CN115992131A - Nanocrystallized chitosan/dsGRK complex and preparation method and application thereof - Google Patents
Nanocrystallized chitosan/dsGRK complex and preparation method and application thereof Download PDFInfo
- Publication number
- CN115992131A CN115992131A CN202210870353.1A CN202210870353A CN115992131A CN 115992131 A CN115992131 A CN 115992131A CN 202210870353 A CN202210870353 A CN 202210870353A CN 115992131 A CN115992131 A CN 115992131A
- Authority
- CN
- China
- Prior art keywords
- dsgrk
- chitosan
- complex
- nanocrystallized
- nano
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 229920001661 Chitosan Polymers 0.000 title claims abstract description 109
- 238000002360 preparation method Methods 0.000 title abstract description 11
- 238000010668 complexation reaction Methods 0.000 title description 2
- 241001048568 Apolygus lucorum Species 0.000 claims abstract description 39
- 230000006196 deacetylation Effects 0.000 claims abstract description 7
- 238000003381 deacetylation reaction Methods 0.000 claims abstract description 7
- 108091032973 (ribonucleotides)n+m Proteins 0.000 claims description 32
- 102000040650 (ribonucleotides)n+m Human genes 0.000 claims description 28
- 238000000034 method Methods 0.000 claims description 14
- 238000000338 in vitro Methods 0.000 claims description 11
- PMZURENOXWZQFD-UHFFFAOYSA-L Sodium Sulfate Chemical compound [Na+].[Na+].[O-]S([O-])(=O)=O PMZURENOXWZQFD-UHFFFAOYSA-L 0.000 claims description 10
- 229910052938 sodium sulfate Inorganic materials 0.000 claims description 10
- 235000011152 sodium sulphate Nutrition 0.000 claims description 10
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 8
- 241000196324 Embryophyta Species 0.000 claims description 7
- 108010008959 G-Protein-Coupled Receptor Kinases Proteins 0.000 claims description 5
- 238000002156 mixing Methods 0.000 claims description 5
- 239000002105 nanoparticle Substances 0.000 claims description 5
- 239000002773 nucleotide Substances 0.000 claims description 5
- 125000003729 nucleotide group Chemical group 0.000 claims description 5
- 102000006575 G-Protein-Coupled Receptor Kinases Human genes 0.000 claims description 4
- VMHLLURERBWHNL-UHFFFAOYSA-M Sodium acetate Chemical compound [Na+].CC([O-])=O VMHLLURERBWHNL-UHFFFAOYSA-M 0.000 claims description 4
- 239000001632 sodium acetate Substances 0.000 claims description 4
- 235000017281 sodium acetate Nutrition 0.000 claims description 4
- 239000000725 suspension Substances 0.000 claims description 4
- 244000046052 Phaseolus vulgaris Species 0.000 claims description 3
- 238000005119 centrifugation Methods 0.000 claims description 3
- 235000021332 kidney beans Nutrition 0.000 claims description 3
- 238000000703 high-speed centrifugation Methods 0.000 claims description 2
- 238000005507 spraying Methods 0.000 claims description 2
- 230000000694 effects Effects 0.000 abstract description 7
- 239000000243 solution Substances 0.000 description 24
- 101150071923 grk gene Proteins 0.000 description 12
- 238000001179 sorption measurement Methods 0.000 description 12
- 238000012228 RNA interference-mediated gene silencing Methods 0.000 description 10
- 230000009368 gene silencing by RNA Effects 0.000 description 10
- 108020002230 Pancreatic Ribonuclease Proteins 0.000 description 9
- 102000005891 Pancreatic ribonuclease Human genes 0.000 description 9
- 238000006243 chemical reaction Methods 0.000 description 8
- 238000001962 electrophoresis Methods 0.000 description 7
- 239000007788 liquid Substances 0.000 description 7
- 239000002086 nanomaterial Substances 0.000 description 7
- 239000002245 particle Substances 0.000 description 6
- 239000000047 product Substances 0.000 description 6
- 238000000246 agarose gel electrophoresis Methods 0.000 description 5
- 239000011543 agarose gel Substances 0.000 description 4
- 230000015572 biosynthetic process Effects 0.000 description 4
- 239000002299 complementary DNA Substances 0.000 description 4
- 238000001514 detection method Methods 0.000 description 4
- 239000000499 gel Substances 0.000 description 4
- HEMHJVSKTPXQMS-UHFFFAOYSA-M Sodium hydroxide Chemical compound [OH-].[Na+] HEMHJVSKTPXQMS-UHFFFAOYSA-M 0.000 description 3
- 230000005540 biological transmission Effects 0.000 description 3
- 150000001875 compounds Chemical class 0.000 description 3
- 230000001351 cycling effect Effects 0.000 description 3
- 230000030279 gene silencing Effects 0.000 description 3
- 238000011068 loading method Methods 0.000 description 3
- 239000000203 mixture Substances 0.000 description 3
- 239000013612 plasmid Substances 0.000 description 3
- 108090000623 proteins and genes Proteins 0.000 description 3
- 238000011084 recovery Methods 0.000 description 3
- 238000010839 reverse transcription Methods 0.000 description 3
- 238000012163 sequencing technique Methods 0.000 description 3
- 238000003786 synthesis reaction Methods 0.000 description 3
- 239000002699 waste material Substances 0.000 description 3
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 2
- 229920002101 Chitin Polymers 0.000 description 2
- 102000004190 Enzymes Human genes 0.000 description 2
- 108090000790 Enzymes Proteins 0.000 description 2
- 241000258937 Hemiptera Species 0.000 description 2
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 2
- 238000011529 RT qPCR Methods 0.000 description 2
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 description 2
- 241000607479 Yersinia pestis Species 0.000 description 2
- 230000001580 bacterial effect Effects 0.000 description 2
- 239000000872 buffer Substances 0.000 description 2
- 230000015556 catabolic process Effects 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 238000010367 cloning Methods 0.000 description 2
- 238000006731 degradation reaction Methods 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 238000004090 dissolution Methods 0.000 description 2
- 238000002296 dynamic light scattering Methods 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 230000004927 fusion Effects 0.000 description 2
- 239000003292 glue Substances 0.000 description 2
- 238000002347 injection Methods 0.000 description 2
- 239000007924 injection Substances 0.000 description 2
- 230000001404 mediated effect Effects 0.000 description 2
- 102000039446 nucleic acids Human genes 0.000 description 2
- 108020004707 nucleic acids Proteins 0.000 description 2
- 150000007523 nucleic acids Chemical class 0.000 description 2
- 230000002265 prevention Effects 0.000 description 2
- 238000000746 purification Methods 0.000 description 2
- 238000004064 recycling Methods 0.000 description 2
- 230000002441 reversible effect Effects 0.000 description 2
- 239000006228 supernatant Substances 0.000 description 2
- 230000004083 survival effect Effects 0.000 description 2
- 238000013518 transcription Methods 0.000 description 2
- 230000035897 transcription Effects 0.000 description 2
- 238000004627 transmission electron microscopy Methods 0.000 description 2
- 108010085238 Actins Proteins 0.000 description 1
- 102000053642 Catalytic RNA Human genes 0.000 description 1
- 108090000994 Catalytic RNA Proteins 0.000 description 1
- RYGMFSIKBFXOCR-UHFFFAOYSA-N Copper Chemical compound [Cu] RYGMFSIKBFXOCR-UHFFFAOYSA-N 0.000 description 1
- 108020004414 DNA Proteins 0.000 description 1
- 102000016911 Deoxyribonucleases Human genes 0.000 description 1
- 108010053770 Deoxyribonucleases Proteins 0.000 description 1
- 241000588724 Escherichia coli Species 0.000 description 1
- 241000238631 Hexapoda Species 0.000 description 1
- 108700001097 Insect Genes Proteins 0.000 description 1
- 241001414825 Miridae Species 0.000 description 1
- 101710163270 Nuclease Proteins 0.000 description 1
- 241000819999 Nymphes Species 0.000 description 1
- 108091034117 Oligonucleotide Proteins 0.000 description 1
- 102000006382 Ribonucleases Human genes 0.000 description 1
- 108010083644 Ribonucleases Proteins 0.000 description 1
- 108020004459 Small interfering RNA Proteins 0.000 description 1
- 238000005411 Van der Waals force Methods 0.000 description 1
- JLCPHMBAVCMARE-UHFFFAOYSA-N [3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[5-(2-amino-6-oxo-1H-purin-9-yl)-3-[[3-[[3-[[3-[[3-[[3-[[5-(2-amino-6-oxo-1H-purin-9-yl)-3-[[5-(2-amino-6-oxo-1H-purin-9-yl)-3-hydroxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(6-aminopurin-9-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methyl [5-(6-aminopurin-9-yl)-2-(hydroxymethyl)oxolan-3-yl] hydrogen phosphate Polymers Cc1cn(C2CC(OP(O)(=O)OCC3OC(CC3OP(O)(=O)OCC3OC(CC3O)n3cnc4c3nc(N)[nH]c4=O)n3cnc4c3nc(N)[nH]c4=O)C(COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3COP(O)(=O)OC3CC(OC3CO)n3cnc4c(N)ncnc34)n3ccc(N)nc3=O)n3cnc4c(N)ncnc34)n3ccc(N)nc3=O)n3ccc(N)nc3=O)n3ccc(N)nc3=O)n3cnc4c(N)ncnc34)n3cnc4c(N)ncnc34)n3cc(C)c(=O)[nH]c3=O)n3cc(C)c(=O)[nH]c3=O)n3ccc(N)nc3=O)n3cc(C)c(=O)[nH]c3=O)n3cnc4c3nc(N)[nH]c4=O)n3cnc4c(N)ncnc34)n3cnc4c(N)ncnc34)n3cnc4c(N)ncnc34)n3cnc4c(N)ncnc34)O2)c(=O)[nH]c1=O JLCPHMBAVCMARE-UHFFFAOYSA-N 0.000 description 1
- 230000002378 acidificating effect Effects 0.000 description 1
- 125000003277 amino group Chemical group 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 239000013043 chemical agent Substances 0.000 description 1
- 239000011248 coating agent Substances 0.000 description 1
- 238000000576 coating method Methods 0.000 description 1
- 238000001816 cooling Methods 0.000 description 1
- 229910052802 copper Inorganic materials 0.000 description 1
- 239000010949 copper Substances 0.000 description 1
- 238000012258 culturing Methods 0.000 description 1
- 238000005520 cutting process Methods 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 230000029087 digestion Effects 0.000 description 1
- 239000003085 diluting agent Substances 0.000 description 1
- 235000013399 edible fruits Nutrition 0.000 description 1
- 230000005611 electricity Effects 0.000 description 1
- 230000009881 electrostatic interaction Effects 0.000 description 1
- 239000012149 elution buffer Substances 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- 238000007710 freezing Methods 0.000 description 1
- 238000010353 genetic engineering Methods 0.000 description 1
- 238000000227 grinding Methods 0.000 description 1
- 238000002173 high-resolution transmission electron microscopy Methods 0.000 description 1
- 229910052739 hydrogen Inorganic materials 0.000 description 1
- 239000001257 hydrogen Substances 0.000 description 1
- 125000002887 hydroxy group Chemical group [H]O* 0.000 description 1
- 238000003384 imaging method Methods 0.000 description 1
- 238000001802 infusion Methods 0.000 description 1
- 230000003993 interaction Effects 0.000 description 1
- 231100000518 lethal Toxicity 0.000 description 1
- 230000001665 lethal effect Effects 0.000 description 1
- 230000000670 limiting effect Effects 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 239000006166 lysate Substances 0.000 description 1
- 238000005259 measurement Methods 0.000 description 1
- 239000002114 nanocomposite Substances 0.000 description 1
- 229910052757 nitrogen Inorganic materials 0.000 description 1
- 239000000575 pesticide Substances 0.000 description 1
- 125000002467 phosphate group Chemical group [H]OP(=O)(O[H])O[*] 0.000 description 1
- IYDGMDWEHDFVQI-UHFFFAOYSA-N phosphoric acid;trioxotungsten Chemical compound O=[W](=O)=O.O=[W](=O)=O.O=[W](=O)=O.O=[W](=O)=O.O=[W](=O)=O.O=[W](=O)=O.O=[W](=O)=O.O=[W](=O)=O.O=[W](=O)=O.O=[W](=O)=O.O=[W](=O)=O.O=[W](=O)=O.OP(O)(O)=O IYDGMDWEHDFVQI-UHFFFAOYSA-N 0.000 description 1
- 229920000642 polymer Polymers 0.000 description 1
- 239000002244 precipitate Substances 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 102000004196 processed proteins & peptides Human genes 0.000 description 1
- 108090000765 processed proteins & peptides Proteins 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 230000002829 reductive effect Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 230000000717 retained effect Effects 0.000 description 1
- 108091092562 ribozyme Proteins 0.000 description 1
- 230000001743 silencing effect Effects 0.000 description 1
- 238000002791 soaking Methods 0.000 description 1
- 239000007974 sodium acetate buffer Substances 0.000 description 1
- 239000011780 sodium chloride Substances 0.000 description 1
- 239000007787 solid Substances 0.000 description 1
- 230000003068 static effect Effects 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 230000001502 supplementing effect Effects 0.000 description 1
- 230000002194 synthesizing effect Effects 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
- 235000013311 vegetables Nutrition 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
- 238000005406 washing Methods 0.000 description 1
- 239000012224 working solution Substances 0.000 description 1
Images
Classifications
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B82—NANOTECHNOLOGY
- B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
- B82Y30/00—Nanotechnology for materials or surface science, e.g. nanocomposites
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B82—NANOTECHNOLOGY
- B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
- B82Y5/00—Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Nanotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Crystallography & Structural Chemistry (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Condensed Matter Physics & Semiconductors (AREA)
- Materials Engineering (AREA)
- General Physics & Mathematics (AREA)
- Composite Materials (AREA)
- Medical Informatics (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention discloses a nano chitosan/dsGRK complex, a preparation method and application thereof, wherein the nano chitosan/dsGRK complex comprises dsGRK and chitosan, and the deacetylation degree of the chitosan is 75%. The lygus lucorum nano chitosan/dsGRK complex provided by the invention can effectively improve the stability of dsGRK, and has the advantages of simple preparation process and no pollution to the environment. The mortality of lygus lucorum in the nanocrystallized chitosan/dsGRK complex treatment group is obviously improved, and the effect is good.
Description
Technical Field
The invention belongs to the technical field of agricultural genetic engineering, and particularly relates to a nano chitosan/dsGRK complex, a preparation method thereof and application thereof in lygus lucorum prevention and treatment.
Background
Apolygus lucorum (Hemiptera: miridae) belongs to the family of Hemiptera, and is an important pest on various commercial crops such as fruit trees, vegetables and the like. The control of lygus lucorum mainly depends on chemical pesticide control, but the long-term use of chemical agents can bring about 3R effect. In recent years, double-stranded RNA (dsRNA) -mediated RNA interference (RNAi) technology has been widely used in functional studies of insect genes and has shown great potential for pest control. Common RNAi methods include injection, infusion, feeding, and the like. The injection method is only suitable for laboratory researches and cannot be popularized and applied in fields due to high cost and high operation technical requirements. In addition, dsRNA is unstable in the external environment, so that RNAi effect is low by adopting a soaking or feeding method.
In recent years, dsRNA delivery systems mediated by nanomaterials have shown great advantages in terms of improving RNAi efficiency compared to traditional dsRNA delivery systems. The nano material is combined with the phosphate group of the nucleic acid mainly through interactions of static electricity, van der Waals force, hydrogen bond and the like to form a dsRNA/nano material compound, so that the stability of the dsRNA/nano material compound can be improved. Chitosan (CS), also known as deacetylated chitin, is obtained by chemically treating chitin (Chitosan), which is widely present in nature. Chitosan contains hydroxyl and amino groups and is one of the most commonly used polymers. Because of the advantages of low cost, easy degradation, good biocompatibility and the like, the compound can be used as a promising delivery system of dsRNA, siRNA, plasmid DNA, oligonucleotides, peptides and even proteins. Chitosan is positively charged under slightly acidic conditions, helping to form dsRNA/nanocomposite with negatively charged nucleic acids by electrostatic interactions.
Currently, studies have shown that nanocomplexes formed by chitosan and dsRNA can be stably and effectively delivered into plants or insects, but the study of RNAi nanomaterials in lygus lucorum control remains blank.
Disclosure of Invention
The invention aims to: the invention aims to solve the technical problems that the stability of dsRNA is improved, the RNA interference efficiency is effectively enhanced, and the effect of controlling lygus lucorum is further improved by synthesizing lygus lucorum GRK gene dsRNA in vitro and forming a nano preparation, namely a nano chitosan/dsGRK complex with chitosan.
The invention also solves the technical problem of providing a preparation method of the nano chitosan/dsGRK complex.
The invention finally solves the technical problem of providing the application of the nano chitosan/dsGRK complex in the prevention and treatment of lygus lucorum.
The technical scheme is as follows: in order to solve the technical problems, the invention provides a nano chitosan/dsGRK complex, wherein the nano chitosan/dsGRK complex comprises dsGRK and chitosan, and the deacetylation degree of the chitosan is 75-80%. Wherein, dsGRK is dsRNA of lygus lucorum G protein coupled receptor kinase (GRK), and the nucleotide sequence of the dsRNA is shown in SEQ ID NO. 1.
Wherein, the mass ratio of dsGRK to chitosan is 1:2 to 5.
Wherein the size of the nano chitosan/dsGRK complex is 200-400 nm, and the surface charge is 16.9+/-4.24 mV.
The invention also discloses a preparation method of the nano chitosan/dsGRK complex, which comprises the following steps: 1) Chitosan with the deacetylation degree of 75-80% is dissolved in sodium acetate solution to prepare chitosan solution;
2) Adding sodium sulfate solution to the dsGRK synthesized in vitro to prepare dsGRK suspension;
3) Mixing chitosan solution and dsGRK suspension, standing in water bath, and centrifuging at high speed.
Wherein, in the step 1), the chitosan concentration in the chitosan solution is 0.02-0.1 w/v%; in the step 2), the concentration of the sodium sulfate solution is 50-100 mmol/L.
In the step 2), the mass ratio of the dsGRK to the sodium sulfate is 1:10-20.
Wherein, in the step 2), the concentration of the sodium sulfate solution is 50-100 mmol/L; the preferred concentration is 100mmol/L.
Wherein, in the step 3) of water bath standing, the water bath temperature is 50-60 ℃, and standing is carried out for 1-2 min; in the step 3) of high-speed centrifugation, the centrifugation conditions are 12000-15000 rpm, and 1-2 min.
The invention also discloses application of the nano chitosan/dsGRK complex in controlling lygus lucorum.
Wherein the application is: spraying the nano chitosan/dsGRK complex on the surface of plants, and feeding the plant bug.
Wherein the plant includes, but is not limited to, kidney beans.
The beneficial effects are that: compared with the prior art, the invention has the following advantages:
(1) The invention provides a lygus lucorum nano chitosan/dsGRK complex, wherein the nano material is 75% deacetylated chitosan; the target gene of dsGRK is lygus lucorum G protein coupled receptor kinase gene; the dsGRK is synthesized in vitro, and the stability of the dsGRK can be effectively improved by utilizing the nano material chitosan.
(2) The invention provides a preparation method of a lygus lucorum nano chitosan/dsGRK complex, which has simple process and no pollution to the environment.
(3) The invention provides application of a nanocrystallized chitosan/dsGRK complex in controlling lygus lucorum, the mortality of lygus lucorum in a nanocrystallized chitosan/dsGRK complex treatment group is obviously improved, and the effect is good.
Drawings
FIG. 1 is an electrophoretogram of in vitro synthesis of dsGRK.
FIG. 2 is an electrophoresis chart of optimal loading ratios of the nanochain chitosan/dsGRK complex. In the figure, M: a maker; lane 1: naked dsGRK; lane 2: a chitosan solution; lane 3: the mass ratio of dsGRK-chitosan is 5:1, a step of; lane 4: the mass ratio of dsGRK-chitosan is 4:1, a step of; lane 5: the mass ratio of dsGRK-chitosan is 3:1, a step of; lane 6: the mass ratio of dsGRK-chitosan is 2:1, a step of; lane 7: the mass ratio of dsGRK-chitosan is 1:1, a step of; lane 8: the mass ratio of dsGRK-chitosan is 1:2; lane 9: the mass ratio of dsGRK-chitosan is 1:3, a step of; lane 10: the mass ratio of dsGRK-chitosan is 1:4, a step of; lane 11: the mass ratio of dsGRK-chitosan is 1:5.
FIG. 3 shows the average particle size (Z-average) and surface charge (Zeta potential) of the nanochain chitosan/dsGRK complex.
FIG. 4 is a transmission electron microscopy image of a nanocrystallized chitosan/dsGRK complex.
FIG. 5 is an electrophoretogram of detecting the stability of the nanochain chitosan/dsGRK complex. In the figure, M: a maker; lane 1: dsGRK without RNase A treatment; lane 2: CS-dsGRK not treated with RNase A; lane 3: RNase A treated dsGRK; lane 4: RNase A treated CS-dsGRK.
FIG. 6 shows the relative expression level of GRK, i.e., RNAi silencing efficiency, detected by qPCR.
Figure 7 shows survival of lygus lucorum in different treatment groups.
Detailed Description
Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only for illustrating the present invention and should not be construed as limiting the scope of the present invention. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.
EXAMPLE 1 acquisition of dsRNA nucleotide sequence of lygus lucorum GRK Gene
1. The Primer Premier 5.0 software was used to design a cloning Primer pair for the lygus lucorum GRK gene (GenBank accession number: MN 514868), the Primer pair sequences were as follows:
GRK-F，SEQ ID NO.2：GGTTTGGAGAAGTTTACGGC
GRK-R，SEQ ID NO.3：ATGAGAAGGAG TCGGGAAGC
primer pairs were all synthesized by Shanghai Biotechnology Co.
2. Extracting total RNA of lygus lucorum by using Trizol method and obtaining cDNA template by reverse transcription:
the method comprises the steps of taking a nymph of the initially hatched 3-year-old lygus lucorum as a sample, taking 10 biological repeats, and quick-freezing in liquid nitrogen. Grinding with an electric grinder, and extracting total RNA according to TRIzol Reagent (TIANGEN, beijing); first strand cDNA was synthesized according to reverse transcription kit HiScript III RT SuperMix (Vazyme, nanjing) as a template for PCR reactions.
3. PCR reaction to obtain lygus lucorum GRK gene dsGRK nucleotide sequence:
and (3) obtaining the lygus lucorum GRK gene sequence by PCR reaction by using the primer synthesized in the step (1) and the cDNA template obtained in the step (2), wherein the reaction system is as follows:
the PCR reaction conditions were: 94 ℃ for 30s; cycling for 35 times at 98 ℃ for 10s,65 ℃ for 30s and 72 ℃ for 1 min; 72 ℃ for 2min.
Analyzing the PCR product by using 1.2% agarose gel electrophoresis, cutting and recycling, and purifying by using a DNA gel recycling kit to obtain a purified PCR product; connecting to a T/A blast vector carrier (Vazyme, nanjing), transferring into competent cells E.coli DH5 alpha, coating on an LB solid plate, and culturing for 12-14 h in an incubator at 37 ℃ after standing for 10 min; selecting positive single colony for bacterial liquid PCR detection and agarose gel electrophoresis analysis; the bacterial liquid with correct verification is sent to jerry (Shanghai) biotechnology company for sequencing, and plasmid DNA is returned after the sequencing result is correct.
The nucleotide sequence of the lygus lucorum GRK gene dsRNA obtained by sequencing is shown as SEQ ID NO. 1.
Example 2 in vitro Synthesis of dsGRK
1. The Primer Premier 5.0 software was used to design a specific Primer pair containing the T7 promoter, the sequence of the specific Primer pair was as follows:
GRK-T7-F，SEQ ID NO.4：TAATACGACTCACTATAGGGGGTTTGGAGAAGTTTACGGC
GRK-T7-R，SEQ ID NO.5：TAATACGACTCACTATAGGGATGAGAAGGAGTCGGGAAGC
the underlined part is the T7 promoter sequence.
2. Preparation of DNA templates
Using the cloning primer pair (SEQ ID NO.2, SEQ ID NO. 3) and the specific primer pair (SEQ ID NO.4, SEQ ID NO. 5) containing the T7 promoter, a synthetic DNA template of dsRNA was prepared using the plasmid DNA of example 1 as a PCR template as follows:
(1) The reaction system is as follows:
(2) The PCR conditions were as follows:
94 ℃ for 30s; cycling for 35 times at 98 ℃ for 10s,65 ℃ for 30s and 72 ℃ for 1 min; 72 ℃ for 2min.
3. Recovery and purification of the product
The PCR amplified product was detected by 1.2% agarose gel electrophoresis, and the target fragment was recovered by reference to agarose gel DNA recovery kit (TIANGEN, beijing).
The recovery operation steps are as follows:
(1) Column balancing: 500. Mu.l of the balance liquid BL was added to the adsorption column CA2 (the adsorption column was placed in the collection tube), and the mixture was centrifuged at 12 rpm for 1min, and the waste liquid in the collection tube was discarded, and the adsorption column was replaced in the collection tube.
(2) Under UV light, single DNA strips of interest were excised from agarose gel (excess excised as much as possible) and weighed into a clean centrifuge tube.
(3) To the gel block was added an equal volume of lysate PN (100. Mu.L PN solution if the gel weight was 0.1g, which could be considered to be 100. Mu.L) and placed in a 50℃water bath with gentle tumbling of the centrifuge tube up and down to ensure adequate dissolution of the gel block. If there are undissolved glue pieces, the placement can be continued for several minutes or some more sol solution can be added until the glue pieces are completely dissolved.
(4) The solution obtained in the previous step was added to an adsorption column CA2 (the adsorption column was placed in a collection tube, placed at room temperature for 2min, and centrifuged at 12,000 rpm for 30-60 s, the waste liquid in the collection tube was poured out, and the adsorption column CA2 was placed in the collection tube.
(5) 600. Mu.L of the rinse solution PW was added to the adsorption column CA2, centrifuged at 12,000 rpm for 30 to 60 seconds, the waste liquid in the collection tube was discarded, and the adsorption column CA2 was placed in the collection tube.
(6) Repeating the operation step (5).
(7) The adsorption column CA2 was put back into the collection tube, and centrifuged at 12 rpm for 2min to remove the rinse solution as much as possible. The adsorption column CA2 was left at room temperature for several minutes and dried thoroughly to prevent the residual rinse from affecting the next experiment.
(8) Placing the adsorption column CA2 into a clean centrifuge tube, suspending and dripping a proper amount of elution buffer EB into the middle position of the adsorption film, and standing at room temperature for 2min.12 The DNA solution was collected by centrifugation at 000rpm for 2min.
(9) The concentration and the band were checked by 1% agarose gel for singleness.
4. In vitro transcription synthesis of dsGRK
After DNA templates were obtained, dsGRK was synthesized according to the T7 RNA interference kit, as follows:
(1) In vitro transcription systems of forward T7-containing and reverse T7-containing DNA were placed in 200. Mu.L of a ribozyme-free centrifuge tube, respectively, at room temperature:
after gentle mixing, the mixture was subjected to PCR at 37℃for 2h.
(2) Transferring the forward and reverse transcription products into the same non-ribozyme centrifuge tube, gently mixing, performing forward and reverse strand RNA fusion at 70 ℃ for 10min by a PCR instrument, and standing at room temperature for about 20min and slowly cooling.
(3) After fusion, 2. Mu.L of RNase diluent (1:200) and 2. Mu.L of DNase solution were added to the double-stranded RNA, and after mixing, digestion of the DNA template and single-stranded RNA was performed at 37℃for 30min in a PCR apparatus.
5. Purification of dsRNA to the digested dsRNA solution, 4.4. Mu.L of sodium acetate (3 mol/L) and 44. Mu.L of isopropanol were added, mixed well, placed on ice for 5min, centrifuged at 15,000 rpm at 4℃for 10min, and the supernatant was discarded. Washing twice with 500. Mu.L 70% glacial ethanolAfter the precipitate was dried at room temperature for 5min, 50. Mu.L of RNase-Free Water was added for resuspension to obtain purified double-stranded RNA. The concentration and purity of dsRNA are detected by an ultraviolet spectrophotometer and 1% agarose gel electrophoresis, the concentration is 6.686-7.384 mug/mu L, A 260 /A 280 Is 2.05 to 2.06, A 260 /A 230 The purity is 2.36-2.45, and the purity is shown in figure 1. FIG. 1 is an electrophoretogram of in vitro synthesized dsGRK, M is maker, lanes 1 and 2 are in vitro synthesized dsGRK.
EXAMPLE 3 preparation of lygus lucorum nanocrystallized Chitosan/dsGRK Complex
The nanocrystallized chitosan/dsGRK complex for lygus lucorum of the embodiment comprises chitosan and dsGRK; the chitosan is directly purchased chitosan with the deacetylation degree of 75%, and the mass ratio of dsGRK to chitosan is 5: 1. 4: 1. 3: 1. 2: 1. 1: 1. 1: 2. 1: 3. 1: 4. 1:5, a step of; dsGRK dsRNA of lygus lucorum GRK gene synthesized in vitro in example 2 was selected.
The method comprises the following steps:
(1) At room temperature, 100mmol/L sodium sulfate and 100mmol/L sodium acetate (pH 4.5) buffer were prepared.
(2) Chitosan with a degree of deacetylation of 75% was dissolved in 100mmol/L sodium acetate buffer to prepare a working solution of 0.02% (w/v), which was kept at room temperature until use.
(3) mu.L of 100mmol/L sodium sulfate buffer was added to 400ng of dsGRK to prepare a solution containing 2. Mu.g of dsGRK per 1. Mu.L of 50mmol/L sodium sulfate.
(4) According to dsGRK: the mass ratio of Chitosan (CS) is 5: 1. 4: 1. 3: 1. 2: 1. 1: 1. 1: 2. 1: 3. 1: 4. 1: the loads were performed at multiples of 5. Taking 0.4, 0.5, 0.67, 1, 2, 4, 6, 8 and 10 mu L of chitosan solution into a clean coreless enzyme centrifuge tube, adding 400ngdsGRK solution in the step (3) into the centrifuge tube, and supplementing 20 mu L with coreless enzyme water.
(5) Heated in a 55℃water bath for 1 minute and then spun at high speed at room temperature, 12,000 rpm,1min to promote CS-dsGRK nanoparticle formation.
(6) The intact loading of dsGRK was assessed by the nanochain chitosan/dsGRK complex retained in the 1% agarose gel spotted wells.
FIG. 2 is an electrophoresis chart of optimal loading ratios of the nanochain chitosan/dsGRK complex. In the figure, M: a maker; lane 1: naked dsGRK; lane 2: a chitosan solution; lane 3: the mass ratio of dsGRK-chitosan is 5:1, a step of; lane 4: the mass ratio of dsGRK-chitosan is 4:1, a step of; lane 5: the mass ratio of dsGRK-chitosan is 3:1, a step of; lane 6: the mass ratio of dsGRK-chitosan is 2:1, a step of; lane 7: the mass ratio of dsGRK-chitosan is 1:1, a step of; lane 8: the mass ratio of dsGRK-chitosan is 1:2; lane 9: the mass ratio of dsGRK-chitosan is 1:3, a step of; lane 10: the mass ratio of dsGRK-chitosan is 1:4, a step of; lane 11: the mass ratio of dsGRK-chitosan is 1:5. as can be seen from the figure, the mass ratio of dsGRK-chitosan is 1:2, the load factor is optimal, reaching about 87.91%.
Example 4 measurement of particle size of lygus lucorum nanocrystallized chitosan/dsGRK Complex particles and Transmission Electron microscopy imaging
The average particle size (Z-average) and surface charge (Zeta potential) of the nanochain chitosan/dsGRK complex were measured at room temperature using photon correlation spectroscopy (Photon Correlation Spectroscopy, PCS) of Zetasizer (Malvern Instruments, uk). As shown in FIG. 3, the particle size of the loaded optimal (dsGRK-chitosan mass ratio of 1:2) nanocrystallized chitosan/dsGRK complex is 200-400 nm, and the surface charge is 16.9+ -4.24 mV.
To determine the morphology of the nanoparticles, the particles were observed under a transmission electron microscope (Transmission Electron Microscope, TEM). A drop of the nanocrystallized chitosan/dsGRK complex was immobilized on a 2% phosphotungstic acid naturally stained copper micro-grid. The stained nanoparticles were incubated for 10min at room temperature. The nanoparticles were then observed under a transmission electron microscope (HRTEM, JEOL2010F, japan) and an image was obtained, see fig. 4.
Example 5 detection of stability of lygus lucorum nanochain Chitosan/dsGRK Complex
The steps for detecting the stability of the lygus lucorum nano chitosan/dsGRK complex are as follows:
(1) To determine the stability of the nanochain chitosan/dsGRK complex, dsGRK was used as in example 3: the mass ratio of Chitosan (CS) to dsGRK was 1:2, the total mass was 20. Mu.L, dsGRK was 400ng, 1. Mu.L RNase A (0.1. Mu.g/. Mu.L, 50mM NaCl) was added, and after 5min treatment at 37℃a CS-dsGRK solution was obtained, the CS-dsGRK solution was centrifuged at 12000 rpm for 1min, the supernatant was removed, 20. Mu.L of NaOH solution having pH=12 was added, and the treatment was carried out for 30min, and the result was detected by 1% agarose gel electrophoresis.
(2) The change of the electrophoresis pattern is observed by taking naked dsGRK as a control, and the stability of the nano chitosan/dsGRK complex is detected.
From the electrophoresis chart 5, chitosan can effectively improve the stability of dsRNA and reduce the degradation of the dsRNA by nuclease. In the figure, M: a maker; lane 1: dsGRK without RNase A treatment; lane 2: CS-dsGRK not treated with RNase A; lane 3: RNase A treated dsGRK; lane 4: RNase A treated CS-dsGRK.
EXAMPLE 5 lethal assay of dsGRK of lygus lucorum GRK Gene
1. Feeding experiments with CS-dsGRK
Respectively set ddH 2 O, 0.02% (w/v) chitosan, 100 ng/. Mu.LdsGFP, 100 ng/. Mu.LdsGRK, CS-dsGRK (dsGRK concentration 100 ng/. Mu.L) 5 treatment groups, the solutions were uniformly smeared on kidney beans of the same size and volume, and were fed with healthy, age-identical 4-year-old lygus lucorum nymphs, survival rates after 6d were recorded, 30 nymphs were treated per group, and 3 biological replicates were set.
2. Silencing detection of lygus lucorum GRK gene
The relative expression levels of GRK gene and reference gene beta-actin are detected by qPCR technology, and the method adopts
And (3) calculating the silencing detection of the lygus lucorum GRK gene by a method. Reaction system (20 μl): SYBR Green Master Mix (YEASEN, shanghai) 10. Mu.L, each of the upstream and downstream primers (10 pmol/L) 0.4. Mu.L, cDNA template 2. Mu.L, RNase-free H 2 O7.2. Mu.L. The reaction procedure: 95 ℃ for 5min; cycling for 40 times at 95 ℃ for 10s and 60 ℃ for 40 s; a dissolution profile was formed at 95℃for 15s,60℃for 60s, and 95℃for 15 s. Each sample was set up with 3 biological replicates and 3 technical replicates.
FIG. 6 shows that the treated group (CS-dsGRK) and the control group(ddH 2 O, CS, dsGFP) and (dsGRK), the expression level of lygus lucorum GRK gene was significantly reduced. The result shows that CS-dsGRK significantly improves the silencing effect of dsRNA on the gene. In the figure, the letters represent the significance of the difference, and b represents the significance of the difference compared to the control group (P<0.05 A represents that the difference is not significant compared with the control group (P>0.05)。
3. Effect of feeding CS-dsGRK on growth and development of lygus lucorum nymphs
FIG. 7 shows that the treated group (CS-dsGRK, dsGRK) and the control group (ddH) 2 O, CS, dsGFP) the mortality rate of lygus lucorum is significantly increased, and the mortality rate after CS-dsGRK treatment reaches 70% and is improved by about 20% compared with that of naked dsGRK. The results show that the chitosan improves the stability of dsGRK and enhances the RNAi effect.
Claims (10)
1. The nano chitosan/dsGRK complex is characterized by comprising dsGRK and chitosan, wherein the deacetylation degree of the chitosan is 75-80%, the dsGRK is dsRNA of lygus lucorum G protein-coupled receptor kinase, and the nucleotide sequence of the dsRNA is shown as SEQ ID NO. 1.
2. The nanochain chitosan/dsGRK complex of claim 1, wherein the mass ratio of dsGRK to chitosan is 1:2 to 5.
3. The nanocrystallized chitosan/dsGRK complex of claim 1, wherein the nanocrystallized chitosan/dsGRK complex has a size of 200-400 nm and a surface charge of 16.9±4.24mV.
4. A method for preparing the nanocrystallized chitosan/dsGRK complex according to any one of claims 1 to 3, characterized by comprising the following steps:
1) Chitosan with the deacetylation degree of 75-80% is dissolved in sodium acetate solution to prepare chitosan solution;
2) Adding sodium sulfate solution to the dsGRK synthesized in vitro to prepare dsGRK suspension;
3) Mixing chitosan solution and dsGRK suspension, standing in water bath, and centrifuging at high speed.
5. The method for preparing a nano-sized chitosan/dsGRK complex according to claim 4, wherein in step 1), the chitosan concentration in the chitosan solution is 0.02-0.1 w/v%; in the step 2), the concentration of the sodium sulfate solution is 50-100 mmol/L.
6. The method of claim 4, wherein in step 2), the mass ratio of dsGRK to sodium sulfate is 1:10-20.
7. The method for preparing a nano chitosan/dsGRK complex according to claim 3, wherein in the step 3) of standing in a water bath, the temperature of the water bath is 50-60 ℃ and the standing is carried out for 1-2 min; in the step 3) of high-speed centrifugation, the centrifugation conditions are 12000-15000 rpm, and 1-2 min.
8. Use of the nanocrystallized chitosan/dsGRK complex of any one of claims 1-3 in the control of lygus lucorum.
9. The use according to claim 8, characterized in that the use is: spraying the nano chitosan/dsGRK complex on the surface of plants, and feeding the plant bug.
10. The use according to claim 9, wherein the plant is kidney beans.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210870353.1A CN115992131A (en) | 2022-07-22 | 2022-07-22 | Nanocrystallized chitosan/dsGRK complex and preparation method and application thereof |
| PCT/CN2023/095169 WO2024016820A1 (en) | 2022-07-22 | 2023-05-19 | Nano chitosan/dsgrk complex, preparation method therefor, and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210870353.1A CN115992131A (en) | 2022-07-22 | 2022-07-22 | Nanocrystallized chitosan/dsGRK complex and preparation method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115992131A true CN115992131A (en) | 2023-04-21 |
Family
ID=85993074
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210870353.1A Pending CN115992131A (en) | 2022-07-22 | 2022-07-22 | Nanocrystallized chitosan/dsGRK complex and preparation method and application thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN115992131A (en) |
| WO (1) | WO2024016820A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024016820A1 (en) * | 2022-07-22 | 2024-01-25 | 江苏省农业科学院 | Nano chitosan/dsgrk complex, preparation method therefor, and application thereof |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070003501A1 (en) * | 2005-05-19 | 2007-01-04 | L'oreal | Vectorization of dsRNA by cationic particles and use of same on a skin model |
| WO2008003329A2 (en) * | 2006-07-07 | 2008-01-10 | Aarhus Universitet | Nanoparticles for nucleic acid delivery |
| CN106399483A (en) * | 2016-08-31 | 2017-02-15 | 中国农业科学院植物保护研究所 | RNA interference feeding method for apolygus lucorum and application of feeding method in gene screening |
| CN106399331A (en) * | 2016-08-31 | 2017-02-15 | 中国农业科学院植物保护研究所 | Lygus lucorum ApEps15 gene and applications thereof in preventing and treating RNAi-mediated pests |
| CN109169702A (en) * | 2018-08-28 | 2019-01-11 | 湖南省植物保护研究所 | Nanosizing RNAi preparation and its preparation method and application |
| CN110396524A (en) * | 2019-05-31 | 2019-11-01 | 海南大学 | A kind of RNAi nano particle and Preparation method and use for mosquito |
| CN111513077A (en) * | 2020-05-25 | 2020-08-11 | 中国农业科学院烟草研究所 | RNAi nano preparation, preparation method thereof and application thereof in TMV prevention and treatment |
| CN113943720A (en) * | 2021-11-03 | 2022-01-18 | 江苏省农业科学院 | Apolygus lucorum GRK gene, dsRNA thereof, synthetic method and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115992131A (en) * | 2022-07-22 | 2023-04-21 | 江苏省农业科学院 | Nanocrystallized chitosan/dsGRK complex and preparation method and application thereof |
-
2022
- 2022-07-22 CN CN202210870353.1A patent/CN115992131A/en active Pending
-
2023
- 2023-05-19 WO PCT/CN2023/095169 patent/WO2024016820A1/en unknown
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070003501A1 (en) * | 2005-05-19 | 2007-01-04 | L'oreal | Vectorization of dsRNA by cationic particles and use of same on a skin model |
| WO2008003329A2 (en) * | 2006-07-07 | 2008-01-10 | Aarhus Universitet | Nanoparticles for nucleic acid delivery |
| US20100015232A1 (en) * | 2006-07-07 | 2010-01-21 | Aarhus Universitet | Nanoparticles for nucleic acid delivery |
| CN106399483A (en) * | 2016-08-31 | 2017-02-15 | 中国农业科学院植物保护研究所 | RNA interference feeding method for apolygus lucorum and application of feeding method in gene screening |
| CN106399331A (en) * | 2016-08-31 | 2017-02-15 | 中国农业科学院植物保护研究所 | Lygus lucorum ApEps15 gene and applications thereof in preventing and treating RNAi-mediated pests |
| CN109169702A (en) * | 2018-08-28 | 2019-01-11 | 湖南省植物保护研究所 | Nanosizing RNAi preparation and its preparation method and application |
| CN110396524A (en) * | 2019-05-31 | 2019-11-01 | 海南大学 | A kind of RNAi nano particle and Preparation method and use for mosquito |
| CN111513077A (en) * | 2020-05-25 | 2020-08-11 | 中国农业科学院烟草研究所 | RNAi nano preparation, preparation method thereof and application thereof in TMV prevention and treatment |
| CN113943720A (en) * | 2021-11-03 | 2022-01-18 | 江苏省农业科学院 | Apolygus lucorum GRK gene, dsRNA thereof, synthetic method and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| D RAMESH KUMAR等: "Delivery of chitosan/dsRNA nanoparticles for silencing of wing development vestigial (vg) gene in Aedes aegypti mosquitoes", 《INT J BIOL MACROMOL》, pages 89 - 95 * |
| HENG QIAO等: "An oral dsRNA delivery system based on chitosan induces G protein-coupled receptor kinase 2 gene silencing for Apolygus lucorum control", 《PESTICIDE BIOCHEMISTRY AND PHYSIOLOGY》, vol. 194, pages 1 - 2 * |
| MAOZHI REN等: "Fighting against fall armyworm by using multiple genes pyramiding and silencing (MGPS) technology", 《SCI CHINA LIFE SCI 》, vol. 62, no. 12, pages 1703 - 1706 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024016820A1 (en) * | 2022-07-22 | 2024-01-25 | 江苏省农业科学院 | Nano chitosan/dsgrk complex, preparation method therefor, and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2024016820A1 (en) | 2024-01-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3461894B1 (en) | Engineered crispr-cas9 compositions and methods of use | |
| Tiedge et al. | Primary structure, neural-specific expression, and dendritic location of human BC200 RNA | |
| EP4163374A1 (en) | Tracking and manipulating cellular rna via nuclear delivery of crispr/cas9 | |
| EP2744905B1 (en) | Methods and compositions for introduction of exogenous dsrna into plant cells | |
| EP3516055B1 (en) | Scalable biotechnological production of dna single strand molecules of defined sequence and length | |
| CN110404081B (en) | DNA tetrahedron and microRNA nano-composite | |
| Sone et al. | A novel gene delivery system in plants with calcium alginate micro-beads | |
| CN105481955B (en) | Fast-growing water plant nitrate transport protein GeNRT2.1 and its encoding gene and application | |
| US20230235349A1 (en) | Novel maize cells and maize plants | |
| WO2022159758A1 (en) | Novel engineered and chimeric nucleases | |
| CN115992131A (en) | Nanocrystallized chitosan/dsGRK complex and preparation method and application thereof | |
| CN110368399A (en) | A kind of antisense peptide nucleic acid-DNA tetrahedron carrier complexes and its preparation method and application | |
| CN115927480A (en) | Gene delivery system based on nucleic acid nanostructure and preparation method and application thereof | |
| CN110088282A (en) | With the method for magnetic-particle separating high-purity nucleic acid | |
| CN101608232A (en) | Be used to screen and identify the novel little RNA chip production method and the application of the little rna expression spectrum of low abundance | |
| CN111249469B (en) | Peptide nanoparticle capable of escaping lysosome and preparation method and application thereof | |
| CN110804621A (en) | Preparation method of escherichia coli extracellular vesicle with endogenous high-expression miRNA (micro ribonucleic acid) | |
| CN116536365A (en) | Method for delivering nucleic acid by utilizing serum cationic protein | |
| CN114340656B (en) | Methods and compositions for facilitating targeted genomic modifications using HUH endonucleases | |
| CN112877331A (en) | Method for creating high amylose corn germplasm | |
| CN118291544A (en) | Nanocrystallized chitosan/sodium tripolyphosphate/dsHcUSP complex and application thereof in preventing and controlling fall webworm | |
| KR20200098424A (en) | Method for gene editing in microalgae using particle bombardment | |
| CN116121252B (en) | Nanocomposite for enhancing resistance of apple alternaria leaf spot and application thereof | |
| Yin et al. | MicroRNAs in the exosome-like nanoparticles from orange juice inhibit Citrus blue mold caused by Penicillium italicum | |
| JP7010941B2 (en) | Systems used for DNA editing and their applications |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |