WO2024016820A1 - Nano chitosan/dsgrk complex, preparation method therefor, and application thereof - Google Patents

Abstract

Provided are a nano chitosan/dsGRK complex, a preparation method therefor, and an application thereof. The nano chitosan/dsGRK complex comprises dsGRK and chitosan, and the degree of deacetylation of the chitosan is 75%. An apolygus lucorum nano chitosan/dsGRK complex can effectively improve the stability of the dsGRK. The death rate of the apolygus lucorum in the nano chitosan/dsGRK complex treatment group is significantly improved.

Description

A nanoscale chitosan/dsGRK complex and its preparation method and application Technical field

The invention belongs to the technical field of agricultural genetic engineering, and specifically relates to a nanoscale chitosan/dsGRK complex, its preparation method and its application in the prevention and control of green stink bugs.

Background technique

Apolygus lucorum (Hemiptera: Miridae) belongs to the family Hemiptera, Apolygus lucorum, and is an important pest on fruit trees, vegetables and other economic crops. The control of green stink bugs mainly relies on chemical pesticides, but long-term use of chemical agents will bring about the 3R effect. In recent years, double-stranded RNA (dsRNA)-mediated RNA interference (RNAi) technology has been widely used in the functional study of insect genes and has shown great application potential in pest control. Commonly used RNAi methods include injection, immersion and feeding. Among them, due to the high cost and high operational technical requirements, the injection method is only suitable for laboratory research and cannot be promoted and applied in the field. In addition, since dsRNA is unstable in the external environment, the RNAi effect is lower when soaking or feeding methods are used.

In recent years, dsRNA delivery systems mediated through nanomaterials have shown great advantages in improving RNAi efficiency compared with traditional dsRNA delivery systems. Nanomaterials mainly combine with the phosphate groups of nucleic acids through interactions such as electrostatic, van der Waals forces, and hydrogen bonds to form dsRNA/nanomaterial complexes, which can improve their stability. Chitosan (CS), also known as chitosan, is obtained from chitin (chitin), which is widely found in nature, through chemical treatment and deacetylation. Chitosan contains hydroxyl and amino groups and is one of the most commonly used polymers. Due to its low cost, easy degradation, and good biocompatibility, it can become a promising delivery system for dsRNA, siRNA, plasmid DNA, oligonucleotides, peptides, and even proteins. Chitosan is positively charged under slightly acidic conditions, which helps form dsRNA/nanocomplexes through electrostatic interactions with negatively charged nucleic acids.

At present, studies have shown that the nanocomplex formed by chitosan and dsRNA can be stably and effectively delivered into plants or insects, but the research on RNAi nanopreparations in the control of green stink bugs is still blank.

Contents of the invention

Purpose of the invention: The technical problem to be solved by the present invention is to synthesize the dsRNA of the green stink bug GRK gene in vitro, and form a nano preparation with chitosan, that is, a nanoscale chitosan/dsGRK complex, to improve the stability of dsRNA and effectively enhance RNA interference. efficiency to further improve the effectiveness of controlling green stink bugs.

The technical problem to be solved by the present invention is to provide a preparation method for nanoscale chitosan/dsGRK complex.

The final technical problem to be solved by the present invention is to provide the application of the nanoscale chitosan/dsGRK complex in preventing and controlling green stink bugs.

Technical solution: In order to solve the above technical problems, the present invention provides a nanoscale chitosan/dsGRK complex. The nanoscale chitosan/dsGRK complex includes dsGRK and chitosan, and the chitosan is removed. The degree of acetylation is 75 to 80%. Wherein, the dsGRK is the dsRNA of the green stink bug G protein-coupled receptor kinase (GRK), and the nucleotide sequence of its dsRNA is shown in SEQ ID NO.1.

The GRK gene of the present invention is actually the GRK2 gene, and the GRK2 gene is a subtype gene of the GRK gene family. Therefore, the A. chlorophylla GRK gene is further named AlGRK2.

Wherein, the mass ratio of dsGRK and chitosan is 1:2-5.

Among them, the size of the nanoscale chitosan/dsGRK complex is 200-400nm, and the surface charge is 16.9±4.24mV. Preferably, the size of the nanoscale chitosan/dsGRK complex is 69±12nm.

The content of the present invention also includes the preparation method of the nanoscale chitosan/dsGRK complex, which includes the following steps: 1) Dissolve chitosan with a deacetylation degree of 75 to 80% in a sodium acetate solution to prepare chitosan sugar solution;

2) Add sodium sulfate solution to the dsGRK synthesized in vitro to prepare a dsGRK suspension;

3) Mix chitosan solution and dsGRK suspension, let stand in a water bath and then centrifuge at high speed to obtain.

Wherein, in step 1), the chitosan concentration in the chitosan solution is 0.02-0.1 w/v%; in step 2), the concentration of the sodium sulfate solution is 50-100 mmol/L.

Wherein, in step 2), the mass ratio of dsAlGRK2 and sodium sulfate is 1:10~20,

Wherein, in step 2), the volume ratio of dsAlGRK2 to sodium sulfate solution is 1:1-2.

Wherein, in step 2), the concentration of the sodium sulfate solution is 50-100mmol/L; the preferred concentration is 100mmol/L.

Wherein, in step 3), in the water bath standing step, the water bath temperature is 50-60°C, and let stand for 1-2 minutes; in step 3), the high-speed centrifugation step, the centrifugation conditions are 12000-15000 rpm, 1-2 minutes.

The present invention also includes the application of the nanoscale chitosan/dsAlGRK2 complex in the prevention and control of green stink bug.

Wherein, the application is: spraying the nanoscale chitosan/dsAlGRK2 complex on the surface of the plant and feeding the green stink bug; or soaking the plant in the nanoscale chitosan/dsAlGRK2 complex and drying it , feeding the green stink bug.

Wherein, the plants include but are not limited to green beans.

Beneficial effects: Compared with the existing technology, the present invention has the following advantages:

(1) The present invention provides a green stink bug nanoscaled chitosan/ds AlGRK2 complex. The nanomaterial is 75% deacetylated chitosan; the target gene of ds AlGRK2 is a green stink bug G protein-coupled receptor. Somatic kinase gene; ds AlGRK2 is synthesized in vitro and the nanomaterial chitosan is used to effectively improve the stability of ds AlGRK2.

(2) The present invention provides a method for preparing a green stink bug nanoscaled chitosan/ds AlGRK2 complex, which has a simple process and no pollution to the environment.

(3) The present invention provides an application of a nanoscale chitosan/ds AlGRK2 complex in the prevention and control of chlorophyll bugs. The mortality rate of chlorophyll bugs in the nanoscale chitosan/ds AlGRK2 complex treatment group is significantly increased, The effect is good.

Description of drawings

Figure 1 shows the electrophoresis pattern of dsAlGRK2 synthesized in vitro.

Figure 2 shows the electrophoresis diagram of the optimal loading ratio of nanoscale chitosan/ds AlGRK2 complex. In the figure, M: maker; lane 1: naked dsAlGRK2; lane 2: chitosan solution; lane 3: dsAlGRK2-chitosan mass ratio is 5:1; lane 4: dsAlGRK2-chitosan mass ratio is 4: 1; Lane 5: The mass ratio of dsAlGRK2-chitosan is 3:1; Lane 6: The mass ratio of dsAlGRK2-chitosan is 2:1; Lane 7: The mass ratio of dsAlGRK2-chitosan is 1:1; Lane 8: The mass ratio of dsAlGRK2-chitosan is 1:2; lane 9: the mass ratio of dsAlGRK2-chitosan is 1:3; lane 10: the mass ratio of dsAlGRK2-chitosan is 1:4; lane 11: dsAlGRK2-chitosan The mass ratio is 1:5.

Figure 3 shows the average particle size (Z-average) and surface charge (Zeta potential) of nanoscale chitosan/dsAlGRK2 complex.

Figure 4 is a transmission electron microscope image of nanoscale chitosan/dsAlGRK2 complex.

Figure 5 is an electrophoresis chart to detect the stability of nanoscale chitosan/dsAlGRK2 complex. A: Treat at pH 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12 for 10 minutes respectively, corresponding to lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, M: maker; B: treated at 5, 10, 15, 20, 25, 30, 35, 40, and 45°C for 10 minutes respectively, corresponding to lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, M: maker; C: M: maker; Lane 1: dsAlGRK2 without RNase A treatment; Lane 2: CS-dsAlGRK2 without RNase A treatment; Lane 3: dsAlGRK2 after RNase A treatment; Lane 4 : CS-dsAlGRK2 treated with RNase A.

Figure 6 shows the relative expression of AlGRK2 detected by qRT-PCR, that is, the silencing efficiency of RNAi.

Figure 7 shows the survival rate of green stink bug under different treatment groups;

Figure 8 shows the development period of the 4th instar nymphs of the green bug under different treatment groups;

Figure 9 shows the body weight of 5th instar nymphs of the green bug under different treatment groups.

Detailed ways

The embodiments of the present invention will be described in detail below with reference to examples, but those skilled in the art will understand that the following examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. If the specific conditions are not specified in the examples, the conditions should be carried out according to the conventional conditions or the conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not indicated, they are all conventional products that can be purchased commercially.

The GRK gene of the present invention is actually the GRK2 gene, and the GRK2 gene is a subtype gene of the GRK gene family. Therefore, the A. chlorophylla GRK gene is further named AlGRK2.

Example 1 Obtaining the dsRNA nucleotide sequence of the green stink bug GRK2 gene

1. Use Primer Premier 5.0 software to design a cloning primer pair for the GRK2 gene (Gen Bank accession number: MN514868). The sequence of the primer pair is as follows:

GRK2F, SEQ ID NO.2: GGTTTGGAGAAGTTTACGGC

GRK2-R, SEQ ID NO.3: ATGAGAAGGAG TCGGGAAGC

Primer pairs were synthesized by Shanghai Sangon Bioengineering Co., Ltd.

2. Use the Trizol method to extract the total RNA of the green stink bug and reverse-transcribe to obtain the cDNA template:

The newly hatched third-instar green stink bug nymphs were selected as samples, and 10 nymphs constituted a biological replicate, and were quickly frozen in liquid nitrogen. Grind with an electric grinder, and extract total RNA according to TRIzol Reagent (TIANGEN, Beijing); synthesize first-strand cDNA according to the reverse transcription kit HiScript III RT SuperMix (Vazyme, Nanjing) as a template for the PCR reaction.

3. PCR reaction to obtain the dsAlGRK2 nucleotide sequence of the green stink bug GRK2 gene:

Using the primers synthesized in step 1 and the cDNA template obtained in step 2, obtain the Green Lygus GRK2 gene sequence through PCR reaction. The reaction system is as follows:

PCR reaction conditions were: 94°C for 30 s; 98°C for 10 s, 65°C for 30 s, 72°C for 1 min, 35 cycles; 72°C for 2 min.

The PCR product was analyzed by 1.2% agarose gel electrophoresis, recovered by cutting the gel, and purified using a DNA gel recovery kit to obtain the purified PCR product; and connected to the T/A blunt vector vector (Vazyme, Nanjing), and transferred into Competent cells E.coli DH5α were spread on LB solid plates, placed upright for 10 minutes and then inverted overnight in a 37°C incubator for 12 to 14 hours; positive single colonies were picked for bacterial liquid PCR detection, and the agarose was condensed. Gel electrophoresis analysis; send the verified bacterial solution to Jieli (Shanghai) Biotechnology Company for sequencing. After the sequencing results are correct, the plasmid DNA will be returned.

The nucleotide sequence of the dsRNA of the green stink bug GRK2 gene obtained by sequencing is shown in SEQ ID NO.1.

Example 2 In vitro synthesis of dsAlGRK2

1. Use Primer Premier 5.0 software to design a specific primer pair containing the T7 promoter. The specific primer sequence is as follows:

GRK2-T7-F, SEQ ID NO.4: TAATACGACTCACTATAGGGGGTTTGGAGAAGTTTACGGC

GRK2-T7-R, SEQ ID NO.5: TAATACGACTCACTATAGGG ATGAGAAGGAGTCGGGAAGC

The underlined part is the T7 promoter sequence.

2. Preparation of DNA template

Utilize the cloning primer pair (SEQ ID NO.2, SEQ ID NO.3) and the specific primer pair containing the T7 promoter (SEQ ID NO.4, SEQ ID NO.5), using the plasmid DNA of Example 1 as PCR Template, follow the steps below to prepare the synthetic DNA template for dsRNA:

(1) The reaction system is as follows:

(2) PCR reaction conditions are as follows:

94℃ 30s; 98℃ 10s, 65℃ 30s, 72℃ 1min, cycle 35 times; 72℃ 2min.

3. Product recovery and purification

The PCR amplification product was detected by 1.2% agarose gel electrophoresis, and the target fragment was recovered with reference to the agarose gel DNA recovery kit (TIANGEN, Beijing).

The recycling operation steps are as follows:

(1) Column equilibration step: Add 500 μl of balancing solution BL to the adsorption column CA2 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm for 1 min, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube. ;

(2) Under UV light, cut out the single target DNA band from the agarose gel (try to cut off the excess part), put it into a clean centrifuge tube, and weigh it;

(3) Add an equal volume of lysis solution PN to the gel block (if the gel weight is 0.1g, its volume can be regarded as 100μL, then add 100μL PN solution), place it in a 50°C water bath, and gently turn the centrifuge tube up and down during this period. , to ensure that the glue block is fully dissolved; if there is still undissolved glue block, you can continue to leave it for a few minutes or add some more sol liquid until the glue block is completely dissolved;

(4) Add the solution obtained in the previous step to an adsorption column CA2 (put the adsorption column into the collection tube, place it at room temperature for 2 minutes, centrifuge at 12 000 rpm for 30 to 60 seconds, pour out the waste liquid in the collection tube, and put the adsorption column CA2 into in the collection tube;

(5) Add 600 μL of rinse solution PW to the adsorption column CA2, centrifuge at 12 000 rpm for 30 to 60 seconds, pour out the waste liquid in the collection tube, and put the adsorption column CA2 into the collection tube;

(6) Repeat step (5);

(7) Put the adsorption column CA2 back into the collection tube, centrifuge at 12 000 rpm for 2 minutes, and remove as much rinse liquid as possible; place the adsorption column CA2 at room temperature for a few minutes, and dry it thoroughly to prevent the remaining rinse liquid from affecting the next experiment. ; (8) Place the adsorption column CA2 into a clean centrifuge tube, drop an appropriate amount of elution buffer EB into the middle of the adsorption membrane, and leave it at room temperature for 2 minutes. Centrifuge at 12 000 rpm for 2 minutes to collect the DNA solution;

(9) Check the concentration and whether the band is single through 1% agarose gel.

4. In vitro transcription and synthesis of dsAlGRK2

After obtaining the DNA template, synthesize dsAlGRK2 according to the T7 RNA interference kit. The specific operations are as follows:

(1) At room temperature, configure the in vitro transcription system of forward T7-containing DNA and reverse T7-containing DNA in a 200 μL ribozyme-free centrifuge tube:

After gentle mixing, place in a PCR machine at 37°C for 2 hours;

(2) Transfer the forward and reverse transcription products to the same ribozyme-free centrifuge tube, mix gently, and then fuse the forward and reverse strand RNA in a PCR machine at 70°C for 10 minutes, then let it stand at room temperature for about 20 minutes to cool slowly;

(3) After fusion to form double-stranded RNA, add 2 μL of RNase diluent (1:200) and 2 μL of DNase solution, mix and digest the DNA template and single-stranded RNA in a PCR machine at 37°C for 30 minutes;

5. Purification of dsRNA

Add 4.4 μL of sodium acetate (3 mol/L) and 44 μL of isopropyl alcohol to the digested dsRNA solution, mix well, place on ice for 5 min, centrifuge at 15,000 rpm at 4°C for 10 min, and discard the supernatant. Add 500 μL of 70% ice-cold ethanol and wash twice, discard the supernatant, dry the precipitate at room temperature for 5 minutes, add 50 μL of RNase-Free Water and resuspend to obtain purified double-stranded RNA. The concentration and purity of dsRNA were detected by UV spectrophotometer and 1% agarose gel electrophoresis. The concentration was 6.686~7.384μg/μL, A ₂₆₀ /A ₂₈₀ was 2.05~2.06, A ₂₆₀ /A ₂₃₀ was 2.36~2.45, and the purity was as follows As shown in Figure 1. Figure 1 shows the electrophoresis pattern of dsAlGRK2 synthesized in vitro, M is maker, and lanes 1 and 2 are dsAlGRK synthesized in vitro.

Example 3 Preparation of nanoscale chitosan/dsGRK complex of green stink bug

The nanoscale chitosan/dsGRK complex used in this embodiment for green stink bugs includes chitosan and dsGRK; chitosan is directly purchased chitosan with a deacetylation degree of 75%, dsGRK and chitosan. The mass ratio of sugar is 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:5; dsGRK was synthesized in vitro in Example 2. dsRNA of the green stink bug GRK gene;

Proceed as follows:

(1) Prepare 100mmol/L sodium sulfate and 100mmol/L sodium acetate (pH 4.5) buffer at room temperature;

(2) Dissolve chitosan with a deacetylation degree of 75% in 100mmol/L sodium acetate buffer to make a 0.02% (w/v) working solution, and keep it at room temperature before use;

(3) Add 1μL 100mmol/L sodium sulfate buffer to 400ng dsGRK to prepare a solution containing 2μg dsGRK per 1μl 50mmol/L sodium sulfate;

(4) According to dsGRK: chitosan (CS) mass ratio is 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:5 The multiples are loaded separately. Take 0.4, 0.5, 0.67, 1, 2, 4, 6, 8, 10μL respectively Pour the chitosan solution into a clean ribozyme-free centrifuge tube, add 400ng of the dsGRK solution in step (3) into the centrifuge tube, and make up to 20 μL with ribozyme-free water;

(5) Heat in a water bath at 55°C for 1 min, and then rotate at high speed at room temperature, 12 000 rpm, for 1 min to promote the formation of CS-dsGRK nanoparticles;

(6) The complete loading of dsGRK was assessed by the nanosized chitosan/dsGRK complex retained in the spotted wells of 1% agarose gel.

Figure 2 shows the electrophoresis diagram of the optimal loading ratio of nanoscale chitosan/dsGRK complex. In the figure, M: maker; lane 1: naked dsGRK; lane 2: chitosan solution; lane 3: dsGRK-chitosan mass ratio is 5:1; lane 4: dsGRK-chitosan mass ratio is 4: 1; Lane 5: The mass ratio of dsGRK-chitosan is 3:1; Lane 6: The mass ratio of dsGRK-chitosan is 2:1; Lane 7: The mass ratio of dsGRK-chitosan is 1:1; Lane 8: The mass ratio of dsGRK-chitosan is 1:2; lane 9: the mass ratio of dsGRK-chitosan is 1:3; lane 10: the mass ratio of dsGRK-chitosan is 1:4; lane 11: dsGRK-chitosan The mass ratio is 1:5. It can be seen from the figure that when the mass ratio of dsGRK-chitosan is 1:2, the loading rate is optimal, reaching about 87.91%.

Example 4 Characterization and analysis of nanoscale chitosan/dsGRK2 complex particles of Green Lysogus

At room temperature, the surface charge (Zeta potential) of the nanoscale chitosan/dsGRK complex was measured using Photon Correlation Spectroscopy (PCS) of Zetasizer (Malvern Instruments, UK). As shown in Figure 3, the surface charge of the nanoscale chitosan/dsGRK complex with the best loading (dsGRK-chitosan mass ratio is 1:2) is 16.9±4.24mV.

In order to determine the morphology of the nanoparticles, the particles were observed under a transmission electron microscope (TEM). A drop of nanosized chitosan/dsGRK complex was fixed on a copper microgrid naturally stained with 2% phosphotungstic acid. The dyed nanoparticles were incubated at room temperature for 10 min. Then the nanoparticles were observed under a transmission electron microscope (HRTEM, JEOL2010F, Japan) and images were obtained, as shown in Figure 4. The particle size of the nanoscale chitosan/dsAlGRK2 complex was 69±12nm.

Example 5 Detection of Stability of Nanosized Chitosan/dsGRK2 Complex of Green Lygus

1. Stability of chitosan/dsAlGRK2 complex under different pH:

In order to determine the stability of chitosan/dsAlGRK2 complex and the release of dsAlGRK2 under different pH. According to Example 3, load dsAlGRK2 with a dsAlGRK2:chitosan (CS) mass ratio of 1:2, the total system is 20 μL, and the mass of dsAlGRK2 is 400 ng. After high-speed centrifugation, the supernatant is removed, and 10 μL of different pH solutions (pH=2, 3) are added. , 4, 5, 6, 7, 8, 9, 10, 11, 12), treat for 10 min, and detect the results by 1% agarose gel electrophoresis.

It can be seen from the electrophoresis figure 5(A) that the chitosan/dsAlGRK2 complex exists stably at pH 2 to 11. When the pH is 12, dsAlGRK2 is released from the complex. In the figure, pH 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12 were treated for 10 minutes, corresponding to lanes 1, 2, 3, 4, 5, 6, 7, 8, and 9 respectively. , 10, 11, M: maker.

2. Stability of chitosan/dsAlGRK2 complex at different temperatures:

In order to determine the stability of chitosan/dsAlGRK2 complex and the release of dsRNA at different temperatures. According to Example 3, dsAlGRK2 was loaded with a dsAlGRK2:chitosan (CS) mass ratio of 1:2, the total system was 20 μL, and the mass of dsAlGRK2 was 400 ng. Treat at different temperatures (5, 10, 15, 20, 25, 30, 35, 40 and 45°C) for 10 min, and detect the results by 1% agarose gel electrophoresis.

It can be seen from the electrophoresis figure 5(B) that dsAlGRK2 has not been degraded at different temperatures and can exist stably. In the figure, treatments were performed at 5, 10, 15, 20, 25, 30, 35, 40 and 45°C for 10 min, corresponding to lanes 1, 2, 3, 4, 5, 6, 7, 8 and 9 respectively, M: maker .

3. Stability of chitosan/dsAlGRK2 complex under RNase A treatment:

In order to determine the stability of the nanoscale chitosan/dsAlGRK2 complex, dsAlGRK2 was loaded according to Example 3 with a dsAlGRK2:chitosan (CS) mass ratio of 1:2, the total system was 20 μL, the mass of dsAlGRK2 was 400 ng, and 1 μL RNase A (0.1 μg/μL, 50mM NaCl), treat at 37°C for 5 minutes to obtain CS-dsAlGRK2 solution, centrifuge the CS-dsAlGRK2 solution at 1,2000rpm for 1min, remove the supernatant, add 20μL of NaOH solution with pH=12, treat for 30min, and pass 1% agarose gel electrophoresis detection results.

Using naked dsAlGRK2 as a control, observe the changes in the electrophoresis pattern and detect the stability of the nanochitosan/dsGRK complex.

It can be seen from the electrophoresis figure 5(C) that chitosan can effectively improve the stability of dsRNA and reduce degradation by nucleases. In the figure, M: maker; lane 1: dsAlGRK2 that has not been treated with RNase A; lane 2: CS-dsAlGRK2 that has not been treated with RNase A; lane 3: dsAlGRK2 that has been treated with RNase A; lane 4: CS that has been treated with RNase A -dsAlGRK2.

Example 6 Lethality experiment of dsAlGRK2 of the green stink bug GRK gene

1. Detection of silencing efficiency of GRK2 gene of Green Lysogus

Chitosan and dsRNA were mixed at a mass ratio of 2:1 to prepare nanoparticles for qRT-PCR and bioassay experiments. Green beans (1cm ³ ) were soaked (1h) in 0.02% (w/v) chitosan, 100ng/μL dsGFP, CS-dsGFP (dsGFP concentration is 100ng/μL), 100ng/μL dsAlGRK2, CS-dsAlGRK2 ( dsAlGRK2 concentration is 100ng/μL). After drying at room temperature for 3, 6, 12, 24, and 48 hours, 30 fourth-instar nymphs were Transfer to dried green beans. After 24 hours of feeding, RNA samples were extracted from five green stink bug nymphs for qRT-PCR experiments. The relative expression levels of the AlGRK2 gene and the internal reference gene β-actin were detected respectively. The 2- ^△△Ct method was used to calculate the silencing detection of the AlGRK2 gene. . Reaction system (20 μL): SYBR Green Master Mix (YEASEN, Shanghai) 10 μL, upstream and downstream primers (10 pmol/L; GRK2-F: TGAAGGGTGAGCAGTGCATA, GRK2-R: CCTGCTTTCTTGGCCATGTT) 0.4 μL each, 2 μL cDNA template, RNase-free H ₂ O 7.2μL. Reaction program: 95℃ for 5min; 95℃ for 10s, 60℃ for 40s, cycle 40 times; 95℃ for 15s, 60℃ for 60s, and 95℃ for 15s to form a dissolution curve. Each sample had 3 biological replicates and 3 technical replicates.

Figure 6 shows that compared with the control group (CS, dsGFP, CS-dsGFP) and (dsAlGRK2), the expression of the Green Lygus GRK2 gene in the treatment group (CS-dsAlGRK2) was significantly reduced. The results showed that CS-dsAlGRK2 significantly improved the silencing effect of dsRNA on this gene. * in the figure indicates significant difference; NS indicates no significant difference (pairwise comparison by t test, P<0.05).

2. Effects of feeding CS-dsAlGRK2 on the growth and development of green stink bug nymphs

The same feeding method was used in the bioassay experiment. Green beans (1cm ³ ) were soaked (1h) in 0.02% (w/v) chitosan, 100ng/μL dsGFP, and CS-dsGFP (dsGFP concentration was 100ng/μL). , 100ng/μL dsAlGRK2 and CS-dsAlGRK2 (dsAlGRK2 concentration is 100ng/μL). After drying on the surface at room temperature for 6, 12 and 24 hours respectively, the green bugs were fed. After 3 days, the survival rate of the test insects was counted, and 4 The development period of instar nymphs and the weight of 5th instar nymphs. Each group was treated with 30 nymphs, and 3 biological replicates were set.

Figure 7 shows that compared with the control group (CS, dsGFP, CS-dsGFP) and (dsAlGRK2), the mortality rate of the green stink bug in the treatment group (CS-dsAlGRK2) is significantly increased, and after CS-dsAlGRK2 treatment, the mortality rate reaches 50%, which is about 30% higher than that of bare dsAlGRK2; Figure 8 shows that after the green bug feeds on CS-dsAlGRK2, the development period of the 4th instar nymphs is significantly extended; Figure 9 shows that after the green bug feeds, After CS-dsAlGRK2, the body weight of 5th instar chlorophyll bug nymphs was significantly reduced. There are significant differences between different letters in the figure (lowercase letters indicate significant differences between treatment groups, capital letters indicate significant differences between drying times).

Claims (10)

1. A nanoscale chitosan/dsGRK complex, characterized in that the nanoscale chitosan/dsGRK complex includes dsGRK and chitosan, and the degree of deacetylation of the chitosan is 75 to 80%, The dsGRK is the dsRNA of the green stink bug G protein-coupled receptor kinase, and the nucleotide sequence of its dsRNA is shown in SEQ ID NO.1.
2. The nanoscale chitosan/dsGRK complex according to claim 1, wherein the mass ratio of the dsGRK and chitosan is 1:2-5.
3. The nanochitosan/dsGRK complex according to claim 1, wherein the nanochitosan/dsGRK complex has a size of 200-400 nm and a surface charge of 16.9±4.24mV.
4. The preparation method of nanoscale chitosan/dsGRK complex according to any one of claims 1 to 3, characterized in that it includes the following steps:

   1) Dissolve chitosan with a deacetylation degree of 75-80% in sodium acetate solution to prepare a chitosan solution;

   2) Add sodium sulfate solution to the dsGRK synthesized in vitro to prepare a dsGRK suspension;

   3) Mix chitosan solution and dsGRK suspension, let stand in a water bath and then centrifuge at high speed to obtain.
5. The method for preparing nanoscale chitosan/dsGRK complex according to claim 4, characterized in that in step 1), the chitosan concentration in the chitosan solution is 0.02 to 0.1 w/v%; In step 2), the concentration of the sodium sulfate solution is 50-100 mmol/L.
6. The method for preparing nanoscale chitosan/dsGRK complex according to claim 4, characterized in that in step 2), the mass ratio of dsGRK to sodium sulfate is 1:10-20.
7. The preparation method of nanoscale chitosan/dsGRK complex according to claim 3, characterized in that, in step 3), in the water bath standing step, the water bath temperature is 50-60°C, and the water bath is left standing for 1-2 minutes; step 3) In the high-speed centrifugation step, the centrifugation conditions are 12,000 to 15,000 rpm, 1 to 2 minutes.
8. Application of the nanoscale chitosan/dsGRK complex described in any one of claims 1 to 3 in the prevention and control of green stink bug.
9. The application according to claim 8, characterized in that the application is: spraying the nanoscale chitosan/dsGRK complex on the surface of the plant and feeding the green stink bug; or soaking the plant in the nanoscale chitosan/dsGRK complex. In the chitosan/dsGRK complex, after drying, the green stink bug was fed.
10. The application according to claim 9, characterized in that the plant is kidney beans.