WO2024050349A2 - Stratégies pour knock-ins au niveau de sites safe harbor b2m - Google Patents

Stratégies pour knock-ins au niveau de sites safe harbor b2m Download PDF

Info

Publication number
WO2024050349A2
WO2024050349A2 PCT/US2023/073068 US2023073068W WO2024050349A2 WO 2024050349 A2 WO2024050349 A2 WO 2024050349A2 US 2023073068 W US2023073068 W US 2023073068W WO 2024050349 A2 WO2024050349 A2 WO 2024050349A2
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
cell
disease
protein
composition
Prior art date
Application number
PCT/US2023/073068
Other languages
English (en)
Inventor
Rafi EMMANUEL
Michal GOLAN MASHIACH
Original Assignee
Emendobio Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Emendobio Inc. filed Critical Emendobio Inc.
Publication of WO2024050349A2 publication Critical patent/WO2024050349A2/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Definitions

  • Beta-2 microglobulin (B2M) safe harbor site may be targeted to introduce a desired sequence to the site without causing deleterious disruptions to the B2M gene or affecting its expression. Such targeting strategies may be utilized to enable B2M promoter mediated expression of the introduced sequence.
  • the present disclosure also provides a method for modifying in a cell at least one allele of the Beta-2 microglobulin (B2M) gene, the method comprising introducing to the cell a composition comprising: at least one CRISPR nuclease, or a polynucleotide molecule encoding the CRISPR nuclease; and an RNA molecule comprising a guide sequence portion having 17-50 nucleotides or a nucleotide sequence encoding the same, wherein a complex of the CRISPR nuclease and the RNA molecule affects a double strand break in at least one allele of the B2M gene.
  • B2M Beta-2 microglobulin
  • the composition also comprises a donor molecule, wherein a sequence of nucleotides from the donor molecule is inserted or copied at or near the double strand break site.
  • the composition further comprises a donor molecule containing a sequence of nucleotides that is introduced at the double strand break site such that the expression of the introduced sequence is mediated by the promoter of the B2M gene.
  • strategies to enable the expression of a gene, or portion thereof, under control of the B2M promoter is enabled without knocking-out B2M gene expression.
  • a first RNA molecule comprising a guide sequence portion having 17-50 contiguous nucleotides containing nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-28998.
  • the composition further comprises a CRISPR nuclease.
  • the composition further comprises a donor molecule.
  • a cell modified to express and secrete a protein of interest within a desired body tissue Such a cell can be modified by insertion of a sequence of a gene of interest under the control of a promoter of a selected gene which contains a safe harbor site (e.g., B2M).
  • Non-limiting examples of methods for modifying a cell to express a gene of interest include knock-in by utilizing a CRISPR nuclease system that generates a double-strand break and a donor molecule which encodes a sequence of the gene of interest.
  • the donor molecule is a ssODN, dsDNA, plasmid, AAV, lentivirus, or transposon.
  • knock-in can be mediated by a composition comprising i) a fusion protein comprising a nickase and a reverse transcriptase and ii) a RNA donor molecule.
  • the cell is a stem cell. In some embodiments, the cell is a monocyte. In some embodiments, the cell is a macrophage. In some embodiments, the cell is an iPS-derived monocyte or macrophage. In some embodiments, the cell is a hematopoietic stem cell (HSC), a hematopoietic stem and progenitor cell (HSPC), a myeloid precursor cell, a myeloblast, a lymphoblast, an erythroid precursor cell, a platelet cell, a natural killer (NK) cell, a B-lymphocyte, a T-lymphocyte, an eosinophil, a neutrophil, or a basophil.
  • HSC hematopoietic stem cell
  • HSPC hematopoietic stem and progenitor cell
  • a myeloid precursor cell a myeloblast, a lymphoblast, an erythroid precursor cell
  • platelet cell a natural killer (NK) cell
  • the cell is an iPS-derived cell.
  • the delivering of any one of the compositions described herein to the cell is performed in vitro, ex vivo, or in vivo.
  • the method is performed ex vivo and the cell is provided/explanted from an individual patient.
  • the method further comprises the step of introducing the resulting cell, with a modified or edited B2M allele, into the individual patient (e.g. autologous transplantation).
  • compositions comprising an RNA molecule comprising a guide sequence portion having 17-50 contiguous nucleotides containing nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-28998 and a CRISPR nuclease for modifying or editing a B2M allele in a cell, comprising delivering to the cell the composition comprising an RNA molecule comprising a guide sequence portion having 17-50 contiguous nucleotides containing nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-28998 and a CRISPR nuclease.
  • the composition further comprises a donor molecule.
  • a medicament comprising an RNA molecule comprising a guide sequence portion having 17-50 contiguous nucleotides containing nucleotides in the sequence set forth in any one of SEQ ID NOs: 1- 28998 and a CRISPR nuclease for use in modifying or editing a B2M allele in a cell
  • the medicament is administered by delivering to the cell the composition comprising an RNA molecule comprising a guide sequence portion having 17-50 contiguous nucleotides containing nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-28998 and a CRISPR nuclease.
  • the medicament further comprises a donor molecule.
  • kits for modifying or editing B2M allele in a cell comprising an RNA molecule comprising a guide sequence portion having 17-50 contiguous nucleotides containing nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-28998, a CRISPR nuclease, and/or a tracrRNA molecule; and instructions for delivering the RNA molecule; CRISPR nuclease, and/or the tracrRNA to the cell.
  • the kit further comprises a donor molecule.
  • Fig.1A Screening guides for optimal editing activity in Intron 1 of B2M in HeLa cells using OMNI-50 nuclease. Cells were harvested 72 hours post- DNA transfection, genomic DNA was extracted, and the region of the mutation was analyzed by next generation sequencing (NGS).
  • Fig 1B Examination of editing activity of selected guides in HSCs using OMNI-50 or OMNI-50 V6172 CRISPR nucleases identifies optimal composition for editing in Intron 1 of B2M.
  • Fig.2 Insertion of GFP by HDR into a B2M endogenous locus for generating a bicistronic transcript. Pre-editing shows the native form of a B2M locus encodes for B2M protein including its signal peptide (SP) in its N-terminus. The SP portion of B2M is encoded by Exon 1.
  • FIG. 3A-3D Integration of GFP into a B2M locus in HSCs enables GFP expression and secretion without altering B2M expression.
  • Fig. 3A FACS analysis of HSCs treated with donor virus (GFP-2A) and RNP results in GFP-expressing cells.
  • FIG. 3B Examination of total B2M transcript levels normalized to GAPDH reveals no change in B2M transcript levels following HDR integration. Data shown is two biological repeats and three technical repeats (nested analysis).
  • Fig. 3C Examination of B2M protein expression using FACS confirms most edited cells retain B2M protein expression. B2M expression in GFP+, edited cells following HDR (top), compared to all live cells in the untreated and ISO-staining control groups. Dashed line represents expression cut-off as determined by the ISO-staining control. Fig.
  • FIG. 3D GFP secretion assayed by ELISA detects GFP (GFP concentration (pg/ml) normalized to 10 6 cells) in HSC media following HDR into a B2M locus. Data shown is two biological repeats and two technical repeats (nested analysis). Graphs show mean ⁇ SD.
  • Figs. 4A-4C Integration of GFP into a B2M locus in HSCs, followed by differentiation into macrophages, enables the generation of GFP-secreting macrophages.
  • Fig 4A FACS analysis of macrophages to verify effectiveness of a differentiation protocol and to validate GFP expression.
  • Fig 4B Examination of B2M protein expression using FACS confirms most edited cells retain B2M protein expression.
  • Fig 4C GFP secretion as measured by ELISA detects GFP in macrophage media following HDR into a B2M locus in HSCs. Data shown is two biological repeats and two technical repeats (nested analysis). Graph shows mean ⁇ SD. [0018] Figs. 5A-5B: Integration of GFP into a B2M locus in iPSCs enables GFP expression and secretion.
  • Fig.5A FACS of iPSCs treated with donor virus (GFP-2A) + RNP results in GFP expression. GFP was not observed in cells treated with donor virus when combined with irrelevant RNP.
  • Fig.5B GFP secretion as measured by ELISA detects GFP in cell media following HDR into a B2M locus. Data shown is two biological repeats and two technical repeats (nested analysis). Graphs show mean ⁇ SD.
  • each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
  • adjectives such as “substantially” and “about” modifying a condition or relationship characteristic of a feature or features of an embodiment of the invention, are understood to mean that the condition or characteristic is defined to within tolerances that are acceptable for operation of the embodiment for an application for which it is intended.
  • the word “or” in the specification and claims is considered to be the inclusive “or” rather than the exclusive or, and indicates at least one of, or any combination of items it conjoins.
  • each of the verbs, “comprise,” “include” and “have” and conjugates thereof, are used to indicate that the object or objects of the verb are not necessarily a complete listing of components, elements or parts of the subject or subjects of the verb.
  • Other terms as used herein are meant to be defined by their well-known meanings in the art.
  • the term "homology-directed repair” or "HDR” refers to a mechanism for repairing DNA damage in cells, for example, during repair of double-stranded and single-stranded breaks in DNA.
  • HDR requires nucleotide sequence homology and uses a "nucleic acid template" (nucleic acid template or donor template used interchangeably herein) to repair the sequence where the double-stranded or single break occurred (e.g., DNA target sequence). This results in the transfer of genetic information from, for example, the nucleic acid template to the DNA target sequence.
  • HDR may result in alteration of the DNA target sequence (e.g., insertion, deletion, mutation) if the nucleic acid template sequence differs from the DNA target sequence and part or all of the nucleic acid template polynucleotide or oligonucleotide is incorporated into the DNA target sequence.
  • nucleic acid template and “donor”, refer to a nucleotide sequence that is inserted or copied into a genome.
  • the nucleic acid template comprises a nucleotide sequence, e.g., of one or more nucleotides, that will be added to or will template a change in the target nucleic acid or may be used to modify the target sequence.
  • a nucleic acid template sequence may be of any length, for example between 2 and 10,000 nucleotides in length.
  • a nucleic acid template may be a single stranded nucleic acid, a double stranded nucleic acid.
  • the nucleic acid template comprises a nucleotide sequence, e.g., of one or more nucleotides, that corresponds to wild type sequence of the target nucleic acid, e.g., of the target position.
  • the nucleic acid template comprises a nucleotide sequence, e.g., of one or more ribonucleotides, that corresponds to wild type sequence of the target nucleic acid, e.g., of the target position.
  • the nucleic acid template comprises modified nucleotides.
  • a donor sequence can contain a non-homologous sequence flanked by two regions of homology to allow for efficient homology directed repair ( HDR) at the location of interest.
  • donor sequences can comprise a vector molecule containing sequences that are not homologous to the region of interest in cellular chromatin.
  • a donor molecule can contain several, discontinuous regions of homology to cellular chromatin.
  • sequences can be present in a donor nucleic acid molecule and flanked by regions of homology to sequence in the region of interest.
  • a donor molecule may be any length, for example ranging from several bases e.g.10-20 bases to multiple kilobases in length.
  • the donor polynucleotide can be DNA or RNA, single-stranded and/or double- stranded and can be introduced into a cell in linear or circular form. See, e.g., U.S. Publication Nos. 2010/0047805; 2011/0281361; 2011/0207221; and 2019/0330620. See also Anzalone et al.
  • the ends of the donor sequence can be protected (e.g., from exonucleolytic degradation) by methods known to those of skill in the art.
  • one or more dideoxynucleotide residues are added to the 3' terminus of a linear molecule and/or self- complementary oligonucleotides are ligated to one or both ends. See, for example, Chang et al. (1987) and Nehls et al. (1996).
  • a donor sequence may be an oligonucleotide and be used for targeted alteration of an endogenous sequence.
  • the oligonucleotide may be introduced to the cell on a vector, may be electroporated into the cell, or may be introduced via other methods known in the art.
  • Donor polynucleotides can be introduced as naked nucleic acid, as nucleic acid complexed with an agent such as a liposome or poloxamer, or can be delivered by viruses (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus and integrase defective lentivirus (IDLV)).
  • viruses e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus and integrase defective lentivirus (IDLV)
  • modified cells refers to cells in which a double strand break is affected by a complex of an RNA molecule and the CRISPR nuclease as a result of hybridization with the target sequence, i.e. on-target hybridization.
  • modified cells may further encompass cells in which an edit or modification, including the introduction of an exogenous sequence, was affected following the double strand break.
  • This invention provides a modified cell or cells obtained by use of any of the methods described herein. In an embodiment these modified cell or cells are capable of giving rise to progeny cells. In an embodiment these modified cell or cells are capable of giving rise to progeny cells after engraftment.
  • the modified cells may be hematopoietic stem cells (HSCs), or any cell suitable for an allogenic cell transplant or autologous cell transplant.
  • the modified cells may be stem cells, monocytes, macrophages, or iPS-derived monocytes or macrophages.
  • This invention also provides a composition comprising these modified cells and a pharmaceutically acceptable carrier. Also provided is an in vitro or ex vivo method of preparing this, comprising mixing the cells with the pharmaceutically acceptable carrier.
  • targeting sequence or “targeting molecule” refers a nucleotide sequence or molecule comprising a nucleotide sequence that is capable of hybridizing to a specific target sequence, e.g., the targeting sequence has a nucleotide sequence which is at least partially complementary to the sequence being targeted along the length of the targeting sequence.
  • the targeting sequence or targeting molecule may be part of an RNA molecule that can form a complex with a CRISPR nuclease, either alone or in combination with other RNA molecules, with the targeting sequence serving as the targeting portion of the CRISPR complex.
  • the RNA molecule alone or in combination with an additional one or more RNA molecules (e.g. a tracrRNA molecule), is capable of targeting the CRISPR nuclease to the specific target sequence.
  • a guide sequence portion of a CRISPR RNA molecule or single-guide RNA molecule may serve as a targeting molecule.
  • Each possibility represents a separate embodiment.
  • a targeting sequence can be custom designed to target any desired sequence.
  • targets refers to preferentially hybridizing a targeting sequence of a targeting molecule to a nucleic acid having a targeted nucleotide sequence. It is understood that the term “targets” encompasses variable hybridization efficiencies, such that there is preferential targeting of the nucleic acid having the targeted nucleotide sequence, but unintentional off-target hybridization in addition to on-target hybridization might also occur. It is understood that where an RNA molecule targets a sequence, a complex of the RNA molecule and a CRISPR nuclease molecule targets the sequence for nuclease activity.
  • the “guide sequence portion” of an RNA molecule refers to a nucleotide sequence that is capable of hybridizing to a specific target DNA sequence, e.g., the guide sequence portion has a nucleotide sequence which is partially or fully complementary to the DNA sequence being targeted along the length of the guide sequence portion.
  • the guide sequence portion is 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length, or approximately 17-50, 17-49, 17-48, 17-47, 17-46, 17-45, 17-44, 17-43, 17-42, 17-41, 17-40, 17-39, 17-38, 17-37, 17-36, 17-35, 17-34, 17-33, 17-31, 17-30, 17-29, 17-28, 17-27, 17-26, 17- 25, 17-24, 17-22, 17-21, 18-25, 18-24, 18-23, 18-22, 18-21, 19-25, 19-24, 19-23, 19-22, 19- 21, 19-20, 20-22, 18-20, 20-21, 21-22, or 17-20 nucleotides in length.
  • the entire length of the guide sequence portion is fully complementary to the DNA sequence being targeted along the length of the guide sequence portion.
  • the guide sequence portion may be part of an RNA molecule that can form a complex with a CRISPR nuclease with the guide sequence portion serving as the DNA targeting portion of the CRISPR complex.
  • the RNA molecule having the guide sequence portion is present contemporaneously with the CRISPR molecule, alone or in combination with an additional one or more RNA molecules (e.g. a tracrRNA molecule), the RNA molecule is capable of targeting the CRISPR nuclease to the specific target DNA sequence.
  • a CRISPR complex can be formed by direct binding of the RNA molecule having the guide sequence portion to a CRISPR nuclease or by binding of the RNA molecule having the guide sequence portion and an additional one or more RNA molecules to the CRISPR nuclease.
  • a guide sequence portion can be custom designed to target any desired sequence.
  • a molecule comprising a “guide sequence portion” is a type of targeting molecule.
  • the guide sequence portion comprises a sequence that is the same as, or differs by no more than 1, 2, 3, 4, or 5 nucleotides from, a guide sequence portion described herein, e.g., a guide sequence set forth in any of SEQ ID NOs: 1-28998.
  • the guide sequence portion comprises a sequence that is the same as a sequence set forth in any of SEQ ID NOs: 1-28998.
  • guide molecule RNA guide molecule
  • guide RNA molecule guide RNA molecule
  • gRNA molecule a molecule comprising a guide sequence portion.
  • non-discriminatory refers to a guide sequence portion of an RNA molecule that targets a specific DNA sequence that is common in both alleles of a gene.
  • a non-discriminatory guide sequence portion is capable of targeting both alleles of a gene present in a cell.
  • an RNA molecule comprises a guide sequence portion having 17-50 contiguous nucleotides containing nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-28998.
  • the guide sequence portion comprises a sequence that is the same as or differs by no more than 1, 2, or 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 1-28998.
  • the RNA molecule and or the guide sequence portion of the RNA molecule may contain modified nucleotides.
  • Exemplary modifications to nucleotides or polynucleotides may be synthetic and encompass polynucleotides which contain nucleotides comprising bases other than the naturally occurring adenine, cytosine, thymine, uracil, or guanine bases.
  • Modifications to polynucleotides include polynucleotides which contain synthetic, non-naturally occurring nucleosides e.g., locked nucleic acids. Modifications to polynucleotides may be utilized to increase or decrease stability of an RNA.
  • An example of a modified polynucleotide is an mRNA containing 1-methyl pseudo-uridine.
  • the guide sequence portion may be 25 nucleotides in length and contain 20-22 contiguous nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-28998. In embodiments of the present invention, the guide sequence portion may be less than 22 nucleotides in length.
  • the guide sequence portion may be 17, 18, 19, 20, or 21 nucleotides in length.
  • the guide sequence portion may consist of 17, 18, 19, 20, or 21 nucleotides, respectively, in the sequence of 17-22 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-28998.
  • a guide sequence portion having 17 nucleotides in the sequence of 17 contiguous nucleotides set forth in SEQ ID NO: 28999 may consist of any one of the following nucleotide sequences (nucleotides excluded from the contiguous sequence are marked in strike-through):
  • the guide sequence portion may be greater than 20 nucleotides in length.
  • the guide sequence portion may be 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
  • the guide sequence portion comprises 17-50 nucleotides containing the sequence of 20, 21 or 22 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-28998 and additional nucleotides fully complimentary to a nucleotide or sequence of nucleotides adjacent to the 3’ end of the target sequence, 5’ end of the target sequence, or both.
  • a CRISPR nuclease and an RNA molecule comprising a guide sequence portion form a CRISPR complex that binds to a target DNA sequence to effect cleavage of the target DNA sequence.
  • CRISPR nucleases e.g. Cpf1
  • CRISPR nucleases may form a CRISPR complex comprising a CRISPR nuclease and RNA molecule without a further tracrRNA molecule.
  • CRISPR nucleases e.g. Cas9, may form a CRISPR complex between the CRISPR nuclease, an RNA molecule, and a tracrRNA molecule.
  • a guide sequence portion which comprises a nucleotide sequence that is capable of hybridizing to a specific target DNA sequence, and a sequence portion that participates in CRIPSR nuclease binding, e.g. a tracrRNA sequence portion, can be located on the same RNA molecule.
  • a guide sequence portion may be located on one RNA molecule and a sequence portion that participates in CRIPSR nuclease binding, e.g. a tracrRNA portion, may located on a separate RNA molecule.
  • a single RNA molecule comprising a guide sequence portion (e.g. a DNA-targeting RNA sequence) and at least one CRISPR protein-binding RNA sequence portion (e.g.
  • a tracrRNA sequence portion can form a complex with a CRISPR nuclease and serve as the DNA-targeting molecule.
  • a first RNA molecule comprising a DNA-targeting RNA portion, which includes a guide sequence portion, and a second RNA molecule comprising a CRISPR protein-binding RNA sequence interact by base pairing to form an RNA complex that targets the CRISPR nuclease to a DNA target site or, alternatively, are fused together to form an RNA molecule that complexes with the CRISPR nuclease and targets the CRISPR nuclease to a DNA target site.
  • a RNA molecule comprising a guide sequence portion may further comprise the sequence of a tracrRNA molecule.
  • Such embodiments may be designed as a synthetic fusion of the guide portion of the RNA molecule and the trans-activating crRNA (tracrRNA). (See Jinek et al., 2012).
  • the RNA molecule is a single guide RNA (sgRNA) molecule.
  • sgRNA single guide RNA
  • Embodiments of the present invention may also form CRISPR complexes utilizing a separate tracrRNA molecule and a separate RNA molecule comprising a guide sequence portion.
  • the tracrRNA molecule may hybridize with the RNA molecule via basepairing and may be advantageous in certain applications of the invention described herein.
  • the term “tracr mate sequence” refers to a sequence sufficiently complementary to a tracrRNA molecule so as to hybridize to the tracrRNA via basepairing and promote the formation of a CRISPR complex. (See U.S. Patent No. 8,906,616).
  • the RNA molecule may further comprise a portion having a tracr mate sequence.
  • "Eukaryotic" cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells and human cells.
  • nuclease refers to an enzyme capable of cleaving the phosphodiester bonds between the nucleotide subunits of nucleic acid.
  • a nuclease may be isolated or derived from a natural source. The natural source may be any living organism. Alternatively, a nuclease may be a modified or a synthetic protein which retains the phosphodiester bond cleaving activity. Gene modification can be achieved using a nuclease, for example a CRISPR nuclease.
  • RNA molecule comprising a guide sequence portion (e.g.
  • a targeting sequence comprising a nucleotide sequence that is fully or partially complementary to a target located in or near an allele of the B2M gene.
  • the guide sequence portion of the RNA molecule consists of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or more than 26 nucleotides.
  • the guide sequence portion is configured to target a CRISPR nuclease to a B2M target site and induce a double-strand break or a single-strand break within 500, 400, 300, 200, 100, 50, 25, or 10 nucleotides of the B2M target site.
  • the RNA molecule is a guide RNA molecule such as a crRNA molecule or a single-guide RNA molecule.
  • the guide sequence portion is complementary to a target sequence located from 30 base pairs upstream to 30 base pairs downstream of Exon 3, Exon 4, Intron 1, Intron 2, Intron 3, or a 3’ untranslated region (3’ UTR) of the B2M gene. In some embodiments, the guide sequence portion is complementary to a target sequence located from 50 base pairs upstream to 50 base pairs downstream of Exon 3, Exon 4, Intron 1, Intron 2, Intron 3, or a 3’ untranslated region (3’ UTR) of the B2M gene. Each possibility represents a separate embodiment.
  • the guide sequence portion is complementary to a target sequence located from 7 base pairs upstream to 7 base pairs downstream of Exon 3, Exon 4, Intron 1, Intron 2, Intron 3, or a 3’ untranslated region (3’ UTR) of the B2M gene.
  • HSC refers to both hematopoietic stem cells and hematopoietic stem progenitor cells.
  • stem cells include bone marrow cells, myeloid progenitor cells, a multipotent progenitor cells, and lineage restricted progenitor cells.
  • progenitor cell refers to a lineage cell that is derived from stem cell and retains mitotic capacity and multipotency (e.g., can differentiate or develop into more than one but not all types of mature lineage of cell).
  • hematopoiesis or “hemopoiesis” refers to the formation and development of various types of blood cells (e.g., red blood cells, megakaryocytes, myeloid cells (e.g., monocytes, macrophages and neutrophil), and lymphocytes) and other formed elements in the body (e.g., in the bone marrow).
  • a method for modifying in a cell an allele of the Beta-2 microglobulin (B2M) gene comprising introducing to the cell a composition comprising: at least one CRISPR nuclease, or a polynucleotide molecule encoding the CRISPR nuclease; and a RNA molecule comprising a guide sequence portion having 17-50 nucleotides, or a nucleotide molecule encoding the same, wherein a complex of the CRISPR nuclease and the RNA molecule affects a double strand break in the allele of the B2M gene.
  • the RNA molecule is a crRNA molecule and the composition further comprises a tracrRNA molecule that forms a crRNA:tracrRNA molecule with the crRNA molecule.
  • the RNA molecule is an sgRNA molecule.
  • the composition also comprises a donor molecule.
  • a sequence of nucleotides from the donor molecule is inserted or copied at or near the double strand break site.
  • the composition further comprises a donor molecule comprising a sequence of nucleotides that is introduced at the double strand break site.
  • the composition further comprises a donor molecule containing a sequence of nucleotides that is introduced at the double strand break site such that the expression of the introduced sequence is mediated by the promoter of the B2M gene.
  • the introduced sequence comprises a sequence from an Alpha- 1 antitrypsin, Glucose-6-phosphatase (G6PC), Serpin Family A Member (SERPINA), Transthyretin (TTR), ornithine transcarbamylase, argininosuccinic acid synthetase, arginase, argininosuccinase, carbamoyl phosphate synthetase, and N-acetylglutamate synthetase, Alpha Galactosidase A, Coagulation Factor IX, Coagulation Factor VII, Lysosomal Alpha Glucosidase, Fibrinogen, Phenylalanine 4 Hydroxylase,
  • the introduced sequence comprises a sequence from an acid ⁇ -glucosidase, ⁇ -L-iduronidase, ⁇ -galactosidase, iduronate-2-sulfatase, N- acetylgalactosamine-6-sulfatase, N-acetylgalactosamine-4-sulfatase, a lysophosphatidylcholine metabolism-related protein, preferably phospholipase A2, a T-REC or K-REC related protein, ⁇ -glucosidase, ⁇ -glucocerebrosidase, arylsulfatase A, Factor VIII, insulin-like growth factor 1 (IGF-1), surfactant protein A, surfactant protein B, aspartyl- ⁇ - glucosaminidase, acetyl-CoA ⁇ -glucosaminide, acetyl-CoA-arylamine N-ace
  • the donor molecule contains a sequence from a gene encoding a protein that is secreted by a cell.
  • the introduced sequence comprises a sequence that encodes a polypeptide of interest that is expressed by the cell.
  • the expressed polypeptide of interest is secreted by the cell.
  • the expressed polypeptide of interest further comprises a signal peptide.
  • the signal peptide is encoded by the allele of the B2M gene.
  • the introduced sequence comprises a sequence encoding a 2A self-cleaving peptide.
  • the introduced sequence comprises a sequence that encodes a signal peptide.
  • the signal peptide is a B2M signal peptide.
  • the introduced sequence comprises a splice acceptor sequence and a splice donor sequence.
  • the introduced sequence comprises a splice acceptor sequence, a sequence encoding a polypeptide of interest, a sequence encoding a 2A self-cleaving peptide, a signal peptide, and a splice donor sequence.
  • the donor molecule comprises a first homology arm sequence that shares at least 90%, 90-95%, 95-100%, or preferably 100%, sequence identity with a B2M sequence upstream of the double-strand break and a second homology arm sequence that shares at least 90%, 90-95%, 95-100%, or preferably 100%, sequence identity with a B2M sequence downstream of the double-strand break.
  • the first homology arm sequence and second homology arm sequences are each about 20-50, 50-100, 100-200, 200-500, 500-1000, or 1000-2000 nucleotides in length.
  • the polypeptide of interest is a soluble protein.
  • the polypeptide of interest is about 20-50, 50-100, 100-200, 200-500, 500-1000, or 1000-2000 amino acids in length.
  • the RNA molecule comprises a guide sequence portion having 17-50 contiguous nucleotides containing nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-28998.
  • the RNA molecule comprises a non-discriminatory guide sequence portion that targets both B2M alleles.
  • the RNA molecule comprises a non-discriminatory guide portion that targets any one of Exon 3, Exon 4, Intron 1, Intron 2, Intron 3, or a 3’ untranslated region (3’ UTR) of the B2M gene.
  • the RNA molecule comprises a non-discriminatory guide portion that targets a sequence that is located within a genomic range selected from any one of 15:44716329-44716356, 15:44717607-44717813, 15:44717825-44718145, 15:44716357- 44717323, 15:44717327-44717606, 15:44711614-44712998, 15:44713001-44713065, 15:44713067-44713182, 15:44713184-44713461, 15:44713463-44714419, 15:44714421- 44714474, 15:44714476-44715422, and 15:44715702-44716328.
  • the modified allele of the B2M gene expresses a B2M gene product. [0075] In some embodiments, the modified allele of the B2M gene expresses a B2M polypeptide and the polypeptide of interest.
  • the cell is a stem cell, a monocyte, a macrophage, an iPS- derived monocyte, an iPS-derived macrophage, a hematopoietic stem cell (HSC), a hematopoietic stem and progenitor cell (HSPC), a myeloid precursor cell, a myeloblast, a lymphoblast, an erythroid precursor cell, a platelet cell, a natural killer (NK) cell, a B- lymphocyte, a T-lymphocyte, an eosinophil, a neutrophil, an iPS-derived cell, or a basophil.
  • HSC hematopoietic stem cell
  • HSPC hematopoietic stem and progenitor cell
  • the cell is a stem cell
  • the method further comprises differentiating the stem cell after modifying the stem cell.
  • a modified cell obtained by the method of any one of the embodiments presented herein.
  • the cell is a stem cell, a monocyte, a macrophage, an iPS-derived monocyte, an iPS-derived macrophage, a hematopoietic stem cell (HSC), a hematopoietic stem and progenitor cell (HSPC), a myeloid precursor cell, a myeloblast, a lymphoblast, an erythroid precursor cell, a platelet cell, a natural killer (NK) cell, a B- lymphocyte, a T-lymphocyte, an eosinophil, a neutrophil, an iPS-derived cell, or a basophil.
  • HSC hematopoietic stem cell
  • HSPC hematopoietic stem and progenitor cell
  • RNA molecule comprising a guide sequence portion having 17-50 contiguous nucleotides containing nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-28998.
  • a composition comprising the RNA molecule and at least one CRISPR nuclease.
  • the composition further comprises a donor molecule.
  • the donor molecule comprises a sequence from an Alpha-1 antitrypsin, Glucose-6-phosphatase (G6PC), Serpin Family A Member (SERPINA), Transthyretin (TTR), ornithine transcarbamylase, argininosuccinic acid synthetase, arginase, argininosuccinase, carbamoyl phosphate synthetase, and N-acetylglutamate synthetase, Alpha Galactosidase A, Coagulation Factor IX, Coagulation Factor VII, Lysosomal Alpha Glucosidase, Fibrinogen, Phenylalanine 4 Hydroxylase, Alkaline Phosphatase, Glucosylceramidase, Beta Galactosidase, Porphobilinogen Deaminase, Arylsulfatase B, Beta Glucuronidase, Alpha-
  • the donor molecule comprises a sequence from an acid ⁇ - glucosidase, ⁇ -L-iduronidase, ⁇ -galactosidase, iduronate-2-sulfatase, N-acetylgalactosamine- 6-sulfatase, N-acetylgalactosamine-4-sulfatase, a lysophosphatidylcholine metabolism-related protein, preferably phospholipase A2, a T-REC or K-REC related protein, ⁇ -glucosidase, ⁇ - glucocerebrosidase, arylsulfatase A, Factor VIII, insulin-like growth factor 1 (IGF-1), surfactant protein A, surfactant protein B, aspartyl- ⁇ -glucosaminidase, acetyl-CoA ⁇ - glucosaminide, acetyl-CoA-arylamine N
  • the donor molecule comprises a sequence from a gene encoding a protein that is secreted by a cell. [0086] In some embodiments, the donor molecule comprises a sequence that encodes a polypeptide of interest. A nucleotide sequence encoding a polypeptide that is desired to be expressed in a target cell and secreted by the cell may be inserted into the B2M allele such that the modified B2M allele is capable of expressing both the polypeptide encoded by the inserted sequence as well as the original B2M gene product. [0087] In some embodiments, the donor molecule comprises a sequence encoding a 2A self- cleaving peptide.
  • the donor molecule comprises a sequence that encodes a signal peptide.
  • the signal peptide is a B2M signal peptide.
  • the donor molecule comprises a splice acceptor sequence and a splice donor sequence.
  • the donor molecule comprises a splice acceptor sequence, a sequence encoding a polypeptide of interest, a sequence encoding a 2A self-cleaving peptide, a signal peptide, and a splice donor sequence.
  • the donor molecule comprises a first homology arm sequence that shares at least 90%, preferably 100%, sequence identity with a first sequence in the B2M gene, and a second homology arm sequence that shares at least 90%, preferably 100%, sequence identity with a second sequence in the B2M gene.
  • the first homology arm sequence and second homology arm sequences are each about 20-50, 50-100, 100-200, 200-500, 500-1000, or 1000-2000 nucleotides in length.
  • the polypeptide of interest is a soluble protein.
  • the polypeptide of interest is up to 20-50, 50-100, 100-200, 200-500, 500-1000, or 1000-2000 amino acids in length.
  • the composition further comprises a tracrRNA molecule.
  • a method for modifying or editing a B2M allele in a cell comprising delivering to the cell the composition of any one of the embodiments presented herein.
  • use of any one of the compositions presented herein for modifying or editing a B2M allele in a cell comprising delivering to the cell the composition of any one of the embodiments presented herein.
  • a medicament comprising the composition of any one of the embodiments presented herein for use in modifying or editing a B2M allele in a cell, wherein the medicament is administered by delivering to the cell the composition of any one of the embodiments presented herein.
  • a kit for modifying or editing a B2M allele in a cell comprising an RNA molecule of any one of the embodiments presented herein, a CRISPR nuclease, and/or a tracrRNA molecule; and instructions for delivering the RNA molecule; CRISPR nuclease, and/or the tracrRNA to the cell.
  • the kit further comprises a donor molecule and instructions for delivering the donor molecule to a cell.
  • a gene editing composition comprising an RNA molecule comprising a guide sequence portion having 17-50 contiguous nucleotides containing nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-28998.
  • the RNA molecule further comprises a portion having a sequence which binds to a CRISPR nuclease.
  • the sequence which binds to a CRISPR nuclease is a tracrRNA sequence.
  • the RNA comprising a guide sequence portion is a crRNA molecule.
  • an RNA molecule comprising a guide sequence portion is a single-guide RNA (sgRNA) molecule.
  • the RNA molecule further comprises a portion having a tracr mate sequence.
  • the RNA molecule may further comprise one or more linker portions.
  • an RNA molecule may be up to 1000, 900, 800, 700, 600, 500, 450, 400, 350, 300, 290, 280, 270, 260, 250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, or 100 nucleotides in length.
  • the RNA molecule may be 17 up to 300 nucleotides in length, 100 up to 300 nucleotides in length, 150 up to 300 nucleotides in length, 100 up to 500 nucleotides in length, 100 up to 400 nucleotides in length, 200 up to 300 nucleotides in length, 100 to 200 nucleotides in length, or 150 up to 250 nucleotides in length.
  • the composition further comprises a tracrRNA molecule.
  • a method for modifying or editing a B2M allele in a cell comprising delivering to the cell a composition comprising an RNA molecule comprising a guide sequence portion having 17-50 contiguous nucleotides containing nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-28998 and a CRISPR nuclease.
  • the composition further comprises a donor molecule.
  • a method for treating a disorder or disease comprising delivering to a cell of a subject having the disorder or disease a composition comprising an RNA molecule comprising a guide sequence portion having 17-50 contiguous nucleotides containing nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-28998 and a CRISPR nuclease.
  • the composition further comprises a donor molecule.
  • a method for treating a disorder or disease comprising delivering to a cell of a subject having the disorder the composition of any one of the above embodiments or delivering to the subject the modified cell of any one of the above embodiments.
  • the disease or disorder is Pompe disease, Mucopolysaccharidosis Type I, Fabry disease, Mucopolysaccharidosis type II, Mucopolysaccharidosis type IVA, Mucopolysaccharidosis type VI, Adrenoleukodystrophy, Severe combined immunodeficiency, Gaucher disease, metachromatic leukodystrophy (MLD), primary immune deficiency, hemophilia A, hemophilia B, IGF-1 deficiency, surfactant deficiency, Aspartylglycosaminuria, Sanfilipo syndrome, mucopolysaccharidosis type III, Sanfilippo Syndrome type IIId, I-cell disease, Schindler Disease, Farber disease (FD), Spinal muscular atrophy with progressive myoclonic epilepsy (SMA-PME), Canavan disease, Lysosomal acid lipase deficiency, Niemann-Pick disease, Mucopolysaccharidosis
  • the composition or the modified cell is delivered to a tissue or tumor of the subject.
  • a medicament comprising the composition any one of the above embodiments for use in modifying a B2M allele in a cell, wherein the medicament is administered by delivering to the cell the composition any one of the above embodiments.
  • composition any one of the above embodiments or the modified cell of any one of the above embodiments for treating ameliorating or preventing a disorder or disease, comprising delivering to a cell of a subject having or at risk of having the disorder the composition any one of the above embodiments or delivering to the subject the modified cell of any one of the above embodiments.
  • a medicament comprising the composition of any one of the above embodiments or the modified cell of any one of the above embodiments for use in treating ameliorating or preventing a disorder or disease, wherein the medicament is administered by delivering to a cell of a subject having or at risk of having the disorder the composition of any one of the above embodiments or delivering to the subject the modified cell of any one of the above embodiments.
  • the disorder or disease is Pompe disease, Mucopolysaccharidosis Type I, Fabry disease, Mucopolysaccharidosis type II, Mucopolysaccharidosis type IVA, Mucopolysaccharidosis type VI, Adrenoleukodystrophy, Severe combined immunodeficiency, Gaucher disease, metachromatic leukodystrophy (MLD), primary immune deficiency, hemophilia A, hemophilia B, IGF-1 deficiency, surfactant deficiency, Aspartylglycosaminuria, Sanfilipo syndrome, mucopolysaccharidosis type III, Sanfilippo Syndrome type IIId, I-cell disease, Schindler Disease, Farber disease (FD), Spinal muscular atrophy with progressive myoclonic epilepsy (SMA-PME), Canavan disease, Lysosomal acid lipase deficiency, Niemann-Pick disease, Mucopolysaccharidosis
  • MLD metachromatic le
  • the disorder or disease is a lysosomal storage disorder.
  • the disorder or disease is a disorder or disease of the blood, lungs, brain, liver, guts, intestines, bones, muscles, or central nervous system, or is an inflammatory disease or autoinflammatory disease.
  • the composition of any one of the above embodiments or the modified cell of any one of the above embodiments is a medicament that is an enzyme replacement therapy.
  • a method of treating a disease or disorder wherein the method is an immunotherapy comprising delivering to the subject the modified cell of any one of the above embodiments.
  • the disease or disorder is cancer.
  • the composition of any one of the above embodiments or the modified cell of any one of the above embodiments is for use in treating ameliorating or preventing a disorder or disease.
  • a method for modifying a DNA target site in a monocyte or macrophage of a subject wherein the modification of the DNA target site induces the monocyte or macrophage to express a desired protein encoded by the modification, the method comprising delivering to the cell of the subject a composition comprising an RNA molecule comprising a guide sequence portion having 17- 50 contiguous nucleotides containing nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-28998 and a CRISPR nuclease.
  • the composition further comprises a donor molecule.
  • a donor molecule at least one CRISPR nuclease and the RNA molecule or RNA molecules are delivered to the subject and/or cells substantially at the same time or at different times.
  • a tracrRNA molecule is delivered to the subject and/or cells substantially at the same time or at different times as the CRISPR nuclease and RNA molecule or RNA molecules.
  • the RNA molecule targets an alternative splicing signal sequence between an exon and an intron of a B2M allele.
  • the RNA molecule is non- discriminatory and targets a sequence present in both B2M alleles.
  • the sequence is present in both B2M alleles.
  • the sequence is present in an intron of the B2M gene.
  • the intron is the first intron that follows the first coding exon of the B2M gene.
  • the method comprises contacting at least one allele of a gene of interest with a non-discriminatory RNA molecule, e.g.
  • RNA molecule comprising a guide sequence portion which is capable of targeting both alleles of a gene, and a CRISPR nuclease e.g., a Cas9 protein, wherein the non-discriminatory RNA molecule and the CRISPR nuclease associate with a nucleotide sequence of the at least one allele of the gene of interest, thereby modifying or editing the at least one allele.
  • a CRISPR nuclease e.g., a Cas9 protein
  • inducing biallelic cleavage with a non-discriminatory RNA molecule that targets an intron of the B2M gene may result in preservation of expression of an endogenous B2M gene from one allele and introduction of a nucleotide sequence, e.g. a nucleotide sequence from a donor molecule, in the other allele.
  • Introduction of the nucleotide sequence in a B2M allele may or may not disrupt expression of the B2M encoded gene product at the B2M allele.
  • the method comprises contacting an allele of a gene of interest with an RNA molecule and a CRISPR nuclease e.g., a Cas9 protein, wherein the RNA molecule and the CRISPR nuclease associate with a nucleotide sequence of the allele of the gene of interest which differs by at least one nucleotide from a nucleotide sequence of a different allele of the gene of interest, thereby modifying or editing the targeted allele.
  • the RNA molecule and a CRISPR nuclease is introduced to a cell encoding the gene of interest.
  • compositions described herein include at least one CRISPR nuclease, RNA molecule(s) comprising a guide sequence portion, and a tracrRNA molecule, which may be separate or attached to an RNA molecule comprising a guide sequence portion, being effective in a subject or cells at the same time.
  • the at least one CRISPR nuclease, RNA molecule(s) comprising a guide sequence portion, and tracrRNA may be delivered substantially at the same time or can be delivered at different times but have effect at the same time.
  • the cell is a stem cell.
  • the cell is a monocyte.
  • the cell is a macrophage.
  • the cell is an iPS-derived monocyte.
  • the cell is an iPS-derived macrophage.
  • the cell is a hematopoietic stem cell (HSC), a hematopoietic stem and progenitor cell (HSPC), a myeloid precursor cell, a myeloblast, a lymphoblast, an erythroid precursor cell, a platelet cell, a natural killer (NK) cell, a B-lymphocyte, a T-lymphocyte, an eosinophil, a neutrophil, an iPS-derived cell, or a basophil.
  • HSC hematopoietic stem cell
  • HSPC hematopoietic stem and progenitor cell
  • myeloid precursor cell a myeloblast, a lymphoblast, an erythroid precursor cell
  • a platelet cell a natural killer (NK) cell
  • B-lymphocyte a T-lymphocyte
  • an eosinophil a neutrophil
  • an iPS-derived cell or a basophil.
  • B2M-mediated expression of the knocked-in sequence is involved in or associated with treatment of a disorder or a disease.
  • a B2M DNA target site in target cell e.g. a monocyte, macrophage, a hematopoietic stem cell (HSC), hematopoietic stem and progenitor cells (HSPCs), myeloid precursor cell, myeloblast, lymphoblast, erythroid precursor cell, platelet cell, natural killer (NK) cell, B-lymphocyte, T-lymphocyte, eosinophil, neutrophil, a basophil, or an iPS cell
  • target cell e.g. a monocyte, macrophage, a hematopoietic stem cell (HSC), hematopoietic stem and progenitor cells (HSPCs), myeloid precursor cell, myeloblast, lymphoblast, erythroid precursor cell, platelet cell, natural killer (NK) cell, B-lymphocyte, T-lymphocyte,
  • target cells may be utilized, for example, to treat lysosomal storage diseases or other disorders of the blood, lungs, brain, liver, guts, intestines, bones, muscles, or central nervous system, or inflammatory or autoinflammatory diseases.
  • these modified cells serve as an alternative to traditional enzyme replacement therapies.
  • these modified cells are used for immunotherapy such as cancer immunotherapy.
  • expression of the knocked-in sequence may be involved in or associated with treatment of a disease or disorder of the blood, lungs, brain, guts, intestines, bones, liver, muscles, or central nervous system.
  • the knocked in sequence may be a A1AT, G6PC, SERPINA, TTR, ornithine transcarbamylase, argininosuccinic acid synthetase, arginase, argininosuccinase, carbamoyl phosphate synthetase, or N-acetylglutamate synthetase sequence, or a portion thereof.
  • expression of the knocked-in sequence may be involved in or associated with treatment of an inflammatory or autoinflammatory disease or disorder, such as inflammatory bowel disease (IBD).
  • IBD inflammatory bowel disease
  • IL-4 insertion into neuronal cells shows reduction in symptoms of multiple sclerosis mice.
  • the knocked-in sequence may be a cytokine or a chemokine such as anti-inflammatory cytokines or chemokines (e.g., IL-10, IGF1, TGF- ⁇ and IL-4).
  • cytokines or chemokines e.g., IL-10, IGF1, TGF- ⁇ and IL-4.
  • the secretion of the knocked-in cytokine or chemokine facilitates the manipulation of immune and inflammatory responses for the treatment of disease or disorder.
  • expression of the knocked-in sequence may be involved in or associated with treatment of cancer.
  • the knocked in sequence may be a cytokine, a chemokine, a factor, or a protein capable of activating the immune system or helping to recruit immune system cells to the tumor site to eliminate the tumor.
  • IL-15 may be knocked-in and secreted to increase persistence of T cells or natural killer cells, or CXCR4 may be knocked-in to increase recruitment of T cells and natural killer cells to a tumor site.
  • a target cell e.g.
  • a monocyte or macrophage may be modified to express a cytokine or a chemokine, including but limited to IL-10, IGF1, TGF- ⁇ , IL-15, CXCR4 and/or IL-4.
  • expression of the knocked-in sequence may be involved in or associated with treatment of a lysosomal storage disease or other disorder.
  • a target cell e.g.
  • a monocyte or macrophage may be modified to express Alpha Galactosidase A, Coagulation Factor IX, Coagulation Factor VII, Lysosomal Alpha Glucosidase, Fibrinogen, Phenylalanine 4 Hydroxylase, Alkaline Phosphatase, Glucosylceramidase, Beta Galactosidase, Porphobilinogen Deaminase, Arylsulfatase B, Beta Glucuronidase, Alpha-N-Acetylglucosaminidase, Lysosomal Alpha, Alpha L-Iduronidase, Mannosidase, Phosphatidylcholine Sterol Acyltransferase, N-Sulphoglucosamine Sulphohydrolase, Coagulation Factor X, N-Acetylgalactosamine-6-Sulfatase, Sphingomyelin Phosphodiesterase, Alpha-1 antitrypsin
  • expression of the knocked-in sequence may be involved in or associated with treatment of any one of the following diseases or disorders (which are each followed by a related gene or enzyme in parentheses): Pompe disease (acid ⁇ - glucosidase), Mucopolysaccharidosis Type I ( ⁇ -L-iduronidase), Fabry disease ( ⁇ - galactosidase), Mucopolysaccharidosis type II (iduronate-2-sulfatase), Mucopolysaccharidosis type IVA (N-acetylgalactosamine-6-sulfatase), Mucopolysaccharidosis type VI (N- acetylgalactosamine-4-sulfatase), Adrenoleukodystrophy (a lysophosphatidylcholine metabolism-related gene, e.g.
  • phospholipase A2 Severe combined immunodeficiency (T- REC or K-REC related gene), Gaucher disease ( ⁇ -glucosidase or ⁇ -glucocerebrosidase), metachromatic leukodystrophy (MLD) (arylsulfatase A), primary immune deficiency, hemophilia A and B (Factor VIII), IGF-1 deficiency (IGF-1), surfactant deficiency (surfactant protein A (SP-A) and/or surfactant protein B (SP-B), Aspartylglycosaminuria (aspartyl- ⁇ - glucosaminidase), Sanfilipo syndrome (acetyl-CoA ⁇ -glucosaminide), mucopolysaccharidosis type III (acetyl-CoA-arylamine N-acetyltransferase), Sanfilippo Syndrome type IIId (N- acetylglucosamine-6-sulfata
  • a target cell may be modified to express a metabolic modulator.
  • a target cell may be modified to express human growth hormone, insulin- like growth factor 1 (IGF-1), Factor VIII (hemophilia A and B), follicle-stimulating hormone, erythropoietin, a cytokine, a chemokine, IL-10, IGF1, TGF- ⁇ , IL-15, CXCR4, IL-4, granulocyte colony-stimulating factor (G-CSF), galactosamine-6-sulfatase, and/or ⁇ - hexosamini enzymes.
  • IGF-1 insulin- like growth factor 1
  • Factor VIII hemophilia A and B
  • follicle-stimulating hormone erythropoietin
  • IL-10 cytokine
  • IGF1 IGF1
  • TGF- ⁇ TGF- ⁇
  • IL-15 CXCR4
  • IL-4 granulocyte colony-stimulating factor
  • monocytes and macrophages reside in target tissues, including in the lungs and brain, and can serve as an expression vector for long-term secretion of proteins in those target tissues.
  • Expression of a transgene under the control of a B2M promoter is achieved by CRISPR mediated knock-in at a safe harbor site that is targeted by the guide sequence portions described herein.
  • the protein product of the expressed transgene may be secreted.
  • ERT enzyme replacement therapy
  • modified monocytes may be useful to target the central nervous system (CNS) or the lungs and secrete a protein of interest in the target tissue.
  • Such an approach is also useful, for example, to treat lysosomal storage diseases. Some of these diseases also display a phenotype in the CNS. Notably, there is a challenge to treat brain damage with enzyme replacement therapy due to the brain blood barrier (BBB). Monocytes may be utilized for delivery across the BBB such that the secreted protein of interest will be secreted in the CNS.
  • BBB brain blood barrier
  • modified monocytes or macrophages delivered to the brain may be utilized to treat a lysosomal storage disease; modified monocytes or macrophages delivered to the lungs may be utilized to treat anti-trypsin deficiency (A1AT), D-Surfactant deficiency, or proteinosis; or modified monocytes or macrophages in the blood may be utilized to treat A1AT or deficiency of adenosine deaminase 2 (DADA2).
  • B2M editing strategies include strategies that enable expression of a desired sequence under the control of a B2M promoter, optionally without knocking out the edited B2M alleles.
  • a new exon 2 by adding a splicing acceptor (SA), a branch site, and a splicing donor (SD) element to the knock-in cassette (e.g. as part of a donor molecule).
  • SA splicing acceptor
  • SD splicing donor
  • the cassette will include a self-cleaving peptide (e.g., 2A self- cleaving peptide such as P2A, F2A, E2A, T2A, or combination of two or more thereof) and/or the signal peptide of B2M at the C-terminus of the inserted gene, which will be cleaved in the endoplasmic reticulum enabling the separation of the inserted gene product from the B2M gene product.
  • a self-cleaving peptide e.g., 2A self- cleaving peptide such as P2A, F2A, E2A, T2A, or combination of two or more thereof
  • the signal peptide of B2M at the C-terminus of the inserted gene which will be cleaved in the endoplasmic reticulum enabling the separation of the inserted gene product from the B2M gene product.
  • B2M editing strategies may be utilized to edit T cells for use in chimeric antigen receptor-T cell (CAR-T) therapies.
  • a sequence of interest encoded by a donor molecule may be introduced to a B2M safe harbor site that is targeted by an RNA molecule comprising a guide sequence portion described herein.
  • Such editing may be utilized to alter the T-cell receptor expression and/or receptor signaling exhibited by the cell.
  • CRISPR nucleases and PAM recognition [0146]
  • the sequence specific nuclease is selected from CRISPR nucleases, or a functional variant thereof.
  • the sequence specific nuclease is an RNA-guided DNA nuclease.
  • the CRISPR complex does not further comprise a tracrRNA.
  • the at least one nucleotide which differs between B2M alleles may be within the PAM site and/or proximal to the PAM site within the region that the RNA molecule is designed to hybridize to.
  • RNA molecules can be engineered to bind to a target of choice in a genome by commonly known methods in the art.
  • the term “PAM” as used herein refers to a nucleotide sequence of a target DNA located in proximity to the targeted DNA sequence and recognized by the CRISPR nuclease complex. The PAM sequence may differ depending on the nuclease identity.
  • a CRISPR system utilizes one or more RNA molecules having a guide sequence portion to direct a CRISPR nuclease to a target DNA site via Watson-Crick base-pairing between the guide sequence portion and the protospacer on the target DNA site, which is next to the protospacer adjacent motif (PAM), which is an additional requirement for target recognition.
  • PAM protospacer adjacent motif
  • a type II CRISPR system utilizes a mature crRNA:tracrRNA complex that directs the CRISPR nuclease, e.g. Cas9 to the target DNA the target DNA via Watson-Crick base-pairing between the guide sequence portion of the crRNA and the protospacer on the target DNA next to the protospacer adjacent motif (PAM).
  • CRISPR nuclease e.g. Cas9
  • PAM protospacer adjacent motif
  • RNA molecules of the present invention are each designed to form complexes in conjunction with one or more different CRISPR nucleases and designed to target polynucleotide sequences of interest utilizing one or more different PAM sequences respective to the CRISPR nuclease utilized.
  • an RNA-guided DNA nuclease e.g., a CRISPR nuclease
  • RNA-guided DNA nucleases are derived from CRISPR systems, however, other RNA-guided DNA nucleases are also contemplated for use in the genome editing compositions and methods described herein. For instance, see U.S. Publication No.2015/0211023, incorporated herein by reference. [0149] CRISPR systems that may be used in the practice of the invention vary greatly. CRISPR systems can be a type I, a type II, or a type III system.
  • Non- limiting examples of suitable CRISPR proteins include Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8al, Cas8a2, Cas8b, Cas8c, Cas9, Casl0, Casl Od, CasF, CasG, CasH, Csyl , Csy2, Csy3, Csel (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl , Csb2, Csb3,Csxl7, Csxl4, Csxl0, Csxl6, CsaX, Csx3, Csz
  • the RNA-guided DNA nuclease is a CRISPR nuclease derived from a type II CRISPR system (e.g., Cas9).
  • the CRISPR nuclease may be derived from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Neisseria meningitidis, Treponema denticola, Nocardiopsis rougevillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii
  • CRISPR nucleases encoded by uncultured bacteria may also be used in the context of the invention.
  • Variants of CRIPSR proteins having known PAM sequences e.g., SpCas9 D1135E variant, SpCas9 VQR variant, SpCas9 EQR variant, or SpCas9 VRER variant may also be used in the context of the invention.
  • an RNA-guided DNA nuclease of a CRISPR system such as a Cas9 protein or modified Cas9 or homolog or ortholog of Cas9, or other RNA-guided DNA nucleases belonging to other types of CRISPR systems, such as Cpf1 and its homologs and orthologs, may be used in the compositions of the present invention.
  • Additional CRISPR nucleases may also be used, for example, the nucleases described in PCT International Application Publication Nos. WO2020/223514 and WO2020/223553, which are hereby incorporated by reference
  • the CRIPSR nuclease may be a "functional derivative" of a naturally occurring Cas protein.
  • a “functional derivative” of a native sequence polypeptide is a compound having a qualitative biological property in common with a native sequence polypeptide.
  • “Functional derivatives” include, but are not limited to, fragments of a native sequence and derivatives of a native sequence polypeptide and its fragments, provided that they have a biological activity in common with a corresponding native sequence polypeptide.
  • a biological activity contemplated herein is the ability of the functional derivative to hydrolyze a DNA substrate into fragments.
  • the term “derivative” encompasses both amino acid sequence variants of polypeptide, covalent modifications, and fusions thereof.
  • Suitable derivatives of a Cas polypeptide or a fragment thereof include but are not limited to mutants, fusions, covalent modifications of Cas protein or a fragment thereof.
  • Derivatives include, but are not limited to, CRISPR nickases, catalytically inactive or “dead” CRISPR nucleases, and fusion of a CRISPR nuclease or derivative thereof to other enzymes such as base editors or retrotransposons. See for example, Anzalone et al. (2019) and PCT International Application No. PCT/US2020/037560.
  • the CRISPR nuclease or derivative thereof may be fused to a protein that has an enzymatic activity.
  • the enzymatic activity modifies a target DNA.
  • the enzymatic activity is nuclease activity, methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity or glycosylase activity.
  • the enzymatic activity is nuclease activity.
  • the nuclease activity introduces a double strand break in the target DNA.
  • the enzymatic activity modifies a target polypeptide associated with the target DNA.
  • the enzymatic activity is methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitinating activity, adenylation activity, deadenylation activity, SUMOylating activity, deSUMOylating activity, ribosylation activity, deribosylation activity, myristoylation activity or demyristoylation activity.
  • the target polypeptide is a histone and the enzymatic activity is methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity or deubiquitinating activity.
  • Cas protein which includes Cas protein or a fragment thereof, as well as derivatives of Cas protein or a fragment thereof, may be obtainable from a cell or synthesized chemically or by a combination of these two procedures.
  • the cell may be a cell that naturally produces Cas protein, or a cell that naturally produces Cas protein and is genetically engineered to produce the endogenous Cas protein at a higher expression level or to produce a Cas protein from an exogenously introduced nucleic acid, which nucleic acid encodes a Cas that is same or different from the endogenous Cas. In some cases, the cell does not naturally produce Cas protein and is genetically engineered to produce a Cas protein. [0155] In some embodiments, the CRISPR nuclease is Cpf1. Cpf1 is a single RNA-guided endonuclease which utilizes a T-rich protospacer-adjacent motif.
  • RNA-guided DNA nuclease of a Type II CRISPR System such as a Cas9 protein or modified Cas9 or homologs, orthologues, or variants of Cas9, or other RNA-guided DNA nucleases belonging to other types of CRISPR systems, such as Cpf1 and its homologs, orthologues, or variants, may be used in the present invention.
  • the guide molecule comprises one or more chemical modifications which imparts a new or improved property (e.g., improved stability from degradation, improved hybridization energetics, or improved binding properties with an RNA- guided DNA nuclease).
  • Suitable chemical modifications include, but are not limited to: modified bases, modified sugar moieties, or modified inter-nucleoside linkages.
  • Non-limiting examples of suitable chemical modifications include: 4-acetylcytidine, 5- (carboxyhydroxymethyl)uridine, 2’-O-methylcytidine, 5-carboxymethylaminomethyl-2- thiouridine, 5-carboxymethylaminomethyluridine, dihydrouridine, 2’-O-methylpseudouridine, "beta, D-galactosylqueuosine", 2’-O-methylguanosine, inosine, N6-isopentenyladenosine, 1- methyladenosine, 1-methylpseudouridine, 1-methylguanosine, 1-methylinosine, "2,2- dimethylguanosine", 2-methyladenosine, 2-methylguanosine, 3-methylcytidine, 5- methylcytidine, N6-methyladenosine, 7-methylguanosine, 5-methylaminomethyluridine, 5- methoxyaminomethyl-2-thiouridine, “beta,
  • RNA molecules comprising a guide sequence portion utilized to target a DNA site may result in degradation of the RNA molecule, limited activity, no activity, or off- target effects. Accordingly, suitable guide sequence portions are necessary for targeting a given DNA site in a gene.
  • a novel set of guide sequence portions have been identified for targeting at least one B2M allele and introducing to the at least one allele a sequence of nucleotides to be expressed under the control of the B2M promoter.
  • Such a gene editing approach may be used to treat a disorder or disease or modify behavior of a cell.
  • RNA molecule capable of targeting both B2M alleles is used for targeting.
  • an RNA molecule is used to target a site in the B2M gene to introduce, or knock-in, an exogenous sequence of nucleotides into the B2M gene.
  • the location of the site is near the intended knock-in site, preferably near the start codon or the stop codon, preferably within 150 nucleotides of the start codon or stop codon.
  • the site is located within the first intron that follows the first coding exon of a targeted B2M allele.
  • compositions described herein may be delivered to a target cell by any suitable means.
  • Compositions of the present invention may be targeted to any cell which contains and/or expresses a B2M allele, including any mammalian cell, preferably a monocyte or macrophage.
  • a B2M allele including any mammalian cell, preferably a monocyte or macrophage.
  • an RNA molecule that specifically targets a B2M allele is delivered to a target cell and the target cell is monocyte or macrophage.
  • the delivery to the cell may be performed in vitro, ex vivo, or in vivo.
  • nucleic acid compositions described herein may be delivered as one or more of DNA molecules, RNA molecules, ribonucleoproteins (RNPs), nucleic acid vectors, or any combination thereof.
  • in vivo delivery methods of the compositions described herein include delivery by a lentivirus, adeno-associated virus (AAV) or nanoparticle.
  • in vivo delivery methods of the compositions described herein include delivery by a lentivirus, adeno-associated virus (AAV) or nanoparticle.
  • the composition may be in the form of an RNP composition. Accordingly, the delivery can be in vivo to monocytes or macrophages within a subject.
  • any one of the compositions described herein is delivered to a cell ex vivo.
  • the cell is a stem cell.
  • the cell is a monocyte.
  • the cell is a macrophage.
  • the cell is an iPS-derived monocyte or macrophage.
  • the cell is a hematopoietic stem cell (HSC), a hematopoietic stem and progenitor cell (HSPC), a myeloid precursor cell, a myeloblast, a lymphoblast, an erythroid precursor cell, a platelet cell, a natural killer (NK) cell, a B-lymphocyte, a T-lymphocyte, an eosinophil, a neutrophil, or a basophil
  • HSC hematopoietic stem cell
  • HSPC hematopoietic stem and progenitor cell
  • myeloid precursor cell a myeloblast, a lymphoblast, an erythroid precursor cell
  • a platelet cell a natural killer (NK) cell
  • B-lymphocyte a B-lymphocyte
  • T-lymphocyte a T-lymphocyte
  • eosinophil a neutrophil
  • basophil a basophil
  • the composition may be delivered to the cell by any known ex viv
  • an RNA molecule of a composition described herein comprises a chemical modification.
  • suitable chemical modifications include 2'-0-methyl (M), 2'-0-methyl, 3'phosphorothioate (MS) or 2'-0-methyl, 3 'thioPACE (MSP), pseudouridine, and 1-methyl pseudo-uridine.
  • M 2'-0-methyl
  • MS 3'phosphorothioate
  • MSP 3 'thioPACE
  • pseudouridine 2-methyl pseudo-uridine
  • 1-methyl pseudo-uridine 2-methyl pseudo-uridine.
  • Any suitable viral vector system may be used to deliver nucleic acid compositions e.g., the RNA molecule compositions of the subject invention.
  • Conventional viral and non- viral based gene transfer methods can be used to introduce nucleic acids and target tissues.
  • nucleic acids are administered for in vivo or ex vivo gene therapy uses.
  • Non-viral vector delivery systems include naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as a liposome or poloxamer.
  • a delivery vehicle such as a liposome or poloxamer.
  • Methods of non-viral delivery of nucleic acids and/or proteins include electroporation, lipofection, microinjection, biolistics, particle gun acceleration, virosomes, liposomes, immunoliposomes, lipid nanoparticles (LNPs), polycation or lipid:nucleic acid conjugates, artificial virions, and agent-enhanced uptake of nucleic acids or can be delivered to plant cells by bacteria or viruses (e.g., Agrobacterium, Rhizobium sp. NGR234, Sinorhizoboiummeliloti, Mesorhizobium loti, tobacco mosaic virus, potato virus X, cauliflower mosaic virus and cassava vein mosaic virus).
  • bacteria or viruses e.g., Agrobacterium, Rhizobium sp. NGR234, Sinorhizoboiummeliloti, Mesorhizobium loti, tobacco mosaic virus, potato virus X, cauliflower mosaic virus and cassava vein mosaic virus.
  • Non-viral vectors such as transposon-based systems e.g.
  • recombinant Sleeping Beauty transposon systems or recombinant PiggyBac transposon systems may also be delivered to a target cell and utilized for transposition of a polynucleotide sequence of a molecule of the composition or a polynucleotide sequence encoding a molecule of the composition in the target cell.
  • Additional exemplary nucleic acid delivery systems include those provided by Amaxa.RTM. Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Md.), BTX Molecular Delivery Systems (Holliston, Mass.) and Copernicus Therapeutics Inc., (see, e.g., U.S. Patent No. 6,008,336).
  • Lipofection is described in e.g., U.S. Patent No. 5,049,386, U.S. Patent No. 4,946,787; and U.S. Patent No. 4,897,355, and lipofection reagents are sold commercially (e.g., Transfectam.TM., Lipofectin.TM. and Lipofectamine.TM. RNAiMAX).
  • Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those disclosed in PCT International Publication Nos. WO/1991/017424 and WO/1991/016024. Delivery can be to cells (ex vivo administration) or target tissues (in vivo administration).
  • lipid:nucleic acid complexes including targeted liposomes such as immunolipid complexes
  • the preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to one of skill in the art (see, e.g., Crystal, Science (1995); Blaese et al., (1995); Behr et al., (1994); Remy et al. (1994); Gao and Huang (1995); Ahmad and Allen (1992); U.S. Patent Nos. 4,186,183; 4,217,344; 4,235,871; 4,261,975; 4,485,054; 4,501,728; 4,774,085; 4,837,028; and 4,946,787).
  • Additional methods of delivery include the use of packaging the nucleic acids to be delivered into EnGeneIC delivery vehicles (EDVs). These EDVs are specifically delivered to target tissues using bispecific antibodies where one arm of the antibody has specificity for the target tissue and the other has specificity for the EDV. The antibody brings the EDVs to the target cell surface and then the EDV is brought into the cell by endocytosis. Once in the cell, the contents are released (See MacDiarmid et al., 2009).
  • EDVs EnGeneIC delivery vehicles
  • Delivery vehicles include, but are not limited to, bacteria, preferably non-pathogenic, vehicles, nanoparticles, exosomes, microvesicles, gene gun delivery, for example, by attachment of a composition to a gold particle which is fired into a cell using via a “gene-gun”, viral vehicles, including but not limited to lentiviruses, AAV, and retroviruses), virus- like particles (VLPs). large VLPs (LVLPs), lentivirus-like particles, transposons, viral vectors, naked vectors, DNA, or RNA, among other delivery vehicles known in the art.
  • viral vehicles including but not limited to lentiviruses, AAV, and retroviruses
  • VLPs virus- like particles
  • LVLPs large VLPs
  • lentivirus-like particles transposons
  • viral vectors naked vectors, DNA, or RNA, among other delivery vehicles known in the art.
  • a CRISPR nuclease and/or a polynucleotide encoding the CRIPSR nuclease, and optionally additional nucleotide molecules and/or additional proteins or peptides may be performed by utilizing a single delivery vehicle or method or a combination of different delivery vehicles or methods.
  • a CRISPR nuclease may be delivered to a cell utilizing an LNP, and a crRNA molecule and tracrRNA molecule may be delivered to the cell utilizing AAV.
  • a CRISPR nuclease may be delivered to a cell utilizing an AAV particle, and a crRNA molecule and tracrRNA molecule may be delivered to the cell utilizing a separate AAV particle, which may be advantageous due to size limitations.
  • RNA or DNA viral based systems for viral mediated delivery of nucleic acids take advantage of highly evolved processes for targeting a virus to specific cells in the body and trafficking the viral payload to the nucleus.
  • Viral vectors can be administered directly to patients (in vivo) or they can be used to treat cells in vitro and the modified cells are administered to patients (ex vivo).
  • RNA virus may be utilized for delivery of the RNA compositions described herein. Additionally, high transduction efficiencies have been observed in many different cell types and target tissues.
  • Nucleic acid of the invention may be delivered by non-integrating lentivirus.
  • RNA delivery with Lentivirus is utilized.
  • the lentivirus includes mRNA of the nuclease, RNA of the guide.
  • the lentivirus includes mRNA of the nuclease, RNA of the guide and a donor template.
  • the lentivirus includes the nuclease protein, guide RNA.
  • the lentivirus includes the nuclease protein, guide RNA and/or a donor template for gene editing via, for example, homology directed repair.
  • the lentivirus includes mRNA of the nuclease, DNA-targeting RNA, and the tracrRNA.
  • the lentivirus includes mRNA of the nuclease, DNA-targeting RNA, and the tracrRNA, and a donor template.
  • the lentivirus includes the nuclease protein, DNA-targeting RNA, and the tracrRNA.
  • the lentivirus includes the nuclease protein, DNA-targeting RNA, and the tracrRNA, and a donor template for gene editing via, for example, homology directed repair.
  • the tropism of a retrovirus can be altered by incorporating foreign envelope proteins, expanding the potential target population of target cells.
  • Lentiviral vectors are retroviral vectors that are able to transduce or infect non-dividing cells and typically produce high viral titers. Selection of a retroviral gene transfer system depends on the target tissue. Retroviral vectors are comprised of cis-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence.
  • retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (See, e.g., Buchschacher et al. (1992); Johann et al. (1992); Sommerfelt et al. (1990); Wilson et al. (1989); Miller et al. (1991); PCT International Publication No. WO/1994/026877A1).
  • At least six viral vector approaches are currently available for gene transfer in clinical trials, which utilize approaches that involve complementation of defective vectors by genes inserted into helper cell lines to generate the transducing agent.
  • pLASN and MFG-S are examples of retroviral vectors that have been used in clinical trials (See Dunbar et al., 1995; Kohn et al., 1995; Malech et al., 1997).
  • PA317/pLASN was the first therapeutic vector used in a gene therapy trial (Blaese et al., 1995). Transduction efficiencies of 50% or greater have been observed for MFG-S packaged vectors. (Ellem et al., (1997); Dranoff et al., 1997).
  • Packaging cells are used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells, which package adenovirus, AAV, and Psi-2 cells or PA317 cells, which package retrovirus.
  • Viral vectors used in gene therapy are usually generated by a producer cell line that packages a nucleic acid vector into a viral particle. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host (if applicable), other viral sequences being replaced by an expression cassette encoding the protein to be expressed. The missing viral functions are supplied in trans by the packaging cell line.
  • AAV vectors used in gene therapy typically only possess inverted terminal repeat (ITR) sequences from the AAV genome which are required for packaging and integration into the host genome.
  • ITR inverted terminal repeat
  • Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences.
  • the cell line is also infected with adenovirus as a helper.
  • the helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid.
  • the helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV. Additionally, AAV can be produced at clinical scale using baculovirus systems (see U.S. Patent No.7,479,554).
  • a viral vector can be modified to have specificity for a given cell type by expressing a ligand as a fusion protein with a viral coat protein on the outer surface of the virus.
  • the ligand is chosen to have affinity for a receptor known to be present on the cell type of interest.
  • Han et al. (1995) reported that Moloney murine leukemia virus can be modified to express human heregulin fused to gp70, and the recombinant virus infects certain human breast cancer cells expressing human epidermal growth factor receptor.
  • filamentous phage can be engineered to display antibody fragments (e.g., FAB or Fv) having specific binding affinity for virtually any chosen cellular receptor.
  • Gene therapy vectors can be delivered in vivo by administration to an individual patient, typically by systemic administration (e.g., intravitreal, intravenous, intraperitoneal, intramuscular, subdermal, or intracranial infusion) or topical application, as described below.
  • vectors can be delivered to cells ex vivo, such as cells explanted from an individual patient (e.g., lymphocytes, bone marrow aspirates, tissue biopsy) or universal donor hematopoietic stem cells, followed by reimplantation of the cells into a patient, optionally after selection for cells which have incorporated the vector.
  • a non-limiting exemplary ex vivo approach may involve removal of tissue (e.g., peripheral blood, bone marrow, and spleen) from a patient for culture, nucleic acid transfer to the cultured cells (e.g., hematopoietic stem cells), followed by grafting the cells to a target tissue (e.g., bone marrow, and spleen) of the patient.
  • tissue e.g., peripheral blood, bone marrow, and spleen
  • the stem cell or hematopoietic stem cell may be further treated with a viability enhancer.
  • cells are isolated from the subject organism, transfected with a nucleic acid composition, and re-infused back into the subject organism (e.g., patient).
  • a nucleic acid composition e.g., a nucleic acid composition
  • Suitable cells include, but are not limited to, eukaryotic cells and/or cell lines.
  • Non- limiting examples of such cells or cell lines generated from such cells include COS, CHO (e.g., CHO--S, CHO-K1, CHO-DG44, CHO-DUXB11, CHO-DUKX, CHOK1SV), VERO, MDCK, WI38, V79, B14AF28-G3, BHK, HaK, NSO, SP2/0-Ag14, HeLa, HEK293 (e.g., HEK293-F, HEK293-H, HEK293-T), perC6 cells, any plant cell (differentiated or undifferentiated), as well as insect cells such as Spodopterafugiperda (Sf), or fungal cells such as Saccharomyces, Pichia and Schizosaccharomyces.
  • COS COS
  • CHO e.g., CHO--S, CHO-K1, CHO-DG44, CHO-DUXB11, CHO-DUKX, CHOK1SV
  • the cell line is a CHO-K1, MDCK or HEK293 cell line.
  • primary cells may be isolated and used ex vivo for reintroduction into the subject to be treated following treatment with a guided nuclease system (e.g. CRISPR/Cas).
  • Suitable primary cells include peripheral blood mononuclear cells (PBMC), and other blood cell subsets such as, but not limited to, CD4+ T cells or CD8+ T cells.
  • PBMC peripheral blood mononuclear cells
  • Suitable cells also include stem cells such as, by way of example, embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells (CD34+), neuronal stem cells and mesenchymal stem cells.
  • stem cells are used in ex vivo procedures for cell transfection and gene therapy.
  • the advantage to using stem cells is that they can be differentiated into other cell types in vitro, or can be introduced into a mammal (such as the donor of the cells) where they will engraft in the bone marrow.
  • Methods for differentiating CD34+ cells in vitro into clinically important immune cell types using cytokines such a GM-CSF, IFN-gamma, and TNF-alpha are known (as a non-limiting example see, Inaba et al., 1992).
  • cytokines such as GM-CSF, IFN-gamma, and TNF-alpha are known (as a non-limiting example see, Inaba et al., 1992).
  • Stem cells are isolated for transduction and differentiation using known methods.
  • stem cells are isolated from bone marrow cells by panning the bone marrow cells with antibodies which bind unwanted cells, such as CD4+ and CD8+ (T cells), CD45+(panB cells), GR-1 (granulocytes), and Iad (differentiated antigen presenting cells) (as a non-limiting example, see Inaba et al., 1992).
  • stem cells that have been modified may also be used in some embodiments.
  • Vectors e.g., retroviruses, liposomes, etc.
  • therapeutic nucleic acid compositions can also be administered directly to an organism for transduction of cells in vivo.
  • Administration is by any of the routes normally used for introducing a molecule into ultimate contact with blood or tissue cells including, but not limited to, injection, infusion, topical application (e.g., eye drops and cream) and electroporation. Suitable methods of administering such nucleic acids are available and well known to those of skill in the art, and, although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective reaction than another route. According to some embodiments, the composition is delivered via IV injection.
  • Vectors suitable for introduction of transgenes into immune cells include non-integrating lentivirus vectors. See, e.g., U.S. Publication No.2009/0117617.
  • compositions described herein may be delivered to a target cell using a non-integrating lentiviral particle method, e.g. a LentiFlash® system.
  • a non-integrating lentiviral particle method e.g. a LentiFlash® system.
  • Such a method may be used to deliver mRNA or other types of RNAs into the target cell, such that delivery of the RNAs to the target cell results in assembly of the compositions described herein inside of the target cell.
  • a non-integrating lentiviral particle method e.g. a LentiFlash® system.
  • Such a method may be used to deliver mRNA or other types of RNAs into the target cell, such that delivery of the RNAs to the target cell results in assembly of the compositions described herein inside of the target cell.
  • Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition.
  • compositions and methods may also be used in the manufacture of a medicament for treating a disease or disorder in a patient.
  • Mechanisms of Action for B2M Safe Harbor Knock-in Methods the instant invention may be utilized to apply a CRISPR nuclease to process a B2M allele in order to introduce a sequence to a safe harbor site within the B2M allele and thereby control expression of the introduced sequence by the promoter of the B2M allele.
  • a specific guide sequence may be selected from Table 1 based on the targeted position and the type of CRISPR nuclease used (e.g. according to a required PAM sequence).
  • the B2M gene is located on chromosome 15 and encodes the Beta-2 microglobulin protein.
  • a donor molecule may be used to introduce a desired sequence of nucleotides into a B2M safe harbor site via knock-in.
  • One strategy is to knock-in a sequence of nucleotides in the first intron or the first intron that follows the first coding exon of the B2M gene.
  • This strategy utilizes an RNA molecule to target a CRISPR nuclease to Intron 1 of the B2M gene and thereby mediate a double-stranded break. Since the break is mediated in a nonregulatory region, it is not expected to affect the expression of the gene.
  • the sequence is inserted as a new exon (namely, Exon 2), by adding splicing acceptor (SA) and splicing donor (SD) elements to the knock-in donor cassette.
  • SA splicing acceptor
  • SD splicing donor
  • the donor cassette includes a 2A self-cleaving peptide and/or the signal peptide of B2M at the C-terminus of the inserted gene, which is cleaved in the endoplasmic reticulum and enables the separation of the inserted sequence protein expression product from B2M protein.
  • Another strategy is to knock-in a sequence of nucleotides in the B2M gene by replacing the stop codon. In this case a biallelic break will be mediated in a 3’UTR region either up to 150 nucleotides downstream of the stop codon or upstream to the stop codon but in an intron region.
  • RNA guide sequences which specifically target alleles of the B2M gene [0193] Although a large number of guide sequences can be designed to target a B2M allele, the nucleotide sequences described in Table 1 identified by SEQ ID NOs: 1-28998 below were specifically selected to effectively implement the methods set forth herein.
  • Table 1 lists guide sequences designed for use as described in the embodiments above to associate specific sequences within a B2M allele.
  • Each engineered guide molecule is further designed such as to associate with a target genomic DNA sequence of interest that lies next to a protospacer adjacent motif (PAM), e.g., a PAM matching the sequence NGG or NAG, where “N” is any nucleobase.
  • PAM protospacer adjacent motif
  • the guide sequences were designed to work in conjunction with one or more different CRISPR nucleases, including, but not limited to, e.g.
  • SpCas9WT (PAM SEQ: NGG), SpCas9.VQR.1 (PAM SEQ: NGAN), SpCas9.VQR.2 (PAM SEQ: NGNG), SpCas9.EQR (PAM SEQ: NGAG), SpCas9.VRER (PAM SEQ: NGCG), SaCas9WT (PAM SEQ: NNGRRT), SpRY (PAM SEQ: NRN or NYN), NmCas9WT (PAM SEQ: NNNNGATT), Cpf1 (PAM SEQ: TTTV), JeCas9WT (PAM SEQ: NNNVRYM), OMNI-50 (PAM SEQ: NGG), OMNI-79 (PAM SEQ: NGG), OMNI-103 (PAM SEQ: NNRACT), OMNI-159 (NNNNCMAN), or OMNI-124 (PAM SEQ: NNGNRMNN).
  • RNA molecules of the present invention are each designed to form complexes in conjunction with one or more different CRISPR nucleases and designed to target polynucleotide sequences of interest utilizing one or more different PAM sequences respective to the CRISPR nuclease utilized.
  • Table 1 Guide sequence portions designed to associate with specific B2M gene targets T arget SEQ ID NOs: of SEQ ID NOs: of SEQ ID NOs: of 2 0 base guides 21 base guides 22 base guides ase and UCSC Genome Browser assembly ID: hg38, Sequencing/Assembly provider ID: Genome Reference Consortium Human GRCh38.p12 (GCA_000001405.27). Assembly date: Dec.2013 initial release; Dec.2017 patch release 12. [0197] Examples are provided below to facilitate a more complete understanding of the invention. The following examples illustrate the exemplary modes of making and practicing the invention. However, the scope of the invention is not limited to specific embodiments disclosed in these Examples, which are for purposes of illustration only.
  • Example 1 B2M On-Target Activity Analysis [0198] Guide sequences comprising 17-50 contiguous nucleotides containing nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-28998 are screened for high on target activity using a CRISPR nuclease in a target cell. On-target activity is determined by DNA capillary electrophoresis analysis.
  • Example 2 Insertion of a Sequence of Interest at a B2M Safe Harbor Site [0199] B2M is highly expressed in target cells (e.g. macrophages) and contains a signal peptide (SP) in its first exon.
  • target cells e.g. macrophages
  • SP signal peptide
  • HDR homology directed repair
  • CRISPR-based ribonucleoprotein (RNP) composition allows editing in Intron 1 of B2M [0200]
  • a guide screen in HeLa cells was performed to identify a potential CRISPR-based RNP composition which allows for editing in Intron 1 of B2M.
  • an OMNI-50 nuclease coding plasmid 64ng was co-transfected with each of the guide expressing plasmids (20ng) in a 96-well plate format using jetOPTIMUS reagent (Polyplus). Cells were harvested 72 hours post-transfection, genomic DNA was extracted, and the DNA was analyzed using next generation sequencing (NGS).
  • NGS next generation sequencing
  • the top performing guide was then examined in hematopoietic stem cells (HSCs) using electroporation of RNPs.
  • HSCs hematopoietic stem cells
  • the current composition chosen for editing and performing HDR in Intron 1 of B2M is a B2M_g57 guide molecule + OMNI-50 V6172 nuclease.
  • HDR editing template integration in Intron 1 of B2M [0202] AAV particles carrying a donor construct encoding for GFP fused to the self-cleaving P2A-T2A elements (2A) and SP were generated to examine the feasibility of HDR editing template integration in Intron 1 of B2M.
  • the donor targets Intron 1 of B2M downstream to the B2M SP.
  • the donor construct contains a GFP-2A-SP sequence flanked by a splice acceptor and splice donor, and further flanked by 800 basepair homology arms matching the B2M_g57 cleavage site (see SEQ ID NO: 29012 and Table 4).
  • CRISPR-mediated DNA cleavage facilitates HDR integration of the donor sequence into B2M Intron 1. This results in a bicistronic transcript with a single open reading frame encoding for SP-GFP-2A- SP-B2M which, following 2A self-cleaving, results in two separated polypeptides of SP-GFP and SP-B2M.
  • GFP integration into a B2M locus in HSCs [0203] The above approach was first examined in primary HSCs. Cells were electroporated with an RNP composed of an OMNI-50 V6172 nuclease and a B2M_g57 guide molecule, followed by infection with AAV6 particles carrying a GFP donor molecule at a multiplicity of infection (MOI) of 10 5 . [0204] First, HSCs were analyzed by FACS for GFP expression three days following treatment (Fig.3A).
  • edited HSCs retain GFP expression and secretion after differentiation into macrophages.
  • edited HSCs were differentiated into macrophages as previously described (Gomez-Ospina et al, Nature Communications, 2019).
  • cells were plated in differentiation media (SFEM II supplemented with SCF (200 ng/ml), Il-3 (10 ng/mL), IL-6 (10 ng/mL), FLT3-L (50 ng/mL), M-CSF (10 ng/ml), GM-CSF (10 ng/ml), penicillin/streptomycin (10 U/mL) for 48 hours.
  • differentiation media SFEM II supplemented with SCF (200 ng/ml), Il-3 (10 ng/mL), IL-6 (10 ng/mL), FLT3-L (50 ng/mL), M-CSF (10 ng/ml), GM-CSF (10 ng/ml), penicillin/streptomycin (10 U/mL) for 48 hours.
  • Adherent cells were maintained in maintenance medium (RPMI supplemented with FBS (10% v/v), M-CSF (10 ng/ml), GM-CSF (10 ng/ml), and penicillin/streptomycin (10 U/mL)), for 19 days.
  • maintenance medium RPMI supplemented with FBS (10% v/v), M-CSF (10 ng/ml), GM-CSF (10 ng/ml), and penicillin/streptomycin (10 U/mL)
  • B2M expression signal was also measured using FACS to confirm that the B2M gene is still expressed after the differentiation procedure and HDR (Fig. 4B). While we detected a reduction in B2M expression at the Day 7 timepoint in the originating HSCs, here we detected recovery of B2M expression as almost all GFP-expressing cells were B2M + and over 90% exhibited WT-levels of signal. To examine GFP secretion, we performed an ELISA assay of the cell media (Fig. 4C) and observed GFP secretion in the edited population.
  • TACTGACATCCACTTTGCCTTTCTCTCCACAG (SEQ ID NO: 29007) T T G C C C A C G A C C G C G G A template molecule described in Example 2, above (SEQ ID NO: 29012).
  • GLVR1 a receptor for gibbon ape leukemia virus, is homologous to a phosphate permease of Neurospora crassa and is expressed at high levels in the brain and thymus”, J Virol 66(3):1635-40. Judge et al. (2006) “Design of noninflammatory synthetic siRNA mediating potent gene silencing in vivo”, Mol Ther.13(3):494-505. Kohn et al. (1995) “Engraftment of gene-modified umbilical cord blood cells in neonates with adnosine deaminase deficiency”, Nature Medicine 1:1017-23.

Abstract

La présente invention concerne des molécules d'ARN comprenant une partie de séquence de guidage ayant 17-50 nucléotides contigus dans la séquence présentée dans l'une quelconque des SEQ ID NO : 1-28998, ainsi que des compositions, des méthodes et des utilisations associées.
PCT/US2023/073068 2022-08-30 2023-08-29 Stratégies pour knock-ins au niveau de sites safe harbor b2m WO2024050349A2 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202263373990P 2022-08-30 2022-08-30
US63/373,990 2022-08-30
US202263477888P 2022-12-30 2022-12-30
US63/477,888 2022-12-30

Publications (1)

Publication Number Publication Date
WO2024050349A2 true WO2024050349A2 (fr) 2024-03-07

Family

ID=90098702

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/073068 WO2024050349A2 (fr) 2022-08-30 2023-08-29 Stratégies pour knock-ins au niveau de sites safe harbor b2m

Country Status (1)

Country Link
WO (1) WO2024050349A2 (fr)

Similar Documents

Publication Publication Date Title
EP4259159A1 (fr) Inactivation biallélique de trac
EP4259160A1 (fr) Inactivation biallélique de b2m
JP2023527464A (ja) ＳＡＲＭ１の両対立ｋ遺伝子ノックアウト
WO2024050349A2 (fr) Stratégies pour knock-ins au niveau de sites safe harbor b2m
WO2021007502A2 (fr) Inactivation différentielle d'un allèle hétérozygote de rpe65
WO2024015968A2 (fr) Stratégies de knock-in dans des sites de zone de sécurité en aplp2
WO2020176463A9 (fr) Inactivation différentielle d'un allèle hétérozygote de stat1
US20230212562A1 (en) Differential knockout of a heterozygous allele of samd9l
JP2024510604A (ja) Ｃ３セーフハーバー部位へのノックイン戦略
US20230332146A1 (en) Differential knockout of a heterozygous allele of samd9
US20230175020A1 (en) Compositions and methods for promoting gene editing of cxcr4 gene
WO2024064607A2 (fr) Inactivation biallélique de tet2
WO2024064623A2 (fr) Inactivation biallélique de cish
WO2024064683A2 (fr) Inactivation biallélique de ciita
WO2024064613A2 (fr) Inactivation biallélique de hla-e
WO2024064637A2 (fr) Inactivation biallélique de faslg
WO2024064633A2 (fr) Inactivation biallélique de pdcd1
WO2024064606A2 (fr) Inactivation biallélique de ctla4
WO2023004375A2 (fr) Inactivations du virus de l'hépatite b (vhb)
AU2022245996A1 (en) Compositions and methods for treating hypercholesterolemia
WO2023102407A2 (fr) Variants de nucléase omni-79 à haute activité génétiquement modifiés
WO2024097900A1 (fr) Compositions et procédés d'excision d'expansion de répétition dans le facteur de transcription 4 (tcf4)
WO2024020484A2 (fr) Inactivation biallélique d'angptl3
WO2023102478A2 (fr) Expression réduite de sarm1 pour une utilisation en thérapie cellulaire
JP2024506608A (ja) Ｏｍｎｉ－１０３ ｃｒｉｓｐｒヌクレアーゼ

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23861486

Country of ref document: EP

Kind code of ref document: A2