WO2024002335A1

WO2024002335A1 - A live bacteria strain of pseudomonas sp.

Info

Publication number: WO2024002335A1
Application number: PCT/CN2023/104598
Authority: WO
Inventors: Qiubin LIN; Mengya ZHANG; Shaoqi SUN; Ming-Chun Lee
Original assignee: Shanghai Yuguan Biotech Co., Ltd.
Priority date: 2022-06-30
Filing date: 2023-06-30
Publication date: 2024-01-04
Also published as: CN117940554A

Abstract

Provided is a live bacteria strain of a species from Pseudomonas sp. such as Pseudomonas aeruginosa and uses thereof. More particularly, provided is a live bacteria strain of P.aeruginosa with reduced OprF activity, to a vaccine against P. aeruginosa infection comprising said live bacteria strain, and to a method for preventing and/or treating P.aeruginosa infection in a subject by administering said live bacteria strain.

Description

A LIVE BACTERIA STRAIN OF PSEUDOMONAS SP.

Technical Field

The invention relates to the field of biomedicine. In particular, the invention relates to a live bacteria strain of a species from Pseudomonas sp. such as Pseudomonas aeruginosa and uses thereof. More particularly, the invention relates to a live bacteria strain of P. aeruginosa with reduced OprF activity, to a vaccine against P. aeruginosa infection comprising said live bacteria strain, and to a method for preventing and/or treating P. aeruginosa infection in a subject by administering said live bacteria strain.

Background

Pseudomonas aeruginosa is a ubiquitous Gram-negative bacterium capable of surviving in a broad range of natural environments. It is also an opportunistic human pathogen associated with hospital-acquired infections such as sepsis, gut and pulmonary infections of immunocompromised patients and a leading cause of morbidity and mortality among individuals suffering from cystic fibrosis. Treatment of P. aeruginosa infections has become a great challenge due to the ability of this bacterium to resist many of the currently available antibiotics. Strains of P. aeruginosa are known to utilize their high levels of intrinsic and acquired resistance mechanisms to counter most antibiotics. In addition, adaptive antibiotic resistance of P. aeruginosa is a recently characterized mechanism, which includes biofilm-mediated resistance and formation of multidrug-tolerant persister cells and is responsible for recalcitrance and relapse of infections1. The adaptability of this opportunistic pathogen has hampered the development of antimicrobial therapies, and consequently, it remains a major threat to public health.

P. aeruginosa was originally classified as an extracellular pathogen. However, numerous reports have emphasized that it can enter host cells, resulting in a phase of intracellular residence, which can be of importance in addition to the classical extracellular infection. More recently, P. aeruginosa has been shown localized within cultured macrophages. The intramacrophage fate of the bacteria has revealed vacuolar escape of P. aeruginosa and macrophage death driven by intracellular bacteria, most likely linked to cytosolic location of bacteria². Bacterial factors involved in this intramacrophage step were also investigated. Among them, OprF have been uncovered as one of the critical factors involved in the intramacrophage survival of P. aeruginosa³.

OprF is a major outer membrane porin involved in maintenance of cell structure, outer membrane permeability, environmental sensing, adhesion, biofilm formation and virulence. It allows a non-specific diffusion of ionic species and small polar nutrients, including polysaccharides up to 1.5 kDa in size⁴. OprF anchors the OM to the peptidoglycan layer and is involved in host-pathogen interactions. The absence of OprF leads to increased biofilm formation and production of the Pel exopolysaccharide and was shown to be required for expression of full virulence^5, 6. In addition, a recent study showed that OprF modulates the transcription of type III secretion system (T3SS) genes. T3SS and its ExoS effector play a main role in the intramacrophage life of P. aeruginosa, allowing internalized bacteria to escape phagosomes and promote macrophages lysis. Consistent with the effect of OprF on T3SS genes transcription, OprF modulated the production of the T3SS PcrV cap protein and the secretion of ExoT and ExoS toxins³. Moreover, OprF also modulates the production of the quorum-sensing-dependent virulence factors pyocyanin, elastase, lectin PA-1L, and exotoxin A⁵, suggesting that OprF acts as a sensor of the host immune system and plays a role in host immune escape in P. aeruginosa infection.

Due to its antimicrobial resistance, vaccines represent an alternative strategy to tackle the pathogen, yet despite over 50 years of research on anti-Pseudomonas vaccines, no vaccine has been licensed⁷. Additional approaches are still needed to generate an effective vaccine.

Summary of the invention

With the fast development of genome modification techniques, utilizing synthetic bacterial vectors in vaccines has become one of the promising strategies. The goal of this study is to construct a bacterial vaccine vector that can be modulated with effective antigen display and elicit immunogenicity in various P. aeruginosa infection models. By targeting on the immune escape in P. aeruginosa, a low virulence was engineered by knocking out oprF gene in P. aeruginosa. By doing so, the new attenuated strain further demonstrates high immunogenicity in mouse models.

In this regard, the present provides at least the following embodiments:

Embodiment 1. A live bacteria strain of a species from Pseudomonas sp., wherein the live bacteria strain lacks OprF activity or has reduced OprF activity, and/or wherein the expression of oprF gene in the live bacteria strain is reduced, and/or wherein the live bacteria strain of the invention contains a mutation of the oprF gene, for example, as compared to a corresponding control strain.

Embodiment 2. The live bacteria strain of Embodiment 1, wherein the species from Pseudomonas sp. is Pseudomonas aeruginosa.

Embodiment 3. The live bacteria strain of Embodiment 1 or 2, wherein the OprF activity in the live bacteria strain is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%or more, as compared to a corresponding control strain, preferably, the live bacteria strain lacks OprF activity.

Embodiment 4. The live bacteria strain of any one of Embodiments 1-3, wherein the expression of oprF gene in the live bacteria strain is reduced, for example, by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%or more, as compared to a corresponding control strain, preferably, the live bacteria strain lacks oprF gene expression.

Embodiment 5. The live bacteria strain of any one of Embodiments 1-4, wherein the oprF gene encodes for an OprF protein which has an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%sequence identity with SEQ ID NO: 1 or an amino acid sequence of SEQ ID NO: 1.

Embodiment 6. The live bacteria strain of any one of Embodiments 1-5, wherein the live bacteria strain contains a mutation of the oprF gene which results in reduced or lack of OprF activity.

Embodiment 7. The live bacteria strain of Embodiment 6, wherein the mutation of the oprF gene results in reduced expression of the OprF protein or expression of mutated OprF protein with reduced activity, preferably, the mutation of the oprF gene results in no expression of OprF protein or expression of mutated OprF protein with no activity.

Embodiment 8. The live bacteria strain of Embodiment 6 or 7, wherein the mutation comprises a deletion of the oprF gene, e.g., a complete deletion or a partial deletion of the oprF gene.

Embodiment 9. The live bacteria strain of any one of Embodiments 6-8, the mutation is achieved by homologous recombination or by targeted mutagenesis, such as via CRISPR, TALEN or ZFN technologies.

Embodiment 10. The live bacteria strain of any one of Embodiments 1-9, wherein the live bacteria strain has reduced virulence, for example, the virulence of the live bacteria strain is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%or more, as compared to a corresponding control strain.

Embodiment 11. The live bacteria strain of any one of Embodiments 1-10, wherein the live bacteria strain has an increased immunogenicity, for example, the immunogenicity of the live bacteria strain is increased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%or more, as compared to a corresponding control strain.

Embodiment 12. The live bacteria strain of any one of Embodiments 1-11, wherein the live bacteria strain is derived from a parent strain which is a clinical isolate.

Embodiment 13. The live bacteria strain of any one of Embodiments 1-11, wherein the live bacteria strain is derived from a parent strain which already has low virulence.

Embodiment 14. The live bacteria strain of any one of Embodiments 1-11, wherein the live bacteria strain is derived from Pseudomonas aeruginosa strain PAO1, or PA14.

Embodiment 15. The live bacteria strain of any one of Embodiments 1-14, which is for use as a live expression vector for expression of a desired protein.

Embodiment 16. The live bacteria strain of any one of Embodiments 1-15, which further comprises a coding sequence of a desired protein, and thereby is capable of expressing the desired protein.

Embodiment 17. The live bacteria strain of Embodiment 16, wherein the coding sequence of the desired protein is introduced into the live bacteria strain, for example, through a nucleic acid expression construct.

Embodiment 18. The live bacteria strain of Embodiment 17, wherein the introduced coding sequence of the desired protein is integrated into the genome of the live bacteria strain.

Embodiment 19. The live bacteria strain of any one of Embodiments 16-18, wherein the desired protein is expressed and displayed on the surface of the cell of the live bacteria strain; or is expressed and secreted out of the cell of the live bacteria strain.

Embodiment 20. The live bacteria strain of any one of Embodiments 16-19, wherein the desired protein is selected from an antibody, or an antigen, preferably, the desired protein is an antigen,

for example, the antigen is selected from pcrV, oprI, or oprJNM from Pseudomonas aeruginosa; adsA, EsxA, EsxB, PmtA, or PmtC from S. aureus; or PspA from S. pneumoniae.

Embodiment 21. Use of the live bacteria strain of any one of Embodiments 1-20 in preparation of a composition, such as a vaccine, for preventing or treating bacterial infection.

Embodiment 22. The use of Embodiment 21, wherein the bacterial infection is an infection caused by a species from Pseudomonas sp., such as Pseudomonas aeruginosa.

Embodiment 23. A composition, such as a vaccine, for preventing or treating bacterial infection, which comprises a live bacteria strain of any one of Embodiments 1-20.

Embodiment 24. The composition of Embodiment 23, wherein the composition further comprises an adjuvant and/or a pharmaceutically acceptable carrier.

Embodiment 25. The use of Embodiment 23 or 24, wherein the bacterial infection is an infection caused by a species from Pseudomonas sp., such as Pseudomonas aeruginosa.

Embodiment 26. A method for preventing and/or treating bacterial infection in a subject, which comprises administering an effective amount of the live bacteria strain of any one of Embodiments 1-20 or the composition of Embodiment 24 or 25 to the subject.

Embodiment 27. The method of Embodiment 26, wherein the bacterial infection is an infection caused by a species from Pseudomonas sp., such as Pseudomonas aeruginosa.

Embodiment 28. A method for generating a live bacteria strain having lowered virulence and/or increased immunogenicity of a species from Pseudomonas sp., which comprises reducing OprF activity in the live bacteria strain, and/or reducing the expression of oprF gene in the live bacteria strain, and/or introducing a mutation into the oprF gene of the live bacteria strain.

Embodiment 29. The method of Embodiment 28, wherein the method comprises reducing expression of oprF gene of the live bacteria strain.

Embodiment 30. The method of Embodiment 28 or 29, wherein the method comprises introducing a mutation into the oprF gene of the live bacteria strain.

Embodiment 31. The method of Embodiment 30, wherein the mutation comprises a complete or partial deletion of the oprF gene.

Embodiment 32. The method of Embodiment 30 or 31, wherein the mutation results in reduced or no expression of the OprF protein.

Embodiment 33. The method of Embodiment 30 or 31, wherein the mutation results in a mutated OprF protein with reduced or no activity.

Embodiment 34. The method of any one of Embodiments 28-33, wherein the species from Pseudomonas sp. is Pseudomonas aeruginosa.

Embodiment 35. The method of any one of Embodiments 29-33, wherein the oprF gene encodes an OprF protein which has an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%sequence identity with SEQ ID NO: 1, or has an amino acid sequence set forth in SEQ ID NO: 1.

Embodiment 36. The method of any one of Embodiments 28-35, wherein the mutation is achieved by homologous recombination, e.g., double homologous recombination, or by targeted mutagenesis, such as via CRISPR, TALEN or ZFN technologies.

Embodiment 37. The method of any one of Embodiments 28-36, wherein the method further comprising introducing a coding sequence of a desired protein into the live bacteria strain, thereby the live bacteria strain is capable of expressing the desired protein.

Embodiment 38. The method of Embodiment 37, wherein the coding sequence of the desired protein is introduced into the live bacteria strain through a nucleic acid expression construct.

Embodiment 39. The method of Embodiment 37 or 38, wherein the introduced coding sequence of the desired protein is integrated into the genome of the live bacteria strain.

Embodiment 40. The method of any one of Embodiments 37-39, wherein the desired protein is selected from an antibody, and an antigen, preferably, an antigen,

Description of the drawings

Figure 1. Knockout of oprF gene in P. aeruginosa.

Figure 2. ΔoprF strain showed an elongated lag phase and lower growth rate as compared to its isogenic wt strain.

Figure 3. ΔoprF strain showed lower virulence. BALB/c mice administered with ΔoprF strain (2×10⁷ CFU) showed 100%survival, whereas mice injected with the same dosage of wt strain all died by day 2.

Figure 4. PAO1 ΔoprF strain showed significantly increased antibody titres on Day 14 compared to control group.

Figure 5. Survival study showed improved protection by ΔoprF strain compared with wt strain.

Figure 6. Bacterial loads from different tissues.

Detailed Description

Before the aspects of the present invention are described, it must be noted that as used herein and in the appended claims, the singular forms "a" , "an" , and "the" include plural reference unless the context clearly dictates otherwise. The term “and/or” is intended to encompass any combinations of the items connected by this term, equivalent to listing all the combinations individually. For example, “A, B and/or C” encompasses “A” , “B” , “C” , “A and B” , “A and C” , “B and C” , and “A and B and C” . Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs.

In one aspect, the invention provides a live bacteria strain of a species from Pseudomonas sp., wherein the live bacteria strain lacks OprF activity or has reduced OprF activity, and/or wherein the expression of oprF gene in the live bacteria strain is reduced, and/or the live bacteria strain of the invention contains a mutation of the oprF gene, for example, as compared to a corresponding control strain.

In some embodiments, the species from Pseudomonas sp. is Pseudomonas aeruginosa.

In some embodiments, the OprF activity in the live bacteria strain of the invention is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%or more, as compared to a corresponding control strain.

In some preferred embodiments, the live bacteria strain lacks OprF activity, e.g., has no detectable OprF activity.

In some embodiments, the expression of oprF gene in the live bacteria strain is reduced. In some embodiments, the expression of oprF gene in the live bacteria strain is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%or more, as compared to a corresponding control strain.

In some preferred embodiments, the oprF gene does not express in the live bacteria strain of the invention.

As used herein, the “oprF gene” may refers to the coding sequence of the OprF protein in the genome of the bacteria. However, the oprF gene may also encompass expression regulatory elements/sequences, e.g., promoter, enhancer, and the like.

In some embodiments, an exemplary OprF protein has an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%sequence identity with SEQ ID NO: 1. In some embodiments, the OprF protein has an amino acid sequence set forth in SEQ ID NO: 1.

In some embodiments, an exemplary oprF gene has a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%sequence identity with SEQ ID NO: 2. In some embodiments, the oprF gene has an amino acid sequence set forth in SEQ ID NO: 2.

In some embodiments, the live bacteria strain of the invention contains a mutation of the oprF gene, for example, a mutation which results in reduced or lack of OprF activity. Such a mutation can be addition, substitution, or deletion of one or more nucleotides.

In some embodiments, the mutation of the oprF gene results in reduced expression of the OprF protein or expression of mutated OprF protein with reduced activity. In some embodiments, the mutation of the oprF gene results in no expression of OprF protein or expression of mutated OprF protein with no activity. In some embodiments, said mutation is a frame-shift mutation, which results in mistranslation of the oprF gene.

In some embodiments, the mutation comprises a deletion of the oprF gene, e.g., a complete deletion or a partial deletion of the oprF gene. The oprF gene may be completely deleted from the strain so that oprF gene are not present in the live strain of the invention. The oprF gene may also be partially deleted so that merely an oprF protein with reduced or no activity is present in the live strain of the invention.

The mutation of the oprF gene may be achieved by various means known in the art. In some embodiments, the mutation is introduced into the live bacteria strain by genetical engineering. In some embodiments, the mutation is not a naturally occurred mutation. For example, the mutation such as a deletion may be achieved by homologous recombination, e.g., double homologous recombination. In some embodiments, the mutation is carried out by targeted mutagenesis, such as via CRISPR, TALEN or ZFN technologies.

In some embodiments, the reduced or lack of activity of the OprF protein, the reduced or lack of expression of oprF gene, and/or the mutation of the oprF gene in the live bacteria strain of the invention results in a reduced virulence.

For example, the virulence of the live bacteria strain of the invention may be reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%or more, as compared to a corresponding control strain.

In some embodiments, the reduced or lack of activity of the OprF protein, the reduced or lack of expression of oprF gene, and/or the mutation of the oprF gene in the live bacteria strain of the invention results in an increased immunogenicity. Immunogenicity may refer to the ability of eliciting immune response (e.g., antibody-mediated immune response) in a host.

For example, the immunogenicity of the live bacteria strain of the invention may be increased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%or more, as compared to a corresponding control strain.

In some embodiment, the “control strain” may be a parent strain from which the live bacteria strain of the invention is derived. In some embodiment, the “control strain” may refers to a strain of the same species whose oprF gene or OprF activity has not been altered. In some embodiment, the “control strain” may also refers to a strain of the same species which does not contain the mutation of the oprF gene as mentioned above.

The live bacteria strain of the invention may be derived from a parent strain which is a wildtype strain of the same species. In some embodiments, a wildtype strain may be a strain that has not been genetically engineered. In some embodiments, a wildtype strain may be a strain whose oprF gene or OprF activity has not be genetically engineered. In some embodiments, a wildtype strain may be a clinical isolate.

The live bacteria strain of the invention may be derived from a parent strain which already has low virulence. For example, the parent strain is an attenuated strain. The parent strain may contain other mutation (s) (not within the oprF gene) that may result in attenuation.

Exemplary Pseudomonas aeruginosa strains which can serve as the parent strain of live bacteria strain of the invention the include but are not limited to PAO1, PA14, and the like.

In some embodiments, the live bacteria strain of the invention is also for use as a live expression vector for expression of a desired protein. The desired protein may confer certain properties to the live bacteria strain of the invention.

In some embodiments, the live bacteria strain of the invention may comprise a coding sequence of a desired protein, and thereby be able to express the desired protein.

In some embodiments of various aspects, the desired protein may be an endogenous protein, i.e., a protein of the bacteria species that the live bacteria strain is derived from. In some embodiments, the desired protein may be an exogenous protein, i.e., a protein of a species different from the bacteria species that the live bacteria strain is derived from.

In some embodiments of various aspects, the coding sequence of the desired protein is introduced into the live bacteria strain of the invention, for example, through a nucleic acid expression construct. In some embodiments, the introduced coding sequence of the desired protein is integrated into the genome of the live bacteria strain of the invention.

As used herein, "expression construct " refers to a vector such as a recombinant vector that is suitable for expression of a nucleotide sequence of interest in a host cell. "Expression" refers to the production of a functional product. For example, expression of a nucleotide sequence may refer to the transcription of a nucleotide sequence and/or the translation of an RNA into a precursor or mature protein. The "expression construct" of the present invention may be a linear nucleic acid fragment, a circular plasmid, a viral vector or, in some embodiments, an RNA that is capable of translation (such as mRNA) .

In some embodiments of various aspects, the desired protein can be expressed and displayed on the surface of the cell of the live bacteria strain of the invention. In some embodiments, the desired protein can be expressed and secreted out of the cell of the live bacteria strain of the invention.

The desired protein includes but is not limited to an antibody, an antigen, and the like.

In some preferred embodiments of various aspects, the desired protein is an antigen protein. Expression or displaying an antigen protein may further increase the immunogenicity of the live bacteria strain of the invention.

In some embodiments of various aspects, the desired protein is an antigen protein of a species different from the bacteria species that the live bacteria strain is derived from. Expression or displaying an antigen protein of other species may confer immunogenicity of the live bacteria strain against said other species.

Exemplary antigen proteins include but are not limited to pcrV, oprI, or oprJNM from Pseudomonas aeruginosa; adsA, EsxA, EsxB, PmtA, or PmtC from S. aureus; or PspA from S. pneumoniae.

In some embodiments, the live bacteria strain of the invention is for use in preventing and/or treating bacterial infection. In some embodiments, the bacterial infection is an infection caused by a species from Pseudomonas sp., such as Pseudomonas aeruginosa. In some specific embodiments, the bacterial infection is an infection caused by Pseudomonas aeruginosa PAO1 strain.

As used herein, preventing and/or treating bacterial infection also encompasses preventing and/or treating diseases or clinical signs or symptoms caused by the bacterial infection.

In one aspect, the invention provides the use of the live bacteria strain of the invention in preparation of a composition for preventing or treating bacterial infection. In some embodiments, the composition is a vaccine.

In one aspect, the invention provides a composition for preventing or treating bacterial infection, which comprises a live bacteria strain of the invention. In some embodiments, the composition comprises an effective amount of the live bacteria strain of the invention. In some embodiments, the composition is a vaccine.

In one aspect, the invention provides a method for preventing and/or treating bacterial infection in a subject, which comprises administering an effective amount of the live bacteria strain of the invention or the composition of the invention to the subject.

In some embodiments of various aspects above, the bacterial infection is an infection by a species from Pseudomonas sp., such as Pseudomonas aeruginosa.

In some embodiments of various aspects above, the composition may further comprise an adjuvant. As used herein, "adjuvant" refers to additional components in a vaccine to enhance the immune response, or ancillary molecules added to the vaccine or generated by the body after the respective induction by such additional components, like but not restricted to interferons, interleukins or growth factors. “Adjuvants” as used herein, can include aluminum hydroxide and aluminum phosphate, saponins, water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion.

In some embodiments of various aspects above, the composition may further comprise a pharmaceutically acceptable carrier. As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. Non-limiting examples of pharmaceutically acceptable carriers include water, NaCl, physiological saline, lactated Ringer's, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavoring agents, salt solutions (such as Ringer's solution) , alcohol, oil, gelatin, carbohydrates such as lactose, amylose or starch, fatty acid esters, hydroxymethyl cellulose, polyvinylpyrrolidone and coloring agents.

In some embodiments of various aspects above, the composition is formulated in a form for intramuscular administration, intraperitoneal administration, subcutaneous administration, oral administration or intranasal administration. In one embodiment, the composition is not for intravenous administration. In some embodiments, the composition is in a lyophilized form, which can be reconstituted before use.

As used herein, "effective amount" refers to an amount of a substance, compound, material, or composition containing a compound (such as the modified live bacteria strain of the invention or the composition of the invention) which is at least sufficient to produce a preventive or therapeutic effect after administration to a subject. Therefore, it is an amount necessary to prevent, cure, improve, retard or partially retard the symptoms of a disease or disorder, such as bacterial infection.

The actual dosage of the live strain or composition of the present invention to be administered to a subject can be determined according to the following physical and physiological factors: weight, sex, severity of symptoms, type of diseases to be treated, previous or current therapeutic intervention, unknown etiological disease of the patient, administration time, administration route and the like. In any case, the amount of the live strains in the composition and the appropriate dose for an individual subject will be determined by the medical personnel responsible for administration.

In one aspect, the present invention provides a method for attenuating and/or increasing the immunogenicity of a live bacteria strain of a species from Pseudomonas sp., or a method for generating a live bacteria strain having lowered virulence and/or increased immunogenicity of a species from Pseudomonas sp., which comprises reducing OprF activity in the live bacteria strain, and/or reducing the expression of oprF gene in the live bacteria strain, and/or introducing a mutation into the oprF gene of the live bacteria strain.

In some embodiments, the method comprises reducing expression of oprF gene of the live bacteria strain.

In some embodiments, the method comprises introducing a mutation into the oprF gene of the live bacteria strain. Such a mutation can be addition, substitution, or deletion of one or more nucleotides.

In some embodiments, the mutation comprises a complete or partial deletion of the oprF gene. In some embodiments, the mutation results in reduced expression of the OprF protein. In some embodiments, the mutation results in no expression of OprF protein. In some embodiments, the mutation results in a mutated OprF protein with reduced activity. In some embodiments, the mutation results in a mutated OprF protein with no activity.

In some embodiments, the oprF gene encodes an OprF protein which has an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%sequence identity with SEQ ID NO: 1. In some embodiments, the OprF protein has an amino acid sequence set forth in SEQ ID NO: 1.

In some embodiments, the mutation such as a deletion may be achieved by homologous recombination, e.g., double homologous recombination. In some embodiments, the mutation is carried out by targeted mutagenesis, such as via CRISPR, TALEN or ZFN technologies.

In some embodiments, the method further comprising introducing a coding sequence of a desired protein into the live bacteria strain, thereby the live bacteria strain is able to express the desired protein. In some embodiments, the desired protein may be an endogenous protein or an exogenous protein.

In some embodiments, the coding sequence of the desired protein is introduced into the live bacteria strain through a nucleic acid expression construct. In some embodiments, the introduced coding sequence of the desired protein is integrated into the genome of the live bacteria strain.

In some preferred embodiments of various aspects, the desired protein is an antigen protein. In some embodiments of various aspects, the desired protein is an antigen protein of a species different from the bacteria species that the live bacteria strain is derived from.

Examples

A further understanding of the present invention may be obtained by reference to the specific examples set forth herein, which are only intended to illustrate the invention, and are not intended to limit the scope of the invention. It is apparent that various modifications and variations may be made to the present invention without departing from the spirit of the invention, and such modifications and variations are therefore also within the scope of the present invention.

Methods and materials

oprF knockout strain construction

The unmarked deletion of oprF in PAO1 was constructed using pCasPA/pACRISPR system developed previously8. Briefly, the single-guide RNA (sgRNA) was designed for a high-efficiency gRNA target sequence followed by the protospacer adjacent motif nucleotide sequence NGG (20nt: ATCTACCACTTCGGTACCCC) . Linearized pACRISPR plasmid was ligated with the annealed spacer oligos oprF-spacer-F (GTGGATCTACCACTTCGGTACCCC) and oprF-spacer-R (AAACGGGGTACCGAAGTGGTAGAT) to generated pACRISPR-sgRNA plasmid. 5’-and 3’-flanking regions of oprF were PCR amplified from chromosomal DNA of P. aeruginosa PAO1 strain with primers oprF-upstream-F (TGTCCATACCCATGGTCTAGAATGAAGAATTGATGCGGCGT) , oprF-upstream-R (CTTGGCTTCAGTTTCATCCGTTAAATCCCC) , oprF-downstream-F (CGGATGAAACTGAAGCCAAGTAATCGGCTGAGC) , and oprF-downstream-R (GGGAGTATGAAAAGTCTCGAGTTCATCCAGCGCCTGATGC) . Individual PCR products were then mixed to generate a deletion pattern of oprF (repair template) and sub-cloned into pACRISPR-sgRNA plasmid to generate plasmid pACRISPR-sgRNA-oprF. The plasmid pACRISPR-sgRNA-oprF was introduced into DH5a and screened on carbenicillin plate. The pCasPA plasmids were transferred into PAO1 electrocompetent cells (PAO1-pCasPA) and the expression of the Cas9 nuclease and the λ-Red system was induced by the addition of L-arabinose to a final concentration of 2 mg/mL. The pACRISPR-sgRNA-oprF plasmid assembled with the spacer and the repair template was further electroporated into the PAO1-pCasPA electrocompetent cells. The cells were recovered in LB for 1～2 hours at 37 ℃ and plated onto the LB agar plate containing 100 μg/mL tetracycline and 150 μg/mL carbenicillin. The defective mutant (PAO1 ΔoprF) was verified for correct deletion through PCR and sequencing with the primers chr-oprF-F (ATCTCACTTGAATAAGCCTCACCC) and chr-oprF-R (AACTGTTGACCCTGAAGGCAG) . The plasmids were cured by streaking the mutants on LB plates supplemented with 5% (w/v) sucrose.

Animal infection experiments

Each BALB/c mice (7-week old, male) was immunized intraperitoneally with single dose of 200μl lyophilizated bacterial suspension (2×10⁷ CFU) . The animals were monitored for weight loss daily for 14 days and serum were sampled on day 14 and day 35. Mice were challenged on day 35 intraperitoneally with 200μl lyophilized PAO1 wt strain (1x10⁷ CFU) and survival rate was monitored for 14 days. Serum samples were tested for antibody titrations by whole bacteria ELISA (coated PAO wt, 1×10⁷ CFU per well) .

Bacterial load was done in a separate experiment. C57BL/6N mice (female) were immunized intraperitoneally on D0 and D15, with 2×10⁷ CFU per mouse. Mice were challenged intraperitoneally with a sublethal dose on day 35 (control n=5, vaccinated n=5) by PAO1 wt at 2×10⁷ CFU per mouse. Tissues were collected at 24h post challenge and homogenized in sterile PBS. The bacterial load in each organ was determined by serial dilution and plating on LB agar plates.

Example 1. Construction and Characterization of ΔoprF P. aeruginosa strains

oprF gene were targeted for unmarked deletion and was successfully removed from PAO1 wt strain confirmed by PCR (Figure 1) . The growth curves in LB broths showed an elongated lag phase and lower growth rate in ΔoprF strain compared to its isogenic wt strain. (Figure 2) .

Example 2. Characterization of ΔoprF P. aeruginosa strains

1. ΔoprF strains showed lower virulence

In BALB/c mouse model, the weight of animals immunized with ΔoprF strains showed slight decrease but quickly stabilize after Day 2. The mice immunized with ΔoprF strains (2×10⁷ CFU) showed 100%survival whereas mice injected with the same dosage of wt strain all died by day 2, indicating lower virulence of ΔoprF strains (Figure 3) .

2. ΔoprF strains exhibited higher immunogenicity

To measure the antibody-mediated immune responses, BALB/c mice were immunized with ΔoprF strains and antibody titres were determined by enzyme-linked immunosorbent assay (ELISA) . PAO1 ΔoprF strain showed significantly increased antibody titres on Day 14 compared to control group (Figure 4) .

3. ΔoprF strains exhibited higher protection

Survival study also showed protection against PAO1 wt. All mice immunized with ΔoprF strains and subsequently challenged with PAO1 wt survived, whereas only 10%of control group survived (Figure 5) . In addition, bacterial loads from different tissues were significant lower in PAO1 ΔoprF vaccinated mice (Figure 6) , indicating protection from the vaccine.

References

1. Pang, Z., Raudonis, R., Glick, B.R., Lin, T. -J. & Cheng, Z. Antibiotic resistance in Pseudomonas aeruginosa: mechanisms and alternative therapeutic strategies. Biotechnol Adv 37, 177–192 (2018) .

2. Moussouni, M., Berry, L., Sipka, T., Nguyen-Chi, M. & Blanc-Potard, A. -B. Pseudomonas aeruginosa OprF plays a role in resistance to macrophage clearance during acute infection. Sci Rep-uk 11, 359 (2021) .

3. Garai, P., Berry, L., Moussouni, M., Bleves, S. & Blanc-Potard, A. -B. Killing from the inside: Intracellular role of T3SS in the fate of Pseudomonas aeruginosa within macrophages revealed by mgtC and oprF mutants. Plos Pathog 15, e1007812 (2019) .

4. Chevalier, S. et al. Structure, function and regulation of Pseudomonas aeruginosa porins. Fems Microbiol Rev 41, 698–722 (2017) .

5. Fito-Boncompte, L. et al. Full virulence of Pseudomonas aeruginosa requires OprF. Infect Immun 79, 1176–86 (2010) .

6. Bouffartigues, E. et al. The absence of the Pseudomonas aeruginosa OprF protein leads to increased biofilm formation through variation in c-di-GMP level. Front Microbiol 6, 630 (2015) .

7. Sainz-Mejías, M., Jurado-Martín, I. & McClean, S. Understanding Pseudomonas aeruginosa–Host Interactions: The Ongoing Quest for an Efficacious Vaccine. Cells 9, 2617 (2020) .

8. Chen, W. et al. CRISPR/Cas9-based Genome Editing in Pseudomonas aeruginosa and Cytidine Deaminase-Mediated Base Editing in Pseudomonas Species. Iscience 6, 222–231 (2018) .

The foregoing description of the specific embodiments will so fully reveal the general nature of the disclosure that others can, by applying knowledge within the skill of the relevant art (s) (including the contents of the documents cited and incorporated by reference herein) , readily modify and/or adapt for various applications such specific embodiments, without undue experimentation, without departing from the general concept of the present disclosure. Such adaptations and modifications are therefore intended to be within the meaning and range of equivalents of the disclosed embodiments, based on the teaching and guidance presented herein. It is to be understood that the phraseology or terminology herein is for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance presented herein, in combination with the knowledge of one skilled in the relevant art (s) .

While various embodiments of the present disclosure have been described above, it should be understood that they have been presented by way of examples, and not limitation. It would be apparent to one skilled in the relevant art (s) that various changes in form and detail could be made therein without departing from the spirit and scope of the disclosure. Thus, the present disclosure should not be limited by any of the above-described exemplary embodiments but should be defined only in accordance with the following claims and their equivalents.

All references cited herein are incorporated herein by reference in their entirety and for all purposes to the same extent as if each individual publication or patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes.

Claims

A live bacteria strain of a species from Pseudomonas sp., wherein the live bacteria strain lacks OprF activity or has reduced OprF activity, and/or wherein the expression of oprF gene in the live bacteria strain is reduced, and/or wherein the live bacteria strain of the invention contains a mutation of the oprF gene, for example, as compared to a corresponding control strain.
The live bacteria strain of claim 1, wherein the species from Pseudomonas sp. is Pseudomonas aeruginosa.
The live bacteria strain of claim 1 or 2, wherein the OprF activity in the live bacteria strain is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%or more, as compared to a corresponding control strain, preferably, the live bacteria strain lacks OprF activity.
The live bacteria strain of any one of claims 1-3, wherein the expression of oprF gene in the live bacteria strain is reduced, for example, by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%or more, as compared to a corresponding control strain, preferably, the live bacteria strain lacks oprF gene expression.
The live bacteria strain of any one of claims 1-4, wherein the oprF gene encodes for an OprF protein which has an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%sequence identity with SEQ ID NO: 1 or an amino acid sequence of SEQ ID NO: 1.
The live bacteria strain of any one of claims 1-5, wherein the live bacteria strain contains a mutation of the oprF gene which results in reduced or lack of OprF activity.
The live bacteria strain of claim 6, wherein the mutation of the oprF gene results in reduced expression of the OprF protein or expression of mutated OprF protein with reduced activity, preferably, the mutation of the oprF gene results in no expression of OprF protein or expression of mutated OprF protein with no activity.
The live bacteria strain of claim 6 or 7, wherein the mutation comprises a deletion of the oprF gene, e.g., a complete deletion or a partial deletion of the oprF gene.
The live bacteria strain of any one of claims 6-8, the mutation is achieved by homologous recombination or by targeted mutagenesis, such as via CRISPR, TALEN or ZFN technologies.
The live bacteria strain of any one of claims 1-9, wherein the live bacteria strain has reduced virulence, for example, the virulence of the live bacteria strain is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%or more, as compared to a corresponding control strain.
The live bacteria strain of any one of claims 1-10, wherein the live bacteria strain has an increased immunogenicity, for example, the immunogenicity of the live bacteria strain is increased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%or more, as compared to a corresponding control strain.
The live bacteria strain of any one of claims 1-11, wherein the live bacteria strain is derived from a parent strain which is a clinical isolate.
The live bacteria strain of any one of claims 1-11, wherein the live bacteria strain is derived from derived from a parent strain which already has low virulence.
The live bacteria strain of any one of claims 1-11, wherein the live bacteria strain is derived from Pseudomonas aeruginosa strain PAO1, or PA14.
The live bacteria strain of any one of claims 1-14, which is for use as a live expression vector for expression of a desired protein.
The live bacteria strain of any one of claims 1-15, which further comprises a coding sequence of a desired protein, and thereby is capable of expressing the desired protein.
The live bacteria strain of claim 16, wherein the coding sequence of the desired protein is introduced into the live bacteria strain, for example, through a nucleic acid expression construct.
The live bacteria strain of claim 17, wherein the introduced coding sequence of the desired protein is integrated into the genome of the live bacteria strain.
The live bacteria strain of any one of claims 16-18, wherein the desired protein is expressed and displayed on the surface of the cell of the live bacteria strain; or is expressed and secreted out of the cell of the live bacteria strain.
The live bacteria strain of any one of claims 16-19, wherein the desired protein is selected from an antibody, or an antigen, preferably, the desired protein is an antigen,

for example, the antigen is selected from pcrV, oprI, or oprJNM from Pseudomonas aeruginosa; adsA, EsxA, EsxB, PmtA, or PmtC from S. aureus; or PspA from S. pneumoniae.
Use of the live bacteria strain of any one of claims 1-20 in preparation of a composition, such as a vaccine, for preventing or treating bacterial infection.
The use of claim 21, wherein the bacterial infection is an infection caused by a species from Pseudomonas sp., such as Pseudomonas aeruginosa.
A composition, such as a vaccine, for preventing or treating bacterial infection, which comprises a live bacteria strain of any one of claims 1-20.
The composition of claim 23, wherein the composition further comprises an adjuvant and/or a pharmaceutically acceptable carrier.
The use of claim 23 or 24, wherein the bacterial infection is an infection caused by a species from Pseudomonas sp., such as Pseudomonas aeruginosa.
A method for preventing and/or treating bacterial infection in a subject, which comprises administering an effective amount of the live bacteria strain of any one of claims 1-20 or the composition of claim 24 or 25 to the subject.
The method of claim 26, wherein the bacterial infection is an infection caused by a species from Pseudomonas sp., such as Pseudomonas aeruginosa.
A method for generating a live bacteria strain having lowered virulence and/or increased immunogenicity of a species from Pseudomonas sp., which comprises reducing OprF activity in the live bacteria strain, and/or reducing the expression of oprF gene in the live bacteria strain, and/or introducing a mutation into the oprF gene of the live bacteria strain.
The method of claim 28, wherein the method comprises reducing expression of oprF gene of the live bacteria strain.
The method of claim 28 or 29, wherein the method comprises introducing a mutation into the oprF gene of the live bacteria strain.
The method of claim 30, wherein the mutation comprises a complete or partial deletion of the oprF gene.
The method of claim 30 or 31, wherein the mutation results in reduced or no expression of the OprF protein.
The method of claim 30 or 31, wherein the mutation results in a mutated OprF protein with reduced or no activity.
The method of any one of claims 28-33, wherein the species from Pseudomonas sp. is Pseudomonas aeruginosa.
The method of any one of claims 29-33, wherein the oprF gene encodes an OprF protein which has an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%sequence identity with SEQ ID NO: 1, or has an amino acid sequence set forth in SEQ ID NO: 1.
The method of any one of claims 28-35, wherein the mutation is achieved by homologous recombination, e.g., double homologous recombination, or by targeted mutagenesis, such as via CRISPR, TALEN or ZFN technologies.
The method of any one of claims 28-36, wherein the method further comprising introducing a coding sequence of a desired protein into the live bacteria strain, thereby the live bacteria strain is capable of expressing the desired protein.
The method of claim 37, wherein the coding sequence of the desired protein is introduced into the live bacteria strain through a nucleic acid expression construct.
The method of claim 37 or 38, wherein the introduced coding sequence of the desired protein is integrated into the genome of the live bacteria strain.
The method of any one of claims 37-39, wherein the desired protein is selected from an antibody, or an antigen, preferably, an antigen,

for example, the antigen is selected from pcrV, oprI, or oprJNM from Pseudomonas aeruginosa; adsA, EsxA, EsxB, PmtA, or PmtC from S. aureus; or PspA from S. pneumoniae.