WO2024005715A1 - Oligonucleotides - Google Patents
Oligonucleotides Download PDFInfo
- Publication number
- WO2024005715A1 WO2024005715A1 PCT/SG2023/050458 SG2023050458W WO2024005715A1 WO 2024005715 A1 WO2024005715 A1 WO 2024005715A1 SG 2023050458 W SG2023050458 W SG 2023050458W WO 2024005715 A1 WO2024005715 A1 WO 2024005715A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sso
- slc25a13
- seq
- sequence
- site
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/323—Chemical structure of the sugar modified ring structure
- C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/33—Alteration of splicing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/34—Allele or polymorphism specific uses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
Definitions
- the present invention relates generally to the field of RNA splicing.
- the invention relates to splice-switching oligonucleotides (SSOs) capable of altering the splicing of a pre- mRNA encoding a variant of the SLC25A13 gene.
- SSOs splice-switching oligonucleotides
- the invention also relates to the use of SSOs as therapeutic candidates for treating citrin deficiency.
- Citrin deficiency is an autosomal recessive disorder of urea cycle metabolism, caused by pathogenic variants in the SLC25A13 gene encoding citrin. a mitochondrial aspartateglutamate carrier.
- This condition can manifest as neonatal intrahepatic cholestasis during infancy (NICCD) and citruilinemia type II (CTLN2) characterized by adult-onset recurrent hyperammonemia with altered mental status that is refractory'- to conventional hyperammonemia therapies.
- NICCD may usually be self-limited and it is followed by a relatively asymptomatic period during childhood.
- asymptomatic period some patients with citrin deficiency may have recurrent hypoglycemia, feeding difficulties, or growth restriction.
- Affected individuals generally have a unique eating pattern (preference of high-fat/protein foods and avoidance of high-carbohydrate diet) with typically lean habitus before the onset of CTLN2. Identifying at-risk individuals during this period is challenging due to the absence of specific clinical findings or biochemical markers to address the disease progression. Undiagnosed individuals are at risk for significant growth restriction, hypoglycemia, and sudden onset of life-threatening hyperammonemia. Therefore, establishing a diagnosis of citrin deficiency in a timely manner and the development of effective therapies are crucial. The detailed mechanism of the disease remains unclear.
- citrin deficiency Currently, the only available management for citrin deficiency is dietary modification with a high-protein/fat diet and adding medium chain triglycerides in diet in some cases. Additionally, high carbohydrate diet and alcohol intake are discouraged since these can cause metabolic decompensations including hyperammonemia, which can lead to neurological damages.
- dietary modification may be used to manage the symptoms of citrin deficiency, it does not cure the underlying genetic cause of the disease.
- the carrier frequency of citrin deficiency was relatively high (nearly 1 in 30-40), particularly in East Asian countries such as in Singapore or Japan. Thus far, no curative management for citrin deficiency exists except for liver transplantation.
- liver transplantation is a major operation that comes with risks of medical complications such as bleeding and infections. Liver transplantation also carries risks such as immune rejection, biliary complications, transplanted liver failure and the need for lifelong immune suppression medication. There is thus a need for a new therapeutic strategy that corrects the underlying pathogenic genetic variant of the SLC25A13 gene that overcomes the drawbacks of the prior art.
- a method of exon-skipping comprising providing a spliceswitching oligonucleotide (SSO) that binds to a site within a target region present on a pre- mRNA transcript of the SLC25A 13 gene, wherein the binding of the SSO induces the exclusion of SLC25A13-PE5 from a mature mRNA transcript of the SLC25A13 gene.
- the target region has at least 95% sequence identity to SEQ ID NO: 28.
- SLC25A13-PE5 comprises the sequence of SEO. ID NO: 29.
- the method as described herein comprises providing an SSO having a binding site that lies within SLC25A13-PE5.
- the method as described herein comprises providing an SSO having a binding site that overlaps with the acceptor splice site of SLC25A13-PE5 and with or a part of SLC25A13-PE5.
- the method as described herein comprises providing an SSO having a binding site that overlaps with or a part of SLC25A13-PE5 and with the donor splice site of SLC25A13-PE5.
- the method as described herein comprises providing an SSO having a sequence selected from the group consisting of SEQ ID NOs 1 to 12.
- the method as described herein comprises providing an SSO having a sequence selected from the group consisting of SEQ ID NOs 13 to 27.
- a splice-switching oligonucleotide that binds to a site within a target region present on a pre-mRNA transcript of the SLC25A13 gene, the target region having at least 95% sequence identity to SEQ ID NO: 28, and wherein binding of the SSO induces the exclusion of SLC25A13-PE5 from a mature mRNA transcript of the SLC25A 13 gene.
- the SSO as described herein has a binding site that lies within SLC25A13- PE5 and wherein SLC25A13-PE5 comprises the sequence of SEQ ID NO: 29.
- the SSO as described herein has a binding site that overlaps with the acceptor splice site of SLC25A13-PE5 and with or a part of SLC25A13-PE5, and wherein SLC25A13-PE5 comprises the sequence of SEQ ID NO: 29.
- the SSO as described herein has a binding site that overlaps with or a part of SLC25A13-PE5 and with the donor splice site of SLC25A13-PE5, and wherein SLC25A13-PE5 comprises the sequence of SEQ ID NO: 29.
- the SSO as described herein comprises a sequence selected from the group consisting of SEQ ID NOs 1 to 12.
- the SSO as described herein comprises a sequence selected from the group consisting of SEQ ID NOs 13 to 27.
- an SSO as described herein for use in treating citrin deficiency.
- a use of an SSO as described herein in the manufacture of a medicament for treating citrin deficiency in one aspect, there is provided a method of treating citrin deficiency comprising administering to a subject a composition comprising an SSO as described herein.
- the SSO as described herein is between 15 and 40 nucleotides in length. in one embodiment, at least one of the nucleotides of the SSO is chemically modified and the chemical modification is 2’-O-methyl RNA modification, 2'-O-methoxyethyl RNA modification, locked nucleic acid substitution, or phospho rath ioate linkage.
- the SSO as described herein comprises phosphorothioate linkages between all nucleotides of the SSO.
- each nucleotide of the SSO as described herein comprises either a 2’-O- methyl RNA modification, a 2 -O-methoxyethyl RNA modification or a locked nucleic acid substitution.
- a pharmaceutical composition comprising (a) a therapeutically effective amount of an SSO as described herein and (b) one or more pharmaceutically acceptable carriers and/or diluents.
- Figure 1 is a schematic of a minigene system that harbours the specific genomic mutation, c.469-2922G>T of the SLC25A 13 gene (accession number NM_001160210.2).
- the minigene includes the full sequence of exon 5, the first 2,000 bases (from exon 5 donor splice site) and last 4,923 bases of intron 5 (or 4,923 bases before exon 6 acceptor site), and the complete sequence of exon 6.
- the relative loci of the G-to-T substitution is demarcated in the figure.
- Figure 2 shows that CRISPR knock-in and minigene recapitulates the generation of SLC25A13-PE5 (c.469-2909 to c.469-2825 with reference to NM_001160210,2).
- Figure 2A is a gel electrophoresis image of PCR products from mRNA extracted from hepatocytes differentiated from human embryonic stem cells (i.e. induced hepatocytes, or Heps) containing CRISPR knock-in of the c.469-2922G>T mutation.
- HET is a heterozygous clone
- HOM1 and HOM2 are two separate homozygous clones containing the c.469-2922G>T mutation.
- CARN 10 serves as a loading control.
- FIG. 2B is an immunoblot image confirming the loss of full length citrin protein in mutant iHeps as a result of the incorporation of SLC25A13-PE5 into SLC25A13 mature transcripts.
- Figure 2C is a graph indicating loss of ureagenic potential and Figure 2D is a graph revealing loss of ammonia clearing capability in mutant iHeps.
- Figure 2E is a graph showing that hepatocyte differentiation markers ALB and ASGR1 are not significantly different in IHeps harbouring wildtype or mutant (heterozygous or homozygous for c.469-2922G>T) SLC25A13, suggesting that loss of citrin does not impact hepatocyte differentiation, and that the loss of ureagenic potential and ammonia clearing capability are not due to a difference in hepatocyte differentiation.
- Figure 2F is a gel electrophoresis image showing PCR products from three cell lines (HEK293T, Huh7 and HepG2) transfected with either pCIT2 (WT minigene construct) or pCIT2mut (mutant minigene construct).
- FIG. 2G is a sample sequencing data showing the incorporation of the pseudoexon SLC25A13-PE5 in mature mRNA from cells transfected with pCIT2mut.
- Figure 3 is a capillary electrophoresis image from screening of SSOs against SLC25A13-PE.
- Huh? were co-transfected with 500ng of pCIT2mut and 25nM of SSOs, after which PCR was performed on complementary DNA (cDNA) generated from RNA extracted from the transfected ceils.
- cDNA complementary DNA
- the data reveals efficacy of the SSOs in mediating splice exclusion of SLC25A13-PE5. Every ribose sugar moiety in a SSO is modified with 2’-O-methyl that is linked via phosphorothioate (PS) backbone.
- PS phosphorothioate
- Figure 4 is a graph showing SSO concentration response curves of selected SSOs from the screen in Figure 3.
- Huh? were co-transfected with 500ng of pGIT2mut and SSOs at the indicated amounts, after which PCR was performed on cDNA generated from RNA extracted from the transfected cells.
- Capillary electrophoresis was used on PCR products to quantify the amount of products with the pseudoexon and without the pseudoexon. Efficacy is reflected as the percentage of PCR products without the pseudoexon over the total amount of PCR products (% splicing correction).
- Figure 5 shows the result of screening of shortened sequences and mixmers.
- Figure 5,4 is a graph showing splicing correction efficacy of SSOs #2032, #2033 and #2034 modified with 2’0-methyl (2OM) or 2’-O-methoxyethyl (2MOE), all of which are shortened from #2008, when Huh7 cells stably expressing the mutant minigene were treated at 20QnM by free uptake in calcium-enriched medium (OEM). #2008 serves as positive control.
- Figure 5B is a graph showing the screening of mixmers derived from the sequence of #2034 when transfected at 10nM into HepG2 stably expressing the mutant minigene.
- PCR was performed on cDNA generated from RNA extracted from the transfected cells.
- Capillary electrophoresis was used on PCR products to quantify the amount of products with the pseudoexon and without the pseudoexon. Efficacy is reflected as the percentage of PCR products without the pseudoexon over the total amount of FOR products (% splicing correction).
- Every ribose sugar moiety in a mixmer is either modified with 2’-O-methyl or 2’-O- methoxyethyl substituted with a locked nucleic acid (2OML or 2MOL, respectively) that is linked via phosphorothioate backbone.
- Figure 6 shows ths results of screening of shortened mixmers used in Figure 5 by free uptake in calcium-enriched medium (OEM).
- Figure 6A is a graph showing screening of mixmers by free uptake under CEM on Huh7 or HepG2 cells stably expressing the mutant minigene when treated with 20nM or 200nM of SSOs, respectively.
- the use of OEM stimulates in vitro uptake by cells and better reflects the in vivo efficacy when compared to transfection.
- the data shows that the shortened mixmers were able to modulate splice-out of SLC25A13-PE5 in the absence of a transfection agent.
- Figure 6B is a graph showing the free uptake dose response curve of selected SSOs, revealing good efficacy of #2034.5 and #2034.15 with ECso in the nanomolar range in Huh? cells stably expressing the mutant minigene. In fact, ECso of the two mixmers are about 10 times lower than their parent SSO (#2008) and the singly 2'-O-methyl modified #2034.
- Figure 6C is a graph of MTT assay whereby Huh7 cells stably expressing the mutant minigene were treated by free uptake under CEM with different concentrations of SSOs for 72 hours; SSOs with a “C” prefix are additional negative controls whose sequence is full complementary with identical chemical modifications as the corresponding SSO lead #2034.
- LNA32 with the sequence EAAaggaaacacaEAT (SEQ ID NO: 46) and LNA41 with the sequence EAEattccttgctETG (SEQ ID NO: 47) are gapmers with full PS backbone linkage containing natural DNA bases (in small letters) flanked by three LNAs (in capital letters) on both ends that were previously shown to be respectively non-toxic and acutely hepatotoxic in vivo in mouse studies. Therefore, LNA32 serves as a negative control and LNA41 serves as a positive control.
- capital letters represent LNA
- small letters represent DNA
- E” represents 5-methylcytosine.
- Figure 7 shows results from asialoglycoprotein receptor-mediated functional uptake of SSOs (in the absence of CEM and a transfection agent) in iHeps homozygous for SLC25A13-PE5 with 4pM of GalNAc*3 (GN*3)-conjugated non-targeting control (NC2 g1.1), 2034.5 (2034.5g1.1) or 2034.15 (2034.15g1.1) in either 2'-O-methyl + LNA (2OML) or 2'-O- methoxyethyl + LNA (2MOL) chemistry combinations.
- NC2 g1.1 GalNAc*3
- 2034.5 2034.5g1.1
- 2034.15g1.1 2034.15g1.1
- 2OML 2'-O-methyl + LNA
- 2MOL 2'-O- methoxyethyl + LNA
- FIG. 7 A reveals that the GaiNAc-conjugated SSOs 2034.5 and 2034.15, but not NC2, can modulate splice-out of SLC25A13-PE5 from endogenous SLC25A13 transcripts.
- Figure 78 displays expression of total SLC25A13 transcripts in mutant iHeps, reflected as relative expression upon normalization to WT iHeps treated with the respective NC2g1.1 non-targeting control (2OM for 2OML SSOs or 2MOE for 2MOL SSOs).
- the data suggests that the splicing correction by the GaiNAc-conjugated SSOs rescues SLC25A13 transcript levels, which were degraded by nonsense-mediated decay in mutant iHeps.
- Figure 7C shows rescue of ureagenesis and Figure 7D highlights rescue of ammonia clearance when mutant iHeps were treated with GaiNAc-conjugated SSOs.
- Figure 7E is a graph of expression of acute toxicity markers CDKN1A.
- BAX and PUMA in mutant iHeps treated with SSOs shown relative to WT iHeps treated with NC2g1.1.
- the data hints at lack of acute toxicity in treated mutant iHeps with no significant increase in expression of acute toxicity markers CDKN1A, BAX and PUMA when compared to WT iHeps treated with NC2g1.1.
- Figure 7F shows an immunoblot image whereby expression of full length citrin protein is rescued in IHeps homozygous for SLC25A13-PE5 (HOM1) treated with GaiNAc-conjugated #2034.15 2OML (GN*3-2034.152OML). This would corroborate with the functional data, suggesting that the rescue in the functional assays (Fig. 7C and 7D) are likely due to rescue in the protein level, and thus protein activity.
- a method of exon-skipping comprising providing a splice-switching oligonucleotide (SSO) that binds to a site within a target region present on a pre-mRNA transcript of the SLC25A13 gene, wherein the binding of the SSO induces the exclusion of SLC25A13-PE5 from a mature mRNA transcript of the SLC25A13 gene.
- SSO splice-switching oligonucleotide
- oligonucleotide it is meant to refer to any polynucleotide.
- a "polynucleotide” is an oligomer comprised of nucleotides.
- a polynucleotide may be comprised of DNA, RNA modified forms thereof, or a combination thereof.
- the term “nucleotide” or its plural as used herein is interchangeable with modified forms as discussed herein and otherwise known in the art.
- the art uses the term “nucieobase” which embraces naturally occurring nucleotides as well as modifications of nucleotides that can be polymerized.
- nucleotide or nucieobase means the naturally occurring nucieobases adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U) as well as non-naturally occurring nucieobases such as xanthine, diaminopurine, 8-oxo-N6- methyladenine, 7-deazaxanthine, 7-deazaguanine, N4,N4-ethanocytosin, N',N'-ethano-2,6 ⁇ diaminopurine, 5-methylcytosine (mC), 5-(C[3j- C6)- alkynyi-cytosine, 5-fluorouracil, 5- bromouracil, pseudoisocytosine, 2-hydroxy-5-methyl-4-tr- iazoiopyridin, isocytosine, isoguanine, inosine and the "non-naturaily occurring” nucleobases described in Benner
- nucleic Acids Research vol. 25: pp 4429-4443.
- nucleobase also includes not only the known purine and pyrimidine heterocycles, but also heterocyclic analogues and tautomers thereof. Further naturally and non-naturaily occurring nucleobases include those disclosed in U. S. Pat. No. 3,687,808 (Merigan, et al), in Chapter 15 by Sanghvi, in Antisense Research and Application, Ed. S. T. Crooke and B.
- polynucleotides also include one or more "nucleosidic bases” or “base units” which include compounds such as heterocyclic compounds that can serve like nucleobases, including certain "universal bases” that are not nucleosidic bases in the mast classical sense but serve as nucleosidic bases.
- Universal bases include 3-nitropyrrole, optionally substituted indoles ⁇ e.g., 5-nitroindole), and optionally substituted hypoxanthine.
- Other desirable universal bases include pyrrole, and diazole or triazole derivatives, including those universal bases known in the art.
- Polynucleotides may also include modified nucleobases.
- a "modified base” is understood in the art to be one that can pair with a natural base (e.g., adenine, guanine, cytosine, uracil, and/or thymine) and/or can pair with a non-naturaily occurring base.
- exemplary modified bases are described in EP 1 072 679 and WO 97/12896, the disclosures of which are incorporated herein by reference.
- Modified nucleobases include, without limitation, 5- methylcytosine (5-me-C), 5-hydroxymethyi cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine and other aikynyi derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracii (pseudouracil), 4-thiouracii, 8- halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5- bromo
- Further modified bases include tricyclic pyrimidines such as phenoxazine cytidine(IH- pyrimido[5,4-b] [!,4]benzoxazin-2(3H)- one), phenothiazine cytidine (!H-pyrimido[5,4-b] [l,4]benzothiazin-2(3H)-one), G-ciamps such as a substituted phenoxazine cytidine (e.g.
- Modified bases may aiso include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2- aminopyridine and 2-pyridone. Additional nucleobases include those disclosed in U. S. Pat.
- bases are useful for increasing the binding affinity of the polynucleotide and include 5-substituted pyrimidines, 6- azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5- propynyluracil and 5-propynylcytosine.
- 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2. deg. C and are, in certain embodiments, combined with 2 - O-methoxyethyl sugar modifications. See, U. S. Pat. Nos. 3,687,808, U. S. Pat. Nos.
- splice switching oligonucleotides As used herein, the term “splice switching oligonucleotides’' (SSOs) or “splice switching oligomers” is meant to include synthetic antisense nucleic acids that base-pair with a pre- mRNA and disrupt the splicing process by statically blocking the RNA-RNA base-pairing or protein-RNA binding interactions that occur between components of the splicing machinery and the pre-mRNA.
- the SSOs may also be known as “antisense nucleotides”, “steric blockers” or “steric hindrance antisense nucleotides” which can modulate splicing. SSOs may modulate splicing via steric blocking. In some embodiments, SSOs may be mixmers.
- the term “mixmer” includes an oligomer on which different types of chemical modifications are applied on its sugar moieties, or on its backbone linkages, or both.
- Examples of chemical modifications include phosphorothioate linkages, 2’-O-methyl RNA modifications, 2’-O-methoxyethyl RNA modifications and locked nucleic acid substitutions.
- the terms “phosphorothioate bond” and “phosphorothioate linkage” are used interchangeably.
- the chemical modifications mayincrease the efficacy, selectivity and stability while manifesting superior toxicity profile of SSOs.
- splicing refers to an RNA processing mechanism in which a pre-mRNA is made into a mature mRNA. During splicing, introns are removed and exons are connected. Splicing is catalysed by the spliceosome complex.
- alternative splicing is meant to indude a process by which a gene can encode for multipie mRNA and protein products by differentially selecting which exons are to be included in a mature mRNA transcript. For example, alternative splicing can take the term of one or more skipped exons, variable position of intron splicing, or intron retention.
- the term “intron” refers to a segment of non-coding nucleic acid sequence that is transcribed and is present in the pre-mRNA but is excised by the splicing machinery and therefore not present in the mature mRNA transcript.
- the term “exon” refers to a segment of a nucleic acid sequence that is transcribed into mRNA and that is present in mature mRNA after splicing.
- the term “exon skipping” is meant to include the process by which an entire exon, or a portion thereof, is removed from a given pre-mRNA and is thereby excluded from being present in the mature mRNA. For example, the portion of the protein that is otherwise encoded by the skipped exon is not present in the expressed form of the protein.
- the target region has at least 95% sequence identity to SEQ ID NO: 28.
- the target region may include a variant sequence of SEQ ID NO: 28.
- the target region may comprise, consist or consist substantially or essentially of a sequence having at least 95%, 96%, 97%, 98%, 99% ot 100% sequence identity thereto.
- splice site is meant to include specific nucleic acid sequences that can be recognized by the splicing machinery as being suitable for excision and/or ligation with the corresponding splice site.
- the splice site defines the precise exon-intron boundary that allows the excision of introns present in pre-mRNA transcripts.
- the term “5’ splice site” (also known as donor splice site) refers to a nucleic acid sequence surrounding the exon-intron boundary at the 5’ end of an intron that marks the start of the intron and its boundary with the preceding exon sequence.
- 3 splice site (also known as acceptor splice site) as used herein refers to a nucleic acid sequence surrounding the intron-exon boundary at the 3’ end of an intron that marks the end of the intron and its boundary with the following exon sequence.
- pre-mRNA or “precursor mRNA” refers to a strand of messenger ribonucleic acid (mRNA), synthesized from a DNA template by transcription. Pre-mRNA is composed of exons, introns and untranslated sequences (before the first and after the last exons respectively). Generally, eukaryotic pre-mRNA exists only briefly before it is fully processed into mature mRNA.
- binding as used in the context of an SSO is meant to indude the hybridization of the SSO to a site within a target region on a pre-mRNA transcript.
- hybridize may include the binding of a single-stranded nucleic acid or a locally singlestranded region of a double-stranded nucleic acid to another single-stranded nucleic acid or a locally single-stranded region of a double-stranded nucleic acid having a complementary sequence through the pairing of complementary nucleic acids. It is generally known to a person skilled in the art that binding or hybridization of one sequence to another does not require total complementarity of the sequences. For example, the sequence of the SSO may be completely complementary or partially complementary to the target region to which it binds.
- site refers to a location that the SSO is substantially or fully complementary to.
- the SSO may bind to this site.
- site lies within the target region, and the target region forms a part of the pre- mRNA transcript.
- variant in the relevant gene, it is meant to include any variation or alteration in the sequences of said gene, such that the sequence differs from what is found naturally or in most people.
- a “non-variant” may include any sequence of the gene that may be considered “wild-type”, i.e. a sequence that is deemed normal or typical for said gene.
- a “variant” of the gene means any one or more alteration(s), i.e. a substitution, duplication, inversion, insertion, and/or deletion, at one or more (several) positions, of the polynucleotide of the gene.
- a substitution may include a replacement of one or more nucleotide(s) occupying a position with one or more different nucleotide(s); a deletion means removal of one or more nucleotide(s) occupying a position; and an insertion means adding one or more nucleotide(s) immediately adjacent to a nucleotide occupying a position.
- the term “variant” may also refer to any variation or alteration in the sequence of a gene that results in the loss of wild-type protein expression and/or function, or gain-of-function.
- the pre-mRNA transcript of the SLC25A 13 gene is a pre-mRNA transcript of a variant of the SLC25A 13 gene.
- the variant of the SLC25A 13 gene may comprise a c.469- 2922G>T mutation, in one embodiment, the binding site of the SSO as described herein resides within a target region of 5’ CCUCCCAUUGUUCAAUAGCUCACGAUUUGUUCAUUCAUUUGGUUUUACAGAAUACUU U U CAC U G A U GAG A.
- SEQ ID NO: 28 The cDNA sequence that encodes for SEQ ID NO: 28 is 5'
- SEQ ID NO: 44 comprises the sequence of SLC25A13-PE5 (SEQ ID NO: 29) as well as the sequence of partial introns flanking SLC25A13-PE5.
- the sequence of partial introns flanking SLC25A13-PE5 include the acceptor and donor splice sites of SLC25A.13-PE5.
- the c.469"2922G>T mutation in SEQ ID NO: 44 and the corresponding G>U mutation in SEQ ID NO: 28 are shown in bold and underline above.
- the binding site of the SSO may overlap with the SLC25A13-PE5 acceptor splice site and with or a part of SLC25A13-PE5.
- the entire binding site of the SSO may lie within SLC25A13-PE5.
- the binding site of the SSO may overlap with or a part of SLC25A13-PE5 and the SLC25A13-PE5 donor splice site.
- SLC25A13-PE5 comprises the sequence of SEQ ID NO: 29.
- pseudoexon refers to a potential exon, containing adequate 5’ and 3 : splice sites, that is not normally spliced into mature mRNA by the splicing machinery.
- the inclusion of a pseudoexon in a mature mRNA for example due to a mutation that either creates/activates or eiiminates/diminishes a splicing motif or splice site, or dysregulation of the splicing machinery stemming from the absence or overproduction of one or more components of the spliceosome complex or specific RNA binding protein(s) acting as splicing enhancers or splicing silencers, may cause a shift in the codon reading frame, an in-frame premature stop codon, or addition of novel amino acid residues, resulting in a loss of expression/function of the protein.
- the genetic mutation(s) that effects the creation of a pseudoexon need not reside within the pseudoexon.
- the term “pseudoexon” as used herein refers to SLC25A13-PE5 with the RNA sequence 5’ -
- SEQ ID NO: 45 AATACTTTTCACTGATGAGAATGCCTGTCATTTATTGAGCACCTACTATACATCTAAAGC ATTCTGCTGAGCTGCATGTATAAAT -3’ (SEQ ID NO: 45). It would be generally understood that a skilled person given SEQ ID NO: 45 would know how to derive the RNA sequence of SLC25A13-PE5 (l.e. SEQ ID NO: 29). Ths terms “SLC25A13-PE5”, “SLC25A13-PE”, “PE” and “Exon 5*” may be used interchangeably.
- the method as described herein comprises providing an SSO having a binding site that lies within SLC25A13-PE5. in one embodiment the method as described herein comprises providing an SSO having a binding site that overlaps with the acceptor splice site of SLC25A13-PE5 and with or a part of SLC25A13-PE5.
- the method as described herein comprises providing an SSO having a binding site that overlaps with or a part of SLC25A13-PE5 and with the donor splice site of SLC25A13-PE5.
- the method as described herein comprises providing an SSO having a sequence selected from the group consisting of SEQ ID NOs 1 to 12.
- the method as described herein comprises providing an SSO having a sequence selected from the group consisting of SEQ ID NOs 13 to 27.
- a splice-switching oligonucleotide that binds to a site within a target region present on a pre-m R NA transcript of the SLC25A13 gene, the target region having at least 95% sequence identity to SEQ ID NO: 28, and wherein binding of the SSO induces the exclusion of SLC25A13-PE5 from a mature mRNA transcript of the SLC25A 13 gene.
- the SSO has a binding site that lies within SLC25A13-PE5 and wherein SLC25A13-PE5 comprises the sequence of SEQ ID NO: 29.
- the SSO has a binding site that overlaps with the acceptor splice site of SLC25A13-PE5 and with or a part of SLC25A13-PE5, and wherein SLC25A13-PE5 comprises the sequence of SEQ ID NO: 29.
- the SSO has a binding site that overlaps with or a part of SLC25A13- PE5 and with the donor splice site of SLC25A13-PE5, and wherein SLC25A13-PE5 comprises the sequence of SEQ ID NO: 29.
- the SSO of the invention comprises a sequence selected from the group consisting of SEQ ID NOs 1 to 12.
- the SSO comprises a sequence selected from the group consisting of SEQ ID NOs 13 to 27.
- the SSO may be between 15 and 40 nucleotides in length.
- SSOs complementary to a pre-mRNA resulting from a mutation selected from the group consisting of c.469-2922G>C, c.469-2922G>A, c.469-2923A>T, c.469-2923A>G, c.469-2923A>C i c.469-2923 represents 469-2920del, c.469- 2922_469-2921del, c.469-2923_469-2921del, c.469-2924_459-2921del !
- the SSOs of the present embodiments are able to bind to the respective binding sites on the target region competitively due to favourable binding thermodynamics and extent of cotranscriptional locally single-stranded binding site on the target region identified. Selection of the target region involves considering the presence of RNA-binding protein motifs on the target region.
- the SSOs of the present embodiments are able to induce the desired splicing modulation by competitive binding to target sites that encompass or overlap sequence motifs used by the appropriate RNA-binding protein(s), snRNPs (small nuclear ribonucleoproteins), or both.
- shortened SSOs reduce propensity of immune response and may have superior uptake kinetics by cells, as shown in Figure 6.
- At least one of the nucleotides of the SSO is chemically modified and wherein the chemical modification is 2’-O-methyl RNA modification, 2'-O-methoxyethyl RNA modification, locked nucleic acid substitution, or phosphorothioate linkage.
- the term “locked nucleic acid” (LNA) generally refers to a modified RNA nucleotide where the ribose ring is “locked” with a methylene bridge connecting the 2'-0 atom with the 4'-C atom.
- Modified polynucleotides are contemplated for use wherein both one or more sugar and/or one or more internucleotide linkage of the nucleotide units in the polynucleotide is replaced with “non-naturaily occurring” sugars (i.e., sugars other than ribose or deoxyribose) or internucleotide linkages, respectively, in one embodiment, this embodiment contemplates a peptide nucleic acid (RNA).
- RNA compounds the sugar-backbone of a polynucleotide is replaced with an amide-containing (e.g., peptide bonds between N-(2-aminoethyl)-giycine units) backbone. See, for example U. S.
- Modified polynucleotides may also contain one or more substituted sugar groups.
- a modification of the sugar includes Locked Nucleic Acids (LNAs) in which the 2’- hydroxyl group is linked to the 3 : or 4 : carbon atom of the sugar ring, thereby forming a bicyclic sugar group.
- LNAs Locked Nucleic Acids
- the linkage is in certain embodiments a methylene (- CH[ 2 J- )[»] group bridging the 2’ oxygen atom and the 4’ carbon atom wherein n is 1 or 2.
- LNAs and preparation thereof are described in WO 98/39352 and WO 99/14226, the disclosures of which are incorporated herein by reference.
- the antisense oligonucleotide comprises a modified polynucleotide backbone.
- the modified polynucleotide backbone may comprise a modified moiety substituted for the sugar of at least one of the polynucleotides.
- the modified moiety may be selected from the group comprising of phosphorodiamidate morpholino oligomer (PMO), peptide-conjugated phosphorodiamidate morpholino oligomer (PPMO). and non-peptide dendrimeric octaguanidine moiety-tagged morpholino oligomer.
- PMO phosphorodiamidate morpholino oligomer
- PPMO peptide-conjugated phosphorodiamidate morpholino oligomer
- non-peptide dendrimeric octaguanidine moiety-tagged morpholino oligomer non-peptide dendrimeric octaguanidine moiety-tagged morpholino oligomer.
- the modified polynucleotide backbone comprises at least one modified internucleotide linkage.
- the modified internucleotide linkage comprises a modified phosphate. More preferably, the modified phosphate is any one selected from the group comprising of a non-bridging oxygen atom substituting a sulfur atom, a phosphonate, a phosphorothioate, a phosphodiester, a phosphoromorpholidate, a phosphoropiperazidate and a phosphoroamidate.
- the SSO comprises a backbone selected from the group comprising of ribonucleic acid, deoxyribonucleic acid, DNA phosphorothioate, RNA phosphorothioate, 2’-O-methyl-oligaribonucleotide and 2'-O-methyl-oligodeoxyribonucleotide, 2 : -O-hydrocarbyl ribonucleic acid, 2'-O-hydrocarbyl DNA, 2’-O-hydrocarbyl RNA phosphorothioate, 2'-O-hydrocarbyi DNA phosphorothioate, 2’-F-phosphorothioate, 2’-F- phosphodiester, 2’-methoxyethyi phosphorothioate, 2-methoxyethyi phosphodiester, deoxy methylene(16ore16lamino) (deoxy MMi), 2’-O-hydrocarby MMI.
- the oligonucleotide is chemically linked to one or more conjugates that enhance the activity, cellular distribution, or cellular uptake of the SSO.
- the SSO comprises phosphorothioate linkages between all nucleotides of the SSO.
- each nucleotide of the SSO comprises either a 2’-O-methyl RNA modification, a 2’-O-methoxyethyl RNA modification or a locked nucleic add substitution.
- the SSOs of this invention for use in medicine or in treating citrin deficiency.
- the term "treat” or “treating” in the context of treating a disease such as citrin deficiency is meant to include improving clinical outcomes of patients having the disease. This includes improving the survival rates of patients having the disease.
- treat or “treatment” may refer io prophylactic and/or therapeutic treatment.
- a use of an SSO as described herein the manufacture of a medicament for treating citrin deficiency.
- a method of treating citrin deficiency comprising administering to a subject a composition comprising an SSO as described herein.
- SSOs may be used in compositions that can be used for treatment, e.g. as a pharmaceutical composition comprising the SSO of the invention and a pharmaceutically acceptable carrier.
- the composition is suitable for parenteral administration either naked or complexed with a delivery agent to a patient.
- the carrier is selected from the group consisting of a nanoparticle, such as a polymeric nanoparticle: a liposome, such as pH- sensitive liposome, an antibody conjugated liposome; a viral vector, a cationic lipid, a polymer, a UsnRNA, such as U7 snRNA and a cell penetrating peptide.
- the SSO is administered orally, or rectal, or transmucosa!, or intestinal, or intramuscular, or subcutaneous, or intramedullary, or intrathecal, or direct intraventricular, or intravenous, or intravitreal, or intraperitoneal, or intranasal, or intraocular.
- a pharmaceutically acceptable carrier refers, generally, to materials that are suitable for administration to a subject wherein the carrier is not biologically harmful, or otherwise, causes undesirable effects.
- Such carriers are typically inert ingredients of a medicament.
- a carrier is administered to a subject along with an active ingredient without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of a pharmaceutical composition in which it is contained.
- Suitable pharmaceutical carriers are described in Martin, Remington’s Pharmaceutical Sciences. 18 th Ed., Mack Publishing Co., Easton, Pa., (1990), incorporated by reference herein in its entirety.
- compositions comprising therapeutically effective amounts of an SSO together with pharmaceutically acceptable diluents, preservatives, solubilizers, emulsifiers, adjuvants and/or carriers.
- compositions include diluents of various buffer content (e.g., phosphate, Tris-HCI, acetate), pH and ionic strength and additives such as detergents and solubilizing agents (e.g., Tween 80, Polysorbate 80), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimersol, benzyl alcohol) and bulking substances (e.g., lactose, mannitol).
- the material may be incorporated into particulate preparations of polymeric compounds such as, for example and without limitation, polylactic acid or polyglycolic acid, or into liposomes. Hylauronic acid may also be used.
- compositions may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the disclosed compositions.
- the compositions may be prepared in liquid form, or may be in dried powder, such as lyophilized form.
- pharmaceutical compositions provided according to the disclosure may be administered by any means known in the art.
- the pharmaceutical compositions for administration are administered by injection, orally, or by the pulmonary, or nasal route.
- the antisense polynucleotides are, in various embodiments, delivered by intravenous, intra-arterial, intraperitoneal, intramuscular, or subcutaneous routes of administration.
- the oligonucleotides of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such pro-drugs, and other bioequivalents.
- pharmaceutically acceptable sate refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e. , salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
- preferred examples of pharmaceutically acceptable sate include, but are not limited to, (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygaiacturonic acid; and
- compositions of the disclosure maybe administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated.
- Administration may be topical (including ophthalmic and to mucous membranes including rectal delivery), pulmonary, e.g., by inhalation of powders or aerosols, (including by nebulizer, intratracheal, intranasal, epidermal and transdermal), oral or parenteral.
- Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.
- the pharmaceutical formulations of the disclosure may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
- Combination therapy with an additional therapeutic agent may also be contemplated by the disclosure.
- the term “combination” or “combination therapy” as used throughout the specification, is meant to encompass the administration of the referred therapeutic agents to a subject suffering from a disease, disorder or pathological condition, in the same or separate pharmaceutical formulations, and at the same time or at different times. If the therapeutic agents are administered at different times they should be administered sufficiently close in time to provide for the potentiating or synergistic response to occur. In such instances, it is contemplated that one would typically administer both therapeutic agents within about 12-24 hours of each other and, more preferably, within about 6-12 hours of each other.
- terapéuticaally effective amount refers to the amount of the SSO that is required to confer the intended therapeutic effect in the subject, which amount will vary depending on the route of administration, status of disease, age, gender, body weight, and possible inclusion of other therapeutics or excipients.
- the method and uses of the invention are for a patient in need thereof.
- the compositions and methods of this invention are for a subject or patient in need thereof.
- patient in need thereof refers to a person who has or is suspected of having or developing citrin deficiency, as well as a person who is predisposed to but yet to develop citrin deficiency.
- the SSO may be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or via an implanted reservoir.
- parenteral as used herein includes subcutaneous, intracutaneous, intravenous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques.
- a sterile injectable composition e.g., a sterile injectable aqueous or oleaginous suspension, can be formulated according to techniques known in the art using suitable dispersing or wetting agents (such as Tween 80) and suspending agents.
- the sterile injectable preparation can also be a sterile injectable solution or suspension in a non-toxic parentally acceptable diluents or solvent for example, as a solution in 1 ,3-butanediol.
- a non-toxic parentally acceptable diluents or solvent for example, as a solution in 1 ,3-butanediol.
- acceptable vehicles and solvents that can be employed are mannitol, water, Ringer's Solution and isotonic sodium chloride solution.
- sterile, fixed oils are conventionally employed as a solvent or suspending medium (eg. Synthetic mono-or dyglycerides).
- Fatty acids such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically-acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated versions.
- oils such as olive oil or castor oil, especially in their polyoxyethylated versions.
- These oil solutions or suspensions can also contain a long-chain alcohol diluents or dispersant, or carboxymethyl cellulose or similar dispersing agents.
- Other commonly used surfactants such as Tweens or Spans or other similar emulsifying agents or bioavailablity enhancers which are commonly used in the manufacture of pharmaceutically acceptable solid, liquid, or other dosage forms can also be used for the purposes of formulation.
- a composition for oral administration can be any orally acceptable dosage form including, but not limited to, capsules, tablets, emulsions and aqueous suspensions, dispersions and solutions.
- carriers that are commonly used include lactose and corn starch.
- Lubricating agents such as magnesium stearate, are also typically added.
- useful diluents include lactose and dried corn starch.
- a nasal aerosol or inhalation composition can be prepared according to techniques well known in the art of pharmaceutical formulation.
- a SSO-containing composition can also be administered in the form of suppositories for rectal administration.
- the carrier in the pharmaceutical composition must be “acceptable” in the sense of being compatible with the active ingredient of the formulation (and preferable, capable of stabilising it) and not deleterious to the subject to be treated.
- solubilising agents which form more soluble complexes with the SSOs, or more solubilising agents, can be utilised as pharmaceutical carriers for delivery of the active compounds.
- examples of other carriers include colloidal silicon dioxide, magnesium stearate, sodium lauryl sulphate, and D&C Yellow #10
- the method as described herein comprises providing an SSO that is between 15 and 40 nucleotides in length. in various embodiments, the method as described herein comprises providing an SSO with at least one of the nucleotides of the SSO being chemically modified and wherein the chemical modification is 2’-O-methyl RNA modification, 2’-O-methoxyethyl RNA modification, locked nucleic acid substitution, or phosphorothioate linkage.
- the method as described herein comprises providing an SSO having phosphorothioate linkages between all nucleotides of the SSO.
- the method as described herein comprises providing an SSO with each nucleotide having either a 2’-O-methyl RNA modification, a 2’-O-methoxyethyl RNA modification or a locked nucleic acid substitution.
- a pharmaceutical composition comprising (a) a therapeutically effective amount of an SSO as described herein and (b) one or more pharmaceutically acceptable carriers and/or diluents.
- HEK293T, Huh? and HepG2 cells were maintained in Dulbecco’s Modified Eagle Medium (DM EM) with high glucose supplemented with 10% fetal bovine serum and kept in a ceil culture incubator set to 37°C and 5% carbon dioxide.
- DM EM Modified Eagle Medium
- ES ceils Embryonic stem ceils
- ES cell-qualified Matrigel Corning
- mTeSR Plus medium STEMCELL Technologies
- ES cells seeded at 50% confluency were induced in definitive endoderm medium 1 (RPMI 1640 medium supplemented with B-27 supplement, W0ng/mL Activin A and 3uM CHIR99021) for two days, definitive endoderm medium 2 (RPMI 1640 medium supplemented with B-27 supplement) for three days, hepatic endoderm medium (definitive endoderm medium 2 with 20ng/mL BMP4 and lOng/mL FGF2) for five days, and Lonza Hepatocyte Culture Medium for fourteen days.
- CRISPR knock-in of the c.469-2922G>T variant into ES cells was outsourced to the Duke-NUS Stem Cell and Gene Editing (SCAGE) Core Facility.
- the minigene was subcloned into a Piggybac-based transfer vector and co-transfected with a Piggybac transposon- expressing plasmid at a 5: 1 ratio for a total of 500ng using Lipofectamine 3000 as above, after which ceils were selected with puromycin at 1pg/mL for 2 weeks.
- Free uptake of SSOs by Huh? and HepG2 under CEM was performed by treating cells with SSOs in calcium-enriched medium (ceil culture media as above supplemented with SmM calcium chloride). Cells were collected 72 hours post-treatment for RNA analysis and were treated with 50pg/mL cycloheximide about 17 hours priorto cell harvesting.
- SSO treatment of iHeps cells were treated with Gal N Ac-conjugated SSOs in Lonza Hepatocyte Culture Medium for 72 hours. No cycloheximide treatment was performed for SSO-treated iHeps.
- QIAquick Gel Extraction Kit QIAquick Gel Extraction Kit
- AATCTGTCATGCTGGTCTGCC-3 (SEQ ID NO: 31); BAX forward 5 -
- GACCTCAACGCACAGTACGAG-3 (SEQ. ID NO: 34), reverse 5 : -
- AGGAGTCCC.ATGATGAGATTGT-3 (SEQ ID NO: 35); ALB forward 5’-
- GTCGCCTGTTCACCAAGGAT-3 (SEQ ID NO: 37); ASGR1 forward 5’-
- GAGACAGAGCTGGACAAG-3 (SEQ ID NO: 38), reverse 5’- CCCCTTCCCTTAAAATCCT-
- Radioimmunoprecipitation buffer 50mM sodium chloride, 50mM Tris buffer pH6.8, 1mM ethylenediaminetetraacetic acid, 1 % Triton X-100, 0.1% sodium deoxycholate
- protease and phosphatase inhibitors were extracted in Radioimmunoprecipitation buffer (50mM sodium chloride, 50mM Tris buffer pH6.8, 1mM ethylenediaminetetraacetic acid, 1 % Triton X-100, 0.1% sodium deoxycholate) supplemented with protease and phosphatase inhibitors and quantified using Bradford reagent (Bio-Rad).
- Huh? cells stably expressing the mutant minigene were treated with SSOs at 10nM, 50nM or 100nM by free uptake in calcium-enriched medium for 72 hours. MTT assay was then performed using the MTT Assay Kit (Abeam) as per manufacturer's instructions. In brief, cells were treated with MTT solution for 3 hours at 37°C, after which MTT solvent was added to the cells to release and dissolve the reduced formazan crystals. Signals were then measured using Tecan Spark 10M plate reader.
- Every sugar moiety in a SSO is linked via a phosphorothioate backbone. Every sugar moiety in a SSO is modified with 2’-O-methyl or 2 > -0-methoxyethyL with the exception of nucleotides substituted with locked nucleic acid as indicated in bold font.
- the SSO comprising the sequence of SEQ ID NO 12 has the same target sequence as the SSOs comprising the sequence of any one of SEQ ID NOs 13 to 27. in some embodiments, the SSOs comprise multiple chemical modifications.
- the sequences of SSOs with chemical modifications are shown in Table 2 below. Nucleotides with a 2’-O-Methyi RNA (2’OMe) are indicated with “m”. Nucleotides with a 2'-O- methoxyethyl (2 : MOE) RNA are indicated with 7MOEr/“. 2 : MOE-mcd!fied thymidine is used in place of 2’MOE-modified uridine.
- Nucleotides with a locked nucleic acid are indicated with LNA-medified thymidine is used in place of LNA-modified uridine.
- Nucleotides joined by a phosphorothioate (PS) bond to the following nucleotide are indicated with It would be generally known to the person skilled in the art that the number of phosphorothioate bonds is one less than the number of bases.
- 1: 2OM indicates that the SSO is modified with 2’-O-methyl RNA.
- “2M0E” indicates that the SSO is modified with 2’-O-methoxyethyl RNA.
- “2OML” indicates that the SSO includes 2'-O-methyl RNA and locked nucleic acid modifications.
- minigene system that harbours the specific genomic mutation, c.469-2922G>T of the SLC25A 13 gene, was constructed.
- the minigene includes the full sequence of exon 5, the first 2,000 bases and last 4,923 bases of intron 5, and full sequence of exon 6; the relative loci of the G>T substitution is demarcated in the figure.
- the wild type minigene there was proper splicing of exon 5 to exon 6, whereas upon introduction of the c.469-2922G>T mutation, the inclusion of the pseudoexon (Exon 5* or SLC25A13-PE5) when the mutant minigene was expressed in several human cell lines was confirmed (Figure 2).
- SSOs #2005, #2007 and #2008 were the top 3 performers whose IC50 ⁇ 0.1 nM and IC75 ⁇ 0.1 nM.
- Figure 7A reveals that the GalNAc-conjugated SSOs 2034.5 and 2034.15, but not NC2, can modulate splice-out of SLC25A13-PE5 from endogenous SLC25A13 transcripts, which subsequently rescues SLC25A13 transcript levels that would otherwise be degraded by nonsense- mediated decay in mutant iHeps ( Figure 78).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Obesity (AREA)
- Hematology (AREA)
- Diabetes (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Epidemiology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202380050249.0A CN119948160A (zh) | 2022-06-28 | 2023-06-28 | 寡核苷酸 |
| JP2024577361A JP2025522625A (ja) | 2022-06-28 | 2023-06-28 | オリゴヌクレオチド |
| US18/876,053 US20250368991A1 (en) | 2022-06-28 | 2023-06-28 | Oligonucleotides |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| SG10202250320V | 2022-06-28 | ||
| SG10202250320V | 2022-06-28 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2024005715A1 true WO2024005715A1 (en) | 2024-01-04 |
Family
ID=89384330
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/SG2023/050458 Ceased WO2024005715A1 (en) | 2022-06-28 | 2023-06-28 | Oligonucleotides |
Country Status (4)
| Country | Link |
|---|---|
| US (1) | US20250368991A1 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2025522625A (cg-RX-API-DMAC7.html) |
| CN (1) | CN119948160A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2024005715A1 (cg-RX-API-DMAC7.html) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021034985A1 (en) * | 2019-08-19 | 2021-02-25 | Stoke Therapeutics, Inc. | Compositions and methods for modulating splicing and protein expression |
| US20210268667A1 (en) * | 2017-10-23 | 2021-09-02 | Stoke Therapeutics, Inc. | Antisense oligomers for treatment of non-sense mediated rna decay based conditions and diseases |
-
2023
- 2023-06-28 US US18/876,053 patent/US20250368991A1/en active Pending
- 2023-06-28 JP JP2024577361A patent/JP2025522625A/ja active Pending
- 2023-06-28 WO PCT/SG2023/050458 patent/WO2024005715A1/en not_active Ceased
- 2023-06-28 CN CN202380050249.0A patent/CN119948160A/zh active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20210268667A1 (en) * | 2017-10-23 | 2021-09-02 | Stoke Therapeutics, Inc. | Antisense oligomers for treatment of non-sense mediated rna decay based conditions and diseases |
| WO2021034985A1 (en) * | 2019-08-19 | 2021-02-25 | Stoke Therapeutics, Inc. | Compositions and methods for modulating splicing and protein expression |
Non-Patent Citations (3)
| Title |
|---|
| SONG, Y. Z. ET AL.: "SLC25A13 Gene Analysis in Citrin Deficiency: Sixteen Novel Mutations in East Asian Patients, and the Mutation Distribution in a Large Pediatric Cohort in China", PLOS ONE, vol. 8, no. 9, 19 September 2013 (2013-09-19), pages e74544, XP055393513, [retrieved on 20231017], DOI: 1 0.1371/JOURNAL.PONE.0074544 * |
| TABATA, A. ET AL.: "Identification of 13 novel mutations including a retrotransposal insertion in SLC25A13 gene and frequency of 30 mutations found in patients with citrin deficiency", JOURNAL OF HUMAN GENETICS, vol. 53, no. 6, 5 April 2008 (2008-04-05), pages 534 - 545, XP019593558, [retrieved on 20231017], DOI: 10.1007/S10038-008-0282-2 * |
| ZHENG QI-QI, ZHANG ZHAN-HUI, ZENG HAN-SHI, LIN WEI-XIA, YANG HENG-WEN, YIN ZHI-NAN, SONG YUAN-ZONG: "Identification of a Large SLC25A13 Deletion via Sophisticated Molecular Analyses Using Peripheral Blood Lymphocytes in an Infant with Neonatal Intrahepatic Cholestasis Caused by Citrin Deficiency (NICCD): A Clinical and Molecular Study", BIOMED RESEARCH INTERNATIONAL, HINDAWI PUBLISHING CORPORATION, vol. 2016, 1 January 2016 (2016-01-01), pages 1 - 7, XP093125794, ISSN: 2314-6133, DOI: 10.1155/2016/4124263 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN119948160A (zh) | 2025-05-06 |
| JP2025522625A (ja) | 2025-07-15 |
| US20250368991A1 (en) | 2025-12-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11761000B2 (en) | Compositions and their uses directed to huntingtin | |
| JP7059242B2 (ja) | 筋強直性ジストロフィープロテインキナーゼ(dmpk)の発現を調節するための化合物及び方法 | |
| JP2022062143A (ja) | 腎臓病の処置のための組成物と方法 | |
| US20180312839A1 (en) | Methods and compositions for increasing smn expression | |
| JP2011510678A (ja) | Dna反復不安定性関連遺伝性障害を治療するための方法及び手段 | |
| JP2022031642A (ja) | アンチセンスオリゴヌクレオチド | |
| US20250368991A1 (en) | Oligonucleotides | |
| WO2025151083A1 (en) | Oligonucleotides | |
| US20050181400A1 (en) | Modulation of eIF4E-BP1 expression | |
| KR20260026019A (ko) | 신장 질환의 치료를 위한 조성물 및 방법 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23832019 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2024577361 Country of ref document: JP Ref document number: 202380050249.0 Country of ref document: CN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11202408708X Country of ref document: SG |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWP | Wipo information: published in national office |
Ref document number: 202380050249.0 Country of ref document: CN |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 23832019 Country of ref document: EP Kind code of ref document: A1 |
|
| WWG | Wipo information: grant in national office |
Ref document number: 11202408708X Country of ref document: SG |