WO2024019555A1 - Diagnostic marker for alzheimer's disease dementia using dna methylation change in atp2c1 gene - Google Patents

Abstract

The present invention relates to a molecular biological composition, kit, and diagnostic method for diagnosing Alzheimer's disease dementia by measuring the methylation level of CpG sites in the promoter of the ATPase secretory pathway Ca²⁺ transporting 1 (ATP2C1) gene. The present invention has the advantages of being simple, non-invasive, and economical.

Description

Alzheimer's disease dementia diagnostic marker using DNA methylation changes in the ATP2C1 gene

The present invention relates to compositions, kits, and methods for diagnosing Alzheimer's disease dementia by detecting the methylation level of gene CpG regions.

Due to Korea's rapid economic growth, westernization of lifestyle, and advancement in medicine, the average life expectancy of Koreans is increasing, while Korea's population is aging at the fastest pace in the world. Accordingly, neurodegenerative diseases that occur in conjunction with aging are also rapidly increasing.

Dementia is a representative disease that causes a large socioeconomic burden, and among them, Alzheimer's disease dementia is the most common type of dementia. Alzheimer's disease Dementia is a representative neurodegenerative brain disease that begins with memory loss and gradually progresses over a long period of time to symptoms such as loss of cognitive ability in time and space, delusions and personality changes, paralysis of language function, and paralysis of motor function, ultimately leading to death. am.

Although research into the treatment of Alzheimer's disease dementia has been continuously conducted for the past several decades, there is currently no fundamental cure, and only treatments that alleviate symptoms or slow down the progression of the lesion are being carried out. Therefore, delaying the onset of Alzheimer's disease dementia through early diagnosis and preemptive treatment has been suggested as the most effective management method.

However, the neurocognitive tests currently used to diagnose Alzheimer's disease dementia have the disadvantage that the patient's age, level of education, or intentional refusal to answer can significantly affect the accuracy of the test results, and brain imaging tests using MRI or PET have the disadvantage of significantly affecting the accuracy of the test results. In some cases, the use of expensive equipment has the disadvantage of making it difficult to perform tests in the early stages when no special symptoms are present.

Accordingly, other methods for diagnosing Alzheimer's disease dementia include a method of detecting beta amyloid protein in cerebrospinal fluid or serum, a method of measuring the concentration of tau protein, and a glial fibrillary acidic protein (GFAP)-antibody. Biochemical methods such as detection methods have been proposed, but problems such as efficiency and accuracy of clinical application of diagnostic methods have been raised (International Patent Publication No. 92/17152; US Patent No. 4,666,829; International Patent Publication No. 89/17152). No. 06242; U.S. Patent No. 5,231,000, etc.)

Therefore, for the diagnosis of Alzheimer's disease dementia, a new diagnostic marker that can represent clinical symptoms or accurately measure the state of Alzheimer's disease is urgently needed.

The present inventors confirmed that the ATP2C1 (ATPase Secretory Pathway Ca ²⁺ Transporting 1) gene is specifically hypermethylated in Alzheimer's disease dementia, and used this as a biomarker to measure the degree of methylation of the ATP2C1 gene to detect Alzheimer's disease dementia. The present invention was completed by confirming that it was possible to diagnose.

Accordingly, an example of the present invention provides a composition for diagnosing Alzheimer's disease dementia, which includes an agent for measuring the methylation level of the CpG region of the ATP2C1 gene promoter.

Another example provides the use of an agent for measuring CpG methylation levels in the ATP2C1 gene promoter for diagnosing Alzheimer's disease dementia.

Another example provides an agent for measuring CpG methylation levels in the ATP2C1 gene promoter for use in diagnosing Alzheimer's disease dementia.

Another example provides a kit for diagnosing Alzheimer's disease dementia, which includes an agent for measuring the methylation level of the CpG region of the ATP2C1 gene promoter.

Another example provides a method of diagnosing Alzheimer's disease dementia, comprising measuring the methylation level of the CpG region of the ATP2C1 gene promoter from a sample of the subject.

Another example provides a method of providing information for diagnosing Alzheimer's disease dementia, including measuring the methylation level of the CpG region of the ATP2C1 gene promoter from a sample of an individual.

Another example provides a method of measuring the methylation level at the CpG region of the ATP2C1 gene promoter from a sample of an individual in order to provide information necessary for diagnosing Alzheimer's disease dementia.

Another example includes measuring the methylation level of the CpG region of the ATP2C1 gene promoter from a sample of an individual suspected of having Alzheimer's disease dementia; Comparing the methylation level with the methylation level of the corresponding gene promoter in a control sample other than Alzheimer's disease dementia or comparing it with a predetermined threshold (cut-off); and determining that the individual has Alzheimer's disease dementia when the methylation level measured from the sample of the individual is higher than the value measured from the control sample or a threshold value.

Another example includes measuring the methylation level of the CpG region of the ATP2C1 promoter from a sample of an individual suspected of having Alzheimer's disease dementia; Comparing the methylation level with the methylation level of the corresponding gene promoter in a control sample other than Alzheimer's disease dementia or comparing it with a predetermined threshold (cut-off); determining that the subject has Alzheimer's disease dementia if the methylation level measured from the subject's sample is higher than the value measured from the control sample or a threshold value; and administering a therapeutic agent for Alzheimer's disease to the individual determined to have Alzheimer's disease dementia.

The present invention provides a molecular biological diagnostic method for diagnosing Alzheimer's disease dementia by measuring the degree of methylation of the CpG region of a specific gene in genomic DNA collected from a patient's sample, which has the advantages of being simple, non-invasive, and economical. Additionally, DNA methylation changes are easy to detect and have the advantage of being more stable and easier to analyze than conventional protein or RNA markers.

Figure 1 shows the difference in DNA methylation levels of the ATP2C1 gene promoter between a normal control group (“Normal”) and a patient group with Alzheimer’s disease dementia (“Symptomatic AD”).

Figure 2 shows the validation set, a normal control group ("Normal"), a group of patients with mild cognitive impairment without amyloid pathology ("MCI (non-AD)"), and a group of patients with mild cognitive impairment from Alzheimer's disease ("Prodromal AD"). ), and the difference in DNA methylation level of the ATP2C1 gene promoter in the Alzheimer's disease dementia patient group ("Symptomatic AD").

Figure 3 shows a normal control group (“Normal”), a group of patients with mild cognitive impairment without amyloid pathology (“MCI (non-AD)”), and a group of patients with mild cognitive impairment from Alzheimer’s disease (“Prodromal”) using DNA methylation changes in the ATP2C1 gene promoter. This shows the results of a receiver operating characteristics curve (ROC curve) analysis to evaluate the effectiveness of distinguishing between Alzheimer's disease dementia patients ("Symptomatic AD") compared to "AD").

The present invention is based on the discovery that the ATP2C1 gene promoter is specifically hypermethylated in Alzheimer's disease dementia, and provides a molecular biological diagnostic technology for diagnosing Alzheimer's disease by measuring the degree of specific DNA hypermethylation that occurs at a specific CpG position in the ATP2C1 gene. do.

DNA methylation changes are easy to detect because they exist in DNA, are more stable than protein or RNA markers, and have the advantage of being easy to analyze because they occur at a specific location in a gene.

Specifically, in one embodiment of the present application, genomic DNA was extracted from samples of a normal control group (normal cognitive function group without amyloid pathology) and a patient group with Alzheimer's disease dementia, and the DNA methylation profile was analyzed through DNA methylation mutation analysis. Compared to normal controls, genes with DNA methylation changes of more than 30% in the CpG region of the gene promoter region of Alzheimer's disease dementia patients were selected. Among these selected genes, it was confirmed that the DNA methylation of the CpG region of the promoter of the ATP2C1 gene was increased by about 49% in the Alzheimer's disease dementia patient group compared to the normal control group (Figure 1). These results suggest that disease-specific hypermethylation of the ATP2C1 gene can be used as a biomarker to diagnose Alzheimer's disease dementia in a non-invasive manner.

In another embodiment of the present application, in order to verify the validity and effectiveness of the biomarker, a normal control group (normal cognitive function group without amyloid pathology findings), a mild cognitive impairment patient group without amyloid pathology findings, a mild cognitive impairment patient group with Alzheimer's disease, and As a result of measuring the degree of DNA methylation of the CpG region of the ATP2C1 gene promoter using pyrosequencing analysis in a validation set consisting of the Alzheimer's disease dementia patient group, DNA methylation of the CpG region of the ATP2C1 promoter was found in the Alzheimer's disease dementia patient group compared to the normal control group. Compared to the normal control group, the mild cognitive impairment patient group without amyloid pathology, and the Alzheimer's disease mild cognitive impairment patient group, it was confirmed that the Alzheimer's disease dementia patient group was increased by 28.5%, 25%, and 25.7%, respectively (Figure 2). Furthermore, as a result of ROC curve analysis, the hypermethylation of the CpG region of the ATP2C1 gene promoter showed that the Alzheimer's disease dementia patient group had a high accuracy compared to the normal control group, the mild cognitive impairment patient group without amyloid pathology, and the Alzheimer's disease mild cognitive impairment patient group (respectively). AUC = 0.8750, 0.7938, 0.8304) (Figure 3).

Overall, these research results indicate that disease-specific hypermethylation of the ATP2C1 gene can be used as a biomarker for diagnosing Alzheimer's disease dementia in a non-invasive manner.

Accordingly, one embodiment provides a composition for diagnosing Alzheimer's disease dementia, which includes an agent for measuring the methylation level of the CpG region of the ATP2C1 gene promoter.

Another embodiment provides the use of an agent for measuring CpG methylation levels of the ATP2C1 gene promoter for diagnosing Alzheimer's disease dementia.

Another embodiment provides an agent for measuring CpG methylation levels in the ATP2C1 gene promoter for use in diagnosing Alzheimer's disease dementia.

Another embodiment provides a kit for diagnosing Alzheimer's disease dementia, including an agent for measuring the methylation level of the CpG region of the ATP2C1 gene promoter.

Another embodiment provides a method for diagnosing Alzheimer's disease dementia, comprising measuring the methylation level of the CpG region of the ATP2C1 gene promoter from a sample of the subject.

Another embodiment provides a method of providing information for diagnosing Alzheimer's disease dementia, comprising measuring the methylation level of the CpG region of the ATP2C1 gene promoter from a sample of an individual.

Another embodiment provides a method of measuring the methylation level at the CpG region of the ATP2C1 gene promoter from a sample of an individual in order to provide information necessary for diagnosing Alzheimer's disease dementia.

Another specific example includes measuring the methylation level of the CpG region of the ATP2C1 gene promoter from a sample of an individual suspected of having Alzheimer's disease dementia; Comparing the methylation level with the methylation level of the corresponding gene promoter in a control sample other than Alzheimer's disease dementia or comparing it with a predetermined threshold (cut-off); and determining that the individual has Alzheimer's disease dementia when the methylation level measured from the sample of the individual is higher than the value measured from the control sample or a threshold value.

Another specific example includes measuring the methylation level of the CpG region of the ATP2C1 electronic promoter from a sample of an individual suspected of having Alzheimer's disease dementia; Comparing the methylation level with the methylation level of the corresponding gene promoter in a control sample other than Alzheimer's disease dementia or comparing it with a predetermined threshold (cut-off); determining that the subject has Alzheimer's disease dementia if the methylation level measured from the subject's sample is higher than the value measured from the control sample or a threshold value; and administering a therapeutic agent for Alzheimer's disease to the individual determined to have Alzheimer's disease dementia.

In the present invention, the term “methylation” or “methylation” refers to the attachment of a methyl group to a base constituting DNA. Preferably, in the present invention, methylation refers to whether methylation occurs at cytosine in the CpG region of a specific gene promoter. When methylation occurs, the binding of transcription factors is disrupted and the expression of a specific gene is suppressed. Conversely, when unmethylation or hypomethylation occurs, the expression of a specific gene increases.

In addition to A, C, G, and T, the genomic DNA of mammalian cells contains a fifth base called 5-methylcytosine (5-mC), which has a methyl group attached to the fifth carbon of the cytosine ring. do. Methylation of 5-methylcytosine occurs only at the C of CG dinucleotide (5'-mCG-3'), called CpG, and methylation of CpG suppresses the expression of alu or transposon and repetitive sequences of the genome. In addition, because the 5-mC of CpG is prone to natural deamination to become thymine (T), CpG is the site where most epigenetic changes frequently occur in mammalian cells.

In the present invention, the term “methylation level measurement” refers to measuring the methylation level of a gene CpG region, using methylation-specific PCR, for example, methylation-specific polymerase chain reaction (MSP), real-time methylation-specific PCR. It can be measured through PCR (real time methylation-specific polymerase chain reaction), PCR using a methylated DNA-specific binding protein, or quantitative PCR. Alternatively, it can be measured by methods such as automatic base analysis such as pyrosequencing or bisulfite sequencing, DNA methylation microarray, or immunoprecipitation using a methylated CpG binding domain or anti-methylcytosine antibody. However, it is not limited to this. Alzheimer's disease dementia can be diagnosed by specifically showing hypermethylation in the ATP2C1 gene in patient samples compared to samples from people without Alzheimer's disease or compared to a predetermined threshold (cut-off).

The human ATP2C1 gene is located on chromosome 3 and is registered in the NCBI Entrez database as Gene ID: 27032.

In the present invention, the CpG site of a gene refers to a CpG site present on the DNA of the gene. The DNA of a gene is a concept that includes a series of structural units that are required for gene expression and are operably linked to each other, for example, a promoter region, a protein coding region (open reading frame, ORF), and a terminator region. Includes. Therefore, the CpG site of a gene may be present in the promoter region, protein coding region (open reading frame, ORF), or terminator region of the gene. Preferably, the CpG site where disease-specific hypermethylation occurs in the ATP2C1 gene may be present in the promoter of the gene.

For example, in the present invention, the methylation level of the CpG region of the ATP2C1 gene promoter is measured by measuring the CpG region of the promoter CpG region of the ATP2C1 gene, more specifically, the CpG region appearing in the 130930227 to 130930348 base sequence (SEQ ID NO: 1) of chromosome 3. It may include measuring the methylation level of cytosine:

AATTTCTTGAGAAGTAGCATGTGGTTAGTATAAAATTGTCTTTCCTATTAGGACTAGCTA C GTAATTAGTCTGAAATATTTTTCTAACTGGAAAATTAGTTGCTGTGAACTTTTGGATTTTT (SEQ ID NO: 1)

More specifically, it may include measuring the methylation of cytosine located at base 130930287 of chromosome 3 (base 61 of SEQ ID NO: 1).

In the present invention, the base sequence of the human genome chromosome region is expressed according to the latest version of GRCh38 Genome Reference Consortium Human Reference 38 (GRCh38/hg38), but the specific sequence of the human genome chromosome region is expressed as the results of genome sequence research are updated. This may be slightly changed, and depending on this change, the expression of the human genomic chromosomal region of the present invention may be different. Therefore, the human genome chromosomal region expressed according to the GRCh38 Genome Reference Consortium Human Reference 38 (GRCh38/hg38) of the present invention is a human reference sequence that has been updated after the filing date of the present invention to represent the human genomic chromosomal region. Even if it is changed differently from what it is now, it will be obvious that the scope of the present invention extends to the changed human genome chromosomal region. These changes can be easily known by anyone with ordinary knowledge in the technical field to which the present invention pertains.

In the present invention, the term "Alzheimer's disease (AD)" is a representative neurodegenerative brain disease with memory decline as an initial symptom and subsequent decline in overall cognitive function. Previously, Alzheimer's disease was defined based on clinical symptoms and confirmed through brain autopsy, but recently, as neuropathological changes related to Alzheimer's disease have been discovered and these changes can be used as clinical tests, these changes can be measured in vivo. ) It became possible to define Alzheimer's disease by identifying it through biomarkers. Even now, the diagnosis of Alzheimer's disease is based on postmortem brain autopsy findings, but as pathological accumulation of amyloid protein and tau protein, which are known to be representative features of brain autopsy findings, can be indirectly confirmed through PET imaging or cerebrospinal fluid examination, clinical Compared to the era when diagnosis was based solely on symptoms, the accuracy of diagnosis has improved dramatically.

Biomarkers for defining Alzheimer's disease include beta-amyloid-related indicators (e.g., binding of amyloid-PET ligand in the cerebral cortex or reduction of Aβ ₄₂ in cerebrospinal fluid) and tau-related indicators in the form of neurofibrillary tangles (e.g. (e.g., increased phosphorylated tau in cerebrospinal fluid or binding of tau-PET ligands in the brain cortex), or indicators of neurodegeneration (e.g., increased cerebrospinal fluid total tau or brain atrophy on MRI and brain hypometabolism on FDG-PET). ), etc.

The 2018 Alzheimer's Disease Research Diagnostic Criteria (Jack CR According to , et al., NIA-AA Research Framework: toward a biological definition of Alzheimer's disease. Alzheimers Dement 2018;14:535-562), Alzheimer's disease is a pathological characteristic of Alzheimer's disease even before clinical symptoms of dementia appear. If Alzheimer's disease biomarkers (as described above) are observed, they are included in the diagnostic criteria for Alzheimer's disease. Specifically, through a combination of biomarkers and cognitive stages, Alzheimer's disease is largely subdivided into preclinical Alzheimer's disease, prodromal Alzheimer's disease, and symptomatic Alzheimer's disease. It is explained with the concept of continuum.

Normal cognitive function in Alzheimer's disease corresponds to the preclinical stage, where biological marker tests show pathological findings of Alzheimer's disease but do not have clinical symptoms. The next stage, mild cognitive impairment of Alzheimer's disease, is a stage in which pathological findings of Alzheimer's disease are shown in biological marker tests, but there is mild objective cognitive decline and the ability to perform independent daily activities is maintained. It is called "Alzheimer's disease in the mild cognitive impairment stage ( The terms "AD with mild cognitive impairment (MCI)" or "prodromal AD" are also used together. Alzheimer's disease dementia shows pathological findings of Alzheimer's disease in biological marker tests, symptoms of dementia develop, and objective cognitive impairment is impaired. Due to the decline in function, the ability to live independently is impaired. The terms “AD with dementia” or “Symptomatic AD” are also used.

Accordingly, the methylation marker of the present invention is specifically highly methylated in the Alzheimer's disease dementia patient group compared to the normal control group, the mild cognitive impairment patient group without amyloid pathology, and the Alzheimer's disease mild cognitive impairment patient group, and is normal through ROC curve analysis. Since the effectiveness of discriminating between the control group, the mild cognitive impairment patient group without amyloid pathology, and the Alzheimer's disease mild cognitive impairment patient group has been confirmed, it can be used as a marker to diagnose Alzheimer's disease dementia.

In the present invention, “diagnosis” means confirming the existence of a disease or the presence or characteristics of a disease pathological state. Comprehensively, diagnosis includes determining whether a specific disease currently exists, measuring the condition before symptoms appear, determining the prognosis of the disease, and further determining whether the disease has progressed or worsened. can do.

In the present invention, the agent for measuring the methylation level of a CpG site is a compound that modifies an unmethylated cytosine base, a methylation-sensitive restriction enzyme, a primer specific for the methylated allele sequence of the gene, or a compound specific for the unmethylated allele sequence. It may include a primer, a methylated CpG binding domain, or a methylated DNA antibody that specifically binds to methylated DNA (for example, an antibody that specifically binds to methylcytosine).

The compound that modifies the unmethylated cytosine base may be bisulfite or a salt thereof, but is not limited thereto, and is preferably sodium bisulfite. Methylation of bisulfite-modified DNA can be detected through various methods such as sequencing or methylation-specific PCR. The method of detecting methylation of a gene by modifying unmethylated cytosine residues using bisulfite is It is well known in the art (e.g. WO01/26536; US2003/0148326A1).

Additionally, the methylation-sensitive restriction enzyme is a restriction enzyme that can specifically detect methylation of a CpG site and may be a restriction enzyme that contains CG as a recognition site of the restriction enzyme. Examples include Sma I, Sac II, Eag I, Hpa II, Msp I, Bss HII, Bst UI, Not I, etc., but are not limited thereto. Depending on methylation or unmethylation at C of the restriction enzyme recognition site, cleavage by restriction enzymes varies and can be detected through PCR or Southern Blot analysis. Other methylation-sensitive restriction enzymes other than the above restriction enzymes are well known in the art.

As a representative example of measuring the methylation level at a specific CpG site of an individual's gene, genomic DNA is obtained from a patient's sample, and the obtained DNA is treated with a compound that modifies unmethylated cytosine bases or a methylation-sensitive restriction enzyme. Afterwards, the treated DNA can be amplified by PCR using primers and measured by confirming the presence or absence of the amplified product.

Accordingly, the agent of the present invention may include primers specific for the methylated allele sequence of the gene and primers specific for the unmethylated allele sequence. In the present invention, the term “primer” refers to a short nucleic acid sequence having a short free 3 terminal hydroxyl group, which can form base pairs with a complementary template and serves as a starting point for copying the template strand. Primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and reagents for polymerization (i.e., DNA polymerase or reverse transcriptase) in an appropriate buffer solution and temperature. Additionally, primers, both sense and antisense nucleic acids having a sequence of 7 to 50 nucleotides, may incorporate additional features that do not change the basic nature of the primer, which serves as an initiation point for DNA synthesis.

The primers of the present invention can be preferably designed according to the sequence of the specific CpG site to be analyzed for methylation, and each primer pair is capable of specifically amplifying a cytosine that is methylated and has not been modified by bisulfite, And it may be a primer pair that can specifically amplify cytosine that is not methylated and thus modified by bisulfite.

Meanwhile, a methylated DNA antibody refers to an antibody that specifically binds to a methylated base in DNA. Specifically, antibodies that have the property of recognizing and binding to methylated cytosine in the DNA chain, such as antibodies to methylcytosine, can be cited. Additionally, among commercially available methylated DNA antibodies, there may be an antibody that can specifically recognize and specifically bind to DNA in the methylated state described herein.

Methylated DNA antibodies can be produced by conventional methods using methylated bases, methylated DNA, etc. as antigens. For example, to produce a methylcytosine antibody, an antibody is prepared using 5-methylcytidine, 5-methylcytosine, or DNA containing 5-methylcytosine as an antigen, and then methylcytosine in the DNA is used as an antigen. The specific combination of can be selected as an indicator.

In addition, when measuring the methylation level using a methylated CpG binding domain (MBD) or methylated DNA antibody, methylated DNA is immunoprecipitated using these, and then analyzed by Southern blot, PCR, microarray, or sequence analysis. Specific CpG sites can be confirmed through sequencing. Additionally, for immunological detection or quantification of antibodies, a substrate, an appropriate buffer solution, a chromogenic enzyme or a fluorescent substance label, a secondary antibody labeled with a chromogenic enzyme or a fluorescent substance, and a chromogenic substrate can be used. In the above, the substrate may be a nitrocellulose membrane, a 96-well plate synthesized from polyvinyl resin, a 96-well plate synthesized from polystyrene resin, and a glass slide glass, and the coloring enzyme may be peroxidase or alkaline phosphatase. Fatase (alkaline phosphatase), etc. can be used, the fluorescent substance can be FITC, RITC, etc., and the coloring substrate solution is ABTS (2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulphate). Ponic acid), OPD (o-phenylenediamine), or TMB (tetramethyl benzidine) can be used, and other radioactive isotope labels, latex bead labels, colloid labels, biotin labels, etc. can be used, but are limited to these. no.

In addition to the above agents, the compositions and kits may additionally include polymerase agarose, buffer solutions required for electrophoresis, etc. Additionally, the kit may be implemented in the form of a DNA methylation microarray.

In another embodiment, the present invention relates to a method for diagnosing Alzheimer's disease dementia by measuring the methylation level at the CpG site of the ATP2C1 gene promoter.

Additionally, the present invention relates to a method for detecting the methylation level of the CpG region of a gene promoter from a sample of an individual in order to provide information necessary for the diagnosis of Alzheimer's disease dementia.

Additionally, the present invention relates to a method of providing information for diagnosing Alzheimer's disease dementia, comprising measuring the methylation level at the CpG region of the ATP2C1 gene promoter from a sample of an individual.

In one embodiment for this purpose, the present invention includes the steps of measuring the methylation level of the CpG region of the ATP2C1 gene promoter from a sample of an individual; And a method for providing information for diagnosing Alzheimer's disease dementia, comprising comparing the methylation level with the methylation level of the corresponding gene in a control sample other than Alzheimer's disease dementia or comparing it with a predetermined threshold (cut-off). It's about.

In addition, the present invention includes the steps of measuring the methylation level of the CpG region of the ATP2C1 gene promoter from a sample of an individual suspected of having Alzheimer's disease dementia; Comparing the methylation level with the methylation level of the corresponding gene promoter in a control sample other than Alzheimer's disease dementia or comparing it with a predetermined threshold (cut-off); and determining that the individual has Alzheimer's disease dementia when the methylation level measured from the sample of the individual is higher than the value measured from the control sample or a threshold value.

In addition, the present invention includes the steps of measuring the methylation level of the CpG region of the ATP2C1 gene promoter from a sample of an individual suspected of having Alzheimer's disease dementia; Comparing the methylation level with the methylation level of the corresponding gene promoter in a control sample other than Alzheimer's disease dementia or comparing it with a predetermined threshold (cut-off); determining that the subject has Alzheimer's disease dementia if the methylation level measured from the subject's sample is higher than the value measured from the control sample or a threshold value; and administering a therapeutic agent for Alzheimer's disease to the individual determined to have Alzheimer's disease dementia.

Hereinafter, the diagnostic method, method of providing information for diagnosis, and treatment method will be described.

In the present invention, the term "sample" includes samples such as cells, tissues, whole blood, serum, plasma, cerebrospinal fluid, saliva, sputum, or urine in which the methylation level of genes is different due to Alzheimer's disease, but is not limited to the above examples and includes DNA. Any sample that can be extracted can be used. Preferred embodiments include skin tissue or skin cells, for example, but are not limited to skin fibroblasts.

First, in order to obtain genomic DNA from a sample of an individual and detect the methylation level, genomic DNA was obtained using the phenol/chloroform extraction method and SDS extraction method (Tai et al., Plant Mol. Biol. Reporter, 8: 297-303, 1990), CTAB separation (Cetyl Trimethyl Ammonium Bromide; Murray et al., Nuc. Res., 4321-4325, 1980), or a commercially available DNA extraction kit.

The step of detecting the methylation level of a specific CpG site of the gene includes a method using restriction enzymes or bisulfite, using the difference between methylated bases and unmethylated bases, a methylated CpG binding domain, or an anti-methylcytosine antibody. It can be performed through immunoprecipitation methods (e.g., MIRA, MeDIP), methods using DNA methylation microarray, etc. For example, methylation-specific polymerase chain reaction, real time methylation-specific polymerase chain reaction, PCR using methylated DNA-specific binding protein, quantitative PCR, The methylation level can be measured or detected using pyrosequencing, bisulfite sequencing, DNA methylation microarray, or immunoprecipitation using a methylated CpG binding domain or anti-methylcytosine antibody.

As an example, in the method of the present application, the step of measuring the methylation level of the CpG region of the gene promoter includes (a) treating genomic DNA in the obtained sample with a compound that modifies unmethylated cytosine bases or a methylation-sensitive restriction enzyme; and (b) amplifying the treated DNA by PCR using primers capable of amplifying a specific CpG region of the gene.

The compound that modifies the unmethylated cytosine base in step (a) may be bisulfite, preferably sodium bisulfite. A method for detecting methylation of a gene by modifying unmethylated cytosine residues using bisulfite is widely known in the art.

In addition, in step (a), the methylation sensitive restriction enzyme is a restriction enzyme capable of specifically detecting methylation of a specific CpG site, as described above, and may be a restriction enzyme containing CG as the recognition site of the restriction enzyme. , Examples include Sma I, Sac II, Eag I, Hpa II, Msp I, Bss HII, Bst UI, Not I, etc., but are not limited thereto.

Amplification in step (b) may be performed by a conventional PCR method. As described above, the primers used at this time can be preferably designed according to the sequence of the specific CpG site to be analyzed for methylation, and each specifically amplifies cytosines that have been methylated and have not been modified by bisulfite. It may be a primer pair that can specifically amplify cytosine that is not methylated and thus modified by bisulfite.

The step of measuring the methylation level of a specific CpG region of the gene may further include the step of (c) confirming the presence or absence of the product amplified in step (b). The presence or absence of the amplified product in step (c) can be determined depending on whether a band at a desired position is detected by a method known in the art, for example, electrophoresis. For example, when a compound that modifies an unmethylated cytosine residue is used, two types of primer pairs are used in step (a), that is, a primer that can specifically amplify cytosine that is methylated and has not been modified by bisulfite. The degree of methylation can be determined based on the presence or absence of PCR results each amplified by a pair of primers that are not methylated and can specifically amplify cytosine modified by bisulfite. Preferably, methylation can be determined using a bisulfite genome sequencing method in which sample genomic DNA is treated with bisulfite, the CpG region of the gene is amplified by PCR, and the base sequence of the amplified region is analyzed. .

In addition, even when restriction enzymes are used, a method known in the art, for example, when a PCR result is obtained from mock DNA and a PCR result is obtained from DNA treated with a restriction enzyme, it is determined that the CpG is methylated, and the restriction enzyme is determined to be methylated. If there is no PCR result from the enzyme-treated DNA, whether the CpG is methylated can be determined by determining that it is unmethylated, and this is obvious to those skilled in the art. In the above, mock DNA refers to sample DNA that has been isolated from the sample and has not undergone any treatment.

Another example of detecting the methylation level of a specific CpG region of a gene may be an immunoprecipitation method using a methylated DNA antibody, for example, an antibody against a methylated CpG binding domain (MBD) or methylcytosine. . For example, after immunoprecipitation using an antibody that specifically recognizes the methylated CpG binding domain or 5-methylcytosine, specific CpG sites can be identified through Southern blot, PCR, microarray, or sequencing. You can.

According to this method, if the CpG region of the ATP2C1 gene promoter in the target sample is detected in a highly methylated state, Alzheimer's disease dementia can be diagnosed.

Therefore, according to the present invention, methylation changes in specific CpG regions of genes appear specifically in individual samples, and thus, methylation changes in genes can be used as a biomarker to effectively diagnose Alzheimer's disease dementia. For example, hypermethylation of a specific CpG region of the ATP2C1 gene can be usefully used as a biomarker to diagnose Alzheimer's disease dementia.

Furthermore, in the present invention, Alzheimer's disease dementia can be treated by administering an Alzheimer's disease treatment agent to the individual determined to have Alzheimer's disease dementia. The agent for treating the disease may be administered in a therapeutically effective amount.

The treatment for Alzheimer's disease may use known treatments and includes substances approved by the U.S. Food and Drug Administration for the treatment of Alzheimer's disease. Known treatments for Alzheimer's disease include cholinergics/cholinesterase inhibitors, such as donepezil, rivastigmine, galantamine, or tacrine; NMDA receptor antagonists such as memantine; Examples of antioxidants include, but are not limited to, selegiline or vitamin E. These therapeutic agents may be in the form of pharmaceutically acceptable salts or esters, but are not limited thereto (e.g., galantamine hydrobromide, rivastigmine tartrate, donepezil hydrochloride, etc.). In certain embodiments, two or more of these therapeutic agents may be used in combination.

The term “pharmaceutically acceptable” refers to a substance that can be effectively used for the desired purpose without causing excessive toxicity, irritation, allergic reaction, etc., within the scope of medical judgment. As used herein, the term “pharmaceutically acceptable salt” includes salts derived from pharmaceutically acceptable inorganic acids, organic acids, or bases. The term “pharmaceutically acceptable ester” as used herein refers to esters that hydrolyze in vitro and include those that decompose readily in the human body to release the parent compound or salt thereof. Suitable ester groups include, for example, those derived from pharmaceutically acceptable aliphatic carboxylic acids, particularly alkano, alkeno, cycloalkano and alkanedio acids, the respective alkyl or alkenyl moieties being advantageously It does not have more than 6 carbon atoms. The therapeutic agents may additionally contain a pharmaceutically acceptable carrier. The dosage of the therapeutic agent varies depending on the patient's condition and weight, degree of disease, drug type, administration route and period, but can be appropriately selected by a person skilled in the art. All modes of administration are contemplated, for example, oral, intravenous, intramuscular, subcutaneous injection, etc.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely illustrative of the present invention, and the present invention is not limited by the following examples.

Example 1. Research subject

The Alzheimer's disease patient group includes three groups: preclinical Alzheimer's disease (AD), prodromal Alzheimer's disease, and Symptomatic Alzheimer's disease. The control group includes normal control group (normal cognitive function and no amyloid pathology), mild cognitive impairment (MCI) due to non-AD, and dementia not due to Alzheimer's disease. It consists of three groups: dementia due to non-AD.

Diagnosis and classification of the six groups of study subjects were performed according to the following four steps:

In the first step, the medical history was taken through a structured interview by a neurologist, along with the research subjects and their guardians.

In the second step, the degree of decline in current cognitive function and daily living skills were determined through neuropsychological testing. Through these two stages, three stages of cognitive decline were determined: normal cognitive function, mild cognitive impairment, and dementia. In the case of the normal cognitive function group, apart from complaints of subjective cognitive decline, all items of the objective neuropsychological test showed test results of standard scores (z score ≥-1.5) or higher, so there was no objective finding of cognitive decline and daily living ability. There is no damage. In the case of mild cognitive impairment, the patient or informant complains of memory decline, and neuropsychological tests show a standard score of 1.5 or less (z score <-1.5), indicating objective memory decline, but overall cognitive function and This is a group where daily living skills are maintained. The dementia group is a group that shows objective decline (standard score of 1.5 or less) in two or more cognitive domains, has a slowly progressive clinical pattern, and requires care from others due to impairment of daily living abilities.

In the third step, blood tests, brain structural imaging (computed tomography, CT or magnetic resonance imaging, MRI), and brain functional imaging (functional MRI, amyloid positron emission tomography, amyloid PET) are performed to detect decline in cognitive function. Other possible causes were ruled out, and the accumulation of amyloid pathology in the brain was confirmed. Ruling out other causes that may cause decline in cognitive function is an important step in diagnosing Alzheimer's disease. It is important to rule out these possibilities by checking blood tests for thyroid hormone dysfunction, vitamin B12 or folic acid deficiency, and neurosyphilis. In addition, alcoholism, drug addiction, major depressive disorder, bipolar disorder, schizophrenia, and convulsive disorders were also excluded because they may be associated with cognitive decline. In addition, structural brain abnormalities such as normal pressure hydrocephalus, stroke, and brain tumor were excluded on brain imaging tests, and other neurodegenerative diseases such as Parkinson's disease, Lewy body dementia, and vascular dementia were also excluded. According to the 2018 research diagnostic criteria for Alzheimer's disease, if amyloid PET was positive (Brain amyloid plaque load, BAPL 2 or 3), it was determined that Alzheimer's disease was present, and depending on clinical symptoms, one of preclinical, prodromal, and symptomatic AD was diagnosed. It was judged to be a group. Negative amyloid PET (BAPL 1) is considered as a control group and according to clinical symptoms, normal control group (group with normal cognitive function and no amyloid pathology), mild cognitive impairment (MCI) not caused by Alzheimer's disease. ) due to non-AD), or dementia not caused by Alzheimer's disease (dementia due to non-AD). Fourth, by combining the clinical information from these three stages, a final decision was made into six groups.

Example 2. Skin biopsy collection and skin fibroblast culture

A skin biopsy was taken from the patient's inner thigh using a cylindrical blade with a diameter of 2 mm. The collected skin biopsy was divided into 6 parts, placed in a 24-well cell culture plate coated with 0.1% gelatin with medium (DMEM/20% FBS) sufficient to submerge the skin biopsy pieces, and cells were observed extending from the edges of the skin biopsy pieces for 7 days. observed. The medium was replenished every 2-3 days to prevent drying of the skin biopsy pieces. After 7 days, the amount of medium was increased to 500 μL and the medium was changed every 2-3 days. After 14 days, when the cells grew around the skin biopsy piece and the outer edge of the culture well was filled with cells, it was transferred to a 35 mm culture dish and cultured on the right side of the medium. After lowering the concentration of fetal serum (FBS) from 20% to 10%, cell culture was continued. Subculture was performed when the cells filled 80-90% of the 35 mm culture dish. When subculture was repeated 2-3 times and only skin fibroblasts were selectively cultured, the expression of SERPHINH1, a fibroblast marker, was confirmed using SERPHINH1 antibody.

Example 3. Genomic DNA extraction

Genomic DNA was extracted from skin fibroblasts cultured in Example 2 using the QIAmp DNA mini kit (Qiagen). The extraction method was performed according to the manufacturer's manual. The extracted genomic DNA was quantified using a spectrophotometer, and the state of the DNA was checked for degradation by electrophoresis on a 1% agarose gel.

Example 4. DNA methylation mutation analysis

DNA methylation mutation analysis involves extracting DNA from skin fibroblasts of patient and control groups, performing bisulfite conversion to change unmethylated cytosine to uracil, and then converting unmethylated cytosine to uracil using an Infinium MethylationEPIC bead chip (Illumina). The degree of methylation was measured for 850,000 CpG sites. The degree of DNA methylation is expressed as a β value ranging from 0 to 1. A β value of 0 means that the corresponding CpG site is completely unmethylated, and 1 means that it is completely methylated.

The independent t-test method was used to identify differentially methylated genes (DMGs) in the patient and control groups. Finally, the promoter CpG site with p value <0.05 and absolute value β difference ≥0.3 was selected as a differentially methylated CpG site, and among these, the gene in which the degree of methylation of the CpG site changed was selected as DMG. .

Example 5. Pyrosequencing analysis

Pyrosequencing analysis was performed to measure the degree of methylation of a specific CpG site (cg04049532, Chr3: 130930287) of the ATP2C1 (ATPase Secretory Pathway Ca ²⁺ Transporting 1) gene. PCR was performed using bisulfite-treated gDNA as a template. At this time, PCR primers were designed using the PSQ assay design program (Qiagen, USA). The base sequences of the designed PCR primers are as follows:

Forward primer, 5'- TGGGTATAGATGGTTTAGTTTTTGAAATG -3' (SEQ ID NO: 2)

Biotinylated reverse primer, 5'- TCCAAAAATTCACAACAACTAATTTTCC -3' (SEQ ID NO: 3)

The PCR reaction solution contained 20 ng or less of bisulfite-converted gDNA, 10 μl 2' Hot/Start PCR premix (Enzynomics), 1 μl forward primer (10 pmole/μl), and 1 μl biotinylated reverse primer (10 μl). It was prepared so that the total volume, including pmole/μl), was 20 μl. The PCR reaction goes through an initial denaturation process at 95°C for 10 minutes, followed by a denaturation process at 95°C for 30 seconds, annealing process at 56°C for 30 seconds, and extension process at 72°C. This was performed for 30 seconds and this process was repeated 50 times. Finally, the final elongation process was performed by reacting at 72°C for 10 minutes. After the PCR reaction was completed, 2 μl of the reaction solution was electrophoresed on a 2.5% agarose gel, and the base sequence size of the final PCR product was confirmed through ethidium bromide staining.

The final PCR product was prepared as an ssDNA template using Streptavidin Sepharose HP beads (Amersham Biosciences). The reaction solution was prepared for each sample to have a total volume of 80 μl, including 1-2 μl beads, 40 μl binding buffer, 16-18 μl PCR product, and high purity water, and then dispensed into each well of the PCR plate. After enclosing the plate, it was mixed well at 1400 rpm for 15-20 minutes using an orbital shaker. After diluting the sequencing primer to a concentration of 0.3 μM using PyroMark annealing buffer, 25 μl was dispensed into each well, and the PCR plate was mounted on a PyroMark Q48 (Qiagen) workstation for sequencing analysis. The base sequence of the sequencing primer used at this time is as follows: Sequencing primer 5'- AAAATTGTTTTTTTTATTAGGAT -3' (SEQ ID NO: 4)

The DNA methylation percentage of a specific CpG site (cg04049532, Chr3: 130930287) of the ATP2C1 gene was calculated as follows. The base sequence of the generated PCR product is 5'-TGGGTATCGATGGTTTAGTTTTTGAAATGTAATTTTTTGAGAAGTAGTATGTGGTTAGTATAAAATTGTTTTTTTTATTAGGATTAGTTA Y G TAATTAGTTTGAAATATTTTTTTAATTGGAAAATTAGTTGTTGTGAATTTTTGGA -3' (SEQ ID NO: 5), and the ratio of cytosine bases at the position indicated by Y (C or T) was calculated as a percentage: C/C+T *100 (%)

Experiment result

1. Confirmation of disease-specific DNA methylation changes in Alzheimer's disease dementia patient group

Among patients who visited Ewha Womans University Mokdong Hospital from 2018 to 2019, 4 normal controls (normal cognitive function group without amyloid pathology) and 12 Alzheimer's disease dementia patients Genomic DNA was extracted by culturing skin fibroblasts from the tissue. DNA methylation profiles were analyzed using the Illumina Human MethylationEPIC bead chip, and genes with DNA methylation changes of more than 30% at specific CpG sites in gene promoters in dermal fibroblasts of Alzheimer's disease dementia patients compared to normal controls were selected. Among these selected genes, the ATP2C (ATPase Secretory Pathway Ca ²⁺ Transporting 1) gene was confirmed to have 49% increased DNA methylation at a specific promoter CpG site (cg04049532) in dermal fibroblasts from Alzheimer's disease dementia patients compared to normal controls. (Table 1)

gene	Target ID	β value (difference) One)	methylation status	p value
ATP2C1	cg04049532	0.49031	hypermethylation	0.00745
1) Value obtained by subtracting the β value of normal control group cells from the β value of patient group cells

The difference in the level of DNA methylation of the ATP2C1 gene between the normal control group and the Alzheimer's disease dementia patient group is shown in a scatter dot plot in Figure 1, and the mean ± standard error (mean ± SEM) values are indicated.

2. Selection of diagnostic markers for Alzheimer's disease and dementia using DNA methylation changes

Patients who visited Ewha Womans University Mokdong Hospital from 2018 to 2019 included 19 normal controls (normal cognitive function group without amyloid pathology), 20 mild cognitive impairment patients without amyloid pathology, and 28 Alzheimer's disease patients. As a result of measuring the DNA methylation level of the ATP2C1 gene-specific CpG site (cg04049532) using pyrosequencing analysis in a validation set consisting of a patient group with mild cognitive impairment and 16 Alzheimer's disease dementia patients, normal control group and amyloid pathology were found. It was confirmed that DNA methylation in Alzheimer's disease dementia patients was increased by 28.5%, 25%, and 25.7%, respectively, compared to the mild cognitive impairment patient group without mild cognitive impairment and the Alzheimer's disease mild cognitive impairment patient group, respectively (Figure 2).

In addition, we confirmed whether it was possible to distinguish between Alzheimer's disease dementia patient groups using the receiver operating characteristics curve (ROC curve). In general, depending on the area under the curve (AUC) value of the ROC curve, it can be classified as uninformative (AUC=0.5), less accurate (0.5<AUC≤0.7), moderately accurate (0.7<AUC≤0.9), and very accurate. Classified as accurate (0.9<AUC<1.0) and perfect (AUC=1.0) tests.

ATP2C1 was highly methylated in the Alzheimer's disease dementia patient group, and this hypermethylation compared the Alzheimer's disease dementia patient group with the normal control group, the mild cognitive impairment patient group without amyloid pathology, and the Alzheimer's disease mild cognitive impairment patient group with high accuracy (AUC=0.8750, It was confirmed that it can be distinguished as 0.7938, 0.8304) (Figure 3).

These results indicate that disease-specific hypermethylation of the ATP2C1 gene, which appears in skin fibroblasts of patients with Alzheimer's disease dementia, is effective as a diagnostic marker for diagnosing Alzheimer's disease dementia in a non-invasive manner.

From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without changing its technical idea or essential features. Therefore, the embodiments described above should be understood in all respects as illustrative and not restrictive. The scope of the present invention should be construed as including the meaning and scope of the patent claims described below rather than the detailed description above, and all changes or modified forms derived from the equivalent concept thereof are included in the scope of the present invention.

Claims (10)

1. A composition for diagnosing Alzheimer's disease dementia, comprising an agent for measuring the methylation level of the CpG region of the ATP2C1 (ATPase Secretory Pathway Ca ²⁺ Transporting 1) gene promoter.
2. According to paragraph 1,

   Agents for measuring the methylation level of the CpG region of the gene promoter include a compound that modifies an unmethylated cytosine base or a methylation-sensitive restriction enzyme, a primer specific for the methylated sequence of the CpG region of the gene promoter, and an unmethylated sequence. A composition comprising a specific primer, a methylated CpG binding domain, or an antibody that specifically binds to methylcytosine.
3. According to paragraph 2,

   A composition wherein the compound that modifies the unmethylated cytosine base is bisulfite or a salt thereof.
4. According to paragraph 2,

   The composition wherein the methylation sensitive restriction enzyme is Sma I, Sac II, Eag I, Hpa II, Msp I, Bss HII, Bst UI or Not I.
5. A kit for diagnosing Alzheimer's disease dementia, comprising the composition of any one of claims 1 to 4.
6. A method of providing information for diagnosing Alzheimer's disease dementia, comprising measuring the methylation level of the CpG region of the ATP2C1 gene promoter from a sample of an individual.
7. According to clause 6,

   The method further comprising comparing the methylation level with the methylation level in the corresponding gene in a control sample not suffering from Alzheimer's disease.
8. According to clause 6,

   The step of measuring the methylation level of the CpG region of the gene promoter is

   (a) treating the genomic DNA in the obtained sample with a compound that modifies unmethylated cytosine bases or a methylation-sensitive restriction enzyme; and

   (b) A method comprising the step of amplifying the treated DNA by PCR using primers capable of amplifying the CpG region of the ATP2C1 gene promoter.
9. According to clause 8,

   The method wherein the compound that modifies the unmethylated cytosine base is bisulfite or a salt thereof.
10. According to clause 6,

    Methods for detecting the methylation level include methylation-specific polymerase chain reaction, real time methylation-specific polymerase chain reaction, and PCR using a methylated DNA-specific binding protein. , quantitative PCR, pyrosequencing, bisulfite sequencing, DNA methylation microarray, and immunoprecipitation using a methylated CpG binding domain or anti-methylcytosine antibody.

Images