WO2024048820A1 - Système d'évaluation de la pluripotence de cellules souches porcines et procédé d'évaluation de la pluripotence l'utilisant - Google Patents

Système d'évaluation de la pluripotence de cellules souches porcines et procédé d'évaluation de la pluripotence l'utilisant Download PDF

Info

Publication number
WO2024048820A1
WO2024048820A1 PCT/KR2022/013148 KR2022013148W WO2024048820A1 WO 2024048820 A1 WO2024048820 A1 WO 2024048820A1 KR 2022013148 W KR2022013148 W KR 2022013148W WO 2024048820 A1 WO2024048820 A1 WO 2024048820A1
Authority
WO
WIPO (PCT)
Prior art keywords
reporter gene
pluripotency
porcine
stem cell
seq
Prior art date
Application number
PCT/KR2022/013148
Other languages
English (en)
Korean (ko)
Inventor
이창규
김승훈
최광환
이동경
이민균
Original Assignee
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교산학협력단 filed Critical 서울대학교산학협력단
Priority to PCT/KR2022/013148 priority Critical patent/WO2024048820A1/fr
Publication of WO2024048820A1 publication Critical patent/WO2024048820A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/6818—Hybridisation assays characterised by the detection means involving interaction of two or more labels, e.g. resonant energy transfer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters

Definitions

  • the present invention relates to a pluripotency evaluation system and method for porcine stem cells.
  • Stem cells are cells with self-renewal and pluripotency (the ability to differentiate into various tissues).
  • the first stem cells were embryonic stem cells (ESC) derived from the inner cell mass (ICM) of the blastocyst in the 1980s, and later embryonic germ cells (EGC) derived from primordial germ cells, and introduction of foreign genes.
  • ESC embryonic stem cells
  • ICM inner cell mass
  • ECC embryonic germ cells
  • iPSC induced pluripotent stem cells
  • the state of stem cells is divided into a naive state and a prime state depending on the ability to form chimeras after the cells are injected into the blastocyst.
  • a naive state chimeras are formed after cells are injected into the blastocyst, whereas in the prime state, chimeras are not formed.
  • the naive state is a state of higher pluripotency and has been reported in rats, but has not yet been reported in pigs.
  • Stem cells have the ability to differentiate into other cells and are proposed as a treatment for incurable and incurable diseases. Additionally, it has high academic value as an embryological or epigenetic research model. In particular, stem cells from economic animals have high research value in the species itself for preserving genetic resources of individuals with excellent economic traits and establishing transgenic animals.
  • pigs are medium-sized animals with high physiological similarity to humans, and have been suggested to be suitable for treating human diseases and as disease model animals.
  • pig stem cells can be used as a preclinical step in treatment using human stem cells. Therefore, the establishment and research of pig stem cells will be helpful not only for research on livestock species themselves, but also for human stem cell research and clinical application.
  • OCT4 gene is essential for stem cells to maintain pluripotency (differentiation into three germ layers while maintaining an undifferentiated state).
  • the OCT4 gene was specifically expressed in pluripotent cells (internal cell mass, embryonic stem cells, and primordial germ cells). It was reported that deletion of the OCT4 gene resulted in loss of cell pluripotency and differentiation into placental cells, and it was confirmed that mouse embryos with OCT4 deletion failed to form an internal cell mass during blastocyst formation.
  • OCT4 is a reprogramming factor that is important in the establishment of induced pluripotent stem cells, and is used as a pluripotency marker gene for embryonic or induced pluripotent stem cells in species in which stem cells have not yet been established.
  • enhancers There are two enhancers and a core promoter in the transcriptional regulatory part of OCT4. It was confirmed that different enhancers operate depending on the state of pluripotency. Among the two enhancers, the enhancer located further from the exon was more active at the higher level of pluripotency, and the enhancer located closer to the exon was more active at the lower level of pluripotency. In studies of mice and humans, these differences are being applied to reporter systems that assess the state of pluripotency.
  • OCT4 is expressed differently in humans, mice, and pigs because it has low homology in the upstream region sequence. Accordingly, it was discovered that the state of pig pluripotent stem cells could be properly evaluated in pigs when a reporter system was applied using pig OCT4, and the present invention was completed.
  • the present invention provides a pluripotency evaluation system that shows different fluorescence depending on the state of pluripotency in pig stem cells using a dual vector system, a stem cell marker selection method using the same, a stem cell isolation method, and a stem cell pluripotency test. It's about evaluation methods.
  • the first form of the present invention includes SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 5, and includes a first vector containing a first reporter gene; and SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5, and a second vector comprising a second reporter gene, wherein the first reporter gene and the second reporter gene are different from each other. It is a cell pluripotency evaluation system.
  • the first reporter and the second reporter can be used as any reporter pair as long as they are distinguished from each other.
  • GFP GFP reporter and RFP reporter. More specifically, GFP, EGFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen, T-Sapphire, EBFP, EBFP2, Azurite, mTagBFP, ECFP, mECFP, Cerulean 433, mTurquoise, CyPet, AmCyan1, Midori-Ishi Cyan, TagCFP, mTFP1 (Teal), EYFP, Topaz, Venus, mCitrine, YPet, TagYFP, PhiYFP, ZsYellow1, mBanana, Kusabira Orange, Kusabira Orange2, mOrange, mOrange2, dTomato, dTomato-Tandem, TagRFP, TagRFP-T, DsRed, DsRed2, DsRed-Express (T1),
  • the first vector contains SEQ ID NO: 28, and the second vector contains SEQ ID NO: 29.
  • the second form of the present invention is a method for evaluating porcine stem cell pluripotency using the above-described porcine stem cell pluripotency evaluation system.
  • Pluripotency is evaluated as having the highest pluripotency when the first reporter gene is expressed more than the second reporter gene among the first and second reporter genes.
  • This pluripotency evaluation system can be used to determine the optimal medium composition for culturing porcine embryonic stem cells. This can be used to select an effective medium composition for reprogramming when producing induced pluripotent stem cells.
  • a third form of the present invention includes introducing the porcine stem cell pluripotency evaluation system into each porcine cell; Comparing marker expression of a first pig cell in which the first reporter gene is expressed more than the second reporter gene and a second pig cell in which the first reporter gene is expressed less than the second reporter gene; and selecting a marker that is specifically expressed only in first pig cells in which the first reporter gene is expressed more than the second reporter gene.
  • a fourth form of the present invention includes introducing the porcine stem cell pluripotency evaluation system into porcine cells; And a cell in which both the first reporter gene and the second reporter gene are expressed, a cell in which only the first reporter gene is expressed, a cell in which only the second reporter gene is expressed, and a cell in which both the first reporter gene and the second reporter gene are not expressed.
  • a method for isolating porcine pluripotent stem cells comprising the step of isolating cells. Cells can be separated using FACS.
  • reporter system By introducing the reporter system according to the present invention, it becomes possible to evaluate the state of pluripotency in living tissues and cells in real time, so it can be used as a basis for research to analyze stem cell establishment and embryonic development processes. Accordingly, precise functional analysis of pig stem cells is possible.
  • This reporter system can non-destructively classify pluripotent cells and distinguish between naive and prime states.
  • the process of reprogramming fibroblasts into induced pluripotent stem cells is the step in which pluripotency is established.
  • the reporter system according to the present invention can monitor the level of pluripotency and confirm the expression pattern at the stage when pig species-specific pluripotency is established. Additionally, by using a reporter system, it is possible to confirm which substances in the culture medium used in the reprogramming process are important for higher pluripotency, or which genes can be used as pluripotency markers.
  • the early embryonic development process of a pig embryo sets the standard for a state of high pluripotency immediately after introduction into an in vitro produced embryo, and is a stage in which pluripotency gradually decreases during the 7-day process of developing into a blastocyst.
  • the reporter system is introduced into embryos produced in vitro and is used to monitor the level of pluripotency and analyze expression patterns as differentiation occurs starting from a high pluripotency stage. Through changes and comparative analysis of pluripotency-related markers, mechanisms of pluripotency, etc. It can be used to analyze.
  • the step of establishing embryonic stem cell lines from in vitro produced pig embryos with reporter introduction it can be used to verify the level of pluripotency of pig embryonic stem cells grown in the currently optimized pig embryonic stem cell culture medium.
  • the reporter system according to the present invention can be used to monitor pluripotency levels and analyze expression patterns in the establishment, maintenance, and differentiation of porcine embryonic stem cells.
  • stem cells can be separated according to the level of pluripotency, and any genetic differences can be identified for each level of pluripotency. This allows the identification of high pluripotency (naive) and low pluripotency (primed). It will be possible to discover marker genes that appear as enemies. Additionally, using the genes discovered in this way and using FACS, it can be used to study pig stem cells that have higher pluripotency than current stem cells.
  • FIG. 1 silver pig OCT4 An upstream region-based dual reporter system shows fluorescence expression in blastocysts after 7 days of early embryonic development in in vitro-produced embryos introduced via microinjection. Green fluorescent protein is associated with the expression of distal enhancers, and red fluorescent protein is associated with the expression of proximal enhancers. It can be seen that both enhancers are used in pig blastocysts.
  • Figure 2 is We show a comparison of the expression levels of distal and proximal enhancers in day 7 blastocysts of in vitro produced embryos into which the porcine OCT4 upstream region-based dual reporter system was introduced via microinjection. As with previously reported naive cells, the expression level of the distant enhancer was higher than that of the local enhancer in pig blastocysts.
  • Figure 3 shows the porcine OCT4 upstream region-based dual reporter system establishing embryonic stem cells using the inner cell mass generated when in vitro produced embryos introduced through microinjection develop into blastocysts. And fluorescence is shown in stem cells.
  • stem cells introduced with the reporter system show green and red fluorescence.
  • stem cells that were not introduced with the reporter system used as a control did not show green or red fluorescence. Yellow fluorescence is nuclear staining.
  • Figure 4 shows reprogramming of porcine embryonic fibroblasts transduced with the porcine OCT4 upstream region-based dual reporter system in FGF2- or LIF-containing medium.
  • the reporter system is introduced into porcine embryonic fibroblasts for 48 hours starting 5 days before reprogramming, and the introduced cells are treated with G418 for 72 hours starting 3 days before reprogramming to select only cells that have completed the introduction. Just separated them. Afterwards, reprogramming is carried out for 15 days, showing the overall schedule of culturing cells in a LIF-dependent or FGF-dependent manner in medium supplemented with LIF, DOX or bFGF and DOX.
  • B Shows the results of introducing DE-GFP and PE-RFP vectors.
  • Ladder means DNA ladder, and TG and TR identify DE-GFP and PE-RFP in porcine embryonic fibroblasts, respectively.
  • CG and CR are negative controls that confirmed DE-GFP and PE-RFP in non-introduced cells, respectively, and VG and VR are positive controls that confirmed DE-GFP and PE-RFP using vectors.
  • C In FGF- and LIF-dependent conditions, an increase in cell number and change in morphology was confirmed for 15 days during which Dox reprogramming was performed. Cell numbers increased more in FGF-dependent conditions than in LIF-dependent conditions. confirmed.
  • Figure 5 shows porcine embryonic fibroblasts introduced with a reporter system were reprogrammed for 15 days in reprogramming culture medium supplemented with FGF or LIF, and qPCR was performed on samples collected 0, 3, 6, 9, 12, and 15 days after culture. Shows the results of performing.
  • the expression patterns of genes such as ECAD, NANOG, OCT4A, SALL4, DAX1, SOX2, CRIPTO, and KLF2 show differences in FGF- or LIF-dependent reprogramming culture conditions during the reprogramming period.
  • Figure 6 shows the far and near enhancer activity patterns in LIF- or FGF-dependent DOX reprogramming medium culture conditions.
  • GFP represents the activity of the far enhancer
  • RFP represents the activity of the near enhancer.
  • the pattern of enhancer activity shows differences depending on the culture conditions for LIF- or FGF-dependent DOX reprogramming.
  • B In both LIF- or FGF-dependent DOX reprogramming medium culture conditions, the expression level of the local enhancer is higher than that of the distant enhancer.
  • Figure 7 shows the results confirming at the protein level that the reporter system introduced into porcine fibroblasts can function during LIF- or FGF-dependent DOX reprogramming.
  • A On day 0 before reprogramming, green fluorescence and red fluorescence associated with the expression of the enhancer are not visible, except for blue staining of the nucleus. However, after 15 days of reprogramming, it was confirmed that both the green fluorescent protein associated with the far enhancer and the red fluorescent protein associated with the near enhancer were expressed under both LIF- or FGF-dependent culture conditions.
  • OCT4 upper nucleotide sequence alignment and sequence-based analysis
  • the 3.5-kb porcine OCT4 sequence was compared with Oct4 sequences from humans, goats, rabbits, rats, cows, and voles from the University of California, Santa Cruz (https://genome.ucsc.edu/).
  • Computer analysis of the DNA sequence was performed using DNA sequence-based analysis programs ALIGN Query, Clustal, and BlastN. Putative transcription factor binding sites (TFBS) were identified and compared in rat and pig DNA sequences.
  • TFBS Putative transcription factor binding sites
  • OCT4-GFP OCT4 upstream region-based GFP reporter system
  • 3.2 kb of the OCT4 regulatory region was inserted into the peGFP vector.
  • the 188,961-bp BAC clone CH242-102G9 was used as sample DNA. It was used to construct the pOCT4- ⁇ PE-eGFP vector (DE-GFP) containing CR1 and 4 and the pOCT4- ⁇ DE-DsRed2 vector (PE-RFP) containing CR1, 2, and 3. Based on this, four vectors were constructed to perform luciferase analysis.
  • DE-GFP pOCT4- ⁇ PE-eGFP vector
  • PE-RFP pOCT4- ⁇ DE-DsRed2 vector
  • OCT4-Luc The longest pOCT4-pGL3 basic vector (OCT4-Luc) contains all conserved regions, the pOCT4- ⁇ PE-pGL3 basic vector (DE-Luc) contains CR1 and tetravalents, and the pOCT4- ⁇ DE-pGL3 vector (PE-Luc) contains CR1; 2 and 3 were included. Lastly, pOCT4-CP-pGL3 basic vector (CP-Luc) contained only CR1.
  • Mouse embryonic stem cell culture medium was Dulbecco's minimum Eagle's medium (DMEM) (Welgene) supplemented with 15% fetal bovine serum (FBS), 2mM GlutaMAX, 0.1mM ⁇ -mercaptoethanol, 1x minimum essential medium (MEM) non-essential amino acids ( Gibco), 1x antibiotic/antimycotic, and 1000 unit/mL leukemia inhibitory factor (LIF; Millipore, MA, USA).
  • DMEM Dulbecco's minimum Eagle's medium
  • FBS fetal bovine serum
  • MAM 1x minimum essential medium
  • Gibco 1x minimum essential medium non-essential amino acids
  • LIF leukemia inhibitory factor
  • the culture medium for embryonic cancer cells and embryonic fibroblasts consisted of DMEM (Welgene) supplemented with 10% FBS, 2mM GlutaMAX, 0.1mM ⁇ -mercaptoethanol, 1x MEM non-essential amino acids (Gibco), and 1x antibiotic/antimycotic.
  • the culture medium was changed daily, and all cells were cultured in humid conditions at 37 degrees Celsius and 5% CO 2 . When the embryonic stem cells and embryonic cancer cells were ready for passage, they were passaged using trypsin.
  • ES-E14TG2a mouse embryonic stem cells, P19 mouse embryonic cancer cells, and porcine embryonic fibroblasts were cultured in a 6-well plate (Nunc). Each reporter was introduced into cells using Lipofectamine 3000 reagent (Invitrogen) according to the manufacturer's protocol. Cell lysates were prepared 48 h after transduction. Luciferase activity was confirmed using the Luciferase Assay System (Promega). Introduction of the pGL3-Basic vector (Promega) containing no inserted DNA was used as a control to determine the basal level of luciferase activity.
  • ES-E14TG2a mouse embryonic stem cells were cultured in a 6-well plate (Nunc). Each reporter was introduced into cells using Lipofectamine 3000 reagent (Invitrogen) according to the manufacturer's protocol. After 48 hours, the cells were suspended through trypsin treatment. Cells were separated according to the level of fluorescence signal using FACSAria II (BD Bioscience).
  • qPCR Quantitative real-time PCR
  • qPCR was performed using the ABI 7300 Real-Time PCR System (Application Biosystems). Dynamo HS SYBR Green qPCR Kit (Thermo Scientific, Rockford, IL, USA) was used for real-time quantification of PCR products.
  • 0.1 ⁇ l of each primer listed in (Table 1) and 0.5 ⁇ l of cDNA were added to the 10 ⁇ l reaction mixture. The reaction was performed for 1 cycle at 95 ⁇ C for 10 minutes, followed by 40 cycles of 95 ⁇ C for 15 seconds and annealing temperature of 60 ⁇ C for 15 seconds. Separation curves were analyzed to confirm the specificity of the PCR products.
  • ACTB was used as a control gene to determine the relative expression level. All genes were measured in triplicate, and relative expression ratios were analyzed using the 2 - ⁇ Ct (threshold cycle) method.
  • GAPDH F TGCTCCTCCCCGTTCGAC (SEQ ID NO: 6)
  • R ATGCGGCCAAATCCGTTC (SEQ ID NO: 7)
  • E-CADHERIN F ATTCTGGGAGGCATCCTTGC (SEQ ID NO: 8)
  • R GTTGTCCCGGGTGTCATCTT (SEQ ID NO: 9)
  • SALL4 F TACCAGAGCCGAAGTCCAGA (SEQ ID NO: 10)
  • CRIPTO F TCCCAGTTTGTACCATCCAC (SEQ ID NO: 12)
  • NANOG F CATCTGCTGAGACCCTCGAC (SEQ ID NO: 14)
  • R: GGGTCTGCGAGAACACAGTT SEQ ID NO: 15
  • DAX1 F GGTACCAGGCCAGATTTGCT (SEQ ID NO: 16)
  • R
  • the present inventors confirmed the function of the reporter system according to the present invention at the protein level.
  • a number of porcine fibroblasts were reprogrammed and expressed at least one fluorescence.
  • Porcine iPSCs were in a heterogeneous state and contained multiple moderately unstable cell types due to spontaneous reprogramming under FGF- or LIF-dependent culture conditions. Therefore, multiple fluorescence expression patterns appeared in each cell colony.
  • the porcine embryonic fibroblast results show that the reporter system according to the present invention operates during porcine reprogramming at the protein level ( FIG . 7A).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne un système d'évaluation de la pluripotence des cellules souches porcines et un procédé d'évaluation de la pluripotence l'utilisant, et plus particulièrement un système d'évaluation de la pluripotence utilisant un système à double vecteur pour afficher différentes fluorescences en fonction de l'état de pluripotence des cellules souches porcines, ainsi qu'un procédé de sélection des marqueurs de cellules souches, un procédé de séparation des cellules souches et un procédé d'évaluation de la pluripotence des cellules souches, chacun utilisant le même système. L'Introduction du système rapporteur selon la présente invention permet des évaluations en temps réel de l'état de pluripotence dans des tissus et des cellules vivants.
PCT/KR2022/013148 2022-09-01 2022-09-01 Système d'évaluation de la pluripotence de cellules souches porcines et procédé d'évaluation de la pluripotence l'utilisant WO2024048820A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/KR2022/013148 WO2024048820A1 (fr) 2022-09-01 2022-09-01 Système d'évaluation de la pluripotence de cellules souches porcines et procédé d'évaluation de la pluripotence l'utilisant

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2022/013148 WO2024048820A1 (fr) 2022-09-01 2022-09-01 Système d'évaluation de la pluripotence de cellules souches porcines et procédé d'évaluation de la pluripotence l'utilisant

Publications (1)

Publication Number Publication Date
WO2024048820A1 true WO2024048820A1 (fr) 2024-03-07

Family

ID=90098046

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/013148 WO2024048820A1 (fr) 2022-09-01 2022-09-01 Système d'évaluation de la pluripotence de cellules souches porcines et procédé d'évaluation de la pluripotence l'utilisant

Country Status (1)

Country Link
WO (1) WO2024048820A1 (fr)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20170005203A (ko) * 2015-07-01 2017-01-12 건국대학교 산학협력단 이중형광마커 형질전환 마우스를 이용한 만능줄기세포 구별방법
KR101698984B1 (ko) * 2014-11-10 2017-01-24 부산대학교 산학협력단 렙틴을 포함하는 유도만능줄기세포로의 역분화 유도용 조성물 및 이를 이용한 유도만능줄기세포로의 역분화 유도 방법
KR20210157208A (ko) * 2020-06-19 2021-12-28 한국화학연구원 형광단백질로 표지된 사이토크롬 p450 으로 형질전환된 인간유도 만능줄기 세포주 및 이를 이용한 ahr 조절제 스크리닝 방법
KR20220124300A (ko) * 2021-03-02 2022-09-14 서울대학교산학협력단 돼지 줄기세포 만능성 평가 시스템 및 이를 이용한 만능성 평가 방법

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101698984B1 (ko) * 2014-11-10 2017-01-24 부산대학교 산학협력단 렙틴을 포함하는 유도만능줄기세포로의 역분화 유도용 조성물 및 이를 이용한 유도만능줄기세포로의 역분화 유도 방법
KR20170005203A (ko) * 2015-07-01 2017-01-12 건국대학교 산학협력단 이중형광마커 형질전환 마우스를 이용한 만능줄기세포 구별방법
KR20210157208A (ko) * 2020-06-19 2021-12-28 한국화학연구원 형광단백질로 표지된 사이토크롬 p450 으로 형질전환된 인간유도 만능줄기 세포주 및 이를 이용한 ahr 조절제 스크리닝 방법
KR20220124300A (ko) * 2021-03-02 2022-09-14 서울대학교산학협력단 돼지 줄기세포 만능성 평가 시스템 및 이를 이용한 만능성 평가 방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
KIM SEUNG-HUN, CHOI KWANG-HWAN, LEE DONG-KYUNG, LEE MINGYUN, HWANG JAE YEON, LEE CHANG-KYU: "Identification and Characterization of the OCT4 Upstream Regulatory Region in Sus scrofa", STEM CELLS INTERNATIONAL, HINDAWI PUBLISHING CORPORATION, US, vol. 2019, 12 March 2019 (2019-03-12), US , pages 1 - 11, XP093143517, ISSN: 1687-966X, DOI: 10.1155/2019/2130973 *
KIM SEUNG-HUN, CHOI KWANG-HWAN, LEE MINGYUN, LEE DONG-KYUNG, LEE CHANG-KYU: "Porcine OCT4 Reporter System can Monitor Species-Specific Pluripotency During Somatic Cell Reprogramming", RESEARCH SQUARE, 14 August 2020 (2020-08-14), XP093143518, Retrieved from the Internet <URL:https://www.researchgate.net/publication/343730916_Porcine_OCT4_Reporter_System_can_Monitor_Species-Specific_Pluripotency_During_Somatic_Cell_Reprogramming/fulltext/5f3c9386458515b7292c7ab9/Porcine-OCT4-Reporter-System-can-Monitor-Species-Specific-Pluripotency-During-Somatic-Cell-Reprogramming.pdf> [retrieved on 20240320], DOI: 10.21203/rs.3.rs-59439/v1 *

Similar Documents

Publication Publication Date Title
Singh et al. Describing the stem cell potency: the various methods of functional assessment and in silico diagnostics
Lai et al. Correction of Hirschsprung-associated mutations in human induced pluripotent stem cells via clustered regularly interspaced short palindromic repeats/Cas9, restores neural crest cell function
Xu et al. Specific arrest of cardiogenesis in cultured embryonic stem cells lacking Cripto-1
JP4901471B2 (ja) 体細胞核初期化物質のスクリーニング方法
US20030224345A1 (en) Screening assays for identifying differentiation-inducing agents and production of differentiated cells for cell therapy
Azami et al. Regulation of the ERK signalling pathway in the developing mouse blastocyst
Bruce et al. Dynamic transcription programs during ES cell differentiation towards mesoderm in serum versus serum-free BMP4 culture
US20040219563A1 (en) Method using gene trapped stem cells for making pathways of stem cell differentiation and making and isolating differentiated cells
US20170313978A1 (en) Endogenous retrovirus transcription as a marker for primate naive pluripotent stem cells
US20110165570A1 (en) Method of effecting de-differentiation of a cell
US20120264648A1 (en) In Vitro Model Of Spinal Muscular Atrophy
Melotti et al. Induction of hematopoietic commitment and erythromyeloid differentiation in embryonal stem cells constitutively expressing c-myb
WO2023177182A1 (fr) LIGNÉE CELLULAIRE PLURIPOTENTE HUMAINE GÉNÉTIQUEMENT MODIFIÉE POUR CO-EXPRIMER LE GÈNE α-MHC ET UN GÈNE RAPPORTEUR FLUORESCENT
WO2024048820A1 (fr) Système d&#39;évaluation de la pluripotence de cellules souches porcines et procédé d&#39;évaluation de la pluripotence l&#39;utilisant
US20220260552A1 (en) Methods to determine the effect of an agent on mammalian embryonic development
Tagore et al. Electrical activity between skin cells regulates melanoma initiation
US20190224251A1 (en) Methods of differentiating stem cells into endoderm
Soares et al. Control of trophoblast cell differentiation: lessons from the genetics of early pregnancy loss and trophoblast neoplasia
Yao et al. Knockout of Dip2c in murine ES cell line IBMSe001-B-1 by CRISPR/Cas9 genome editing technology
WO2024167297A1 (fr) Lignée de cellules souches pluripotentes humaines génétiquement modifiées pour co-exprimer le gène tubb3 et le gène rapporteur fluorescent
AU2017265022B2 (en) Screening assays for identifying differentiation-inducing agents and production of differentiated cells for cell therapy
Stefanovic et al. Hox-dependent coordination of cardiac cell patterning and differentiation
US20030032177A1 (en) Cell maintenance and proliferation
Severino X chromosome status: a gatekeeper of germ cells meiotic entry
Ruan et al. Cell-type-specific splicing of transcription regulators and Ptbp1 by Rbfox1/2/3 in the developing neocortex

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22957499

Country of ref document: EP

Kind code of ref document: A1