CN117440950A - ER alpha receptor covalent binding antagonist - Google Patents

ER alpha receptor covalent binding antagonist Download PDF

Info

Publication number
CN117440950A
CN117440950A CN202180097433.1A CN202180097433A CN117440950A CN 117440950 A CN117440950 A CN 117440950A CN 202180097433 A CN202180097433 A CN 202180097433A CN 117440950 A CN117440950 A CN 117440950A
Authority
CN
China
Prior art keywords
compound
product
antagonist
reaction
added
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202180097433.1A
Other languages
Chinese (zh)
Inventor
张磊
王虎庭
王静
默董亮
金明吉
彭勇
孟坤
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Shengnuoji Pharmaceutical Technology Co Ltd
Original Assignee
Beijing Shengnuoji Pharmaceutical Technology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Shengnuoji Pharmaceutical Technology Co Ltd filed Critical Beijing Shengnuoji Pharmaceutical Technology Co Ltd
Publication of CN117440950A publication Critical patent/CN117440950A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/415—1,2-Diazoles
    • A61K31/416—1,2-Diazoles condensed with carbocyclic ring systems, e.g. indazole
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/4965—Non-condensed pyrazines
    • A61K31/497—Non-condensed pyrazines containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/50—Pyridazines; Hydrogenated pyridazines
    • A61K31/501—Pyridazines; Hydrogenated pyridazines not condensed and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • A61P5/24—Drugs for disorders of the endocrine system of the sex hormones
    • A61P5/32—Antioestrogens
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/02—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
    • C07D405/06—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/14—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing three or more hetero rings

Abstract

The invention relates to an ER alpha receptor covalent binding antagonist, which has a structure shown in a structural formula (I), and application of the compound or pharmaceutically acceptable salt thereof in preparing medicines for treating diseases related to estrogen receptors

Description

ER alpha receptor covalent binding antagonist Technical Field
The invention relates to an ER alpha receptor covalent binding antagonist, an optical isomer of the antagonist, a pharmaceutically acceptable salt thereof and a medicament containing the antagonist, belonging to the field of medicaments.
Background
The Estrogen Receptor (ER) is a steroid hormone receptor, which is one of the members of the nuclear receptor protein superfamily, and can be activated by estradiol. The estrogen receptor can change the configuration through combining with ligand estradiol, the receptor monomer dimerizes, transfers into the cell nucleus, combines with DNA response element, and starts gene transcription and translation; after entering the nucleus, the receptor can also indirectly regulate gene transcription by combining with enhancer elements such as activated protein 1 (AP-1) or specific protein 1 (SP-1) of a target gene promoter region.
ER consists structurally of 5 domains with different functions: an N-terminal A/B domain, a DNA binding region, a hinge region, a ligand binding region, and a C-terminal F domain. The A/B domain has transcriptional functions, which include a functional domain designated AF-1, important for ligand independent activation, and regulates the transcription of estrogen responsive genes by phosphorylation. The DNA binding domain has very high homology between ERalpha and ERbeta, and can be combined with specific DNA to achieve the goal of transcribing target gene. The hinge region connects the DNA binding domain and the ligand binding domain. The ligand binding domain determines the specific binding of estrogen receptor and ligand such as estrogen, changes the spiral configuration, and regulates the activation or inactivation of transcription. The ligand binding domain and F domain contain a highly conserved region- -12 helices and AF-2 domains, which are critical for ligand-dependent transcriptional regulation and AF-1 synergy to regulate and activate target gene transcription functions. ER is composed mainly of two subtypes ER alpha and ER beta. ERα and ERβ have high similarity at the amino acid level, up to 97% homology in the DNA binding domain, about 30% homology in the hinge domain and 55% homology in the ligand binding domain.
The estrogen receptor alpha (ERalpha) is widely distributed in vivo, and has high mRNA expression in uterus, ovary, pituitary gland, male reproductive organ, pituitary gland, kidney, bone, skeletal muscle, adipose tissue, prostate, gall bladder, skin, aorta and the like.
The expression and dysfunction of estrogen and estrogen receptors in different tissues can lead to the development of a variety of diseases such as cancer, cardiovascular disease, metabolic-related disease, osteoporosis, and some diseases of the nervous system. Breast cancer is the most common cancer in women, with about 210 ten thousand new cases of breast cancer in women worldwide in 2018, about one fourth of the cases of breast cancer in women, and breast cancer causes about 63 ten thousand deaths in 2018. Breast cancer is clinically divided into: ER and PR positive, her2 positive and triple negative breast cancers. Of these, more than 70% of breast cancers are ER positive, and hormonal or endocrine therapies are the first choice for adjuvant treatment of most ER positive breast cancers. The invention comprises a series of compounds which can be covalently bound with ER alpha to inhibit ER alpha from entering the nucleus to regulate transcriptional expression, thereby achieving the purpose of treating breast cancer.
Disclosure of Invention
The object of the present invention is to provide an optical isomer compound of an erα receptor covalent binding antagonist or a pharmaceutically acceptable salt thereof.
In one aspect, the present invention provides an optical isomer compound of an erα receptor covalent binding antagonist or a pharmaceutically acceptable salt thereof, the antagonist compound having a structure represented by the following formula (i):
wherein X is 1 、X 2 Or X 3 Each independently selected from one or more of C and N; r is R 1 、R 2 Or R is 3 Each independently selected from-H, -CH 3 -Cl or-F; r is R 4 Selected from-O or-N; n=1 or 2.
Preferably, the antagonist compound has a structure represented by the following formula (ii):
wherein R is 1 、R 2 Or R is 3 Each independently selected from-H, -CH 3 -Cl or-F; r is R 4 Selected from-O or-N.
Preferably, the antagonist compound has a structure represented by the following formula (iii):
wherein R is 1 Or R is 3 Each independently selected from-H, -CH 3 -Cl or-F; r is R 4 Selected from-O or-N.
Preferably, the optical isomer compound of the antagonist or a pharmaceutically acceptable salt thereof is characterized in that the compound has a structure shown in the following formula (IV):
wherein R is 1 、R 2 Or R is 3 Each independently selected from-CH 3 -H, -Cl or-F; r is R 4 Selected from-O or-N.
Preferably, the antagonist comprises a compound having the structure shown in the formula:
one of them.
The use of a compound of the invention or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for the treatment of a disorder associated with an estrogen receptor.
Compared with the prior antagonist compounds, the ER alpha receptor covalent binding antagonist has better pharmaceutical effect.
Drawings
FIG. 1 shows plasmid construction of pCDH-ERα 66.
Detailed Description
The following non-limiting examples are illustrative only and do not limit the invention in any way. The invention is also applicable to various other forms of modification, variation and adaptation.
In certain embodiments, one or more compounds of the invention may be used in combination with each other, or alternatively, the compounds of the invention may be used in combination with any other active agent for the preparation of a phosphatase inhibitor, and if a group of compounds are used, the compounds may be administered to a subject simultaneously, separately or sequentially.
In certain embodiments, the compounds of the present invention may be used in combination with one or more other anticancer agents. Anticancer agents that may be used in combination include but are not limited to the specific embodiments,
the compounds of the invention and their preparation and use are illustrated below by way of example in connection with the examples. The synthetic method comprises the following steps:
the compounds of the present invention may be prepared according to the routes described above. Each of the products obtained by the reaction in scheme 1 may be obtained by conventional separation techniques including, but not limited to, filtration, distillation, crystallization, chromatographic separation, and the like. The starting materials may be synthesized by themselves or purchased from commercial institutions (e.g., without limitation, adrich or Sigma). These materials can be characterized using conventional means such as physical constants and spectral data. The compounds described herein may be synthesized using synthetic methods to give individual isomers or mixtures of isomers.
In scheme 1, starting material I is reacted with a suitable catalyst, ligand and base to afford intermediate II. And removing the protecting group of the intermediate under acidic conditions to obtain the target compound III. III reacts with the corresponding intermediate under the proper alkaline condition to obtain the target compound IV. Unless otherwise indicated, temperatures are degrees celsius. Reagents were purchased from commercial suppliers of national pharmaceutical group chemicals Beijing Co., ltd, alfa Aesar (Alfa Aesar), or Beijing carboline technologies Co., ltd, and these reagents were used directly without further purification unless otherwise indicated.
Unless otherwise indicated, the following reactions were carried out at room temperature, in anhydrous solvents, under positive pressure of nitrogen or argon, or using dry tubes; the reaction flask is provided with a rubber diaphragm, so that a substrate and a reagent are added through a syringe; glassware drying and/or heat drying.
Column chromatography as used herein is purchased from 200-300 mesh silica gel from the Qingdao ocean chemical plant unless otherwise indicated. The thin layer chromatography plates herein were purchased from the thin layer chromatography silica gel prefabricated plate, trade name HSGF254, manufactured by the institute of chemical industry, smokestack; the MS was determined using a Thermo LCQ sheet type (ESI) liquid chromatograph-mass spectrometer; the polarimeter SGW-3 was used for polarimeter, shanghai Shen Guang instruments and meters Inc.
Nuclear magnetic data (1H NMR) were run at 400MHz using a Varian apparatus. The solvent used in the nuclear magnetic data is CDCl 3 、CD 3 OD、D 2 O、DMSO-d 6 Etc., based on tetramethylsilane (0.00 ppm) or on residual solvent (CDCl) 3 :7.26ppm；CD 3 OD:3.31ppm；D 2 O:4.79ppm；d 6 DMSO 2.50 ppm). When peak shape diversity is indicated, the following abbreviations represent the different peak shapes: s (singlet), d (doublet), t (triplet), q (quartet), m (multiplet), br (broad), dd (doublet), dt (doublet). If the coupling constant is given, it is in Hertz (Hz).
Unless otherwise indicated, puromycin herein is purchased from sameiser (thermo fisher) technology limited.
Unless otherwise indicated, 3-chloro-6-iodopyridazine herein was purchased from Shanghai Yi En chemical technologies Co., ltd under the trade designation R037330.
Unless otherwise indicated, 5-bromoindole herein was purchased from Leyankee reagent under the trade designation 1014837.
Unless otherwise stated, 2-fluoro-5-iodopyridine herein was purchased from Sigma (Sigma-Aldrich), under the trade designation MFCD03095301.
Unless otherwise indicated, 2, 6-difluoro-4-chlorobenzaldehyde herein was purchased from Shanghai Bi-pharmaceutical technologies Co., ltd under the trade designation BD95674.
Unless otherwise indicated, 2, 6-difluoro-4-bromoiodobenzene herein was purchased from Shanghai Bi's pharmaceutical technologies Co., ltd under the trade designation BD18678.
Unless otherwise indicated, 2, 6-tetramethyl-2H-3, 5, 6-dihydropyran-4-one herein is available from Jiangsu ai Kang Shengwu pharmaceutical research and development Co., ltd., CAS number 1197-66-6
Unless otherwise indicated, 2-chloro-5-iodopyrazine herein was purchased from Shanghai Haohong biomedical technology limited, CAS number 1057216-55-3.
Unless otherwise stated, N-Boc ethanolamine herein is available from Shanghai Pichia pharmaceutical technologies Inc., under the trade designation BD10099.
Unless otherwise indicated, N-Boc ethylenediamine herein is purchased from Beijing Lvbod Biotech Inc., CAS number 57260-73-8.
Unless otherwise indicated, the dess-martin oxidizing reagent herein is purchased from Shanghai Bi medical technologies Co., ltd under the trade designation BD35199.
Unless otherwise stated, pCMV3 plasmids herein are purchased from the sense of perk.
Unless otherwise stated, DH 5. Alpha. Competent bacteria herein were purchased from full gold, commercial number: #CD201.
Unless otherwise stated, the psPAX2 plasmid herein is purchased from Shanghai platinum Siemens Biotechnology Inc.
The pMD2.G plasmid herein is purchased from Shanghai Rui platinum Siemens Biotech, inc., unless otherwise indicated.
Plasmid pCDH herein is purchased from bioelectric resource technologies, inc unless otherwise indicated.
Unless otherwise indicated, the 0.22 μm filter herein was purchased from Qingdao Tianze Biotechnology Inc. under the trade designation Millex-GV PVDF needle filter under the trade designation SLGVX13N.
Unless otherwise indicated, 6-well plates herein were purchased from sameidie technologies, inc.
Unless otherwise indicated, the fetal bovine serum herein was purchased from sameidie technologies.
Unless otherwise indicated, bovine insulin herein was purchased from middley michaeli technologies, inc.
Unless otherwise indicated, EMEMs herein are purchased from ATCC.
Unless otherwise indicated, the CellTiter-Glu kit herein is purchased from Promega biotechnology Co.
Unless otherwise indicated, HEK293T cells herein were purchased from the chinese academy of sciences stem cell bank, numbered: SCSP-502.
Unless otherwise indicated, the Fugen HD transfection reagent herein was purchased from Promega Biotechnology Inc. under the trade designation E2311 (Promega, E2311).
Unless otherwise stated, the Renilla-luciferase reference plasmid herein was purchased from Promega Biotechnology Inc. under the trade designation E6921 (Promega, E6921).
Unless otherwise indicated, the dual-fluorescein reporter gene test kit herein was purchased from Biyun biotechnology Co., ltd under the trade designation RG027.
Unless otherwise indicated, the term "PrimeStar Hi-Fi enzyme" herein is purchased from Bao Ri doctor Material technology Beijing Co.
Abbreviations:
intermediate 1:
the reaction route is as follows:
step 1:
5-Bromoidazole (70 g) was dissolved in acetonitrile (1.5L), acetic acid (150 mL) and Selectflour (273 g) were added and the reaction was placed under a nitrogen blanket and reacted at 80℃for 16 hours. After the reaction mixture was cooled to room temperature, it was diluted with water (2L), and was extracted three times with ethyl acetate (500 mL). The organic phases were combined and dried over anhydrous sodium sulfate. After the solvent was removed, the crude product was purified by column chromatography to give the product (40 g).
Step 2:
the product (26.5 g) obtained in step 1 was dissolved in methylene chloride (200 mL), and after the reaction solution was cooled to 0℃3, 4-2H-dihydropyran (31.1 g) and p-toluenesulfonic acid (1.4 g) were added. After the reaction mixture was slowly warmed to room temperature, stirring was continued for 12 hours. The reaction mixture was washed with saturated brine (300 mL), dried over anhydrous sodium sulfate, and the solvent was removed to obtain a crude product. After purification by column chromatography, intermediate 1 (33.5 g) was obtained.
Intermediate 2:
the reaction route is as follows:
step 1:
2-fluoro-5-iodopyridine (22.3 g) was dissolved in anhydrous DMF, N-BOC ethanolamine (16.1 g) was added, and after cooling the reaction mixture to 0℃sodium hydride (6 g, 60%) was added in portions. After the reaction solution was slowly warmed to room temperature, it was stirred overnight. After the reaction was completed, it was quenched with saturated aqueous ammonium chloride solution and extracted 3 times with ethyl acetate. The organic phases were combined, washed with water and saturated brine, then dried over anhydrous sodium sulfate, and the solvent was removed to give a crude product. The crude product was purified by column chromatography to give the product (24.5 g).
Step 2:
the product (24 g) obtained in step 1 was dissolved in methanol (600 ml) and Pd (dppf) Cl was added 2 .CH 2 Cl 2 (5.27 g), TEA (32.7 g). After the air was sufficiently replaced with carbon monoxide, the reaction mixture was allowed to react overnight at 60℃under a carbon monoxide atmosphere. After the reaction was completed, the organic phase was removed to obtain a crude product, and the crude product was purified by column chromatography to obtain a product (19 g).
Step 3:
the product (19 g) obtained in step 2 was dissolved in tetrahydrofuran (400 ml), water (150 ml) and lithium hydroxide (7.44 g) were added, and the reaction solution was stirred at room temperature overnight. After the completion of the reaction, the pH of the reaction mixture was adjusted to 2 with 0.5N hydrochloric acid. The solid was filtered and washed with water and dried under vacuum overnight to give the product (15.9 g).
Step 4:
the product (15.9 g) obtained in step 3 was dissolved in methylene chloride (500 ml), and after adding triethylamine (28.2 g) and HOBt (11.3 g), EDC. HCl (16 g) was added in portions. After the reaction mixture was stirred at room temperature for 10 minutes, N-methyl-N-methoxyamine hydrochloride (8.16 g) was added in portions. The reaction was stirred at room temperature overnight and the solvent was removed to give the crude product. The crude product was purified by column chromatography to give a pure product (17.5 g).
Step 5:
intermediate 1 (2.1 g) was dissolved in anhydrous tetrahydrofuran (22 ml) under nitrogen blanket. After the reaction mixture was cooled to-78 ℃, n-butyllithium (3 ml,2.5 m) was added dropwise. After the reaction solution was stirred at this temperature for 30 minutes, an anhydrous tetrahydrofuran solution (10 ml) of the product (1.79 g) obtained in step 4 was added dropwise. After completion of the dropwise addition, the reaction solution was slowly warmed to room temperature, stirring was continued for 1 hour, and after completion of the reaction, it was quenched with a saturated aqueous ammonium chloride solution. The mixture was extracted three times with ethyl acetate, and the organic phases were combined and washed with water and saturated brine. The organic phase was removed after drying over anhydrous sodium sulfate to give the crude product. The crude product was purified by column chromatography to give pure intermediate 2 (500 mg).
Intermediate 3:
trans-4-bromo-2-butenoic acid (50 g) was dissolved in methylene chloride (300 mL), and after the mixture was cooled to 0 ℃, oxalyl chloride (76.8 g) was added dropwise. After the reaction mixture was slowly warmed to room temperature, stirring was continued for 1 hour. After removal of the solvent at low temperature, the residue was dissolved in dichloromethane (500 mL) and cooled to 0 ℃, to which was added dropwise an aqueous dimethylamine solution (100 mL), 40% w). The reaction solution was stirred at this temperature for 1 hour. The solution was separated, and the organic phase was washed three times with water (200 mL), washed with saturated brine (200 mL) and dried over anhydrous sodium sulfate. The solvent was removed to give the product (35 g).
Intermediate 4:
intermediate 1 (40 g) was dissolved in anhydrous tetrahydrofuran (400 ml), and the system was fully replaced with nitrogen and cooled to-78 ℃. To the above system was added dropwise n-hexane solution of n-butyl (92 ml, 1.6M), and after completion of the addition, the system was kept under stirring at this temperature for 1 hour, and triisopropyl borate (30.3 g) was then added dropwise. After the completion of the dropwise addition, the reaction system was slowly warmed to room temperature and stirred for 1 hour. After TLC showed the reaction was completed, the reaction solution was cooled to 0 ℃ and quenched with 10% aqueous ammonium chloride, and the resulting mixture was left to stand and separated. The aqueous phase was extracted three times with ethyl acetate and the organic phases were combined. The organic phase was washed 3 times with 10% saline and dried over anhydrous sodium sulfate. After removal of the solvent, a small amount of isopropyl ether was added to the residue and stirred overnight. The solid was filtered, washed with a small amount of isopropyl ether and dried in vacuo to give intermediate 4 (22 g).
Intermediate 5:
the experimental steps are as follows:
step 1:
5-Bromoidazole (100 g) was dissolved in methylene chloride (800 ml), and 3, 4-2H-dihydropyran (86 g) and anhydrous p-toluenesulfonic acid (8.8 g) were added to the reaction mixture, which was reacted at room temperature for 16 hours. After completion of the reaction, the reaction mixture was washed with a saturated aqueous sodium hydrogencarbonate solution 3 times and then with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate, the solvent was removed, and the residue was purified by column chromatography to give a product (110 g).
Step 2:
referring to the synthesis method of intermediate 4, intermediate 5 (30 g) was obtained using the product (50 g) obtained in step 1 as a starting material.
Intermediate 6:
the synthesis method comprises the following steps:
intermediate 4 (3 g) was dissolved in 1, 4-dioxane (30 ml), and 2-iodo-5-chloropyridine (3 g), pd (dppf) Cl was added to the above solution 2 (830 mg), anhydrous potassium carbonate (4 g). After the system was fully displaced with carbon monoxide, the mixture was heated to 65 degrees and stirred overnight. After the reaction was completed, the mixture was cooled to room temperature, water and ethyl acetate were added to the reaction mass, and the organic phase was separated and collected. The organic phase was washed with water and brine, dried over anhydrous sodium sulfate, and the solvent was removed to give a crude product. The crude product was purified by column chromatography to give intermediate 6 (1 g).
Intermediate 7:
the synthesis method comprises the following steps:
referring to the synthesis of intermediate 6, starting from intermediate 5 (3 g) and 2-iodo-5-chloropyridine (3 g), product intermediate 7 (1.1 g) was obtained.
Intermediate 8:
the synthesis method comprises the following steps:
referring to the synthesis of intermediate 6, starting from intermediate 4 (3 g) and 4-chloroiodobenzene (3 g), product intermediate 8 (1.3 g) was obtained.
Intermediate 9:
the synthesis method comprises the following steps:
referring to the synthesis of intermediate 6, using intermediate 5 (3 g) and 4-chloroiodobenzene (3 g) as starting materials, product intermediate 9 (2.2 g) was obtained.
Intermediate 10:
the synthesis method comprises the following steps:
step 1:
intermediate 1 (5 g) was dissolved in anhydrous tetrahydrofuran (50 ml), the system was fully replaced with nitrogen, the reaction solution was cooled to-78℃and n-butyllithium in n-hexane (11.5 ml, 1.6M) was added dropwise. After completion of the dropwise addition, the reaction solution was stirred at this temperature for an additional 30 minutes. A solution of 2, 6-difluoro-4-chlorobenzaldehyde (3 g) in anhydrous tetrahydrofuran (15 ml) was added dropwise thereto. The reaction solution was stirred at this temperature for another 30 minutes, and then the reaction temperature was slowly raised to 0℃and the reaction was continued at this temperature for 1 hour. After the completion of the reaction, the reaction mixture was quenched with a 10% aqueous ammonium chloride solution. After separation, the aqueous phase was extracted 2 times with ethyl acetate and the organic phases were combined. The organic phase was washed with water and brine, dried over anhydrous sodium sulfate, and then the solvent was removed to give a crude product. The crude product was purified by column chromatography to give the product (2.3 g).
Step 2:
the product (2.2 g) obtained in step 1 was dissolved in methylene chloride (25 ml), and to the above reaction solution was added Dess-Martin reagent (2.8 g) in portions and stirring was continued overnight. The reaction mixture was diluted with methylene chloride, and then washed with saturated sodium bicarbonate, water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and the solvent was removed to give a crude product, which was purified by column chromatography to give pure intermediate 10 (1.2 g).
Intermediate 11:
the synthesis method comprises the following steps:
referring to the synthesis of intermediate 6, starting from intermediate 5 (2.5 g) and 2, 6-difluoro-4-bromoiodobenzene (3.5 g), product (0.42 g) was obtained.
Intermediate 12:
the synthesis method comprises the following steps:
referring to the synthesis of intermediate 6, starting from intermediate 4 (3 g) and 2-fluoro-5-iodopyridine (2.8 g), the product (1.8 g) was obtained.
Intermediate 13:
the synthesis method comprises the following steps:
referring to the synthesis of intermediate 6, starting from intermediate 5 (3 g) and 2-fluoro-5-iodopyridine (3 g), product (1.2 g) was obtained.
Intermediate 14:
the synthesis method comprises the following steps:
referring to the synthesis of intermediate 6, starting from intermediate 4 (3 g) and 2-chloro-5-iodopyrazine (3 g), product (0.6 g) was obtained.
Intermediate 15:
the synthesis method comprises the following steps:
referring to the synthesis of intermediate 6, starting from intermediate 4 (3 g) and 3-chloro-6-iodopyridazine (3 g), the product (0.45 g) was obtained.
Intermediate 16:
the synthesis method comprises the following steps:
intermediate 6 (990 mg) was dissolved in anhydrous toluene (15 ml), N-Boc ethanolamine (0.88 g), pd was added 2 (dba) 3 .CHCl 3 (142 mg), t-BubrettPhos (0.27 g) and cesium carbonate (2.3 g), the reaction system was thoroughly replaced with nitrogen, and the mixture was heated to 100℃until the reaction was complete. After the mixture was cooled to room temperature, ethyl acetate and water were added, the solution was separated and the organic phase was collected. The organic phase was washed with water and saturated brine, and dried over anhydrous sodium sulfate. The solvent was removed to give a crude product, which was purified by column chromatography to give a pure product (750 mg).
Intermediate 17:
the synthesis method comprises the following steps:
referring to the synthesis of intermediate 16, using intermediate 7 (1.1 g) as starting material, the product (800 mg) was obtained.
Intermediate 18:
the synthesis method comprises the following steps:
referring to the synthesis of intermediate 16, starting from intermediate 8 (1.0 g), the product (700 mg) was obtained.
Intermediate 19:
the synthesis method comprises the following steps:
referring to the synthesis of intermediate 16, using intermediate 9 (2.1 g) as starting material, product (1 g) was obtained.
Intermediate 20:
the synthesis method comprises the following steps:
referring to the synthesis of intermediate 16, starting from intermediate 10 (1.2 g), product (0.6 g) was obtained.
Intermediate 21:
the synthesis method comprises the following steps:
referring to the synthesis of intermediate 16, using intermediate 11 (380 mg) as a starting material, the product (350 mg) was obtained.
Intermediate 22:
the synthesis method comprises the following steps:
intermediate 12 (1.8 g) was dissolved in 1, 4-dioxane (10 ml), N-Boc ethylenediamine (1 g) and DIEA (2 g) were added, and the reaction solution was placed in an 80℃oil bath for continuous reaction until completion. After cooling the reaction mixture to room temperature, ethyl acetate was added thereto, and the obtained organic phase was washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and the solvent was removed to give a crude product, which was purified by column chromatography to give a pure product (1 g).
Intermediate 23:
the synthesis method comprises the following steps:
referring to the synthesis of intermediate 22, using intermediate 13 (1.1 g) as starting material, the product (600 mg) was obtained.
Intermediate 24:
the synthesis method comprises the following steps:
referring to the procedure of step 1 in intermediate 2, using intermediate 14 (1.2 g) as starting material, product intermediate 24 (500 mg) was obtained.
Intermediate 25:
the synthesis method comprises the following steps:
referring to the procedure of step 1 in intermediate 2, using intermediate 15 (430 mg) as starting material, product intermediate 25 (135 mg) was obtained.
Intermediate 26:
the synthesis method comprises the following steps:
intermediate 6 (1.05 g) was dissolved in anhydrous toluene (18 ml), N-Boc ethylenediamine (0.5 g), pd was added 2 (dba) 3 .CHCl 3 (150 mg), t-BubrettPhos (281 mg) and cesium carbonate (2.88 g), and after the reaction system was sufficiently replaced with nitrogen, the mixture was heated to 110℃until the reaction was complete. After the mixture was cooled to room temperature, ethyl acetate and water were added, the solution was separated and the organic phase was collected. The organic phase was washed with water and saturated brine, and dried over anhydrous sodium sulfate. The solvent was removed to give a crude product, which was purified by column chromatography to give pure intermediate 26 (310 mg).
Example 1:
step 1:
zinc powder (633 mg) was added to TiCl pre-cooled to 0℃under nitrogen protection 4 (918 mg) in anhydrous tetrahydrofuran (100 ml). After the reaction mixture was warmed to room temperature, the reaction was continued at 65℃for 2 hours. After cooling to 0 degree, intermediate 2 (500 mg) and 2, 6-tetramethyl-2H-3, 5, 6-dihydropyran-4-one (260 mg) were added, and the reaction mixture was warmed to room temperature and then continued at 65 degree overnight. After the reaction was completed, it was cooled to room temperature and quenched with aqueous sodium bicarbonate. The organic phase was extracted three times with ethyl acetate, washed with water and saturated aqueous sodium chloride solution, and dried over anhydrous sodium sulfate. Removing the solventThe product (300 mg) was obtained after the preparation.
Step 2:
the product (300 mg) obtained in step 1 was dissolved in methylene chloride (10 ml), trifluoroacetic acid (10 ml) was added at room temperature, and the reaction solution was stirred at room temperature overnight. After the reaction is completed, the solvent is removed to obtain a crude product. The crude product was purified by Prep-HPLC to give the product (120 mg).
Step 3:
the product (120 mg) obtained in step 2 was dissolved in tetrahydrofuran (15 ml), and after sodium carbonate (81 mg) was added and cooled to 0 degree, a tetrahydrofuran solution (8 ml) of intermediate 3 (41 mg) was slowly added dropwise. After the reaction solution was slowly warmed to room temperature, stirring was continued overnight. After the reaction was completed, filtration was performed. The filtrate was concentrated to give a crude product, which was purified by Prep-HPLC to give pure product (11.6 mg). LC-MS (ES, M/z) [ M+H ]] + ＝536；1H-NMR(400MHz,CD 3 OD,ppm):δ8.07(s,1H),7.59(d,J＝2.4Hz,1H),7.47(s,1H),7.39-7.38(d,J＝2.4Hz,1H),7.27-7.24(m,2H),6.88-6.83 (m,2H),6.69-6.68(m,1H),4.61-4.58(m,2H),3.92-3.91(m,2H),3.49-3.46(m,2H),3.30(s,3H),3.11(s,3H),2.29-2.03(m,4H),1.24-1.20(m,12H)。
The following compounds can be synthesized according to the above method:
biological evaluation:
the invention is further illustrated below in conjunction with test examples, which are not meant to limit the scope of the invention.
Test example 1 inhibitory Effect of the Compounds of the invention on proliferation of over-expressed estrogen receptor MCF-7 cells (MCF-7/ER 66)
1. Purpose of experiment
The purpose of this experiment was to test the inhibition of MCF7/ER66 cell proliferation by the compounds of the invention using the ATP method, according to GI 50 Size the compounds were evaluated for in vitro activity.
2. Experimental procedure
2.1 Construction of pCDH-ER alpha 66 plasmid:
EcoR l and BamH l sites were selected and primers were designed:
F:CCGgaattcgccaccatgGATTACAAGGATGACGACGATAAGatgaccatgaccctcca
R:cgcggatcctcagaccgtggcagggaaac
taking a pCMV3-flag-ER alpha 66 plasmid as a template (the template plasmid vector has a flag sequence, a primer is introduced to have the flag sequence, the complete CDS sequence of ER alpha 66 is amplified without any tag, and then secondary PCR is carried out by taking the template as the template), carrying out PCR amplification by PrimeStar high-fidelity enzyme, connecting the PCR amplification product with a pCDH vector after double digestion, transferring a connection product into DH5 alpha competent bacteria, sequencing positive plasmids after picking Long Mei and cutting identification, and obtaining the pCDH-ER alpha 66 plasmid with complete and correct sequence. See fig. 1.
2.2 construction of ERalpha 66 overexpressing cells
293T cells were cultured in 10cm dishes with 10% fetal bovine serum at 37℃in 95% air and 5% carbon dioxide. When cells were grown to 60% density, 293T cells were transfected to package pCDH-ERα 66 virus according to the following system: 15 μg pCDH-ERα 66, 10 μg psPAX2,5 μg pMD2.G. After 6 hours, the culture was performed for 48 hours, and then the supernatant was collected, and after 72 hours, the supernatant was collected again and filtered through a 0.45 μm filter (Millex-GV) to obtain pCDH-ER. Alpha.66 lentivirus. PEG-8000 concentration method 10ml of virus solution was concentrated to 250. Mu.l and split-filled. MCF-7 cells were plated at 3X 10 one day in advance 5 The individual wells/well were seeded in six well plates. After cell attachment, 50. Mu.l of virus (the amount of virus is determined according to MOI values of different cells) is added into 1ml of complete culture medium, and 1 well of 6-well plate is infected with 1 well of MCF-7 fineCells, after 24 hours, were supplemented with 1mL of complete medium to ensure good cell status and placed in a cell incubator. And (4) observing fluorescence after 48 hours, and screening the stable cell strain for 5-7 days by using 0.4 mug/mL puromycin (the drug concentration takes all death of uninfected virus control cells for 3-5 days as reference), thus obtaining the stable cell strain with over-expressed ER alpha 66.
2.2 experiments of the inhibition of proliferation of ERalpha 66 overexpressing MCF-7 cells by Compounds
Human breast cancer cells MCF-7 were cultured with EMEM medium containing 10% fetal bovine serum, 10. Mu.g/mL bovine insulin at 37 ℃,95% air and 5% CO 2 Culturing under conditions of 25cm 2 Or 75cm 2 In a plastic tissue culture bottle, subculturing for 2-3 times a week.
The cells were grown at 3X 10 3 Density of wells/well in 96-well cell culture plates, 90. Mu.L/well, and at 37 ℃,95% air and 5% CO 2 Is cultured. After 24 hours the test compound is added: compounds were 10-fold gradient diluted with DMSO starting at 10mM (dissolved in DMSO) to prepare a gradient stock solution; preparing complete medium containing 0.1% dmso for further dilution, temporarily referred to as "dilution buffer", preparing a second stage solution by diluting each stock solution with 9 volumes of dilution buffer, i.e., adding 2 μl of 10mM stock solution to 18 μl of dilution buffer; each secondary solution was diluted with 9 volumes of dilution buffer to prepare working solutions, i.e., 10. Mu.L of a second order stock solution of 1mM in 10% DMSO-medium was added to 90. Mu.L of dilution buffer, and finally 10. Mu.L of working solution was added to the cell-inoculated culture plates. The final concentration of DMSO in the cell culture is 0.1% and the final concentration of the compound tested is 1pM to 10. Mu.M. The cells were incubated at 37℃for 3 days. The medium was aspirated, replaced with 90. Mu.L/well fresh complete medium and the test compound was added again according to the compound dilution method described above. On day 6, cellTiter-Glu was added for cell viability assay.
3. Data analysis
Cell viability assay by CellTiter-Glu kit and finally half of the compounds for cell proliferation was calculated by Prism programInhibitory concentration, i.e. GI 50 Values.
TABLE 1 GI of the inhibitory Effect of the inventive Compounds on MCF7 cell proliferation 50
Examples GI 50 (nm)
H3B-6545 0.5
1 0.4
2 13.98
3 18.23
4 9.36
5 1.05
6 0.1
7 0.3
8 0.2
9 0.2
Conclusion: the compound has obvious inhibition effect on the proliferation of MCF-7 cells over-expressed by ER alpha 66.

Claims (6)

  1. An optical isomer compound of an era receptor covalently bound antagonist, or a pharmaceutically acceptable salt thereof, the antagonist compound having a structure represented by the following formula (i):
    wherein X is 1 、X 2 Or X 3 Each independently selected from one or more of C and N; r is R 1 、R 2 Or R is 3 Each independently selected from-H, -CH 3 -Cl or-F; r is R 4 Selected from-O or-N; n=1 or 2.
  2. An optical isomer compound of an antagonist or a pharmaceutically acceptable salt thereof according to claim 1, wherein said antagonist compound has a structure represented by the following formula (ii):
    wherein R is 1 、R 2 Or R is 3 Each independently selected from-H, -CH 3 -Cl or-F; r is R 4 Selected from-O or-N.
  3. The optical isomer compound of an antagonist or a pharmaceutically acceptable salt thereof according to claim 1, wherein the antagonist compound has a structure represented by the following formula (iii):
    wherein R is 1 Or R is 3 Each independently selected from-H, -CH 3 -Cl or-F; r is R 4 Selected from-O or-N.
  4. An optical isomer compound of an antagonist or a pharmaceutically acceptable salt thereof according to claim 1, wherein said antagonist compound has a structure represented by the following formula (iv):
    wherein R is 1 、R 2 Or R is 3 Each independently selected from-CH 3 -H, -Cl or-F; r is R 4 Selected from-O or-N.
  5. The optical isomer compound of the antagonist of claim 1 or a pharmaceutically acceptable salt thereof, wherein the antagonist compound comprises a compound having a structure represented by the formula:
    one of them.
  6. Use of a compound according to any one of claims 1 to 5, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for the treatment of a disorder associated with an estrogen receptor.
CN202180097433.1A 2021-06-27 2021-06-27 ER alpha receptor covalent binding antagonist Pending CN117440950A (en)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/CN2021/102586 WO2023272410A1 (en) 2021-06-27 2021-06-27 ERα RECEPTOR COVALENT BINDING ANTAGONIST

Publications (1)

Publication Number Publication Date
CN117440950A true CN117440950A (en) 2024-01-23

Family

ID=84690893

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202180097433.1A Pending CN117440950A (en) 2021-06-27 2021-06-27 ER alpha receptor covalent binding antagonist

Country Status (2)

Country Link
CN (1) CN117440950A (en)
WO (1) WO2023272410A1 (en)

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2483736B (en) * 2010-09-16 2012-08-29 Aragon Pharmaceuticals Inc Estrogen receptor modulators and uses thereof
BR112017025546B1 (en) * 2015-05-29 2023-02-14 Eisai R&D Management Co., Ltd COMPOUND, PHARMACEUTICAL COMPOSITION INCLUDING SAID COMPOUND AND ITS USES
CN106518768B (en) * 2015-09-15 2021-07-02 江苏恒瑞医药股份有限公司 Acrylic acid derivative, preparation method and medical application thereof
CN110300751A (en) * 2016-11-24 2019-10-01 卫材 R&D 管理有限公司 Four substituted olefine compounds and its purposes for treating breast cancer
US20220226300A1 (en) * 2019-05-24 2022-07-21 Eisai R&D Management Co., Ltd. A method for treating cancer with an oral dosage form of an estrogen receptor-alpha inhibitor

Also Published As

Publication number Publication date
WO2023272410A1 (en) 2023-01-05

Similar Documents

Publication Publication Date Title
WO2016192586A1 (en) Deuterium-substituted dehydrophenylahistin-like compound, preparation method thereof and use in preparation of antitumor drug
KR101335746B1 (en) Disubstituted phthalazine hedgehog pathway antagonists
WO2021178846A1 (en) Methods of treating estrogen receptor-associated diseases
CN113825754B (en) Disubstituted sulfonamide selective BCL-2 inhibitors including methyl and trifluoromethyl
CN110099900A (en) For the hedgehog pathway inhibitor of Smoothened mutant strain
EA024182B1 (en) Novel morpholinyl derivatives useful as mogat-2 inhibitors
Lee et al. Novel inhibitors of RANKL-induced osteoclastogenesis: Design, synthesis, and biological evaluation of 6-(2, 4-difluorophenyl)-3-phenyl-2H-benzo [e][1, 3] oxazine-2, 4 (3H)-diones
Wu et al. Synthesis of novel 10, 11-methylenedioxy-camptothecin glycoside derivatives and investigation of their anti-tumor effects in vivo
JP5234558B2 (en) Anticancer agent containing tamoxifen analog as active ingredient
CN117440950A (en) ER alpha receptor covalent binding antagonist
CA2861479A1 (en) Paroxetine derivative
CN109180621B (en) Preparation of Schiff base compounds and application of Schiff base compounds in cancer treatment
CN115057850B (en) Aloe-emodin derivative and preparation method and application thereof
CN106117188B (en) Compounds for the treatment of cancer
CN114591306B (en) 1,4 naphthoquinone STAT3 inhibitor of 1,2,4-triazole ring and application thereof
CN112375112B (en) Benzimidazole derivative BI361 and preparation method and application thereof
CN108727400A (en) A kind of compound for treating tumour
CN115872996B (en) Estrogen receptor degradation agent compound and preparation method and application thereof
CN115322168B (en) Calycosin derivative and preparation method and application thereof
CN108815167A (en) A kind of purposes of noval chemical compound in the drug of preparation treatment tumour
CN112300235B (en) Benzimidazole derivative BI321 and preparation method and application thereof
CN102093381A (en) 6H-benzofuran[3,2-c][1]benzopryan-6-ketone compound as well as preparation method and application of 6H-benzofuran[3,2-c][1] benzopryan-6-ketone compound
CN111393416B (en) Preparation method and application of pyrazole compound containing 1-methylpyridine-3- (4-chlorphenyl) pyrazole unit
CN112250725B (en) Benzimidazole derivative BI345 and preparation method and application thereof
WO2016206138A1 (en) Histone deacetylase inhibitor and preparation method and use thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination