WO2024017318A1

WO2024017318A1 - Ralstonia eutropha having low endotoxin content, and use thereof

Info

Publication number: WO2024017318A1
Application number: PCT/CN2023/108313
Authority: WO
Inventors: 丰婧; 杨晓妍; 尹进; 李腾; 张浩千
Original assignee: 深圳蓝晶生物科技有限公司
Priority date: 2022-07-21
Filing date: 2023-07-20
Publication date: 2024-01-25
Also published as: TW202407101A; CN115976088A; CN115976088B

Abstract

The present application belongs to the technical field of microorganisms and provides Ralstonia eutropha having low endotoxin content and a use thereof. Further provided is a use of the reduction of enzymatic activity and/or expression of the H16_A0228 protein and/or the H16_B0917 protein of Ralstonia eutropha in the reduction of the endotoxin content of Ralstonia eutropha. The inactivation of the H16_A0228 and H16_B0917 proteins of Ralstonia eutropha can markedly reduce the endotoxin content of Ralstonia eutropha. The engineered Ralstonia eutropha having loss-of-function of the H16_A0228 protein and H16_B0917 protein has significantly lowered endotoxin content, while cell dry weight and PHA yield are significantly raised. The present application provides new gene and strain resources for the development of engineer PHA strains, provides an effective method for reducing the endotoxin content of PHAs, and has important significance for extending the application of PHAs in medical materials.

Description

Eutrophic bacterium rosenbergii with low endotoxin content and its application

Technical field

The present invention relates to the technical field of microorganisms, and in particular to low endotoxin content of Eutrophus rosenbergii and its application.

Background technique

Endotoxins are a component of the outer cell membrane of most Gram-negative bacteria. The outer cell membrane is an asymmetric lipid bilayer, mainly composed of phospholipids as the inner layer and lipopolysaccharide as the outer layer. Lipopolysaccharide is composed of hydrophobic lipid A (Lipid A), hydrophilic non-specific core polysaccharides (Core polysaccharides) and long-chain O-antigen polysaccharides (O-antigen). The core polysaccharide contains an outer hexose region and An inner heptose region is connected to specific polysaccharides and lipid A respectively. The long-chain O antigen polysaccharide gives the strain a specific surface antigen and is composed of repeated oligosaccharide subunits. Lipid A causes endotoxin toxicity. key ingredients. It has been reported that lipid A deficiency is lethal to most other Gram-negative bacteria (Clementz, T. Inhibition of lipopolysaccharide biosynthesis and cell growth following inactivation of the kdtA gene in Escherichia coli.[J].Journal of Biological Chemistry ,1995,270(46):27646.).

Polyhydroxyalkanoates (PHA) are a type of polymer synthesized by microorganisms. They have multi-material properties and have been widely used in medical, agricultural, environmental protection, chemical and other fields, especially in the field of medical materials. , due to its excellent material properties, it is considered to be a material with broad application prospects. However, biosynthesized PHA cannot come into direct contact with the human body, and pyrogenic components (such as endotoxins) must be removed before it can reach medical grade PHA materials.

Ralstonia eutropha, also known as Cupriavidus necator, is a type of Gram-negative bacteria and one of the strains that can be used to synthesize PHA. However, the residual endotoxin in PHA materials greatly limits the application of PHA in medical materials. Therefore, purified PHA needs to minimize the endotoxin content. There have been no reports of genetic modification of E. rosenbergii to reduce its endotoxin content.

Contents of the invention

One of the objects of the present invention is to provide a method for reducing the endotoxin content in E. rosenbergii. Another object of the present invention is to provide an engineered E. rosenbergii that reduces endotoxin content.

The present invention takes Eutrophic bacterium rosette as the research object and develops a method to reduce its endotoxin content through genetic engineering. Law. During the research and development process, the present invention found that the molecular weight, fatty acid chain structure and other chemical structures of lipid A of Eutrophus rosenbergii are significantly different from other Gram-negative bacteria such as Escherichia coli. A has one more 4-amino-4-deoxy-L-arabinose, and the primary acyl chain of the fatty acid chain of Eutropha rosenbergii is C14, and at the same time, a secondary acyl chain is produced at the 2 and 2' positions. The primary acyl chains are also C14 (the primary acyl chain of E. coli is C14, and one of the secondary acyl chains is C12). The currently discovered fatty acid chain synthases of lipid A in Gram-negative bacteria generally have substrate specificity, and the synthesis of fatty acid chains of different lengths is catalyzed by different enzymes (for example, lauroyltransferase catalyzes the synthesis of C12 fatty acid chains, cardamom Acyltransferase catalyzes the synthesis of C14 fatty acid chains). It can be deduced that the enzymes involved in the synthesis of lipid A and its fatty acid chain in E. rosettei and their synthesis and regulatory mechanisms may be significantly different from other Gram-positive bacteria such as Escherichia coli. However, there is currently no information on the synthesis of lipid A and its fatty acid chain in E. rosettei. Report on the synthesis pathway of lipid A and its fatty acid chain and related enzymes.

In addition, during the research and development process, the present invention has tried to use the existing technology disclosed methods for reducing the endotoxin toxicity or content of Gram-negative bacteria such as Escherichia coli and Bacillus pertussis in Eutrophus rosenbergii, for example: knockout for regulating fatty acids The chain is transferred to the carbon skeleton of lipid A. The msbB and pagP genes simultaneously overexpress the inner membrane phosphatase lpxEft derived from Francisella tularensis to change the structure of lipid A, and express the acyltransferase LpxDpa derived from Pseudomonas aeruginosa. LpxApa can change the length of the acyl chain at different positions. However, none of the above methods can achieve the purpose of reducing the endotoxin content in E. roselli. This further proves that the chemical structural characteristics of lipid A and its fatty acid chain in E. roselli lead to Its synthetase and its synthesis and regulatory mechanisms may be significantly different from other Gram-positive bacteria such as Escherichia coli.

After continuous attempts, the present invention unexpectedly found that weakening or knocking out the H16_A0228 protein and H16_B0917 protein of E. rosenbergii can significantly reduce its endotoxin content, and is also beneficial to increasing PHA production and biomass.

Specifically, the present invention provides the following technical solutions:

In a first aspect, the present invention provides the application of the expression and/or enzyme activity reduction of E. rosette H16_A0228 protein or its homologous protein, and/or H16_B0917 protein or its homologous protein in reducing the endotoxin content of E. rosettei. .

In a second aspect, the present invention provides the application of expression and/or enzyme activity reduction of E. rosenbergii H16_A0228 protein or its homologous protein, and/or H16_B0917 protein or its homologous protein in improving PHA production of E. rosenbergii.

In a third aspect, the present invention provides the application of the expression and/or enzyme activity reduction of E. rosenbergii H16_A0228 protein or its homologous protein, and/or H16_B0917 protein or its homologous protein in increasing the biomass of E. rosenbergii.

In the fourth aspect, the present invention provides that the expression and/or enzyme activity of the H16_A0228 protein or its homologous protein of E. rosettei, and/or the H16_B0917 protein or its homologous protein can be reduced while reducing the endotoxin content of E. rosettei while improving the Application of PHA production and biomass of eutrophic bacteria.

In some embodiments of the present invention, the present invention provides that expression and/or enzyme activity reduction of E. rosettei H16_A0228 protein or its homologous protein can reduce endotoxin content of E. rosettei and increase PHA production of E. rosettei and/or application in increasing the biomass of E. rosenbergii.

In some embodiments of the present invention, the present invention provides that expression and/or enzyme activity reduction of E. rosettei H16_B0917 protein or its homologous protein can reduce endotoxin content of E. rosettei and increase PHA production of E. rosettei and/or application in increasing the biomass of E. rosenbergii.

In some embodiments of the present invention, the present invention provides the expression and/or enzymatic activity reduction of E. rosenbergii H16_A0228 protein or its homologous protein and H16_B0917 protein or its homologous protein in reducing the endotoxin content of E. rosenbergii, Application in increasing the PHA production of Eutrophus rosenbergii and/or increasing the biomass of Eutrophus rosenbergii.

In the above applications, the increase in biomass can be expressed as an increase in dry cell weight.

In the present invention, H16_A0228 and H16_B0917 are locus_tags of protein-coding genes in GenBank, and the sequences of H16_A0228, H16_B0917 proteins and their coding genes are available in GenBank.

Specifically, the coding gene sequence of the H16_B0917 protein is shown in SEQ ID NO.3, and the amino acid sequence of the H16_B0917 protein is shown in SEQ ID NO.4. The coding gene sequence of H16_A0228 protein is shown in SEQ ID NO.5, and the amino acid sequence of H16_A0228 protein is shown in SEQ ID NO.6.

The amino acid sequence of H16_B0917 protein (SEQ ID NO.4) is as follows:

The amino acid sequence of H16_A0228 protein (SEQ ID NO.6) is as follows:

Based on the amino acid sequences of the above-mentioned H16_A0228 and H16_B0917 proteins, using sequence comparison search tools such as BLAST, those skilled in the art can obtain the homologous proteins of the H16_A0228 and H16_B0917 proteins in E. rosenbergii.

Preferably, the homologous protein is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97% identical to the H16_A0228 or H16_B0917 protein. , at least 98%, at least 99%, at least 99.5% or at least 99.9% sequence similarity, and having the same function.

In the above applications, reducing the expression and/or enzyme activity includes weakening the expression and/or enzyme activity of the protein, or causing the protein not to be expressed or inactivated.

The present invention has no special limitations on the manner of achieving expression and/or reduction of enzyme activity. For example, genetic engineering means can be used to modify the target protein, its encoding gene, its regulatory element and/or its regulatory gene or protein, so that the target protein can be modified. Protein expression and/or enzyme activity are reduced.

In some embodiments of the present invention, the expression and/or enzyme activity reduction of H16_A0228 protein and H16_B0917 protein is achieved through any one or a combination of the following (1) to (3):

(1) Mutation of the amino acid sequence of the protein to reduce the expression and/or enzyme activity of the protein;

(2) Mutation of the nucleotide sequence of the protein coding gene to reduce protein expression and/or enzyme activity;

(3) Replace the transcription and/or translation regulatory elements of protein-coding genes with less active elements to reduce protein expression.

Mutation of the above-mentioned amino acid sequence includes deletion, insertion or substitution of one or more amino acids.

Mutation of the nucleotide sequence described above includes deletion, insertion or replacement of one or more nucleotides.

The above-mentioned transcription and translation regulatory elements include promoters, ribosome binding sites, etc.

In some embodiments of the present invention, the expression and/or enzyme activity reduction of the H16_A0228 protein and H16_B0917 protein is achieved by inactivating the proteins.

In some embodiments of the present invention, the expression and/or enzyme activity of the H16_A0228 protein and H16_B0917 protein is reduced by deleting the genes encoding the proteins (H16_B0917 gene, H16_A0228 gene).

Those skilled in the art can understand that both reduced protein expression and reduced enzyme activity will lead to a reduction in the total activity of the enzyme in the cell, thereby affecting the corresponding physiological and metabolic phenotypes of the enzyme. Therefore, whether the expression of H16_A0228 protein and H16_B0917 protein is reduced or the enzyme activity of H16_A0228 protein and H16_B0917 protein is reduced, the endotoxin content of E. rosettei can be significantly reduced, and its biomass and PHA production can be increased.

In the above-mentioned applications of the first to fourth aspects, the E. rosenbergii is a strain containing H16_A0228 protein or its homologous protein, and/or, H16_B0917 protein or its homologous protein.

In some embodiments of the present invention, the E. rosenbergii is H16 or a derivative strain of E. rosenbergii H16. The derivative strain of E. rosettei H16 is E. rosettei H16, which is obtained by genetically modifying E. rosettei H16 using means such as genetic engineering, mutagenesis, and adaptive evolution. mutant strains.

In a fifth aspect, the present invention provides an engineered E. rosettei, which is modified such that the expression and/or enzyme activity of H16_A0228 protein and/or H16_B0917 protein is reduced.

In some embodiments of the invention, the engineered E. rosettei is modified such that the expression and/or enzyme activity of the H16_A0228 protein is reduced.

In some embodiments of the invention, the engineered E. rosenbergii is modified such that the expression and/or enzymatic activity of the H16_B0917 protein is reduced.

In some embodiments of the invention, the engineered E. rosenbergii is modified such that the expression and/or enzymatic activity of H16_A0228 protein and H16_B0917 protein is reduced.

The above-mentioned reduction of expression and/or enzyme activity includes weakening the expression and/or enzyme activity of the protein, or causing the protein to be non-expressed or inactive.

(3) Replace the transcription and/or translation regulatory elements of protein-coding genes with less active elements so that the protein White expression is reduced.

In some embodiments of the present invention, the H16_A0228 protein and/or the H16_B0917 protein in the engineered Eutrophus rosenbergii is inactivated, or the engineered Eutrophus rosenbergii does not express the H16_A0228 protein and/or H16_B0917 protein.

In some embodiments of the present invention, the engineered E. rosenbergii lacks genes encoding H16_A0228 protein and/or H16_B0917 protein.

In a sixth aspect, the present invention provides the application of the above-mentioned engineered E. rosenbergii in the fermentation production of biochemicals.

The above-mentioned biochemicals include but are not limited to polyesters, alcohols, amino acids, polypeptides, proteins, nucleic acids, sugars, lipids, etc.

In some embodiments of the present invention, there is provided the use of the above-mentioned engineered E. rosenbergii in the fermentative production of PHA or its derivatives.

In some embodiments of the present invention, the above-mentioned engineered Eutrophic bacteria are used to ferment and produce PHA with vegetable oil (including but not limited to palm oil, palm kernel oil, peanut oil, soybean oil, linseed oil, rapeseed oil, cottonseed oil, One or a mixture of castor oil, corn oil) was used as the carbon source.

The culture medium used for fermentation production may also contain nitrogen sources (including but not limited to ammonium salts), inorganic salts (including but not limited to disodium hydrogen phosphate, potassium dihydrogen phosphate), trace elements (including but not limited to magnesium, calcium , zinc, manganese, cobalt, boron, copper, nickel, molybdenum).

In a seventh aspect, the present invention provides a method for constructing the above-mentioned engineered E. rosettei, which method includes: modifying E. rosettei so that the expression and/or enzyme activity of H16_A0228 protein and/or H16_B0917 protein is reduced.

In an eighth aspect, the present invention provides a method for reducing the endotoxin content of E. rosettei, which method includes: modifying E. rosettei to reduce the expression and/or enzyme activity of H16_A0228 protein and/or H16_B0917 protein.

In some embodiments of the present invention, the expression and/or enzyme activity reduction is to inactivate the H16_A0228 protein and/or H16_B0917 protein, or to cause E. rosenbergii not to express the H16_A0228 protein and/or H16_B0917 protein.

The beneficial effect of the present invention is that the inactivation of the H16_A0228 protein and the H16_B0917 protein of E. rosenbergii provided by the present invention can significantly reduce the endotoxin content of E. rosenbergii. The engineered E. rosenbergii with functional loss of H16_A0228 protein and H16_B0917 protein not only significantly reduced the endotoxin content, but also significantly increased its cell dry weight and PHA production, providing new genes and strain resources for the development of PHA engineered strains. Reducing the endotoxin content of PHA provides an effective method, which is of great significance for expanding the application of PHA in medical materials.

Detailed ways

The following examples are used to illustrate the invention but are not intended to limit the scope of the invention.

The experimental methods used in the following examples are all conventional methods unless otherwise specified.

The materials, reagents, etc. used in the following examples can all be obtained from commercial sources unless otherwise specified. Among them, the enzyme reagents used were purchased from New England Biolabs (NEB), the kits used to extract plasmids were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd., and the kits used to recover DNA fragments were purchased from Omega Company in the United States. The corresponding operating steps are strict. Follow the product instructions and all media should be prepared with deionized water unless otherwise specified.

The culture medium formula used in the following examples is as follows:

Seed culture medium: 10g/L peptone, 5g/L Yeast Extract, 3g/L glucose.

Production medium: 1.0% palm oil, 9.85g/L Na ₂ HPO ₄ ·12H ₂ O, 1.5g/L KH ₂ PO ₄ , 3.0g/L NH ₄ Cl, 10mL/L trace element solution I and 1mL/L Trace Element Solution II. The composition of trace element solution I is: 20g/L MgSO ₄ and 2g/L CaCl ₂ . The composition of trace element solution II is: 100mg/L ZnSO ₄ ·7H ₂ O, 30mg/L MnCl ₂ ·4H ₂ O, 300mg/L H ₃ BO ₃ , 200mg/L CoCl ₂ ·6H ₂ O, 10mg/L CuSO ₄ ·5H ₂ O, 20mg/L NiCl ₂ ·6H ₂ O, 30mg/L NaMoO ₄ ·2H ₂ O. The above reagents were purchased from Sinopharm Chemical Reagent Company.

Example 1 Construction and identification of H16_B0917 deletion mutant strain

In this example, E. rosenbergii H16 is used as the starting strain to knock out the H16_B0917 gene, which specifically includes the following steps:

Step 1: Construct basic plasmid

Using E. rosenbergii H16 genome as a template, 917H1-F and 917H1-R were used for PCR amplification. The upstream homology arm 917-H1 of H16_B0917 was amplified by PCR using 917H2-F and 917H2-R to obtain the downstream homology arm 917-H2 of H16_B0917; using the modified plasmid pK18mob as a template, pK-F and pK-R were used The vector fragment was obtained by primer PCR amplification, and 917-H1 and 917-H2 were connected to the vector fragment through the Gibson Assembly method to obtain the recombinant plasmid pKO-H16_B0917 (the sequence is shown in SEQ ID NO. 1). The primers used above are shown in Table 1.

Table 1

Step 2: Construct the target strain of H16_B0917 deletion mutation

Transform the recombinant plasmid pKO-H16_B0917 obtained in step 1 into Escherichia coli S17-1, and then transfer it into E. rosenbergii H16 through the conjugation transformation method. Taking advantage of the characteristic that the suicide plasmid cannot replicate in the host bacteria, use 500 μg/ LB plates containing mL spectinomycin and 100 μg/mL apramycin were used to screen out positive clones. The recombinant plasmid with the homologous fragment in the positive clone was integrated into the specific position of H1 and H2 on the genome, which was the first homologous recombination bacterium. The first homologous recombinant bacteria were cultured as single clones on LB plates containing 100 mg/mL sucrose, and clones without spectinomycin resistance were screened out from these single clones, and primer 917-H1FP (SEQ ID NO. 19): ATGTCGCTGACCGACGACCATGTC and 917-H1RP (SEQ ID NO.20): TTGGCACCACCAGCCTGACCAATG for PCR identification of H16_B0917 gene knockout The recombinant strain, the finally obtained recombinant strain was E. rosenbergii Re01 with the H16_B0917 gene knocked out.

Example 2 Construction and identification of H16_A0228 deletion mutant strain

In this example, E. rosenbergii H16 is used as the starting strain to knock out the H16_A0228 gene, which specifically includes the following steps:

Step 1: Construct basic plasmid

Using the E. rosenbergii H16 genome as a template, 228H1-F and 228H1-R were used for PCR amplification to obtain the upstream homology arm 228-H1 of H16_A0228, and 228H2-F and 228H2-R were used for PCR amplification to obtain the downstream homology arm of H16_A0228. Source arm 228-H2; use the modified plasmid pK18mob as a template and use pK-F and pK-R as primers to PCR amplify the vector fragment; connect 228-H1 and 228-H2 to the vector fragment using the Gibson Assembly method to obtain Recombinant plasmid pKO-H16_A0228 (sequence is shown in SEQ ID NO.2). The primers used are shown in Table 2.

Table 2

Step 2: Construct the target strain with H16_A0228 deletion mutation

Transform the recombinant plasmid pKO-H16_A0228 obtained in step 1 into E. coli S17-1, and then transfer it into E. rosenbergii H16 through the conjugation transformation method. Taking advantage of the fact that the suicide plasmid cannot replicate in the host bacteria, use simultaneous Positive clones were screened out on LB plates containing 500 μg/mL spectinomycin and 100 μg/mL apramycin. The recombinant plasmid with the homologous fragment in the positive clone was integrated into the specific position of H1 and H2 on the genome, which was the first homologous recombination bacterium. The first homologous recombinant bacteria were cultured as single clones on LB plates containing 100 mg/mL sucrose, and clones without spectinomycin resistance were screened out from these single clones, and primer 228-H1FP (SEQ ID NO. 21): ATCGATACCACCGAGATCCATTCG and 228-H1RP (SEQ ID NO. 22): AGCTGCATGGCTTTGACGACTACC were used to perform PCR to identify the recombinant strain with H16_A0228 gene knockout, and the recombinant strain finally obtained was E. rosenbergii Re02 with H16_A0228 knockout.

Example 3 Construction and identification of H16_B0917 and H16_A0228 double deletion mutant strains

In this example, E. rosenbergii Re02 constructed in Example 2 was used as the starting strain to knock out the H16_B0917 gene. The specific steps are as follows:

The recombinant plasmid pKO-H16_B0917 obtained in Example 1 was transformed into E. coli S17-1, and then transferred into E. rosenbergii Re02 constructed in Example 2 through the conjugation transformation method, taking advantage of the fact that the suicide plasmid cannot replicate in the host bacteria. , use LB plates containing both 500 μg/mL spectinomycin and 100 μg/mL apramycin to screen out positive clones. The recombinant plasmid with the homologous fragment in the positive clone was integrated into the specific position of H1 and H2 on the genome, which was the first homologous recombination bacterium. The first homologous recombination bacteria were cultured as single clones on LB plates containing 100 mg/mL sucrose, and clones without spectinomycin resistance were screened out from these single clones, and primers 917-H1FP: ATGTCGCTGACCGACGACCATGTC and 917- H1RP:TTGGCACCACC AGCCTGACCAATG performed PCR to identify the recombinant strain with H16_B0917 gene knockout, and the finally obtained recombinant strain was E. rosenbergii Re03 with both H16_B0917 and H16_A0228 knocked out.

Example 4 Performance verification of strains Re01, Re02 and Re03

In this example, Eutrophus rosenbergii H16 was used as the control strain to test the endotoxin content, biomass and PHB content of Re01, Re02 and Re03 after fermentation.

Step 1: Fermentation culture of strains Re01, Re02 and Re03

Re01, Re02, Re03 and E. rosenbergii H16 were streaked on an LB plate to obtain single clones. The single clones were inoculated into seed culture medium (4 mL) and cultured for 12 hours. Transfer the bacterial solution cultured overnight to a 100 mL glass Erlenmeyer flask containing 10 mL of seed culture medium. Inoculate the final OD volume of about 0.1, incubate at 30°C, 220 rpm for 8 hours, and the transfer culture is ready. The culture for PHA fermentation production is to pre-culture seed liquid with an OD value between 6-7. Inoculate the final inoculation amount into a 250 mL shake flask containing 30 mL of production medium at a final OD of 0.1, and ferment and culture at 30°C and 220 rpm for 48 hours. Each strain was set up in 3 parallels.

Step 2: Determination of endotoxin content of strains Re01, Re02 and Re03

Take 1 mL of fresh bacterial liquid after fermentation in the above step 1, centrifuge at 13400g for 1 minute to collect the bacterial cells, discard the supernatant, then use 30% ethanol solution to resuspend the bacterial cells and centrifuge, discard the supernatant, repeat the above steps twice, and wash the bacteria body. Finally, the bacteria were diluted with deionized water to an OD ₆₀₀ of 0.5, lysed at 100°C for 30 minutes, and then left at room temperature for 24 hours to fully release the endotoxin. Use ToxinSensor chromogenic LAL endotoxin detection kit to detect endotoxin content. The test results are shown in Table 3. Compared with the control strain E. rosenbergii H16, the endotoxin unit contents of Re01, Re02, and Re03 were reduced by 46 times, 52 times, and 95 times, respectively.

The above-mentioned ToxinSensor chromogenic LAL endotoxin detection kit was purchased from Genscript Biotechnology Co., Ltd.

table 3

Step 3: Biomass determination of strains Re01, Re02 and Re03

Take the amount of fermentation liquid from the above step 1 and use a 50mL graduated cylinder to measure the volume of the bacterial liquid (recorded as V, unit: mL), place it in a weighed centrifuge tube (the weight is recorded as m1, unit: g), 8000rpm, room temperature, Centrifuge for 10 minutes, discard the supernatant, and collect the bacteria; then use 15 mL of 30% ethanol solution to resuspend the bacteria at 8000 rpm, room temperature, and centrifuge for 10 minutes. Repeat twice to wash away the grease and culture medium in the strain, and finally collect the bacteria. The centrifuge tube is placed in a 60°C oven, dried to constant weight, and its weight is accurately weighed using an analytical balance (recorded as m2, unit: g). and calculate its dry weight. The results are shown in Table 4. Compared with the control strain Eutrophus rosenbergii H16, the biomass of Re01, Re02 and Re03 increased by 27.8%, 17.9% and 28.2% respectively.

The above dry weight calculation formula is M=(m2-m1)/V*1000, and the unit is g/L.

Table 4

Step 4: Determination of PHB content of strains Re01, Re02 and Re03

1. Sample processing: Weigh the sample dried in step 3 above, weigh 30 to 40 mg accurately and place it in a digestion tube. Add 2 mL of esterification solution and 2 mL of chloroform. Cover the esterification tube and seal it for 4 hours at 100°C. The reaction is completed. Then let it stand and cool to room temperature, add 1 mL of deionized water, vortex until completely mixed, let it stand and separate into layers, then remove the lower organic phase for gas chromatography analysis.

The preparation method of the above esterification liquid is to take 485mL of anhydrous methanol, add 1g/L benzoic acid, and slowly add 15mL of concentrated sulfuric acid to prepare 500mL of esterification liquid.

2. Standard product processing: poly[(R)-3-hydroxybutyric acid], used to calibrate 3HB unit, white powder, weighing gradient values are 15mg, 25mg, 35mg, weighing method and processing method are the same as the above sample processing method same.

3. GC analysis of PHA composition and content: Shimadzu GC-2014 gas chromatograph was used. The configuration of the chromatograph is: HP-5 capillary chromatographic column, hydrogen flame ionization detector FID, and SPL split inlet; high-purity nitrogen is used as the carrier gas, hydrogen is the fuel gas, and air is the fuel-assisted gas; AOC-20S automatic Injector, acetone is the cleaning solution. The settings of the GC analysis program are: the inlet temperature is 240°C, the detector temperature is 250°C, the column temperature starts at 80°C, and is maintained for 1.5 minutes; it is raised to 140°C at a rate of 30°C/min and maintained for 0 minutes; Ramp to 240°C at 40°C/min and hold for 2 minutes; total time is 8 minutes. The GC results used the internal standard normalization method to quantitatively calculate the PHB content based on the peak area. The results are shown in Table 5. Compared with the control strain, the PHB contents of RE01, RE02 and RE03 increased by 7.02%, 5.42% and 9.61% respectively.

table 5

The E. rosenbergii H16 used in the above examples is a model bacterium for studying the physiological metabolism and PHA production of E. rosenbergii. Those skilled in the art know that the results of gene function studies of model bacteria are universal in other strains of the same species. The present invention found that the effects of H16_A0228 protein and H16_B0917 protein on the endotoxin content, biomass and PHA production of E. rosettei do not depend on the specific genetic composition of E. rosettei H16 strain itself. The E. rosettei H16 was subjected to different After genetic engineering, as long as it still contains H16_A0228 protein and H16_B0917 protein, reducing the expression and/or activity of H16_A0228 protein and/or H16_B0917 protein can play a role in reducing the endotoxin content of the strain and increasing biomass and PHA production.

In addition, the above examples took PHB as an example to analyze the impact of the expression and/or enzyme activity reduction of H16_A0228 protein and H16_B0917 protein on the production of metabolites by E. rosenbergii. In the present invention, the expression and/or enzymatic activity of H16_A0228 protein and/or H16_B0917 protein is reduced, which will lead to the loss of the lipid A structure, thereby allowing, on the one hand, part of the carbon source and energy used to synthesize the outer membrane to be diverted to the synthesis of other product, thereby leading to an increase in PHA production; on the other hand, the lack of outer membrane structure will increase the permeability of the cell membrane of E. rosettei, which can promote the entry of exogenous substrates (carbon sources, nitrogen sources, etc.) into the cells and increase their diffusion level within the plant, thus promoting the production of biomass and PHA. Therefore, the products that can be promoted by the expression of H16_A0228 protein and H16_B0917 protein and/or the reduction of enzyme activity are not limited to the PHB exemplified in the above embodiments. When E. rosenbergii H16 or its derivative strains are used to produce PHA, among them If the expression and/or enzyme activity of H16_A0228 protein and/or H16_B0917 protein is reduced, it is reasonable to expect that the production of other PHAs other than PHB will also be significantly increased.

Although the present invention has been described in detail with general descriptions and specific embodiments above, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Industrial applicability

The present invention finds that the inactivation of H16_A0228 protein and H16_B0917 protein of Eutrophus rosenbergii can significantly reduce the Endotoxin content of Eutrophic bacteria. The engineered E. rosettei constructed by deleting the function of H16_A0228 protein and H16_B0917 protein not only significantly reduced the endotoxin content, but also significantly increased its cell dry weight and PHA production, providing new genes and strains for the development of PHA engineered strains. resources, provides an effective method to reduce the endotoxin content of PHA, and is of great significance for expanding the application of PHA in medical materials.

Claims

Use of expression and/or reduction of enzyme activity of E. rosenbergii H16_A0228 protein or its homologous protein, and/or H16_B0917 protein or its homologous protein in reducing endotoxin content of E. rosenbergii.
Use of expression and/or reduction of enzyme activity of E. rosenbergii H16_A0228 protein or its homologous protein, and/or H16_B0917 protein or its homologous protein in increasing PHA production of E. rosenbergii.
Use of expression and/or reduction of enzyme activity of E. rosenbergii H16_A0228 protein or its homologous protein, and/or H16_B0917 protein or its homologous protein in increasing the biomass of E. rosenbergii.
The expression and/or enzymatic activity of E. rosettei H16_A0228 protein or its homologous protein, and/or H16_B0917 protein or its homologous protein is reduced, which can reduce the endotoxin content of E. rosettei while increasing the PHA production and production of E. rosettei. Applications in biomass.
Engineered E. rosettei, characterized in that the engineered E. rosettei is modified so that the expression and/or enzyme activity of the H16_A0228 protein or its homologous protein, and/or the H16_B0917 protein or its homologous protein is reduced .
The engineered E. rosettei according to claim 5, characterized in that the H16_A0228 protein or its homologous protein, and/or the H16_B0917 protein or its homologous protein in the engineered E. rosettei is inactivated, or, The engineered E. rosenbergii does not express H16_A0228 protein or its homologous protein, and/or H16_B0917 protein or its homologous protein.
Application of the engineered Eutrophic bacterium Roschanii described in claim 5 or 6 in the fermentation production of biochemicals.
The construction method of engineered Eutrophus rosettei according to claim 5 or 6, characterized in that the method includes: modifying Eutrophus rosettei so that the H16_A0228 protein or its homologous protein, and/or the H16_B0917 protein or its The expression and/or enzyme activity of homologous proteins is reduced.
A method for reducing the endotoxin content of E. rosettei, characterized in that the method includes: modifying E. rosettei so that the H16_A0228 protein or its homologous protein, and/or the H16_B0917 protein or its homologous protein Reduced expression and/or enzyme activity.
The method for reducing the endotoxin content of Eutrophic bacterium rosette according to claim 9, characterized in that the expression and/or enzyme activity is reduced to inactive H16_A0228 protein or its homologous protein, and/or H16_B0917 protein or its homologous protein Homologous protein, or, E. rosenbergii does not express H16_A0228 protein or its homologous protein, and/or H16_B0917 protein or its homologous protein.