissolution of the calcium sulphate.
  • the trace metal solution was filtered sterilised through a 0.2 pm filter and stored at 2-8 °C in a bottle wrapped in aluminium foil.
  • One pH control reagent was a phosphoric acid solution (10% w/v), prepared by adding 118 ml of 85% H 3 PO 4 to 882 ml of purified water. The solution was sterilised by autoclaving. The other was an ammonia solution (10% v/v), prepared by adding 330 ml of a 30% ammonia solution to 670 ml of purified water. That solution was assumed to be self-sterilising. An antifoam solution was prepared by mixing 100 ml of Sigma antifoam 204 with 900 ml of purified water, providing a concentration of 10%. The mixture was sterilised by autoclaving.
  • a feed solution was prepared by adding 134 ml of 200 g/L ammonium chloride which had been filter sterilised to 1 L of 660 g/L glucose, and sterilised by autoclaving.
  • S. cerevisiae strain D5A (ATCC 200062) was used as a yeast for experiments on production of lipids including phospholipids.
  • yeast strains of the species Yarrowia lipolytica were also used and were obtained from the American Type Culture Collection (Manassas VA, USA), for example wildtype strain W29 (Casaregola et al., 2000).
  • yNI0121 The fungal strain described herein as yNI0121 (Mucor hiemalis) has been deposited with National Measurement Institute, Port Melbourne, VIC 3207, Australia on 4 February 2021 under the Budapest Treaty and has been designated the following Deposit Number: yNI0121 Deposit Accession number V22/001757.
  • yNI0125 Mortierella elongata
  • yNI0126 Mortierella sp.
  • yNI0127 Mortierella sp.
  • yNI0132 Mortierella alpina
  • SD-Ura medium When SD-Ura medium was used, a carbon source such as 2% glycerol or raffinose (w/v) (MP Chemicals, USA, Catalog No. 4010022) was used. Cultures were incubated overnight at 28°C with shaking for aeration. The inoculum culture was diluted into 10 ml of SD-Ura medium, or other volume as specified, containing 2% (w/v) glycerol or raffinose to provide an initial OD600 of 0.1. The culture in a 50 ml tube or a 250 ml flask was incubated in a shaker at 28°C at 200 rpm for aeration. The OD600 was checked at time intervals of 15 or 30 min. When the OD600 reached 0.3, exogenous compounds as potential substrates (if any) were added to the medium.
  • 2% glycerol or raffinose MP Chemicals, USA, Catalog No. 4010022
  • yeast inoculum cultures were diluted into their respective growth media containing 1% tergitol (Sigma Aldrich Catalog No. NP40S) or Tween- 100 at an OD600 of 0.1 and incubated with shaking for a period of time, typically 2 h.
  • Lipid substrates such as e.g. fatty acids, oil or oil-hydrolysates were then added to the medium and the cultures further incubated for different time periods.
  • fatty acid substrates were dissolved in ethanol and provided to the cultures to a final concentration of 0.5 mg/ml, or the sodium salts of the fatty acids were provided in aqueous solution.
  • a frozen glycerol stock of the yeast strain was used to inoculate 100 mL of DM in a plastic baffled 1 L Erlenmeyer flask with a vented cap. This was incubated at 28 °C with shaking at 200 rpm for aeration for 24 ⁇ 2 h. The optical density at 600 nm (OD600) was measured at the end of incubation.
  • a secondary seed culture was prepared by using the primary seed culture to inoculate 500 mL of DM in a plastic baffled 2 L Erlenmeyer flask with a vented cap, to a starting OD600 of 0.04. The second seed culture was incubated at 28°C with shaking at 200 rpm for 16 + 2 hours. The GD600 was measured at the end of incubation. This culture was used to inoculate the large-scale fermentation.
  • lipid substrates such as ARA, DGLA, y-linolenic acid (GLA) or other fatty acids
  • cell pellets were washed successively with 1 ml of 1% tergitol (v/v), 1 ml of 0.5 % tergitol and a final wash with 1 ml water to remove any remaining substrate from the exterior of the cells and freeze-dried as described above.
  • total cellular lipid was extracted from yeast cells such as S. cerevisiae or Y. lipolytica by using a method modified from Bligh and Dyer (1959). Approximately 50 mg freeze- dried cells were homogenized with 0.6 ml of a mixture of chloroform/methanol (2/1, v/v) with 0.5 g zirconium oxide beads (Catalog No. ZROB05, Next Advance, Inc., USA) in a 2 ml Eppendorf tube using a Bullet Blender Blue (Next Advance, Inc. USA) at speed 6 for 5 min. The mixture was then sonicated in an ultrasonication water bath for 5 min and 0.3 ml 0.1 M KC1 was added.
  • the mixture was shaken for 10 min and centrifuged at 10,000 g for 5 min.
  • the lower, organic phase containing lipid was transferred to a glass vial and remaining lipid was extracted from the upper phase containing the cell debris by mixing it with 0.4 ml chloroform for 20 min and centrifugation.
  • the lower phase was collected and combined with the first extract in the glass vial.
  • the solvent was evaporated from the lipid sample under a flow of nitrogen gas and the extracted lipid resuspended in a measured volume of chloroform. If required, the lipid samples were stored at -20°C until further analysis.
  • the upper phase was mixed with 1 g of glass beads in a Vibramax mixer for 10 min and with vigorous vortexing for 1 min.
  • One volume of chloroform was added to each tube and mixed again for 3 min.
  • the lower phase was transferred to Tube B and the solvent was evaporated under a flow of nitrogen gas at room temperature.
  • the upper phase in Tube A was mixed with another volume of chloroform and mixed for 3 min.
  • the lower phase was again transferred to Tube B.
  • 0.5 volume each of methanol and 0.1 M KC1 were added to Tube B and mixed for 3 min.
  • the lower phase was transferred to a Falcon tube and the solvent was evaporated under a flow nitrogen gas at room temperature.
  • the extracted lipid was dissolved in chloroform/methanol (2/1, v/v) and stored at -20°C.
  • the following method was used to extract lipid from biomass of fungi such as Mortierella or Mucor, where the method preferentially extracts the polar lipid including phospholipids (PL) on the basis of differential solubility of PL and neutral lipids, firstly in ethanol as solvent and then in hexane for remaining lipid.
  • Wet fungal biomass of a known weight was washed with ethanol to remove water, then resuspended in ethanol using 2 ml ethanol per g of biomass.
  • the mixture was homogenised using an Ultra-Turrax for 3 min and then sonicated for 5 min. The homogenisation and sonication steps were repeated twice more for a total of three times.
  • TLC thin layer chromatography
  • PL and TAG were fractionated from about 100 mg of total lipid by loading the lipid on 18 cm lines on each of eight TLC plates (Silica gel 60; Catalog No. 1.05626.0001, Merck, Darmstadt, Germany) and chromatographed with a solvent mixture consisting of hexane/diethylether/acetic acid (70:30:1, v:v:v). An aliquot of a lipid standard containing TAG, DAG, FFA and MAG (18-6A; NuChek Inc, USA) was run in parallel to assist with identifying the lipid bands.
  • the PL bands located at the origin and the TAG bands having the same mobility as the TAG standard were collected and transferred to Falcon tubes.
  • the lipid/silica samples were extracted with a mixture of 6 ml chloroform and 3 ml methanol, mixing vigorously for 5 min, then adding 3 ml water and further mixing for 5 min. After centrifugation for 5 min at 3,000 g, the lower organic phase was transferred to a new tube. The lower phase was transferred to a Falcon tube after centrifugation at 3,000 ref for 5 min. The upper phase was mixed with 5 ml chloroform for 5 min to extract any remaining lipid. After centrifugation, the lower phase was combined with the first extract.
  • the solvent was evaporated under a flow of nitrogen gas.
  • the extracted lipid, TAG or PL was dissolved in a small volume of chloroform and filtered through 0.2 pm micro-spin filter (Chromservis, EU, Catalog No. CINY-02) to remove any particulates.
  • the fatty acid composition and amount of each PL and TAG fraction were determined by preparation of FAME and GC analysis. Such preparations were used, for example, to separate different polar lipid classes such as PC, PE, PI and PS, or in Maillard reactions for aroma tests or for detection of volatile compounds as reaction products.
  • fatty acid methyl esters were prepared from total extracted lipid or the purified TAG or polar lipid fractions, including PL samples, by treatment with 0.7 ml 1 N methanolic -HC1 (Sigma Aldrich, Catalog No. 90964) in a 2 ml glass vial having a PTTE-lined screw cap at 80°C for 2 h.
  • a known amount of heptadecanoin (Nu-Chek Prep, Inc., Catalog No. N-7-A, Waterville, MN, USA) dissolved in toluene was added to each sample before the treatment as an internal standard for quantification.
  • the individual FAMEs were identified and quantified by GC using an Agilent 7890A GC (Palo Alto, California, USA) with a 30 m SGE-BPX70 column (70% cyanopropyl polysilphenylene- siloxane, 0.25 mm inner diameter, 0.25 pm film thickness), a split/splitless injector and an Agilent Technologies 7693 Series auto sampler and injector, and a flame ionisation detector (FID). Samples were injected in split mode (50:1 ratio) at an oven temperature of 150°C.
  • the column temperature was programmed for 150°C for 1 min, increasing to 210°C at 3°C/min, holding for 2 min and reaching 240°C at 50°C/min, then holding at 240°C for 0.4 min.
  • the injector temperature was set at 240°C and the detector at 280°C.
  • Helium was used as the carrier gas at a constant flow of 1.0 ml/min. FAME peaks were identified based on retention times of FAME standards (GLC-411, GLC-674; NuChek Inc., USA).
  • Peaks were integrated with Agilent Technologies ChemStation software (Rev B.04.03 (16), Palo Alto, California, USA) based on the response of the known amount of the external standard GLC-411 (NuChek) and C17:0-ME internal standard.
  • the resultant data provide the fatty acid composition on a weight basis, with percentages of each fatty acid (weight %) in a total fatty acid content of 100%. These percentages on a weight basis could readily be converted to percentages on a molar basis (mol%) based on the known molecular weight of each fatty acid.
  • MS ion source and interface temperatures were 200°C and 250°C, respectively. Data were collected at a scan speed of 1000 and scan range from 40 to 500 m/z. Peak separation was provided by a Stabilwax or Stabilwax-DA (Restek/Shimadzu) capillary column (30 m x 0.25 mm i.d., 0.25 pm film thickness) using He as a carrier gas at 30 cm/sec. Mass spectra correlations were performed using a NIST library, retention indices and matching retention time of available standards. Identified SCFA was set to be present when S/N ratio were above 10:1. Instrument blanks and procedural blanks were run for quality control purposes.
  • Crude lipid preparations may be fractionated with organic solvents to provide purer polar lipids or fractions having mostly neutral (non-polar) lipids including TAG (e.g. US Patent No. 7,550,616).
  • organic solvents such as ethanol or acetone.
  • fractionation of several lipids having a mixture of substantial neutral and polar lipids was attempted, including egg yolk lipid and krill lipid, as model systems.
  • the lipids in chicken eggs are present mostly in the yolk fraction which constitutes about 33% lipid by weight.
  • the lipids, which are closely associated with proteins in the yolk, are mostly TAG (66% by weight), with phospholipids (PL, 28%) and cholesterol and its esters (6%) present in lower amounts (Belitz et al., 2009).
  • the PL contains some co3 and co6 fatty acids (Gladkowski et al., 2011). Based on the method of Palacios and Wang (2005), Gladkowski et al., (2012) extracted PL from egg yolk with ethanol and then purified the PL by removing neutral lipids by precipitation of the PL with cold acetone.
  • the ethanol from the combined supernatants was evaporated using a SR- 100 rotary evaporator (Buchi, Switzerland) operating at 400 rpm with a vacuum of 15 mbar, with the chiller set at -16°C and the waterbath at 37°C.
  • the lipid recovered from the krill oil probably still contained a small amount of solvent. Nevertheless, the recovery of essentially 100% indicated that the krill oil from the capsules was highly enriched for PL to begin with.
  • the precipitate was washed 5 times with 20 ml portions of cold acetone (-20°C) to remove more of the TAG and other neutral lipids such as cholesterol.
  • the residual solvent was removed from the washed precipitate by rotary evaporation at room temperature for 10 h.
  • the lipid yield was measured gravimetrically and a small aliquot used for analysis of the fatty acid composition by GC quantitation of FAME. From the initial input of 17 g of fresh egg yolk, 1.1 gram of purified polar lipid was recovered. An aliquot of this extracted lipid was analysed by TLC and was observed to be essentially devoid of any neutral lipids, including TAG.
  • Neutral lipid was extracted from the precipitates after the ethanol extraction of the egg yolk and egg yolk powder by extracting the precipitate twice with 50 ml of hexane. The combined hexane solution containing the neutral lipid was washed four times, each time with 50 ml of 90% ethanol. The hexane was then evaporated under reduced pressure to provide the purified neutral lipids from egg yolk.
  • Both fresh egg yolk and the purer polar lipid preparations also contained co6 and co3 LC-PUFA.
  • the fresh egg yolk 1 st precipitate contained 5.3% C20:4 (ARA), 2.3% C20:5 (EP A) and 5% C22:6 (DHA) while more purified polar lipid preparation contained 5.3% ARA and 4% DHA.
  • the first precipitate from the krill oil and the more purified polar lipid from the krill oil had Cl 6:0 as their main saturated fatty acid.
  • the krill oil 1 st precipitate and the more purified polar lipid also contained substantial amounts of co3 LC-PUFA, namely 1.1% ARA, 34.7% EPA and 19.0% DHA in the 1 st precipitate, while the more purified polar lipid contained 1.1% ARA, 48.1 % EPA and 25.7% DHA.
  • the precipitated lipid from the egg yolk lecithin powder had 17% C16:0 and 4% C18:0 but was low in the LC-PUFA EPA and DHA. It was considered that the low LC- PUFA content of the lecithin powder was likely due to oxidative breakdown of those polyunsaturated fatty acids during its production or storage.
  • An alternative method to purify polar lipids by fractionation from a total lipid preparation is to use silica-based column chromatography such as, for example, use of SPE columns (HyperSep aminopropyl, ThermoFisher, UK).
  • SPE columns Hydrophilicity Polysorbents
  • Table 3 Fatty acid composition of polar lipids purified from egg yolk and krill oil capsules.
  • the Maillard reaction is a chemical reaction between a reducing sugar and an amino group, for example in a free amino acid, with application of heat. Like caramelisation, it is a form of non- enzymatic browning. In this reaction, the amino group reacts with a carbonyl group of the sugar and produces N-substituted glycosylamine and water. The unstable glycosylamine undergoes an Amadori rearrangement reaction and produces ketosamines. The ketosamines can react further in different ways to produce reductones, diacetyl, aspirin, pyruvaldehyde, and other short-chain hydrolytic fission products. Finally, a furan derivate may be obtained which reacts with other components to polymerize into a dark-coloured insoluble material containing nitrogen.
  • the outcome of the Maillard reaction depends on temperature, time and pH. For example, the reaction slows at low temperature, low pH and low water activity (Aw) levels. The browning colour occurs more quickly in alkaline conditions because the amino group remains in the basic form. The reaction peaks at intermediate water activities such as Aw of 0.6-0.7. In addition to colour, many volatile aroma compounds are typically formed during the Maillard reaction. Flavour-intensive compounds may be formed in the presence of the sulphur-containing amino acids methionine or cysteine or other sulphur containing compounds such as thiamine. Unsaturated fatty acids and aldehydes formed from fatty acids also contribute to the formation of heterocyclic flavour compounds during the Maillard reaction (Gehard Feiner, 2006). In view of this contribution of unsaturated fatty acids to formation of flavours and aromas, the inventors tested the extracted egg yolk polar lipid preparation from Example 2 as a model system for Maillard reactions.
  • each mixture was added to the vials in the following order.
  • Components were added to provide final concentrations of 10 mM xylose as the sugar, 0.1 mM thiamine hydrochloride, and either 5 mM cysteine or 5 mM cystine as a sulphur-containing amino acid. These components were dissolved in a final concentration of 32.6 mM potassium phosphate buffer pH 6.0 or 5.3, prepared from potassium dihydrogen phosphate and dipotassium hydrogen phosphate.
  • Some mixtures also included one or more of 15 mg/mL yeast extract, 3.5 mg/L iron (Fe 2+ ) in the form of iron fumarate (Apohealth, NSW, Australia) and 2 mM L-glutamic acid monosodium salt hydrate.
  • yeast extract was intended to test whether it would either mask, or enhance, the aroma produced from the extracted lipid having PL, or have no effect.
  • the assembled mixtures were sonicated for 30 min and then heated for 15 min in an oven set at 146°C. During the heat treatment, the vials were tightly sealed. The vials were cooled until warm to the touch about 15 min later, and then opened briefly for sniffing by a panel of 4 volunteers (Pl to P4). These included 2 males and 2 females, ages ranging from 24-65 years. The volunteers did not know the composition of any of the vials prior to sniffing the contents and the vials were sniffed in a random order as selected by the volunteers. The volunteers sniffed coffee beans between sniffing each test sample to reset their olefactory senses. Their descriptions of the aromas were recorded without any comments being shared until the sniffing was completed.
  • the reaction mixes were sonicated as a batch by placing the vials in a floating foam and placed in a sonicator (Soniclean, Thermoline) set up at a medium power for 30 min and then heat treated in an oven at 140°C for about 60 min.
  • the vials containing the reaction mixtures were cooled slowly over about 15 min until warm to the touch.
  • the vials were opened briefly by each of 10 volunteers and the contents sniffed, and their descriptions of the aromas recorded.
  • the volunteers ranging in age from 29 to 65 years and were from a range of ethnic backgrounds.
  • the reactions had been coded with random 3-digit numbers to avoid bias, and the volunteers sniffed coffee beans between vials, as before.
  • Example 4 Feeding omega-6 fatty acids to yeasts and incorporation into polar lipids
  • the inventors produced phospholipids (PL) containing co6 fatty acids by incorporation into microbial PL, specifically by supplementing Y. lipolytica and S. cerevisiae cultures with the co6 fatty acids such as ARA, GLA and DGLA. This was initially done by supplying co6 fatty acids to the microorganisms during growth of the cultures and then extracting lipids from the cells and fractionating them to isolate the polar lipids, including the PL.
  • PL phospholipids
  • an ARA -containing oil was obtained from Jinan Boss Chemical Industry Co., Ltd (China), having 50% ARA in its total fatty acid content (Table 4).
  • the inventors hydrolysed some of the oil to convert its TAG into free fatty acids, as follows.
  • Two similar methods were tested to hydrolyse the TAG in the ARA -rich oil, both using KOH to release the free fatty acids from the glycerol backbone, in a salt form.
  • Method 1 was based on Lipid Analysis book, 2 nd edition, Christie. In this method, 0.5 g of the ARA -rich oil was mixed with 1.5 ml 1 M KOH in 95% ethanol for 1 h in a glass tube (A).
  • Method 2 based on Salimon 2011, was identical to method 1 except that 0.5 g ARA- rich oil was treated with 1.5 ml 1.75 M KOH in 90% ethanol for 1 h at 65°C.
  • the fatty acids were extracted into hexane as in method 1. Again, the hexane was evaporated under a flow of nitrogen and the dried lipid dissolved in 0.3 ml chloroform. In both methods, the alkali was not neutralised before the hexane extraction, but this was done for later preparations of hydrolysates. However, in this experiment, the hydrolysed fatty acids were isolated by TLC and recovered, so not requiring neutralisation.
  • FFA Free fatty acid
  • GLA y-linolenic acid
  • DGLA dihomo-y-linolenic acid
  • ARA arachidonic acid
  • DTA docosatetraenoic acid-N6
  • DPAco6 docosapentaenoic acid-co6
  • the fatty acids GLA, DGLA and ARA, each of 99% purity (NuChek Inc, USA) and dissolved in ethanol were added to a final concentration of 0.5 mg/ml and incubation continued.
  • the W29 and INVScl cells were harvested after 2 days and 4 days of culturing, respectively, due to their different growth rates. The harvested cells were pelleted by centrifugation at 4,600 g for 15 min. The cell pellets were washed twice to remove any remaining FFA by resuspension in water and centrifugation, and the cell pellets freeze dried. Lipid extraction and analysis of both the content and fatty acid composition of extracted polar lipid and TAG was carried out as described in Example 1.
  • the TAG fractions from the yeast cells also showed high levels of these co6 faty acids.
  • the -S', cerevisiae cells exhibited TAG with incorporation of 78.1%, 80.2% and 76.8% of GLA, DGLA and ARA, respectively, indicating high activity of the acyltransferases in S. cerevisiae towards these exogenous co6 fatty acids and efficient incorporation into TAG.
  • the polar lipid content was higher, at greater than 2.0% of DCW, in Y. lipolytica cells, while S. cerevisiae contained approximately 1% polar lipid by dry weight.
  • Table 4 Fatty acid composition of ARA oil and hydrolysed preparation from the oil.
  • Table 5 Fatty acid composition of polar lipids and TAG in Y. lipolytica strain W29 after culturing with co6 fatty acids. The percentages are the average of triplicate assays.
  • the base medium contained Yeast Extract at 3 g/L, Malt Extract at 3 g/L, Soy peptone at 5 g/L and dextrose monohydrate as the main carbon source at 10 g/L.
  • the pH was initially adjusted to 6.0. This medium was prepared and sterilised in the fermenter by autoclaving in situ, then cooled by direct cooling to the fermenter jacket.
  • ARA was added aseptically by overpressure to the medium in the form of 12.5 g ARA (NuChek) as free fatty acid in 300 ml of 17% Triton-X-100 to give a final concentration in the fermenter of 0.5 g/L ARA and 0.2% Triton-X-100, with further addition of 100 ml of unhydrolyzed ARA oil to provide a concentration of 0.4% (v/v) unhydrolyzed ARA oil in addition to the FFA.
  • a seed culture was prepared in 400 ml YM medium at 29°C with shaking at 180 rpm overnight, providing an inoculum having an GD600 of 4.23. When the medium temperature was 29°C, 400 mL of the seed culture was transferred to the fermenter by overpressure, providing an initial cell density (OD600) of 0.07 by calculation.
  • the initial fermentation parameters at inoculation were DO at 7.92, pH 7.01, air introduction at 10 ml/min, agitation at 5% of full speed, and back pressure at 11 psi.
  • the initial OD600 was 3.35, almost entirely from the surfactant/oil emulsion, so DO, citric acid production and pH changes were tracked to follow logarithmic growth. In particular, these parameters were followed after about 15 h post inoculation for signs that log-growth was slowing. Agitation and air flow were low to avoid excessive foaming from the surfactant.
  • the backpressure (11 psi) was applied to ensure good oxygen transfer at the low agitation speed.
  • the pH was not controlled. Almost no antifoam (20% Silfax D3 food grade) was used during this experiment.
  • the culture was terminated at late logarithmic growth phase to maximise polar lipid content and ARA incorporation and was not heat treated at the end of the fermentation.
  • the cells were budding as observed by light microscopy and there were very few that stained with Methylene Blue, so the oil content and therefore the TAG content was low as intended.
  • a final yield of 294 g of wet paste was obtained from the 21 L of culture, with approximately 72% water content i.e. approximately 28% w/w solids.
  • the cell paste was frozen and then freeze dried in 3 batches to yield 73 g of dry yeast cake.
  • the dry yeast cake was milled to a fine powder and dispensed as 3 portions - a 3 g portion for lipid analysis, a 35 g portion for food application trials and a 35 g portion for further processing to yield a crude lipid fraction.
  • Lipid was extracted from 35 g of yeast powder by adding 900 mL of 60% hexane/40% dry ethanol in a 1 L bottle. The bottle was shaken in an orbital shaker at 180 rpm for 4 h at 29°C. The yeast powder was well suspended in the solvent using this approach. After 4 h of extraction, the solvent was filtered into a glass flask using a ceramic Buchner funnel and a glass filter (Advantec GA-100, 125mm diameter). Some yeast debris bypassed the filter so the solution was re -filtered by gravity into a 2 L round bottom flask. The solvent was evaporated under vacuum to a final volume of approximately 20 mL and transferred to a glass culture tube for shipment.
  • the fatty acid composition of the polar lipid fraction from the extracted lipid included 16.4% ARA, as well as 25% of LA. There were also smaller amounts of the other co6 fatty acids GLA, EDA and DGLA present in the total fatty acid content, and a trace amount of the co3 fatty acid ALA. Monounsaturated fatty acids were present included 32.7% oleic acid, the most prevalent fatty acid in the polar lipid fraction, and 7.4% palmitoleic acid. Saturated fatty acids (SFA) were present at lower amounts, predominantly palmitic acid at 12.7% and surprisingly low levels of stearate at 0.5% in the total fatty acid content of the polar lipid fraction.
  • SFA saturated fatty acids
  • the fatty acid composition of the TAG fraction was different, including 22.1% ARA.
  • Other co6 fatty acids were either absent or lower than in the polar lipids, for example LA at 16.7%.
  • oleic acid was the predominant fatty acid in the TAG fraction.
  • the TAG content was indeed low, with a favourable polar lipid:TAG ratio of about 20 in the total lipid content.
  • the dissolved oxygen (DO) probe provided unexpectedly low readings 20 min post inoculation, hence the pH, OD and dry weight were the only parameters used to monitor growth of the culture in this experiment.
  • the pH of the culture medium was not controlled in this experiment, falling from pH 6.7 to 3.3 at 16 h due acid production from cellular metabolism.
  • the cell density (dry weight) was 9.4 g/L at 16 h, while optical density of washed cell samples increased from 0.1 to 29.3 at time 0 and 16 h, respectively. There was no bacterial growth observed during the fermentation process as determined by tests for coliforms and Salmonella, and aerobic plate count.
  • the culture was chilled at 16 h post inoculation, the cells harvested and the cell pellets washed three times with cold deionised water.
  • the cell paste was then heat treated at a temperature above 76°C and below 82°C for 3 min, aiming to inactivate the cells, then chilled by immersing the container in a water bath with ice.
  • the fermentation terminated at 16 h produced a wet cell paste of 1390 g having a dry cell weight of 236 g.
  • the cell paste was freeze dried.
  • Lipid was extracted from biomass samples using 25 mL 60% hexane:40% ethanol as solvent per gram of the freeze-dried cells, for 3.5 h at 30°C.
  • the solvent extracts were evaporated under vacuum at 50°C and then dried under CO2 gas at 10 L/min.
  • the total lipid content of the 16 h freeze-dried sample was 4.6% on a dry weight basis.
  • the extracted lipid was resuspended in chloroform at a concentration of 200 mg/mL and chromatographed on a TLC plate as before. The TLC results showed substantial amounts of polar lipid had been extracted from the 16 h cells.
  • the ARA levels in the lipid extracted from the biomass when analysed by GC were 7.7% and 2.6% in TAG and PL, respectively, and 2.4% and 2.5% of the total fatty acid content in the TAG and polar lipid fractions, respectively.
  • the biomass production was much greater, but the ARA incorporation rate was reduced. There therefore appeared to be an inverse relationship between the amount of biomass produced and the level of ARA incorporation.
  • the cell density (GD600) of the inoculum was 9.19, so 200 mL was added to the 25 L medium in the fermenter to achieve a starting GD600 calculated at 0.08.
  • the ARA oil and FFA were added as before.
  • the pH dropped from an initial 7.08 at 0 h to 4.63 at 15.68 h but then started to increase in the last 30 min of the culturing.
  • the culture might have reached stationary phase and glucose was depleted.
  • the cells After the exhaustion of glucose, the cells might have started breaking down phospholipids for maintenance. It was therefore considered important to harvest the culture before it reached stationary phase.
  • the cell biomass was harvested from the culture and the pellets washed twice with cold deionized water.
  • the washed cells were heat inactivated at a temperature of approximately 95 °C for 3 min, then chilled by immersing the container in a water bath with ice.
  • the heat inactivation of the yeast cells was successful as shown by a lack of viable cells when plated.
  • 225 g of dry cell biomass was generated.
  • Total lipid was extracted from biomass samples and analysed as before.
  • the freeze-dried cells contained about 4.7% crude lipid.
  • the polar lipid fraction from this experiment had 4.1% ARA and the TAG fraction had 4.0% ARA as a percentage of the total fatty acid content of those fractions (Table 8).
  • the total lipid also had less TAG, MAG and FFA than in previous experiments, as shown by TLC. This was taken as an indication that the cells took up the ARA and incorporated it into PL in cell membranes under the prescribed culture conditions, however, the PL might have been broken down to some extent to maintain cellular activities due to glucose depletion in the medium.
  • the Triton X- 100 separated from the water as the sterilised solution cooled overnight and needed to be warmed to about 50°C to re-dissolve it, with shaking. Once the Triton X-100 was fully dissolved, it was vigorously mixed with 10.0 g ARA and 100 mL ARA oil to form an emulsion and then pumped into the fermenter. Lastly, 400 mL inoculum culture was transferred to the fermenter by overpressure. The calculated culture density (OD600) at inoculation was 0.07.
  • the dissolved oxygen level dropped to zero at 6 h post inoculation under the initial set up conditions of airflow at 10 L/m, pressure 10 psi and DO 15.9.
  • the temperature gradually dropped from 28°C to 23°C overnight as the culture density was insufficient to generate heat.
  • the reduced temperature was likely beneficial in decreasing the culture growth rate shown by the gradual decrease in pH decline.
  • the airflow, stirring rate and backpressure were changed to increase the DO and the temperature was also increased.
  • the OD600 was 7.4 at 14 h, therefore, the fermentation was extended by 2 hours until the OD600 was above 10 and the pH began to stabilise at pH 5.
  • the culture was run without pH control for 16 hours, the pH naturally falling from pH 6.96 to 5.07 due to acid production from cellular metabolism.
  • the cell density (dry weight) was 5.27 g/L at 16 h, while the OD600 increased from 0.07 to 12.1 at 16 h.
  • the culture assimilated 4.5 g/L of glucose, which was 51% of the 8.9 g/L glucose supplied in the start medium.
  • the harvested cells were heat inactivated at a temperature of 95°C for 3 min as before, yielding 584 g wet weight of biomass corresponding to 114 g dry weight.
  • Lipid was extracted from freeze-dried samples and analysed as before. The total lipid content of the 16 h freeze-dried cells was 3.4%.
  • the TLC analysis showed that more polar lipid was present than in experiment B012.
  • the ARA level in the polar lipid and TAG fractions were 10.2% and 13.3%, respectively.
  • the data for the fatty acid compositions are provided in Table 9.
  • Table 7 Comparison of Y. lipolytica W29 cultures under different fermentation conditions Table 8. Fatty acid composition of polar lipids and TAG in Y. lipolytica after culturing with ARA, for experiments B005, B009, B012 and B013.
  • polar lipids including PL with one or more of the co6 fatty acids GLA, DGLA or ARA were produced in yeast cells, extracted and purified.
  • polar lipid preparations including GLA or ARA were mixed with cysteine and ribose in glass vials and heated in an oven at 140°C for 1 h. This Example describes these experiments and the results.
  • Experiment 1. Maillard reactions
  • Polar lipid samples were prepared by extraction from yeast cells supplemented with GLA or ARA and fractionation as described in Example 4. Samples of 8.0 mg of polar lipid from the ARA- fed cells, 7.6 mg from the GLA-fed cells, 9.0 mg from the control cells and 16.0 mg of polar lipid extracted from pork meat, each dissolved in chloroform, were transferred to 20 ml glass vials. The solvent was evaporated under nitrogen flow at room temperature. 2 ml of 0.1 M potassium phosphate buffer, pH 7.2, containing 4.5 mg/ml ribose (Catalog No. R9629, Sigma-Aldrich) and 5.0 mg/ml cysteine (Catalog No.
  • the heated mixtures having the ARA-fed and pork polar lipids gave off pleasant, meat-like aromas, while the mixture including the GLA-fed polar lipid had a mild garlic-like aroma.
  • the mixture having the polar lipid from Y. lipolytica that had not been fed the amino acids (control) and the control mixture lacking lipid emitted a sulphurous aroma.
  • the inventors concluded that the polar lipid containing ARA provided a more meat-like aroma than the polar lipid containing GLA, even though the GLA was present at a 3-fold greater amount in the polar lipid than the ARA.
  • the inventors also concluded that the presence of ARA in the polar lipid provided the meat -like aroma, which did not occur with the corresponding polar lipid lacking the ARA.
  • Polar lipid was extracted from Y. lipolytica strain W29 cells as before.
  • the fatty acid composition of the polar lipid was determined by GC-FID of FAME, showing the presence of 16.3% ARA (Table 9).
  • Samples of 15 mg of polar lipid were treated in the same manner as in Experiment 1. Additional, control mixtures having buffer with ribose but without the cysteine were prepared to test the effect of omitting the sulphur-containing amino acid.
  • 3-octanone and 1 -nonanol were detected only in the reaction having the YL ARA polar lipid i.e. not in any of the other vials.
  • Other compounds namely 2-heptanone, 2,3- octanedione, 1 -hexanol and 1 -octanol were detected only in the reactions having YL ARA and the soy lecithin.
  • the co6 fatty acid in the reactions with polar lipid containing ARA clearly created a chemical difference which was associated with the sensory difference observed by the volunteers, with an increased amount of lipid oxidation products and reduced amounts of heterocyclic compounds, such as pyrazines.
  • Octanal was produced from the samples containing YL ARA, YL and soy lecithin, i.e. all three polar lipid samples, but not produced from the ARA-Oil and no lipid samples.
  • the unsaturated alcohol l-octen-3-ol also produced in all the oil-containing samples tested (YL ARA, YL, soy lecithin and ARA Oil) may contribute to an herbaceous aroma resulted from thermal decomposition of methyl linoleate hydroperoxide.
  • the vials were subjected to ultrasonication for 1 h at 40°C in a water bath to emulsify the mixtures and then incubated at 140°C for 1 h by placing the vials on aluminium foil inside an oven. After the vials were cooled, the volatile compounds in the headspace of each vial were analysed by solid-phase microextraction coupled with gas chromatography-mass spectrometry (HS-SPME-GCMS) as before. The reaction mixtures including 0.5 mg lipid showed peaks for the volatile compounds but at lower intensities than desired with some compounds being undetected.
  • HS-SPME-GCMS gas chromatography-mass spectrometry
  • hydrocarbons not considered in the analysis for this reason were: Hexane, 2,4-dimethyl-; Dodecane, 4,6-dimethyl-; Hexadecane; Heptadecane; Undecane, 3,8-dimethyl-; Triacontane; Hentriacontane; Tetradecane, 5-methyl-; Decane, 3,3,6-trimethyl-; and Hexadecane, 2,6,10,14-tetramethyl-.
  • HS-SPME-GCMS analysis of the volatiles produced after the heating step showed the presence of numerous compounds which were either increased or decreased in the mixtures having ARA-PC relative to the mixtures having 18:0/18: 1-PC or were present in one mixture and absent or not detected in the other mixture.
  • the compound 2-pentyl thiophene has a characteristic aroma which has been described as chicken, roasted hazelnut or meaty.
  • the compound 2-pentyl furan has an aroma described as a fruity, earthy or having a vegetable aroma.
  • the inventors nevertheless tested this polar lipid in Maillard reactions, with the conditions as in Experiment 5 except using 15, 30 or 60 mg polar lipid per reaction in 2 ml volumes to increase the amount of ARA -polar lipid.
  • the control polar lipid extract had been prepared from Y. lipolytica cells which had not been fed co6 fatty acids in the medium. Control reactions were also set up having aliquots of the polar lipid extracts but lacking the ribose and cysteine.
  • the aromas from the reactions were smelled by three volunteers.
  • the mixtures having the ARA-PL provided mild aromas that were described as “pork like, pork crackling, meaty, fatty” or “broiled chicken, milder aroma” or “like broiled fish” whereas the control mixtures having the polar lipid from Y. lipolytica not fed the ARA was described as being sulphurous or “burnt” in their aroma.
  • the mixtures lacking ribose and cysteine were described as “burnt vegetable”.
  • Y. lipolytica strain W29 cells producing polar lipids including PL were grown in 25 L cultures, either in the presence of ARA (Yl-ARA) in the growth medium or in the absence of ARA (Yl).
  • the fatty acid composition of the polar lipid in the Y. lipolytica cells is shown in Table 10 for Experiments 2 and 3.
  • ARA was present at 16.4% of the total fatty acid content of the polar lipid, with GLA at 1.4% and DGLA at 1.9%.
  • the harvested cells were then freeze dried and the dried material milled to a powder. The cells were not heat treated or otherwise treated to kill or inactivate the cells.
  • the inventors wished to test the dried yeast cells for the capacity to provide aroma compounds after the cells were heated in the presence of a sugar, for example D-xylose, and an amino acid, for example L-cysteine.
  • a series of reactions were prepared to test the effect of different amounts of the sugar, the amino acid and varying amounts of freeze-dried cells (Table 13). Briefly, L-cysteine powder (Catalog No. 30089, Sigma -Aldrich), D-xylose powder (Catalog No. X1500, Sigma- Aldrich), sodium citrate dihydrate (Catalog No. W302600, Sigma- Aldrich), and wheat flour were weighed into 10 ml GC headspace analysis vials (Catalog No.
  • vial 13 The loosened cap on vial 13 was presumed to have allowed escape of some of the volatile compounds during heating.
  • Duplicate samples for vials 18-20 were prepared without the water, kept at ambient temperature for 5 or 7 days before the addition of water and then heated to 120°C for 60 min. These vials provided the same aroma results as vials 18-20 that had been prepared and heated immediately, then frozen for the week, showing that the mixtures can be stored stably for at least one week at room temperature.
  • the heating time was also a factor to consider. Vials 14-16 and 17-19 were designed to compare this variable with 45 or 60 min heating. The shorter heating time resulted in a noticeably lighter coloured mixture while the longer cooking time produced considerably browner colour. This darkening effect also appeared to be correlated with cysteine levels with more cysteine generally resulting in a darker reaction as long as adequate sugar was present.
  • Mortierella alpina is a filamentous and saprophytic fungus of the family Zygomycete which is commonly found to inhabit soils from temperate grasslands. Some strains of this species are used commercially to produce oils containing polyunsaturated fatty acids (PUFA), specifically the co6 fatty acids arachidonic acid (C20:4; ARA), linoleic acid (C18:2; LA) and y-linolenic acid (C18:3; GLA).
  • PUFA polyunsaturated fatty acids
  • ARA co6 fatty acids
  • linoleic acid C18:2; LA
  • y-linolenic acid C18:3; GLA
  • Mucor hiemalis is a zygosporic fungus of the Order Mucorales that is ubiquitous in nature and can be found, for example, in unspoiled foods.
  • the Biomes of Australian Soil Environments (BASE) project database is a database that contains integrated information about microbial diversity and function for microbial isolates from more than 1 ,400 soil samples taken from 902 locations across Australia. It includes associated metadata for all of the soil samples across extensive environmental gradients, including information from phylogenetic marker sequencing of bacterial 16S rRNA, archaeal 16S rRNA and eukaryotic 18S rRNA genes to characterise the diversity of microorganisms in community assemblages. Fungal diversity was informed by the 18S rRNA gene amplicon sequences.
  • ITS internal transcribed spacer
  • the BASE database was therefore interrogated to identify soil samples from the BASE archive that might contain fungal species in the Mortierella or Mucor genera.
  • the interrogation used a M. alpina strain ATCC 32222 internal transcribed spacer 1 (ITS; SEQ ID NO: 1) as a query. More than 12 soil samples were identified as candidates containing these strains from these genera.
  • One such soil sample designated 102.100.100/14183, was identified and retrieved from the archive for isolation of fungal strains.
  • two other soil samples designated Namadgi sample I and Namadgi sample II, were collected from an open grassland field from the temperate Namadgi region of the Australian Capital Territory, Australia.
  • mycelia from the edge of each colony were transferred through agar slices to fresh MEA plates and incubated at ambient temperatures for 4 days. Colonies that appeared pure through visual inspection were inoculated into 5 ml of malt extract broth and grown at ambient temperature in a static culture for 5 days. A total of 67 fungal strains were thereby isolated from the three soil samples.
  • Genomic DNA was isolated from each hyphal biomass using the YeaStar Genomic DNA kit (Zymo research, Catalog No. D2002).
  • An internal transcribed spacer (ITS) was amplified through PCR as described by Ho and Chen, (2008) using oligonucleotide primers xMaFl GGAAGTAAAAGTCGTAACAAGG (SEQ ID NO: 2) and xMaF2 TCCCCGCTTATTGATATGC (SEQ ID NO: 3).
  • the nucleotide sequence of the ITS from the amplicons from each isolate were determined by Sanger sequencing. The obtained sequences were compared to sequences within the NCBI repository using BLAST. The closest hits, with at least 95% nucleotide sequence identity for each isolate and often at 98% or 99% identity, were used to identify the species for each fungal isolate.
  • the ITS regions amplified with primers xMaFl and xMaF2 produced amplicons having a length of between 639 and 647 basepairs for the Mucor hiemalis strains, between 668 and 672 basepairs for the Mortierella alpina strains, between 628 and 652 basepairs for the Mortierella sp. isolates, and between 640 and 659 for the two Mortierella elongata strains. The length of this ITS amplicon was therefore useful in helping to distinguish between the four species. Table 13. Species identities of isolated soil fungi.
  • the Mortierella alpina strains yNI0133 to yNI0135 produced abundant ARA as well as GLA and DGLA.
  • the ARA level in both the TAG and polar lipids was about 30% by weight of the total fatty acid content in those fractions.
  • These M. alpina strains therefore did not exhibit any preference for accumulating the co6 PUFA in polar lipid relative to TAG.
  • the GLA and DGLA levels were about 2% and about 6%, respectively, in TAG, and about 4-7% and about 2-4%, respectively, in the polar lipid. Compared to the ARA levels, this indicated that the M.
  • alpina strains have efficient A6 elongase and A5 desaturase enzymes. Genes encoding such enzymes have been isolated from other strains of M. alpina (Huang et al., 1999; Knutzon et al., 1998). The Mortierella alpina strains also produced about 4-5% of C24:0 in the TAG fractions
  • the presumed Mortierella sp. strains yNI0126 to yNI0130 produced ARA and DGLA in addition to GLA and accumulated these co6 PUFA in both TAG and polar lipids.
  • the Mortierella sp. strains accumulated 2- to 4-fold more ARA in their polar lipid than in their TAG. It was concluded that these Mortierella sp. strains, like the Mucor strains, preferentially accumulated their co6 PUFA in the polar lipid relative to the TAG.
  • the two Mortierella elongata strains yNI0125 and yNI0131 were similar in many features to the Mortierella sp. strains, including that they produced ARA and DGLA in addition to GLA and accumulated these co6 PUFA in both TAG and polar lipids. They also showing a preference for accumulated more ARA in their polar lipid than in their TAG.
  • the Mortierella elongata strains could be distinguished from the Mortierella sp. in the levels of some of the other fatty acids, or the ratios between pairs of related fatty acids, i.e. reflecting the conversion rate of one fatty acid to another e.g. GLA to DGLA. Nevertheless, further phylogenetic analyses need to be done to establish the relationship of the Mortierella sp. strains to the Mortierella elongata strains.
  • the other SFA present in all strains were myristic acid (C14:0), pentadecanoic acid (C15:0), arachidic acid (C20:0), behenic acid (C22:0) and lignoceric acid (C24:0).
  • the monounsaturated fatty acids Cl 6: 1 A7, C17: 1, C18: 1A11 (vaccenic acid) and C22: 1 were present at low but detectable levels in all of the strains.
  • strains yNI0121 (Mucor hiemalis), yNI0125 (Mortierella elongata), yNI0127 (Mortierella sp.) and yNI0132 (Mortierella alpina) in order generate larger quantities of fungal biomass to evaluate mycelium disruption methods and to produce sufficient amounts of extracted lipid for food incorporation experimentation.
  • yNI0132 had also been isolated from the 102.100.100/14183 soil sample, identified as M. alpina on the basis of ITS homology and exhibited similar fatty acid profile in the polar lipid and TAG fractions as yNI0133, yNI0134 and yNI0135.
  • the fungal strains yNI0121, yNI0125, yNI0127 and yNI0132 were freshly propagated by agar slice growth, taking 0.5 x 0.5 cm agar pieces with fungal mycelium from the edge of colonies and placed them in the centre of a fresh MEA plate. The plates were kept at ambient temperature for 3 to 5 days until the new colonies were at least 3 cm in diameter. For each strain, intermediate cultures were then prepared by inoculating six 0.5 x 0.5 cm agar pieces containing mycelium into 10 ml malt extract medium and incubating these with shaking for 3 days at 26°C and then kept stationary for 2 days.
  • the complete cultures were then used to inoculate 50 ml of malt extract medium in 250 ml baffled flasks and incubated with shaking at 26°C for 3 days. These cultures were then used to inoculate 600 ml of medium containing (per litre) 60 g glucose, 10 g yeast extract, 5 g malt extract, 4 g KH2PO4, 3 g (NH4)2HPO4 and 0.6 g MgSO4 with the pH adjusted to 6.0 with 2 M NaOH. These larger cultures were incubated with shaking at 26°C, the cultures sampled after 2 days and the biomass harvested by centrifugation after 3 days, freeze dried and then frozen.
  • the seed cultures were used to inoculate 600 ml cultures in Medium 1 (per litre): 20 g glucose, 5 g yeast extract, 10 g peptone, incubated at 26°C with shaking at 200 rpm for aeration.
  • Parallel cultures of 800 ml were also grown at the same time in a second medium, Medium 2, containing 30 g glycerol, 0.85 g yeast extract, 8.7 g KH2PO4, 1.9 g (NH 4 ) 2 HPO 4 , pH 6.2, cultured at 26°C with shaking at 200 rpm for aeration. Growth was significantly faster in Medium 1, reaching about 14 g/1 dry weight at 70 h.
  • Total lipid was extracted from harvested wet fungal biomass (Table 15, Experiment 2) using hexane as solvent, as follows. Most of the water was removed by washing the cell biomass with ethanol, using 2 ml of ethanol per gram of cell biomass (wet weight) followed by centrifugation each time to recover the cell biomass. The pelleted cells were resuspended in hexane, using 5 ml hexane per gram of cell biomass. The suspensions were homogenised and the cells disrupted with the UltraTurrax (IKA, Malaysia) for 3 min followed by sonication for 5 min, which pair of treatments was repeated twice for a total of three times.
  • UltraTurrax IKA, Malaysia
  • the ethanol was evaporated from the combined supernatants in a rotary evaporator, programmed as follows: vacuum pump at 15 mbar, chiller at -16 °C, water bath at 37 °C and 400 rpm. From an initial input of 45.63 g of M. alpina dry biomass, 5.7 g of phospholipid enriched precipitate was recovered. The precipitate at this stage also contained some TAG. The phospholipid enriched precipitate was dissolved in 30 ml hexane and cooled in an ice bath at 0°C. Next, 120 ml of cold acetone (-20°C) was added into the stirred mixture to precipitate phospholipids.
  • the precipitate was washed 5 times with 30 ml portions of cold acetone (-20°C).
  • the residual solvent in the extracted and purified phospholipid preparation was removed in a rotary evaporator at room temperature for 10 h.
  • the polar lipid yield was measured gravimetrically and a small aliquot used for FAME analysis. Another aliquot was chromatographed on TLC to check for purity. From an initial input of 45.63 g of M. alpina dry biomass, 1.1 g of relatively pure phospholipid was recovered.
  • the inventors next produced whole cell biomass and lipid extracts from the biomass including PL containing co6 fatty acids such as ARA from the fungal isolates described in Example 6.
  • the fungal isolates were cultured at 35 L scale, the fungal mass harvested from the cultures and lipids extracted.
  • the lipids were fractionated to isolate the polar lipids, including the PL, and both whole cells and extracted lipids used in Maillard reactions and food preparations.
  • Mortierella alpina strain yNI0132 was grown in a Braun fermenter in a rich medium containing glucose as the main carbon source, seeking to produce more cell biomass and a suitable polar lipid:TAG ratio having co6 faty acid incorporated into polar lipids.
  • the growth medium was based on a rich yeast extract-malt extract medium which favoured biomass production rather than TAG production, even though M. alpina is an oleaginous species that naturally is capable of producing abundant TAG.
  • the medium used for the seed culture for inoculation and for the first phase of culture contained (per litre) 60 g glucose, 10 g yeast extract, 5 g malt extract, 3 g (NH ⁇ hSCU, 1 g KH2PO4, 0.6 g MgSCU-VILO, 0.06 g CaCL and 0.001 g of ZnSCU, pH 6.2.
  • the second stage of culturing used a feed solution of 5 L containing (per litre) 5 g malt extract, 7.5 g (NH ⁇ hSCU, 1 g KH2PO4, 6.0 g MgSC>4-7H2O, 0.3 g CaCL and 0.005 g of ZnSCL but no yeast extract.
  • the first phase culture medium was prepared and sterilised in the fermenter by autoclaving in situ at 121°C for 15 min, then cooled by direct cooling to the fermenter jacket.
  • the glucose stock solution (438 g glucose monohydrate plus 563 ml water) was autoclaved separately as a 40% solution and, while still warm at 45°C, was added to the fermenter.
  • An inoculum culture was prepared in 4 x 200 ml YM broth in 500 ml flasks using starter cultures from agar plates. The inoculum culture was incubated for 71.5 h at 30°C with shaking at 180 rpm, at which time the inoculum cultures showed luxuriant growth. The inoculum culture was introduced into the fermenter without homogenisation of the culture. In the first phase of culturing with the aim of maximising biomass production, a high aeration rate was maintained at about 0.6 to 1.0 vvm (18-30 1/min) and mixing was low at 50-150 rpm to maintain dissolved oxygen at greater than 1 ppm without excessive shear forces being applied to the culture.
  • the nutrient feed solution was added to the fermenter.
  • the pH was controlled at 6.0 throughout by addition of NaOH and the temperature was maintained at 30°C.
  • the culture was sampled (50 ml) every 24 h post inoculation.
  • the parameters that were measured daily were cell density (dry cell weight), glucose level by HPLC, total nitrogen level by the Kjeldahl method, phosphate and sulphate levels by colorimetric strips, and the appearance of the fungus by light microscopy.
  • Dry weight dry cell weight was measured by weighing the material collected on a glass microfibre obtained by filtering 20 ml of culture using a Buchner funnel and a vacuum pump before being dried in an oven and then weighed.
  • the culture was harvested at 94 h when the cell density had reached 19.5 g/1 (wet weight/w).
  • the biomass was harvested by filtration through a nylon gauze (200 micron).
  • the biomass was resuspended and washed twice, each time with two volumes of cold water relative to the volume of biomass.
  • the mycelial biomass was greywhite in colour.
  • Excess water was removed by squeezing the wet mycelial cake through the filter cloth by hand. This yielded 2.27 kg of washed biomass having a dry weight of approximately 590 g.
  • the biomass cake was spread to a 1 -2 cm layer in ziploc bags and frozen. Table 16.
  • Mortierella alpina strain yNI0132 was grown in a Braun fermenter in a rich medium containing glucose as the main carbon source, and harvested at 65 hrs.
  • the medium used for the seed culture for inoculation and for the first phase of culture contained (per litre) 65.6 g glucose, 10 g yeast extract, 5 g malt extract, 3 g (NH zSCL, 1 g KH2PO4, 0.6 g MgSCU- TILO. 0.06 g CaCL and 0.001 g of ZnSCU, pH 6.2, as well as Polyglycol P2000 at 1.0% as an antifoam.
  • the second stage of culturing used a feed solution of (per litre) 0.833 g malt extract, 1.25 g (NELOzSCL, 0.167 g KH2PO4, 1 g MgSO4-7H2O, 0.05 g CaCL and 0.0008 g of ZnSCU but no yeast extract.
  • the first phase culture medium was prepared and sterilised in the fermenter by autoclaving in situ at 122°C for 30 min, then cooled by direct cooling to the fermenter jacket.
  • the glucose stock solution was sterilised separately at 121 °C for 15 min and transferred to the fermenter after the broth and glucose had cooled to 45°C.
  • a IL inoculum culture was prepared in YM broth in 5L ml flasks using colonies from agar plates. The inoculum culture was incubated for 24 h at 28°C with shaking at 150 rpm. The fermenter was sterilised with batch medium (no glucose) and antifoam (at 1.0 % in the fermenter). Glucose was separately sterilised and added to the sterile batch medium by peristaltic pump, and the pH was adjusted to pH 6.0 and temperature to 30°C. The fermenter was inoculated with 1000 mL starter culture by peristaltic pump when the bottle showed luxurious growth of pumpable colonies (16-24 hours).
  • the fermenter was sampled at TO (after adding inoculum) and everyday (50 mL) and measured for cell density (oven dry weight (DW)), glucose by HPLC and phosphate and sulphate (strips).
  • DW was measured by weighing the dry pellet on glass microfibre obtained by filtering approximately 15 g of sample using a Buchner funnel and a vacuum pump before being dried in an oven and then weighed. Nutrient feed without glucose was transferred as bolus at 43.1 hours post inoculation.
  • the fermenter was harvested at 65.2 hours post inoculation, and the harvested culture was processed using a wine press (100 kPA, 10 minutes).
  • the biomass was resuspended in sterile water and reprocessed using the wine press at lOOkPA for 10 minutes.
  • the biomass cake was wrapped in aluminium foil in thin layers, and the paste wet weight in each wrap was recorded and the biomass yield per litre of culture calculated.
  • the wrapped biomass samples were placed in ziplock bags and frozen.
  • the frozen biomass was rehydrated in sterile water (1:4) and suspended using the Silversson high shear mixer.
  • the paste was then homogenised using APV homogeniser at 10 000 psi, 10 minutes until a free-flowing liquid was produced.
  • the homogenised sample was pasteurised at >76°C, with a pump rate of 20-30 rpm.
  • a portion of the pasteurised sample was packed in sterile containers and frozen, another of the sample was freeze dried.
  • the biomass pastes pre -homogenised, homogenised and pasteurised were sub sampled for microtests, with 100 pL of each sample/ treatment plated on YM plates and incubated at 25°C for 96 hours.
  • Example 8 Maillard reactions using fungal biomass and extracted lipid
  • the experiment also tested a combination of cells and the extracted lipid, all produced as described in Example 7. These reactions had L-cysteine, D-ribose, thiamine hydrochloride, iron fumarate and glutamic acid present in a phosphate buffer at pH 6.0, and either had added yeast extract or lacked the yeast extract.
  • the presence or absence of yeast extract was intended to test whether it would either mask, or enhance, the aroma produced by the M. alpina cells or extracted lipid having PL, or have little effect.
  • the base medium used for the Maillard reactions designated “Matrix A” lacking yeast extract and “Matrix B” including yeast extract, had the following composition in aqueous buffer at final concentrations: 10 mM L-cysteine, 10 mM D-(-)-ribose, 2 mM thiamine hydrochloride, 35 pg/ml of iron fumarate (Apohealth, NSW, Australia) and 2 mM L-glutamic acid monosodium salt hydrate.
  • Reactions #4 to #7 containing M. alpina biomass and/or extracted lipid were described by all five volunteers as having a meaty aroma, but with different aroma notes recorded by the volunteers, whilst the descriptions of the aromas from reactions having the S. cerevisiae biomass were more variable between the volunteers.
  • the control reaction mixtures lacking the lipid extract, and the mixtures having the lipid extract without any cell biomass, were generally perceived to have a lower intensity of aromas compared to the corresponding samples that contained biomass or a combination of biomass and extracted lipid from M. alpina.
  • Reaction mixtures containing biomass spiked with the extracted lipid from M. alpina were described as having similar or enhanced aromas compared to reactions containing only M. alpina biomass.
  • lipolytica cells incorporating ARA in its polar lipid were applied as wet cells at 200 mg per 2 ml reaction in 20 ml glass vials, tightly sealed. Control reactions had the same base media compositions but lacked the Y. lipolytica or M. alpina cells.
  • the reaction mixes were sonicated as a batch by placing all vials in a floating foam and placed in a sonicator (Soniclean, Thermoline) set up at a medium power for 30 min and then heat treated in an oven at 140°C for 60 min. The vials containing the reaction mixtures were cooled slowly over about 15 min until warm to the touch. The contents were sniffed in random order by nine volunteers who did not know the composition of each mixture. The reactions had been coded with random 3 -digit numbers to avoid bias, and the volunteers sniffed coffee beans between samples to reset the olefactory senses.
  • the aromas from mixtures having glutamic acid were generally described as more associated with meaty aromas compared to the reactions lacking glutamic acid.
  • a reaction mixture having glutamic acid was described as providing meaty aroma by 5 of the 9 participants whereas the corresponding sample lacking glutamic acid was described as having a meaty aroma by only 2 participants.
  • Addition of fenugreek leaf powder in the reactions was generally described as generating a pleasant, sweet herb or vegetable aroma, but addition of the herb powder also moderated the meaty aroma in the presence of the Y. lipolytica or M. alpina cells.
  • the M. alpina biomass as a dried powder was compared to several commercial plant -based and meat flavouring products on the market in Australia, including Deliciou plant-based beef, Deliciou plant-based chicken, Deliciou plant -based pork, Massel plant -based stock cube - beef, Massel plant-based stock cube - chicken, Oxo stock cube-beef, Oxo stock cube-chicken and Bonox beef stock.
  • Reaction mixtures were prepared in 2 ml volumes using 150 mg of dry product or 200 mg of product as a wet paste and heated at 140°C for about 60 min.
  • the samples containing the M. alpina cell biomass were described as comparable or superior in their meaty aroma to the commercially-available flavouring products.
  • reaction mixes were prepared and then dried down by placing the vials in an oven at 115°C for 2 h followed by 82°C for a further 2 h.
  • corresponding samples were dried overnight at 70°C.
  • all of the samples were reconstituted in 2 ml of water, mixing them well to dissolve the dried powder, and subjected to sniffing by volunteers.
  • the samples treated at the higher temperature generally provided a burnt smell, whereas the samples subjected to the lower temperature drying still provided some meaty aromas. This indicated that lower temperature drying was better than the higher temperature for retaining the meaty aroma. Further investigation is carried out to optimise the drying conditions.
  • compositions can be used with the yeast or fungal biomass containing co6 fatty acids to enhance meaty aromas when heated, including in the presence of other flavouring components as commonly used in food preparations.
  • Example 9 Further Maillard reactions using fungal biomass and extracted lipid
  • the inventors further tested the M. alpina cells and the extracted lipid obtained from the cells in further Maillard reactions under modified conditions. From the previous experiments, the samples containing M. alpina biomass were considered to have the strongest meat -like aroma, often described as having a roast meat/BBQ meat aroma. Several volunteers in the aroma tests, however, described that to them the aroma was like an overcooked or even burnt meat with a charred note. A “fatty aroma” was also noted by some. In another experiment, when the mixtures were tasted after heating, some volunteers described a sourness or bitterness in the samples including the matrix bases A and B, in particular bitterness for samples containing M. alpina.
  • an alternative base medium was used to compare it to the Matrix B base.
  • This alternative medium contained a mixture of amino acids, including cystine (33%), glutamine, alanine, leucine, glutamic acid, lysine, valine, proline and methionine as well as 2.7% dextrose by weight. This mixture was added at 7.5% (w/v) to the aqueous medium, as was an additional 0.5% (w/v) cystine and 0.5% (w/v) dextrose.
  • the samples for the Maillard reactions used either 150 mg of dry M. alpina biomass or 300 mg of wet slurry of S. cerevisiae cells. Control samples had only the amino acids and sugars and no cells added.
  • the alternate base medium was used at two concentrations: 7.5% (w/v) or 0.75% (w/v).
  • Another sample had an additional 100 mg dextrose added per 2 ml mixture.
  • Some samples contained 200 mg of extracted polar lipid, mostly PL, from M. alpina.
  • a shortened heat treatment of 45 min at 140°C was applied for samples containing M. alpina while the standard heat treatment of 75 min at 140°C was used for other samples.
  • the volunteers described that the mixtures having the higher concentration of base medium had a more distinguished meat-like and pleasant aroma compared to the samples prepared at the low concentration. Further, the higher concentration samples had a browny/golden brown colour after the heat treatment, whereas the lower concentration samples did not have that colour.
  • Example 10 Food products using fungal biomass and extracted lipid
  • the oils and plant-based fats used were canola oil, “Heart Smart” safflower cooking oil and copha vegetable shortening from a supermarket and a plant -based ghee (Emkai Lite Interesterified vegetable fat, Sai food products, Tamil, India).
  • the food items tested by applying the taste mixtures were a macro firm tofu obtained from a local supermarket, dried bean curd (tofu skin, Shenzhen Ming Lee Food Manufacturing Co. Ltd., Guandongzhou, China), a plant-based mince (V2 Foods, Australia) and textured vegetable protein high fibre slices (TVP, Lamyong, NSW, Australia).
  • the fungal biomasses used were a wet slurry of .S', cerevisiae having about 10% ARA (B013, see Example 4), or M. alpina biomass in either a wet or dry form (Example 7).
  • This experiment used the B013 yeast biomass, containing ARA in both the polar lipid and TAG (Example 4).
  • a mixture (mixture A) was prepared containing 2 ml of a Matrix B2 base medium.
  • Matrix B2 contained one tenth the concentration of thiamine hydrochloride compared to Matrix B but otherwise had an identical composition.
  • Mixtures were prepared having 0.5 ml of B013 cell slurry and 0.5 ml of a chicken flavoured yeast extract (2.5 g/3 ml water, Flavex). Control mixtures lacked either the B013 cell slurry or the Matrix B2 base medium.
  • Tofu pieces were marinated in the mixtures for 45 min and cooked on a baking tray in an oven set at 180°C for about 6 min.
  • all of the tofu pieces had a salty/sweet/umami taste but only the test pieces treated with mixture A exhibited a light roast chicken aroma and taste. It was considered that the umami taste was most likely brought by the flavoured yeast extract whereas the B013 yeast biomass contributed to the chicken aroma.
  • the yeast biomass was substituted with 200 mg of M. alpina wet biomass, having about 30% ARA in its lipid.
  • the composition of the mixtures and baking conditions were otherwise the same as in Experiment 2 except that the mixtures were heated for 45 min rather than 75 min prior to application to the tofu pieces. After heating them in the oven, the tofu pieces were sniffed and tasted.
  • the volunteers described that the control tofu marinated in Matrix B2 without the M. alpina biomass had a pleasant, light meaty aroma, whereas the tofu treated with the mixture having the M. alpina biomass had a strong meaty aroma and taste.
  • M. alpina biomass The effect of M. alpina biomass on aroma and taste in a Maillard reaction composition was investigated. 8 samples were prepared containing wet M. alpina biomass (approx. 75% moisture) and matrix base C. The samples included M. alpina biomass in weight percentages of from 0.1% to 15% (0.025% to 3.75% dry weight equivalent), as well as one control (no biomass, only matrix C). Sample compositions are shown in Table 21 below, and the composition of matrix C is shown in Table 22 below.
  • vials were prepared comprising M. alpina wet biomass (in noncontrol samples, concentrations varying from 0.10% - 10% biomass/TVP w/w%), matrix C (as described above in Table 20) and, in one sample, water instead of matrix C.
  • the vials were vortexed at 20000 rpm for 2 minutes before being subjected to a heat treatment at 140°C for 45 minutes.
  • the composition of the vials is shown below in Table 23. Table 23. Composition of samples
  • 450 g of rehydrated TVP was prepared by adding 320 g of water to 130 g of TVP and leaving to rehydrate for 30 minutes. The rehydrated TVP was then divided into 9 portions, and each portion added to one of the vials of Table 21 and mixed and marinated thoroughly for approximately 5 minutes. Each portion of the marinated TVP was then cooked on a frying pan at a medium heat setting (1000 W) with 3 mF of canola oil for 2 minutes.
  • Matrix C as defined in Example 11 was mixed at different levels of dilution with the same concentration of wet M. alpina biomass (10% w/v).
  • the six samples prepared are provided in Table 24 below.
  • the associated compositions of matrix C in each of the samples is provided in Table 25 below. a) Table 24. Composition of samples
  • a total of six participants were asked to sniff the M. alpina sample first and use it as the reference for testing other samples (at any order preferred by the participants). Between samples, the participants were requested to sniff the coffee to neutralize/clear the nose. The participants were requested to evaluate the aroma for the meatiness and pleasantness based on a five -point hedonic scale, with the higher score indicating the increased meatiness and pleasantness.
  • Additional Mortierella spp. isolates were isolated and tested in Maillard reactions essentially as described above, and compared to NI0132 (M. alpind) and matrix only control. These isolates included Sl-3, identified as M. elongata based on ITS homology; S2-2, identified as M. minutissima based on ITS homology; S2-3, identified as M. minutissima or M. zonata based on ITS homology; S’2- 3, identified as M. minutissima based on ITS homology; Myu3, identified as M. elongata based on ITS homology; Burnsenl, identified as M. elongata based on ITS homology; and Burnsen2, also identified as M. elongata based on ITS homology. Analysis of the TFA in the lipids from the isolates is shown in Table 28.
  • Table 29 shows the results of the blinded sensory assessment of the Maillard reactions, where the total score from six participants is shown. All of the Mortierella strains imparted increased meatiness aroma to the reactions, compared to the matrix only control. Table 29. Sensory assessment of Maillard reaction
  • a set of 4 samples were prepared according to Table 30, using ARA oil from NuCheck Inc. (Cat# NC0632549).
  • Sample C contained equivalent ARA to that in the biomass, while sample D contained 10% ARA oil.
  • the samples were then vigorously mixed for 2 min at room temp and subjected to heating at 140 °C for 45 min. After the heat treatment was completed, the samples were cooled down and tempered at 45 °C throughout the sensory evaluation.
  • a total of five participants (both male and female, aging from 25-65) were asked to sniff the samples in order of A to D. Between samples, the participants were requested to sniff the coffee to neutralize/clear the nose. The participants were requested to evaluate the aroma for the meatiness and pleasantness based on a five -point hedonic scale, with the higher score indicating the increased meatiness and pleasantness.
  • M. isabellina was cultured and an amount of approximately 200 mg of M. isabellina wet biomass was transferred into a 15 mL Falcon tube and then dried in the oven set at 80 °C. The samples were dried until the weight remained unchanged or up to 42 hours. Moisture content was then determined and fatty acid content in the total lipid fraction assessed.
  • M. alpina biomass prepared as previously described was also utilised in the study.
  • a set of 8 vial samples were prepared according to Table 33.
  • a biomass equivalent to 50 mg (or less, as detailed in the table) dry matter based on an estimated moisture content was weighed and transferred into the vial.
  • An amount of 2 mL matrix C was then added into each vial.
  • a negative control with matrix C only and no biomass was also included.
  • the samples were then vortex at 2000 rpm to mix for 2 min at room temperature and subjected to heating at 140 °C for 45 min. After the heat treatment was completed, the samples were cooled down and tempered at 45 °C throughout the sensory evaluation.
  • a preference testing method using 5 -point hedonic scales and a scaling test with labelled magnitude scales were used in this evaluation.
  • a total of six participants (both male and female, aging from 25-65) were asked to sniff the samples in order of #8, then #1 to #7 and use #1 as the reference. Between samples, the participants were requested to sniff the coffee to neutralize/clear the smelling sense and avoid the carry-over effect from the previous sample.
  • the participants were requested to evaluate the aroma for the meatiness and pleasantness based on a five -point hedonic scale, with the higher score indicating the increased meatiness and pleasantness.
  • M. isabellina was associated with lower meatiness and pleasantness scores compared to M. alpina, suggesting that arachidonic acid was important for generating meaty aromas.
  • the positive control M. alpina “B17” biomass
  • the 39 mg M. isabellina sample was scored lower in pleasantness and the meatiness level lower by an average of 1.1 on a scale from 1 to 5. While that the dry mass equivalent weight for this sample was lower than the 50mg used for M. alpina, notably as the concentration of M. isabellina increased, an associated slight decrease in the meatiness aromas was observed. It could therefore be assumed that a 50mg sample of M. isabellina would have an even lower meatiness aroma.
  • Example 16 Further assessment of Maillard reaction components
  • MC positive control/reference sample
  • M. alpina biomass M. alpina strain yNI0132, B017 culture as described above [“B17_wet”]
  • cystine of differing concentration ranging from 0 to 200 mM
  • each marinated TVP sample was cooked on an oiled frying pan (3 ml of safflower oil) at 1000 W for 2 minutes, stirring occasionally. Between each sample, the frying pan was cleaned and dried. All cooked samples were stored in individual closed containers and kept at 60 °C for no longer than 1 hour until tasting.
  • each marinated TVP sample was cooked on an oiled frying pan (3 ml of safflower oil) at 1000 W for 2 minutes, stirring occasionally. Between each sample, the frying pan was cleaned and dried. All cooked samples were stored in individual closed containers and kept at 60 °C for no longer than 1 hour until tasting.
  • Cysteine, Ribose Cysteine, Dextrose
  • Cystine, Ribose Cystine, Dextrose
  • each marinated TVP sample was cooked on an oiled frying pan (3 ml of safflower oil) at 1000 W for 2 minutes, stirring occasionally. Between each sample, the frying pan was cleaned and dried. All cooked samples were stored in individual closed containers and kept at 60 °C for no longer than 1 hour until tasting.
  • Results are shown in Figure 16. While all combination of amino acid and sugar produced meaty aromas and flavours when combined with the M. alpina biomass, the combination of cysteine and dextrose was the most preferred combination and had the highest meatiness score. This sample was noted with dark chicken meat such as chicken thigh, strong umami notes and slight aftertaste without any strong bitter tastes.
  • each marinated TVP sample was cooked on an oiled frying pan (3 ml of safflower oil) at 1000 W for 2 minutes, stirring occasionally. Between each sample, the frying pan was cleaned and dried. All cooked samples were stored in individual closed containers and kept at 60 °C for no longer than 1 hour until tasting.
  • a triangle test was utilised in this sensory evaluation. There are six permutations/variations in a triangle test: AAB, ABA, BAA, BBA, BAB, ABB.
  • Sample A contained 25 mM of Monosodium Glutamate and Sample B contained 10 m of Glutamic Acid.
  • Each participant was provided with two sets of samples and each set contained three samples. Among the three samples, two of them were the same and the third one was different.
  • Yeast Extract when absent: The sample contained a light chicken aroma with more intense vegetable aroma. It was also noted to have similar aroma notes to the positive control (OM) but without the depth/intensity.
  • Cysteine when absent: When compared to the positive control (OM), this sample had a sweet aroma but lack of meaty notes. The dextrose in the sample would likely be the main contributor to the sweet aroma and the caramelisation during heating. The sample also had a bitter aftertaste with key taste notes such as mushroom and metallic.
  • Glutamic Acid when absent: The meaty aroma was present but at a much lower intensity when compared to the positive control (OM), with traceable sulphur notes. The sample had a savoury taste note with a bitter aftertaste, with taste profile reminiscent of chicken.
  • Dextrose when absent: Bland in aroma without the umami and meaty note, and a stronger salty aroma note. Compared to the OM sample, this sample had a weaker umami taste but still had a sweet aftertaste. The sweet aftertaste was different from the thiamine -removed sample which contained 200mM of dextrose.
  • the extraction was repeated a further 3 times (total 4 washes) by adding a further 500 mL ethanol to the filtered biomass and repeating the steps.
  • the washed and filtered biomass was transferred to a wash glass and the ethanol dried off.
  • the resulting biomass was the ‘defatted biomass’ fraction.
  • the ethanol washes were pooled and 200 mL the solvent evaporated under vacuum on a Buchi Rotor Evaporator. Sufficient water was then added such that the water part of the aqueous phase was -40% of the phase. This was then washed with hexane by adding 0.2 v/v of hexane to the hydroalcoholic phase, before being shaken on a platform vortex for 10 min and centrifuged (2000g, 10 min) to separate the phases. The lower (aqueous) phase and upper (hexane, lipid containing) phase were collected. The aqueous phase was washed a further 3 times with hexane, with the hexane phases pooled. The pooled hexane phases were dried on a Buchi rotor evaporator to produce the ‘total lipid’ fraction.
  • TAG neutral lipid fraction
  • polar lipid (PL) fraction To produce the polar lipid (PL) fraction, total lipid fraction was weighed and resuspended in 30 volumes acetone (w/v) before being vortexed for 30 sec) and sonicated for 30 secs repeatedly until visibly resuspended. The sample was then precipitated at 4°C for 30 min and then centrifuged at 3900g for 10 min at 4 °C. The supernatant was removed and the precipitate washed twice more with another 30 x volumes ice cold acetone. The precipitate was dried under nitrogen gas until it reached a constant weight, thereby producing the ‘PL’ fraction.
  • Table 42 The components of the fractionation samples, adding each fraction proportionally to its content in 50mg DCW of the M. alpina biomass.
  • Benzeneacetaldehyde and Nonanol were not present in SI, S4 or S8 (‘Matrix OM + TAG’) but were present in all other samples.
  • Benzeneacetaldehyde has been identified in beef (Specht et al. J Ag Food Chem 1994;42(10):2246-53) and as a desirable aroma for meatiness (Zhang et al. Food Sci Tech. 2017;82:184-91).
  • Nonanol is one of the major volatiles in lamb (Luo et al. Food Sci Nutrition. 2019 (7):2796-805) and it has been suggested that is produced via lipid (oleic acid) oxidation.
  • TAG fractions are contributing to off-notes there are volatiles that are detected in greater abundance in S6 (‘Matrix OM + biomass minus PL’) and S8 when compared to the whole biomass or sample not containing TAG, such as Tetradecane (waxy), Naphthalene (Mothball) and 2,2,4-trimethyl-l,3-pentanediol diisobutyrate (plasticiser).
  • S6 ‘Matrix OM + biomass minus PL’
  • S8 when compared to the whole biomass or sample not containing TAG, such as Tetradecane (waxy), Naphthalene (Mothball) and 2,2,4-trimethyl-l,3-pentanediol diisobutyrate (plasticiser).
  • the non-lipid components of the biomass also appear to play an important role in the aroma profile, likely interacting with the lipids to modulate their effect on the aroma. This is seen in the PCA plot where S7 and S8 are positioned away from the biomass containing samples S2-6 which are clustered closer together. Additionally, there are volatiles that are detected in S8 or S7 in much higher abundance than in other samples. Examples of these for S7 are Dodecanal; 2-Undecanone; 2-Methyl- 1 -undecanol; 1 -Hexadecanol 2,4-dimethyl-benzaldehyde; and 2 -Ethyl- 1 -hexanol.
  • S8 examples of these for S8 are l-(lH-pyrrol-2-yl)-ethanone; 2 -butyl- 1 -octanol; Hexadecane; l-Octen-3-ol; 1-Pentanol and 1 -Heptanol, many of which have been identified as mushroom and/or off -notes (2, 6, 7, 9) which aligns with the sensory data.
  • Table 43 List of aroma volatile compounds identified and their aroma description.
  • Matrix OM (5 mL) was mixed with either the Mortierella biomass (BM) or fraction thereof according to Table 44 in 20 ml GC headspace vials. The samples were vigorously mixed (2000 rpm) for 2 minutes at room temp (22-24 °C) and subjected to heating at 140 °C for 45 min. Table 44
  • the sample with the most pleasant and meaty aroma was the wet M. alpina biomass, with the PL containing samples also demonstrating some meatiness: the ‘biomass minus TAG’ sample showed a meaty note that was not as complex and had less intensity of the wet biomass; and the ‘PL’ sample was also identified as having some meatiness, but at approximately with even less intensity than the wet biomass.
  • the TAG-containing fraction sample were not identified as meaty: the ‘biomass minus PL’ was described as floral and pleasant, while the ‘TAG’ alone sample was unpleasant with descriptors of “rancid” and “chemical”. This suggested that the TAG fraction was contributing off- notes that could be mitigated by other fractions in the biomass (as in the biomass or biomass minus PL samples).
  • the ‘defatted biomass’ sample was pleasant but lacked the meaty notes of the wet biomass.
  • Maillard composition concentrates were prepared with 5 mL matrix OM and 500 mg wet M. alpina biomass. This concentrate was then added to 50 g rehydrated TVP, which was allowed to marinate before being pan fried with 3 mL safflower oil for 2 min (heat setting at 1000 w). A blinded sensory assessment of the samples was then performed, with the participants evaluating aroma, taste and mouthfeel.
  • Example 20 Amino acid profiles of samples before and after Maillard heat treatment
  • Biomass of M. alpina ATCC32223, M. alpina SI 1-2 (identified as M. alpina by ITS homology), and M. zonata SS3 (S’2-3; also identified as M. minutissima by ITS homology) was mixed with Matrix OM (equivalent to 50 mg dry biomass in 2mL Matrix OM) in a 20 ml GC headspace vial as shown. The samples were then vigorously mixed (2000 rpm) for 2 minutes at room temp (22-24 °C) and subjected to heating at 140 °C for 45 minutes.
  • the aroma attributes evaluated in this experiment was overall meatiness, roastiness, animalic, rancid and sulphury.
  • the intensity for each attribute for the reference was given “5”, with a higher score indicating increased intensity compared to the reference and a lower score indicating decreased intensity compared to the reference.
  • the control Maillard matrix (OM) had the lower acceptance score, lower overall meatiness, roastiness and animalic (farmlike) note but a higher sulfury notes compared to other samples containing the biomass, re-confirming the importance of biomass in the meaty aroma formation. In general, the differences in aroma characteristics of tested biomasses were minimal.
  • Sample ATCC32223 had the lowest acceptance score, with the lowest scores in meatiness, sulfury and animalic notes when compared to other biomasses.
  • Biomass from SS3 had the highest overall meatiness and roastiness scores, the lowest rancid (off-animal fat) notes compared to ATCC32223 and SI 1-2. SI 1-2 had the lowest roastiness notes and the highest animalic, rancid and sulfury notes.
  • a total of six participants (both male and female, aging from 25-65) analysed the TVP food samples by sniffing and tasting. The participants were requested to evaluate both aroma and taste for the meatiness and pleasantness based on a five -point hedonic scale, with the higher score indicating increased meatiness and pleasantness.
  • the low-ARA strain M. isabellina
  • M. alpina NI0132 The low-ARA strain, M. isabellina, has been shown to produce y-hexalactone following feeding with hexanoic acid (EP 1038971).
  • a study was performed to induce production of y-hexalactone in M. alpina NI0132.
  • the strain was inoculated on YPD plates (Sigma: Yeast extract lOg/L, peptone 20g/L, dextrose 20g/L, agar 15g/L) and incubated at 28°C for 3-5 days.
  • a 1 cm 2 mycelium slice from the plate was inoculated into a 500ml flask containing 100ml of seed medium and cultivated at 280 °C at 150 rpm for 72 hours. During the cultivation, samples were taken at 24, 48 and 72 hours, and the cell density was measured and culture purity was checked by plating out on LB (Yeast extract 5g/L; Tryptone lOg/L; NaCl lOg/L; agar 15g/L) plates and microscope observation.
  • LB Yeast extract 5g/L; Tryptone lOg/L; NaCl lOg/L; agar 15g/L
  • 4-hydroxy fatty acids are circularised to form y-lactones, a spontaneous process that can be driven by low pH or heat.
  • M.alpina biomass containing the 4-hydroxylated acid intermediate could therefore be able to generate y-lactones during the cooking process.
  • Hydroxylated fatty acids such as ricinoleic acid (e.g. as present in castor oil), or short chain fatty acids such as hexanoic acid, fed to M. alpina during fermentation could biotransform to the 4-hydroxylated fatty acid intermediate (e.g. 4- hydroxydecanoic acid or 4-hydroxyhexanoic acid), thus providing the biomass for the generation of y- lactones such as y-decalactone or y-hexalactone during cooking.
  • M. alpina was prepared in 250 mL flasks with 50 mL liquid fermentation medium (10 g/L yeast extract, 60 g/L glucose, 5 g/L malt extract, 3 g/L (NH 4 ) 2 SO 4 , 1 g/L KH 2 PO 4 , 0.6 g/L MgSO 4 , 0.06 g/L CaCl 2 , 0.001 g/L ZnSO 4 , pH 6.2) and incubated for 2 days at 30°C, 180 rpm.
  • liquid fermentation medium 10 g/L yeast extract, 60 g/L glucose, 5 g/L malt extract, 3 g/L (NH 4 ) 2 SO 4 , 1 g/L KH 2 PO 4 , 0.6 g/L MgSO 4 , 0.06 g/L CaCl 2 , 0.001 g/L ZnSO 4 , pH 6.2
  • the inoculum was homogenised (20,000 rpm) and added at a concentration of 10% to 100 mL fermentation medium in 500 mL flasks, in duplicates) before being incubated at 30°C, 180 rpm.
  • castor oil (1 g/L) or methyl ricinoleate (1 g/L dissolved in Tween 80, 0.3 g/L) were added to the flasks. These chemicals were filter sterilised before addition to the flasks.
  • the harvesting of biomass was conducted at various time intervals (3h, 6h, 8h, and 24h) after the addition of castor oil or methyl ricinoleate by centrifugation (3500 rpm, 10 min).
  • the biomass pellet was snap frozen in liquid nitrogen and stored at -80°C freezer.
  • Biomass is thawed and extracted using Chloroform:Methanol:Water (1:3:1 or 8:4:3 ratio). Extracts are then cleaned using aminopropyl SPE cartridges to remove TAG and PL. The fatty acid fraction is collected for analysis. The dried fatty acid fraction is derivatised with BSTFA at 45 °C for 30 min and analysed on GCMS on full scan mode. Lactone intermediates (e.g. 4-hydroxy fatty acids) are identified by comparing the mass spectra to NISTMS database. Peak areas of intermediates are normalised to internal standard and quantitated against a calibration curve. Sensory analysis of biomass containing 4-hydroxylated fatty acids is then performed as essentially described above.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Food Science & Technology (AREA)
  • Nutrition Science (AREA)
  • Polymers & Plastics (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Virology (AREA)
  • Biomedical Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Non-Alcoholic Beverages (AREA)

Abstract

La présente invention concerne des compositions comprenant une biomasse microbienne, une ou plusieurs lactones et/ou un ou plusieurs acides gras 4-hydroxy, ainsi que des produits de type aliment, des produits de type boisson ou des aliments pour animaux comprenant une biomasse microbienne, une ou plusieurs lactones et/ou un ou plusieurs acides gras 4-hydroxy. Les utilisations desdites compositions et des produits de type aliment, des produits de type boisson ou des aliments pour animaux pour produire des arômes et/ou des saveurs de type aliment lorsqu'elles sont chauffées, en particulier pour subir des réactions de Maillard sont également décrites dans la présente description. L'invention concerne également des procédés de production d'arômes et/ou de saveurs de type aliment.
PCT/AU2023/050407 2022-09-07 2023-05-12 Compositions et procédés de production d'arômes de type viande WO2024050589A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
AU2022902577A AU2022902577A0 (en) 2022-09-07 Compositions and methods for producing meat-like aromas
AU2022902577 2022-09-07
AU2022902593A AU2022902593A0 (en) 2022-09-08 Compositions and methods for producing meat-like aromas
AU2022902593 2022-09-08

Publications (1)

Publication Number Publication Date
WO2024050589A1 true WO2024050589A1 (fr) 2024-03-14

Family

ID=90192594

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2023/050407 WO2024050589A1 (fr) 2022-09-07 2023-05-12 Compositions et procédés de production d'arômes de type viande

Country Status (1)

Country Link
WO (1) WO2024050589A1 (fr)

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000021524A1 (fr) * 1998-10-15 2000-04-20 Dsm N.V. Complements a base de pufa
RU2182429C2 (ru) * 2000-07-26 2002-05-20 Кубанский государственный технологический университет Способ производства мясорастительных консервов
US20050042349A1 (en) * 2001-12-19 2005-02-24 Kortes Jan Gerrit Compositions with a ckicken flavour, use and production thereof
EP1038971B1 (fr) * 1999-03-25 2005-06-15 INTERNATIONAL FLAVORS & FRAGRANCES INC. Procédé pour la préparation de gamma Hexalactones, produits ainsi obtenus et leurs applications organoleptiques
US7045160B1 (en) * 1998-09-15 2006-05-16 Dsm N.V. Mucorales fungi for use in preparation of foodstuffs
WO2006124598A2 (fr) * 2005-05-12 2006-11-23 Martek Biosciences Corporation Hydrolysat de biomasse, ses utilisations, et sa production
US20080095897A1 (en) * 2006-08-01 2008-04-24 Martek Biosciences Corporation Processed Meat Products and Methods of Making
US10172380B2 (en) * 2014-03-31 2019-01-08 Impossible Foods Inc. Ground meat replicas

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7045160B1 (en) * 1998-09-15 2006-05-16 Dsm N.V. Mucorales fungi for use in preparation of foodstuffs
WO2000021524A1 (fr) * 1998-10-15 2000-04-20 Dsm N.V. Complements a base de pufa
EP1038971B1 (fr) * 1999-03-25 2005-06-15 INTERNATIONAL FLAVORS & FRAGRANCES INC. Procédé pour la préparation de gamma Hexalactones, produits ainsi obtenus et leurs applications organoleptiques
RU2182429C2 (ru) * 2000-07-26 2002-05-20 Кубанский государственный технологический университет Способ производства мясорастительных консервов
US20050042349A1 (en) * 2001-12-19 2005-02-24 Kortes Jan Gerrit Compositions with a ckicken flavour, use and production thereof
WO2006124598A2 (fr) * 2005-05-12 2006-11-23 Martek Biosciences Corporation Hydrolysat de biomasse, ses utilisations, et sa production
US20080095897A1 (en) * 2006-08-01 2008-04-24 Martek Biosciences Corporation Processed Meat Products and Methods of Making
US10172380B2 (en) * 2014-03-31 2019-01-08 Impossible Foods Inc. Ground meat replicas

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
"Biotechnology of Aroma Compounds", vol. 55, 1 January 1997, SPRINGER BERLIN HEIDELBERG, Berlin, Heidelberg, ISBN: 978-3-540-68602-6, ISSN: 0724-6145, article GATFIELD IAN L.: "Biotechnological production of flavour-active lactones", pages: 221 - 238, XP009553266, DOI: 10.1007/BFb0102067 *
WASSERMAN, A. E.: "Thermally produced flavor components in the aroma of meat and poultry", JOURNAL OF AGRICULTURAL AND FOOD CHEMISTRY, vol. 20, no. 4, 1972, pages 737 - 741, XP001350232 *

Similar Documents

Publication Publication Date Title
CA2261231C (fr) Procede exploitant ulkenia sp. pour preparer de l'acide docosahexanoique et de l'acide docosapentanoique
JP4127860B2 (ja) 高度不飽和脂肪酸及びこれを含有する脂質の製造方法
JP5371749B2 (ja) 新規なリゾホスファチジン酸アシル基転移酵素遺伝子
Gottardi et al. Recovery and valorization of agri-food wastes and by-products using the non-conventional yeast Yarrowia lipolytica
CA3210860A1 (fr) Production de phospholipides dans des microbes et leurs utilisations
WO2009077054A1 (fr) Procédé de culture de microorganismes de l'ordre des thraustochytriales
WO2023064988A1 (fr) Compositions et procédés de production d'arômes
Fan et al. Utilization of food processing waste by Thraustochytrids
WO2020132285A1 (fr) Utilisation humaine et non humaine d'huile anaplérotique microbienne
US11272718B2 (en) Flavor oil-and-fat
WO2024050589A1 (fr) Compositions et procédés de production d'arômes de type viande
WO2024050590A1 (fr) Compositions et procédés de production d'arômes de type viande
WO2024050588A1 (fr) Compositions et procédés de production d'arômes
AU2022368452A1 (en) Compositions and methods for producing aromas
WO2024050591A1 (fr) Compositions et procédés de production de produits alimentaires avec des arômes de type viande
CA3221448A1 (fr) Production de graisses saturees dans des microbes
Ye et al. Effect of lipase and lipoxygenase on lipid metabolism and the formation of main volatile flavour compounds in fermented fish products: a review
Elhalis et al. The potentials and challenges of using fermentation to improve the sensory quality of plant-based meat analogs
JP5725598B2 (ja) 抗酸化性組成物の製造方法
Zhao et al. Research advancements in the maintenance mechanism of Sporidiobolus pararoseus enhancing the quality of soy sauce during fermentation
EP4170040A1 (fr) Utilisation circulaire de résidus d'aliments par fermentation microbienne
JP7262536B2 (ja) 脂質組成物、その用途及びその製造方法
Liu et al. Identification and validation of core microbes for the formation of the characteristic flavor of fermented oysters (Crassostrea gigas)
WO2023194619A1 (fr) Produit alimentaire comestible ayant une texture de type viande à basse et haute température et son procédé de production
Vahvaselkä et al. Esterification of conjugated linoleic acid by yeasts for increasing the value of plant materials

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23861716

Country of ref document: EP

Kind code of ref document: A1