WO2023272410A1 - ERα RECEPTOR COVALENT BINDING ANTAGONIST - Google Patents

Abstract

The present invention relates to an ERα receptor covalent binding antagonist. The antagonist has the structure as shown in the structural formula (I). A compound of the present invention or a pharmaceutically acceptable salt thereof has a use in the preparation of a medicament for treating estrogen receptor-related diseases.

Description

An ERα receptor covalent binding antagonist technical field

The invention relates to an ER alpha receptor covalent binding antagonist, optical isomers of the antagonist, pharmaceutically acceptable salts thereof, and medicines containing the antagonist, belonging to the field of medicine.

Background technique

Estrogen receptor (ER) is a steroid hormone receptor, a member of the nuclear receptor protein superfamily, which can be activated by estradiol. The estrogen receptor can change its configuration by binding to the ligand estradiol, the receptor monomer dimerizes, transfers to the nucleus, binds to the DNA response element, and initiates gene transcription and translation; after the receptor enters the nucleus, it can also It indirectly regulates gene transcription by binding to enhancer elements such as activator protein 1 (AP-1) or specific protein 1 (SP-1) in the promoter region of the target gene.

ER is structurally composed of five structural domains with different functions: N-terminal A/B domain, DNA binding region, hinge region, ligand binding region and C-terminal F domain. The A/B domain has transcriptional functions, including a functional domain called AF-1, which is important for ligand-independent activation and regulates the transcription of estrogen-responsive genes through phosphorylation. The DNA binding domain has a very high homology between ERα and ERβ, and binds to specific DNA to achieve the purpose of transcribing target genes. The hinge region connects the DNA-binding and ligand-binding domains. The ligand-binding domain determines the specific binding of estrogen receptors to ligands such as estrogen, changes the configuration of the helix, and regulates the activation or inactivation of transcription. The ligand-binding domain and the F domain contain a highly conserved region—12 helices and the AF-2 functional domain, which are critical to ligand-dependent transcriptional regulation and AF-1 cooperates to regulate and activate the transcriptional function of target genes. ER is mainly composed of two subtypes, ERα and ERβ. ERα and ERβ have high similarity at the amino acid level, with up to 97% homology in the DNA binding region, about 30% homology in the hinge region, and 55% homology in the ligand binding region sex.

Estrogen receptor alpha (ERα) is widely distributed in the body, with high levels in the uterus, ovary, pituitary gland, male reproductive organs, pituitary, kidney, bone, skeletal muscle, adipose tissue, prostate, gallbladder, skin and aorta mRNA expression.

Abnormal expression and function of estrogen and estrogen receptors in different tissues can lead to the occurrence and development of various diseases, such as cancer, cardiovascular disease, metabolic related diseases, osteoporosis and some diseases of the nervous system. Breast cancer is the most common cancer in women. In 2018, there were about 2.1 million new female breast cancer cases worldwide, accounting for about a quarter of female cancer cases. In 2018, breast cancer caused about 630,000 deaths. Breast cancer is clinically divided into: ER and PR positive, Her2 positive and triple negative breast cancer. More than 70% of breast cancers are ER-positive, and hormone or endocrine therapy is the first choice for adjuvant treatment of most ER-positive breast cancers. The invention includes a series of compounds, which can covalently bind to ERα, inhibit ERα from entering the nucleus and regulate transcriptional expression, so as to achieve the purpose of treating breast cancer.

Contents of the invention

The object of the present invention is to provide an optical isomer compound or a pharmaceutically acceptable salt of an ERα receptor covalently binding antagonist.

One aspect of the present invention provides an optical isomer compound or a pharmaceutically acceptable salt thereof of an ERα receptor covalently bound antagonist, the antagonist compound has a structure shown in the following formula (I):

Wherein: X ₁ , X ₂ or X ₃ are each independently selected from one or more of C and N; R ₁ , R ₂ or R ₃ are each independently selected from -H, -CH ₃ , -Cl or - F; R4 is selected from -O or -N; n= ₁ or 2.

Preferably, the antagonist compound has the structure shown in the following formula (II):

Wherein, R ₁ , R ₂ or R ₃ are each independently selected from -H, -CH ₃ , -Cl or -F; R ₄ is selected from -O or -N.

Preferably, the antagonist compound has the structure shown in the following formula (III):

Wherein, R ₁ or R ₃ are each independently selected from -H, -CH ₃ , -Cl or -F; R ₄ is selected from -O or -N.

Preferably, the optical isomer compound of the antagonist or a pharmaceutically acceptable salt thereof is characterized in that the compound has the structure shown in the following formula (IV):

Wherein, R ₁ , R ₂ or R ₃ are each independently selected from -CH ₃ , -H, -Cl or -F; R ₄ is selected from -O or -N.

Preferably, the antagonist includes a compound having the structure shown in the following formula:

One of.

Use of the compound of the present invention or a pharmaceutically acceptable salt thereof in the preparation of medicines for treating diseases related to estrogen receptors.

Compared with the existing antagonist compounds, the ERα receptor covalent binding antagonist of the present invention has better pharmaceutical effect.

Description of drawings

Figure 1 shows the plasmid construction of pCDH-ERα66.

specific implementation

The following non-limiting examples are illustrative only and do not limit the invention in any way. The deformations, changes and transformations made within the protection scope of the present invention are all within the protection scope of the present invention.

In some embodiments, one or more compounds of the present invention can be used in combination with each other, and optionally, the compounds of the present invention can be used in combination with any other active agent for the preparation of phosphatase inhibitors, if used If it is a group of compounds, these compounds can be administered to the subject simultaneously, separately or sequentially.

In certain embodiments, the compounds of the invention may be used in combination with one or more other anticancer agents. Anticancer agents that can be used in combination include but are not limited to specific embodiments,

The compounds of the present invention and their preparation methods and uses are illustrated below in conjunction with the examples. Synthetic method flow 1:

The compounds shown in the present invention can be prepared according to the routes described above. Each product obtained from the reaction in scheme 1 can be obtained by conventional separation techniques, such traditional techniques include but not limited to filtration, distillation, crystallization, chromatographic separation and the like. Starting materials can be synthesized in-house or purchased from commercial establishments such as, but not limited to, Adrich or Sigma. These starting materials can be characterized using conventional means, such as physical constants and spectral data. The compounds described in this invention may be obtained using synthetic methods as single isomers or as mixtures of isomers.

In Scheme 1, the intermediate II is obtained from raw material I under the action of a suitable catalyst, ligand and base. The intermediate is deprotected under acidic conditions to obtain the target compound III. III reacts with the corresponding intermediate under suitable basic conditions to obtain the target compound IV. Temperatures are in degrees Celsius unless otherwise indicated. Reagents were purchased from commercial suppliers such as Sinopharm Chemical Reagent Beijing Co., Ltd., Alfa Aesar, or Beijing Bailingwei Technology Co., Ltd., and these reagents were used directly without further purification unless otherwise stated.

Unless otherwise stated, the following reactions were performed at room temperature in anhydrous solvents, under positive pressure of nitrogen or argon, or using drying tubes; reaction vials were fitted with rubber septa to allow addition of substrates and reagents by syringe; glassware was oven-dried and / or heat dry.

Unless otherwise stated, the column chromatography in this article was purchased from Qingdao Ocean Chemical Factory 200-300 mesh silica gel. The thin-layer chromatographic plate in this article was purchased from the thin-layer chromatographic silica gel prefabricated plate produced by Yantai Chemical Industry Research Institute, product number HSGF254; the determination of MS used Thermo LCQ Fleet type (ESI) liquid chromatography-mass spectrometry; Use SGW-3 automatic polarimeter, Shanghai Shenguang Instrument Co., Ltd.

Nuclear magnetic data (1H NMR) were run at 400 MHz using Varian equipment. Solvents used in NMR data include CDCl ₃ , CD ₃ OD, D ₂ O, DMSO-d ₆ , etc., based on tetramethylsilane (0.00ppm) or residual solvent (CDCl ₃ : 7.26ppm; CD ₃ OD D ₂ O: 4.79 ppm; d ₆ -DMSO: 2.50 ppm). When indicating peak shape diversity, the following abbreviations represent different peak shapes: s (singlet), d (doublet), t (triplet), q (quartet), m (multiplet), br (broad ), dd (double doublet), dt (double triplet). If a coupling constant is given, it is in Hertz (Hz).

Puromycin used herein was purchased from Thermofisher Technologies, Inc. unless otherwise stated.

Unless otherwise stated, 3-chloro-6-iodopyridazine herein was purchased from Shanghai Yien Chemical Technology Co., Ltd., product number R037330.

Unless otherwise stated, 5-bromoindole used herein was purchased from Leyan Reagents, product number 1014837.

Unless otherwise stated, 2-fluoro-5-iodopyridine herein was purchased from Sigma-Aldrich, Cat. No. MFCD03095301.

Unless otherwise stated, 2,6-difluoro-4-chlorobenzaldehyde in this article was purchased from Shanghai Bid Pharmaceutical Technology Co., Ltd., product number BD95674.

Unless otherwise stated, 2,6-difluoro-4-bromoiodobenzene in this paper was purchased from Shanghai Bid Pharmaceutical Technology Co., Ltd., product number BD18678.

Unless otherwise stated, 2,2,6,6-tetramethyl-2H-3,5,6-trihydropyran-4-one in this article was purchased from Jiangsu Aikang Biomedical Research and Development Co., Ltd., CAS No.: 1197 -66-6

Unless otherwise stated, 2-chloro-5-iodopyrazine in this article was purchased from Shanghai Haohong Biomedical Technology Co., Ltd., CAS No. 1057216-55-3.

Unless otherwise stated, N-Boc ethanolamine in this article was purchased from Shanghai Bid Pharmaceutical Technology Co., Ltd., product number BD10099.

Unless otherwise stated, N-Boc ethylenediamine used herein was purchased from Beijing Lvyuan Bird Biotechnology Co., Ltd., CAS No. 57260-73-8.

Unless otherwise stated, the Dess-Martin oxidizing reagents used in this article were purchased from Shanghai Biide Pharmaceutical Technology Co., Ltd., product number BD35199.

Unless otherwise stated, the pCMV3 plasmids herein were purchased from Sino Biological.

Unless otherwise stated, DH5α-competent bacteria in this paper were purchased from Quanshijin, product number: #CD201.

Unless otherwise stated, the psPAX2 plasmid in this paper was purchased from Shanghai Ruibosi Biotechnology Co., Ltd.

Unless otherwise stated, the pMD2.G plasmid in this paper was purchased from Shanghai Ruibosi Biotechnology Co., Ltd.

Plasmid pCDH herein was purchased from Biowind Resource Technology Services unless otherwise stated.

Unless otherwise stated, the 0.22 μm filter in this article was purchased from Qingdao Tianze Biotechnology Co., Ltd., the product name is Millex-GV PVDF syringe filter, and the product number is SLGVX13N.

Unless otherwise stated, 6-well plates in this paper were purchased from Thermo Fisher Scientific Co., Ltd.

Unless otherwise stated, fetal bovine serum in this paper was purchased from Thermo Fisher Scientific Co., Ltd.

Unless otherwise stated, bovine insulin in this article was purchased from Zhongke Maichen Technology Co., Ltd.

Unless otherwise stated, EMEM herein was purchased from ATCC.

Unless otherwise stated, the CellTiter-Glu kit herein was purchased from Promega Biotechnology Co., Ltd.

Unless otherwise stated, HEK293T cells in this paper were purchased from the Chinese Academy of Sciences Stem Cell Bank, number: SCSP-502.

Unless otherwise stated, the Fugen HD transfection reagent herein was purchased from Promega Biotechnology Co., Ltd., the product number is E2311 (Promega, E2311).

Unless otherwise stated, the Renilla-luciferase internal reference plasmid herein was purchased from Promega Biotechnology Co., Ltd., the product number is E6921 (Promega, E6921).

Unless otherwise stated, the dual fluorescein reporter gene detection kit in this paper was purchased from Beyontian Biotechnology Co., Ltd., product number RG027.

Unless otherwise stated, the term "PrimeStar high-fidelity enzyme" herein was purchased from Bio-Tech Biotechnology Beijing Co., Ltd.

Acronyms:

Intermediate 1:

Reaction route:

step 1:

5-Bromoindazole (70g) was dissolved in acetonitrile (1.5L), acetic acid (150mL) and Selectflour (273g) were added, and the reaction was placed under a nitrogen atmosphere, and reacted at 80°C for 16 hours. The reaction solution was cooled to room temperature, diluted with water (2 L), and extracted three times with ethyl acetate (500 mL). The organic phases were combined and dried over anhydrous sodium sulfate. After removing the solvent, the crude product was purified by column chromatography to give the product (40 g).

Step 2:

The product (26.5g) obtained in step 1 was dissolved in dichloromethane (200mL), and after the reaction solution was cooled to 0 degrees Celsius, 3,4-2H-dihydropyran (31.1g) and p-toluenesulfonic acid ( 1.4g). After the reaction solution was slowly raised to room temperature, stirring was continued for 12 hours. The reaction solution was washed with saturated brine (300 mL), dried over anhydrous sodium sulfate, and the solvent was removed to obtain a crude product. After purification by column chromatography, Intermediate 1 (33.5 g) was obtained.

Intermediate 2:

Reaction route:

step 1:

2-Fluoro-5-iodopyridine (22.3g) was dissolved in anhydrous DMF and N-BOC ethanolamine (16.1g) was added. After cooling the reaction solution to 0°C, sodium hydride (6g, 60%) was added in batches. After the reaction solution was slowly warmed to room temperature, it was stirred overnight. After the reaction was completed, it was quenched with saturated aqueous ammonium chloride, and extracted 3 times with ethyl acetate. After the organic phases were combined, they were washed with water and saturated brine, then dried over anhydrous sodium sulfate, and the solvent was removed to obtain a crude product. The crude product was purified by column chromatography to obtain the product (24.5 g).

Step 2:

The product obtained in step 1 (24g) was dissolved in methanol (600ml), and Pd(dppf) _{Cl2.CH2Cl2 ( 5.27g} ), TEA (32.7g) were added. After fully replacing the air with carbon monoxide, the reaction solution was placed under a carbon monoxide atmosphere and reacted overnight at 60°C. After the reaction, the organic phase was removed to obtain a crude product, which was purified by column chromatography to obtain a product (19 g).

Step 3:

The product (19 g) obtained in step 2 was dissolved in tetrahydrofuran (400 ml), water (150 ml) and lithium hydroxide (7.44 g) were added, and the reaction solution was stirred overnight at room temperature. After the reaction, the pH value of the reaction solution was adjusted to 2 with 0.5N hydrochloric acid. The solid was filtered, washed with water and dried under vacuum overnight to give the product (15.9g).

Step 4:

The product (15.9g) obtained in step 3 was dissolved in dichloromethane (500ml), and after adding triethylamine (28.2g) and HOBt (11.3g), EDC.HCl (16g) was added in batches. After the reaction solution was stirred at room temperature for 10 minutes, N-methyl-N-methoxyamine hydrochloride (8.16 g) was added in portions. The reaction solution was stirred overnight at room temperature, and the crude product was obtained after removing the solvent. The crude product was purified by column chromatography (17.5g).

Step 5:

Under nitrogen protection, Intermediate 1 (2.1 g) was dissolved in anhydrous THF (22 ml). After the reaction solution was cooled to -78°C, n-butyllithium (3ml, 2.5M) was added dropwise. After the reaction solution was stirred at this temperature for 30 minutes, an anhydrous THF solution (10 ml) of the product (1.79 g) obtained in Step 4 was added dropwise. After the dropwise addition, the reaction solution was slowly raised to room temperature and continued to stir for 1 hour. After the reaction was completed, it was quenched with saturated ammonium chloride aqueous solution. The mixture was extracted three times with ethyl acetate, and the combined organic phases were washed with water and saturated brine. After drying over anhydrous sodium sulfate, the organic phase was removed to give a crude product. The crude product was purified by column chromatography to obtain pure Intermediate 2 (500mg).

Intermediate 3:

Trans-4-bromo-2-butenoic acid (50 g) was dissolved in dichloromethane (300 mL), and after the mixture was cooled to 0°C, oxalyl chloride (76.8 g) was added dropwise. After the reaction solution was slowly raised to room temperature, stirring was continued for 1 hour. After removing the solvent at low temperature, the residue was dissolved in dichloromethane (500 mL) and cooled to 0 degrees, and aqueous dimethylamine solution (100 mL), 40%w) was added dropwise thereto. The reaction solution was stirred at this temperature for 1 hour. The layers were separated, and the organic phase was washed three times with water (200 mL), washed with saturated brine (200 mL) and dried over anhydrous sodium sulfate. The product (35 g) was obtained after removal of the solvent.

Intermediate 4:

Intermediate 1 (40g) was dissolved in anhydrous tetrahydrofuran (400ml), and the system was fully replaced with nitrogen and then cooled to -78°C. Add n-butyl n-hexane solution (92ml, 1.6M) dropwise to the above system, keep the system at this temperature to continue stirring for 1 hour after dropwise addition, and then add triisopropyl borate (30.3g) dropwise. After the dropwise addition was completed, the reaction system was slowly raised to room temperature, and the stirring was continued for 1 hour. After TLC showed that the reaction was complete, the reaction solution was lowered to 0° C. and quenched with 10% ammonium chloride aqueous solution, and the resulting mixture was left to stand and then separated. The aqueous phase was extracted three times with ethyl acetate and the organic phases were combined. The organic phase was washed three times with 10% brine, and dried over anhydrous sodium sulfate. After removing the solvent, a small amount of isopropyl ether was added to the residue and stirred overnight. The solid was filtered, washed with a small amount of isopropyl ether, and dried in vacuo to afford Intermediate 4 (22 g).

Intermediate 5:

Experimental steps:

step 1:

5-Bromoindazole (100g) was dissolved in dichloromethane (800ml), 3,4-2H-dihydropyran (86g) and anhydrous p-toluenesulfonic acid (8.8g) were added, and the reaction solution was reacted at room temperature 16 hours. After the reaction was completed, it was washed three times with saturated aqueous sodium bicarbonate solution, and then washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and the solvent was removed, and the residue was purified by column chromatography to obtain the product (110 g).

Step 2:

Referring to the synthesis method of intermediate 4, the product (50 g) obtained in step 1 was used as a raw material to obtain intermediate 5 (30 g).

Intermediate 6:

resolve resolution:

Intermediate 4 (3g) was dissolved in 1,4-dioxane (30ml), and to the above solution was added ₂ -iodo-5-chloropyridine (3g), Pd(dppf)Cl2 (830mg), anhydrous Potassium carbonate (4g). After the system was sufficiently replaced with carbon monoxide, the mixture was heated to 65° C. and kept stirring overnight. After the reaction was completed, the mixture was cooled to room temperature, water and ethyl acetate were added to the reactant, the layers were separated and the organic phase was collected. The organic phase was washed with water and brine, dried over anhydrous sodium sulfate, and the crude product was obtained after removing the solvent. The crude product was purified by column chromatography to obtain product intermediate 6 (1 g).

Intermediate 7:

resolve resolution:

Referring to the synthesis method of intermediate 6, using intermediate 5 (3 g) and 2-iodo-5-chloropyridine (3 g) as raw materials, the product intermediate 7 (1.1 g) was obtained.

Intermediate 8:

resolve resolution:

Referring to the synthesis method of intermediate 6, using intermediate 4 (3 g) and 4-chloroiodobenzene (3 g) as raw materials, the product intermediate 8 (1.3 g) was obtained.

Intermediate 9:

resolve resolution:

Referring to the synthesis method of intermediate 6, using intermediate 5 (3 g) and 4-chloroiodobenzene (3 g) as raw materials, the product intermediate 9 (2.2 g) was obtained.

Intermediate 10:

resolve resolution:

step 1:

Intermediate 1 (5g) was dissolved in anhydrous tetrahydrofuran (50ml), and after the system was fully replaced with nitrogen, the reaction solution was cooled to -78°C, and n-butyl lithium in n-hexane solution (11.5ml, 1.6M) was added dropwise . After the dropwise addition was completed, the reaction solution was stirred at this temperature for 30 minutes. A solution of 2,6-difluoro-4-chlorobenzaldehyde (3 g) in anhydrous tetrahydrofuran (15 ml) was added dropwise to the above. The reaction solution was stirred at this temperature for 30 minutes, then the reaction temperature was slowly raised to 0°C, and the reaction was continued at this temperature for 1 hour. After the reaction was completed, the reaction solution was quenched with 10% ammonium chloride aqueous solution. After liquid separation, the aqueous phase was extracted twice with ethyl acetate, and the organic phases were combined. The organic phase was washed with water and brine, dried over anhydrous sodium sulfate, and the solvent was removed to obtain a crude product. The crude product was purified by column chromatography to obtain the product (2.3g).

Step 2:

The product (2.2 g) obtained in step 1 was dissolved in dichloromethane (25 ml), and Dess-Martin reagent (2.8 g) was added in batches to the above reaction solution, and the stirring was continued overnight. The reaction solution was diluted with dichloromethane and washed with saturated sodium bicarbonate, water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and the solvent was removed to obtain a crude product, which was purified by column chromatography to obtain pure intermediate 10 (1.2 g).

Intermediate 11:

resolve resolution:

Referring to the synthesis method of intermediate 6, using intermediate 5 (2.5 g) and 2,6-difluoro-4-bromoiodobenzene (3.5 g) as raw materials, the product (0.42 g) was obtained.

Intermediate 12:

resolve resolution:

Referring to the synthesis method of intermediate 6, using intermediate 4 (3 g) and 2-fluoro-5-iodopyridine (2.8 g) as raw materials, the product (1.8 g) was obtained.

Intermediate 13:

resolve resolution:

Referring to the synthesis method of intermediate 6, using intermediate 5 (3 g) and 2-fluoro-5-iodopyridine (3 g) as raw materials, the product (1.2 g) was obtained.

Intermediate 14:

resolve resolution:

Referring to the synthesis method of Intermediate 6, using Intermediate 4 (3 g) and 2-chloro-5-iodopyrazine (3 g) as raw materials, the product (0.6 g) was obtained.

Intermediate 15:

resolve resolution:

Referring to the synthesis method of intermediate 6, using intermediate 4 (3 g) and 3-chloro-6-iodopyridazine (3 g) as raw materials, the product (0.45 g) was obtained.

Intermediate 16:

resolve resolution:

Intermediate 6 (990 mg) was dissolved in anhydrous toluene (15 ml), N-Boc ethanolamine (0.88 g), Pd ₂ (dba) ₃ .CHCl ₃ (142 mg), t-BubrettPhos (0.27 g) and cesium carbonate ( 2.3 g), after fully replacing the reaction system with nitrogen, the mixture was heated to 100 degrees until the reaction was complete. After the mixture was cooled to room temperature, ethyl acetate and water were added, the layers were separated and the organic phase was collected. The organic phase was washed with water and saturated brine, and dried over anhydrous sodium sulfate. The crude product was obtained after removal of solvent, which was purified by column chromatography to give pure product (750mg).

Intermediate 17:

resolve resolution:

Referring to the synthesis method of Intermediate 16, using Intermediate 7 (1.1 g) as raw material, the product (800 mg) was obtained.

Intermediate 18:

resolve resolution:

Referring to the synthesis method of Intermediate 16, using Intermediate 8 (1.0 g) as raw material, the product (700 mg) was obtained.

Intermediate 19:

resolve resolution:

Referring to the synthesis method of Intermediate 16, using Intermediate 9 (2.1 g) as raw material, the product (1 g) was obtained.

Intermediate 20:

resolve resolution:

Referring to the synthesis method of intermediate 16, using intermediate 10 (1.2 g) as raw material, the product (0.6 g) was obtained.

Intermediate 21:

resolve resolution:

Referring to the synthesis method of Intermediate 16, using Intermediate 11 (380 mg) as raw material, the product (350 mg) was obtained.

Intermediate 22:

resolve resolution:

Intermediate 12 (1.8g) was dissolved in 1,4-dioxane (10ml), N-Boc ethylenediamine (1g) and DIEA (2g) were added, and the reaction solution was placed in an 80-degree oil bath to continue the reaction until the reaction is complete. After cooling the reaction solution to room temperature, ethyl acetate was added, and the obtained organic phase was washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and the solvent was removed to obtain a crude product, which was purified by column chromatography to obtain a pure product (1 g).

Intermediate 23:

resolve resolution:

Referring to the synthesis method of Intermediate 22, using Intermediate 13 (1.1 g) as raw material, the product (600 mg) was obtained.

Intermediate 24:

resolve resolution:

Referring to the operation method of step 1 in intermediate 2, using intermediate 14 (1.2 g) as raw material, the product intermediate 24 (500 mg) was obtained.

Intermediate 25:

resolve resolution:

Referring to the operation method of step 1 in intermediate 2, using intermediate 15 (430 mg) as raw material, the product intermediate 25 (135 mg) was obtained.

Intermediate 26:

resolve resolution:

Intermediate 6 (1.05g) was dissolved in anhydrous toluene (18ml) and N-Bocethylenediamine (0.5g), Pd2(dba) _3.CHCl3 (150mg), t _{- BubrettPhos} (281mg) and carbonic acid were added Cesium (2.88g), after fully replacing the reaction system with nitrogen, the mixture was heated to 110 degrees until the reaction was complete. After the mixture was cooled to room temperature, ethyl acetate and water were added, the layers were separated and the organic phase was collected. The organic phase was washed with water and saturated brine, and dried over anhydrous sodium sulfate. The crude product was obtained after solvent removal, and the crude product was purified by column chromatography to obtain pure intermediate 26 (310 mg).

Example 1:

step 1:

Under the condition of nitrogen protection, zinc powder (633 mg) was added to a solution (100 ml) of TiCl ₄ (918 mg) in anhydrous tetrahydrofuran pre-cooled to 0°C. After the reaction solution was raised to room temperature, the reaction was continued for 2 hours at a temperature of 65°C. After cooling to 0 degrees, intermediate 2 (500mg) and 2,2,6,6-tetramethyl-2H-3,5,6-trihydropyran-4-one (260mg) were added, and the reaction solution rose to After room temperature, the reaction was continued overnight at 65°C. After the reaction was complete, it was cooled to room temperature and quenched with aqueous sodium bicarbonate. The organic phase was extracted three times with ethyl acetate, washed with water and saturated aqueous sodium chloride solution, and dried over anhydrous sodium sulfate. The product (300 mg) was obtained after removal of the solvent.

Step 2:

The product obtained in step 1 (300 mg) was dissolved in dichloromethane (10 ml), trifluoroacetic acid (10 ml) was added at room temperature, and the reaction solution was stirred overnight at room temperature. After the reaction was completed, the solvent was removed to obtain a crude product. The crude product was purified by Prep-HPLC to obtain the product (120 mg).

Step 3:

The product (120mg) obtained in step 2 was dissolved in tetrahydrofuran (15ml), sodium carbonate (81mg) was added and after cooling to 0°C, a tetrahydrofuran solution (8ml) of intermediate 3 (41mg) was slowly added dropwise. After the reaction solution was slowly raised to room temperature, stirring was continued overnight. After the reaction is complete, filter. The filtrate was concentrated to obtain a crude product, which was purified by Prep-HPLC to obtain a pure product (11.6 mg). LC-MS (ES, m/z): [M+H] ⁺ = 536; 1H-NMR (400MHz, CD ₃ OD, ppm): δ8.07 (s, 1H), 7.59 (d, J = 2.4Hz ,1H),7.47(s,1H),7.39-7.38(d,J＝2.4Hz,1H),7.27-7.24(m,2H),6.88-6.83(m,2H),6.69-6.68(m,1H ),4.61-4.58(m,2H),3.92-3.91(m,2H),3.49-3.46(m,2H),3.30(s,3H),3.11(s,3H),2.29-2.03(m,4H ), 1.24-1.20(m,12H).

The following compounds can be synthesized according to the above method:

Biological Evaluation:

The present invention is further described below in conjunction with test examples, but these test examples are not meant to limit the scope of the present invention.

Test Example 1 Inhibitory effect of the compounds of the present invention on the proliferation of overexpressed estrogen receptor MCF-7 cells (MCF-7/ER66)

1. Purpose of the experiment

The purpose of this experiment is to use the ATP method to test the inhibitory effect of the compound of the present invention on the proliferation of MCF7/ER66 cells, and to evaluate the in vitro activity of the compound according to the size of GI ₅₀ .

2. Experimental steps

2.1 Construction of pCDH-ERα66 plasmid:

Choose EcoR 1 and BamH 1 sites, design primers:

F: CCGgaattcgccaccatgGATTACAAGGATGACGACGATAAGatgaccatgaccctcca

R: cgcggatcctcagaccgtggcagggaaac

Using the pCMV3-flag-ERα66 plasmid as a template (there is a flag sequence in the template plasmid vector, and there is also a flag sequence in the introduction primer, first amplify the complete CDS sequence of ERα66 without any tag, and then use this as a template for secondary PCR), PrimeStar high-fidelity enzyme was used for PCR amplification, double enzyme digestion and then ligated into pCDH vector, the ligated product was transformed into DH5α competent bacteria, the positive plasmid was sequenced after the clone was picked and identified by enzyme digestion, and the pCDH-ERα66 plasmid with completely correct sequence was obtained. See attached picture 1.

2.2 Construction of ERα66 overexpression cells

293T cells were cultured in 10 cm culture dish with 10% fetal bovine serum at 37°C, 95% air and 5% carbon dioxide. When the cells grow to 60% density, transfect 293T cells to package pCDH-ERα66 virus according to the following system: 15 μg pCDH-ERα66, 10 μg psPAX2, 5 μg pMD2.G. Change the medium after 6 hours, take the supernatant after 48 hours of cultivation, and take another supernatant after 72 hours, and filter it with a 0.45 μm filter (Millex-GV) to obtain pCDH-ERα66 lentivirus. The PEG-8000 concentration method concentrates 10ml of virus liquid into 250μl and distributes it. One day in advance, MCF-7 cells were seeded in six-well plates at 3×10 ⁵ cells/well. After the cells adhere to the wall, add 50 μl of virus to 1 ml of complete medium (determine the amount of virus according to the MOI value of different cells), infect MCF-7 cells in one well of a 6-well plate, and supplement 1 mL of complete medium after 24 hours to ensure that the cells In good condition, put into the cell culture incubator. After 48 hours, observe the fluorescence, 0.4 μg/mL puromycin (the drug concentration is based on the death of all uninfected virus control cells within 3 to 5 days) to screen stable cell lines for 5 to 7 days to obtain stable cell lines with ERα66 overexpression.

2.2 The inhibitory effect of compounds on the proliferation of MCF-7 cells overexpressing ERα66

Human breast cancer cells MCF- ⁷ were cultured in 25cm2 or ^75cm2 plastic tissue culture medium with EMEM medium containing 10% fetal bovine serum and 10μg/mL bovine insulin at 37°C, 95% air and 5% _CO2 conditions In the bottle, subculture 2-3 times a week.

Cells were seeded in a 96-well cell culture plate at a density of 3×10 ³ /well, 90 μL/well, and cultured at 37°C in 95% air and 5% CO ₂ . After 24 hours, add the compound to be tested: start from 10 mM (dissolved in DMSO) and carry out 10-fold gradient dilution with DMSO to prepare a gradient stock solution; prepare a complete medium containing 0.1% DMSO for further dilution, temporarily called "dilution Buffer", prepare the second phase solution by diluting each stock solution with 9 volumes of dilution buffer, that is, add 2 μL of 10 mM stock solution to 18 μL of dilution buffer; dilute each with 9 volumes of dilution buffer Secondary solution to prepare the working solution by adding 10 μL of the second-stage stock solution of 1 mM in 10% DMSO-medium to 90 μL of the dilution buffer, and finally adding 10 μL of the working solution to the culture plate seeded with cells. The final concentration of DMSO in the cell culture medium was 0.1%, and the final concentration of the tested compound was 1 pM-10 μM. The above cells were incubated at 37°C for 3 days. Aspirate the medium, replace it with 90 μL/well of fresh complete medium, and add the compound to be tested according to the compound dilution method described above. On day 6, CellTiter-Glu was added for cell viability assay.

3. Data Analysis

The cell viability was determined by CellTiter-Glu kit, and finally the half inhibitory concentration of the compound on cell proliferation was calculated by the Prism program, that is, the GI ₅₀ value.

Table 1 GI ₅₀ of the inhibitory effect of the compounds of the present invention on the proliferation of MCF7 cells

Example

GI50 (nm)

H3B-6545	0.5
1	0.4
2	13.98
3	18.23
4	9.36
5	1.05
6	0.1
7	0.3
8	0.2
9	0.2

Conclusion: the compound of the present invention has obvious inhibitory effect on the proliferation of MCF-7 cells with ERα66 overexpression.

Claims (6)

1. An optical isomer compound of an ERα receptor covalently bound antagonist or a pharmaceutically acceptable salt thereof, the antagonist compound has a structure shown in the following formula (I):

   

   Wherein: X ₁ , X ₂ or X ₃ are each independently selected from one or more of C and N; R ₁ , R ₂ or R ₃ are each independently selected from -H, -CH ₃ , -Cl or - F; R4 is selected from -O or -N; n= ₁ or 2.
2. The optical isomer compound of the antagonist according to claim 1 or a pharmaceutically acceptable salt thereof, wherein the antagonist compound has a structure shown in the following formula (II):

   

   Wherein, R ₁ , R ₂ or R ₃ are each independently selected from -H, -CH ₃ , -Cl or -F; R ₄ is selected from -O or -N.
3. The optical isomer compound of the antagonist according to claim 1 or a pharmaceutically acceptable salt thereof, wherein the antagonist compound has a structure shown in the following formula (III):

   

   Wherein, R ₁ or R ₃ are each independently selected from -H, -CH ₃ , -Cl or -F; R ₄ is selected from -O or -N.
4. The optical isomer compound of antagonist according to claim 1 or its pharmaceutically acceptable salt, is characterized in that, described antagonist compound has the structure shown in following formula (IV):

   

   Wherein, R ₁ , R ₂ or R ₃ are each independently selected from -CH ₃ , -H, -Cl or -F; R ₄ is selected from -O or -N.
5. The optical isomer compound of the antagonist described in claim 1 or a pharmaceutically acceptable salt thereof, the antagonist compound includes a compound having the structure shown in the following formula:

   

   

   One of.
6. Use of the compound according to any one of claims 1-5 or a pharmaceutically acceptable salt thereof in the preparation of a medicament for treating estrogen receptor-related diseases.

Images