WO2023236864A1

WO2023236864A1 - Baf155 mutant gene and pharmaceutical use thereof

Info

Publication number: WO2023236864A1
Application number: PCT/CN2023/098024
Authority: WO
Inventors: 孙英贤; 张乃今; 张莹
Original assignee: 孙英贤; 张乃今; 张莹
Priority date: 2022-06-06
Filing date: 2023-06-02
Publication date: 2023-12-14
Also published as: CN114920816B; CN114920816A

Abstract

Provided in the present invention are a BAF155 mutant gene and the pharmaceutical use thereof. Provided in the present invention are a BAF155 mutant or an active fragment thereof. Compared with wild-type BAF155, the BAF155 mutant or the active fragment thereof contains a mutation of K948. The present invention further provides a pharmaceutical composition, the pharmaceutical composition comprising the BAF155 mutant or the active fragment thereof. Further provided in the present invention is the use of the BAF155 mutant or the active fragment thereof or the pharmaceutical composition in preparation of drugs for preventing or treating cardiac remodeling. The applicants have found that BAF155 interacts with the BRCT domain of PARP1, and BAF155-K948R is ubiquitinated to modify the PARP1 and cooperates with SIRT2 to prevent cardiac remodeling, thus providing a new thinking and research direction for treatment and prevention of cardiovascular diseases.

Description

BAF155 mutated gene and its pharmaceutical uses

Technical field

The present application relates to the field of drugs for preventing or treating cardiac remodeling. In particular, the present application relates to BAF155 mutants or active fragments thereof. The present application also relates to the pharmaceutical use of said BAF155 mutants or active fragments thereof.

Background technique

Non-communicable diseases (NCDs), which account for nearly half of cardiovascular diseases (CVD), have surpassed infectious diseases to become a major global pathology. At the same time, cardiovascular disease remains the most lethal pathology globally. With the rapid improvement of living standards and dramatic changes in lifestyle in China, the prevalence and mortality of cardiovascular diseases have increased significantly. With the advent of an aging society, heart disease has become one of the most important health problems worldwide. Ventricular remodeling, including myocardial hypertrophy and fibrosis, forms the etiological basis of heart failure. Poly(ADP-ribose) polymerase 1 (PARP1) is an important damage factor in CVD, especially cardiac remodeling caused by various factors. PARP1 upregulation and enhanced PARP1 activity occur during cardiac remodeling, resulting in extremely high energy consumption by damaged cardiomyocytes. However, it is currently unclear how PARP1 is regulated in cardiac remodeling.

SWI/SNF (mating type switching/sucrose non-fermenting) is a multi-subunit ATP-dependent chromatin remodeling complex and a fundamental epigenetic regulator of gene transcription. BAF155, also known as SMARCC1, stands for SWI/SNF subunit. As a helicase and ATPase, BAF15 regulates gene transcription by changing the chromatin structure around genes. BAF155 has been reported to contribute to a variety of physiological and pathological events, including cancer, development, and more.

However, although BAF155 is highly abundant in the heart, its role in the myocardium is not yet clear.

Contents of the invention

The technical solution of this application is proposed based on the following research:

The Applicants found that AngII-induced cardiac remodeling, including cardiac hypertrophy, fibrosis and failure, was significantly attenuated in BAF155 cardiac muscle-specific knockout mice. In contrast, overexpression of BAF155 in mice significantly exacerbated cardiac remodeling. The study found that BAF155 binds PARP1 in the PARP1-BRCT domain and inhibits PARP1 ubiquitination at K249 by interfering with WWP2, an important E3 ubiquitin ligase. Applicants discovered that BAF155 was identified as a novel substrate for acetyltransferase CBP and deacetylase SIRT2 under physiological conditions. CBP/SIRT2 interacts with BAF155 and acetylates/deacetylates BAF155 at K948. The same lysine site of BAF155 is ubiquitinated by WWP2, thereby inducing the downstream degradation of BAF155 through the proteasome. Crosstalk between acetylation and ubiquitination of BAF155 dynamically regulates the stability of the BAF155-PARP1 complex in a competitive manner. In summary, Applicants' studies identify a novel role for BAF155 and its upstream and downstream regulatory mechanisms in cardiac remodeling. Specifically, BAF155 interacts with PARP1, reducing PARP1 degradation and exacerbating cardiac remodeling by inhibiting WWP2. BAF155 is regulated by SIRT2-mediated deacetylation, which helps mobilize WWP2 to degrade BAF155 and dissociate the BAF155-PARP1 cardiac remodeling damage complex. The findings of this application provide new research directions for the treatment and prevention of cardiac remodeling injury.

Therefore, the purpose of this application is achieved through the following technical solutions:

A first aspect of the present invention provides a BAF155 mutant or an active fragment thereof, which comprises a mutation of K948R compared with wild-type BAF155.

Wherein, the sequence of the BAF155 mutant is shown in SEQ ID NO: 1:

The present invention also provides an isolated nucleic acid molecule, wherein the nucleic acid molecule encodes the BAF155 mutant or active fragment thereof.

The present invention also provides a vector, wherein the vector contains the aforementioned isolated nucleic acid molecule.

The present invention also provides a host cell, wherein the host cell contains the aforementioned vector.

The present invention also provides a pharmaceutical composition, wherein the pharmaceutical composition comprises the aforementioned BAF155 mutant or active fragment thereof.

The pharmaceutical composition according to the present invention, wherein the pharmaceutical composition further includes pharmaceutically acceptable diluents, excipients and/or carriers.

The present invention also provides the use of the BAF155 mutant or active fragment thereof or the pharmaceutical composition in the preparation of drugs for preventing or treating cardiac remodeling.

According to the use of the present invention, the cardiac remodeling is AngII-induced cardiac remodeling.

According to the use of the present invention, the cardiac remodeling is selected from one or more of cardiac hypertrophy, cardiac fibrosis and/or heart failure.

Compared with the existing technology, this application has the following beneficial effects:

BAF155 interacts with PARP1, reducing PARP1 degradation and exacerbating cardiac remodeling by inhibiting WWP2. BAF155 is regulated by SIRT2-mediated deacetylation, which helps mobilize WWP2 to degrade BAF155 and dissociate the BAF155-PARP1 cardiac remodeling damage complex to prevent cardiac remodeling. This provides new ideas and research directions for the treatment and prevention of cardiac remodeling injury.

Description of the drawings

Below, the embodiments of the present application are described in detail with reference to the accompanying drawings, wherein:

Figure 1 shows that cardiac-specific knockout of BAF155 alleviates cardiac remodeling in mice, where:

Among them, Figure 1A shows BAF155-cWT mice and myocardial-specific BAF155 knockout (BAF155-cKO) mice exposed to continuous 0.9% NaCl and AngII (2 mg/kg/day) for two weeks;

Figure 1B-C show the results of immunofluorescence and Western blotting respectively, showing that BAF155 is specifically knocked out in cardiac tissue;

Figure 1D shows that BAF155-cKO significantly alleviated AngII-induced cardiac dysfunction compared with BAF155-cWT mice;

Figures 1E and 1F show increases in left ventricular ejection fraction (EF) % and fractional shortening (FS) %, respectively, in mice;

Figure 1G shows H&E and WGA staining data, showing that in BAF155-cWT mice, AngII increased the size of cardiomyocytes and the cross-sectional area of cardiomyocytes, while this change in BAF155-cKO mice given AngII was not significant;

Figure 1H-I show that BAF155-cKO significantly inhibited the AngII-induced increase in HW/BW and HW/TL ratios compared with BAF155-cWT mice, respectively, indicating that cardiac-specific knockout of BAF155 alleviated the cardiac Hypertrophy;

Figure 1J shows that compared with BAF155-cWT mice, BAF155-cKO significantly reduced the AngII-induced expression of mouse ANP, BNP, cleavedcaspase-3 and PARP1;

Figure 1K shows that the level of AngII-induced myocardial fibrosis in BAF155-cKO mice was significantly reduced compared with BAF155-cWT mice;

Figure 1L shows that compared with BAF155-cWT mice, BAF155-cKO mice have reduced expression of cardiac fibrosis-related proteins α-SMA and collagen I;

Figure 2 shows that BAF155 overexpression significantly exacerbates cardiac hypertrophy and heart failure in a mouse model, where:

Figure 2A shows the exposure of BAF155-WT and BAF155 transgenic mice (BAF155-TG) to continuous 0.9% NaCl and AngII (2 mg/kg/day) for two weeks;

Figure 2B shows a Western blot showing that BAF155 is specifically overexpressed in cardiac tissue;

Figure 2C shows that compared with BAF155-WT mice, BAF155-TG significantly aggravated AngII-induced cardiac dysfunction;

Figures 2D and 2E show increases in left ventricular ejection fraction (EF) % and fractional shortening (FS) %, respectively, in mice;

Figure 2F shows H&E and WGA staining data. Compared with BAF155-WT mice, AngII administration resulted in an increase in cardiomyocyte size and cardiomyocyte cross-sectional area in BAF155-TG mice;

Figure 2G-H shows that compared with BAF155-WT mice, BAF155-TG significantly exacerbated AngII-induced increases in HW/BW and HW/TL ratios, indicating that overexpression of BAF155 causes cardiac hypertrophy in mice;

Figure 2I-Figure 2K respectively show that compared with BAF155-WT mice, AngII-induced expression of ANP, BNP, cleavedcaspase-3 and PARP1 were all increased in BAF155-TG mice (Figure 2I). Similarly, with Compared with BAF155-WT mice, BAF155-TG significantly aggravated AngII-induced myocardial fibrosis in mice (Figure 2J), and upregulated α-SMA and collagen I (Figure 2K);

Figure 3 shows that PARP1 acts as a key BAF155-binding protein under physiological conditions and suggests that the BAF155-PARP1 axis may regulate cardiac remodeling, where:

Figures 3A and 3B evaluate the interaction between endogenous BAF155 and PARP1 by co-immunoprecipitation;

Figure 3C shows that the interaction between BAF155 and PARP1 is induced by AngII;

Figure 3D shows the interaction of BAF155 with the 476-779 amino acid domain of PARP1, that is, the PARP-A-helical domain;

Figure 4 shows the regulatory mechanism of PARP1 by BAF155, where:

Figure 4A shows that increased expression of BAF155 leads to synchronized expression of PARP1;

Figure 4B shows that BAF155 silenced with 56438shBAF155 RNA significantly downregulated PARP1 expression;

Figure 4C shows that the abundance of PARP1 gradually decreased in the Flag control group, while BAF155 overexpression maintained PARP1 expression in the presence of increased CHX, a transcription inhibitor used to inhibit PARP1 protein synthesis;

Figure 4D shows that after MG132 treatment, PARP1 expression increased (rate and extent) in BAF155 overexpressing cells compared with Flag control cells;

Figure 4E shows that compared with the Flag-control plasmid group, the ubiquitination level of PARP1 was reduced after transfection with Flag-BAF155;

Figure 4F shows that the ubiquitination level of PARP1 is increased by BAF155 knockdown;

Figure 4G shows that BAF155 reduced the ubiquitination level in the PARP1-WT group, but not in PARP1-K249R cells, indicating that BAF155 inhibited PARP1 ubiquitination on K249;

Figures 4H-4K respectively show that under the treatment of MG132, the degradation of PARP1 and BAF155 was blocked by exogenous immunoassay, resulting in enhanced interaction of BAF155 and PARP1 with WWP2 (4H); in addition, after BAF155 knockdown , the binding of PARP1 to WWP2 increased (Figure 4I), while the overexpression of BAF155 led to the reduced binding of PARP1 to WWP2 (Figure 4J); when WWP2 was overexpressed, compared with the Flag control group, the overexpression of Flag-BAF155 increased the binding of PARP1 to WWP2 (Figure 4J). Ubiquitination levels decreased (Fig. 4K);

Figures 4L to 4O show that the binding of PARP1 to WWP2 and SIRT2, respectively, was enhanced after treatment with AngII and significantly increased in the heart tissue of BAF155-cKO mice compared with WT with or without AngII treatment (Figure 4L); In terms of ubiquitination levels of PARP1, Applicants' data show that AngII induces ubiquitination in heart tissue of WT mice (Figure 4M); furthermore, ubiquitination of PARP1 increased in BAF155-cKO compared with WT mice There was a significant increase in the heart tissue of mice (Figure 4M); conversely, the binding of PARP1 to WWP2 and SIRT2 was reduced in the heart tissue of BAF155-TG mice compared with WT mice (Figure 4N); compared with WT mice In comparison, the ubiquitination of PARP1 was significantly reduced in the heart tissue of BAF155-TG mice (Figure 4O);

Figure 5 shows that K948 on BAF155 is specifically regulated by SIRT2, where:

Figure 5A-C demonstrates that endogenous and exogenous co-immunoprecipitation confirms that SIRT2 interacts with BAF155;

Figure 5D and E show that the interaction between SIRT2 and BAF155 is enhanced under the induction of AngII;

Figure 5F demonstrates that the SWIRM domain of BAF155 is the binding site for SIRT2;

Figure 5G shows that the acetylation level of BAF155 increased after treatment with trichostatin A (TSA) and nicotinamide (NAM);

Figure 5H shows that overexpression of CBP significantly increased the acetylation level of BAF155;

Figures 5I and 5J show that CBP interacts with BAF155 under both endogenous and exogenous conditions;

Figure 5K shows that the acetylation level of BAF155 is upregulated in shSIRT2 cells and cells treated with AGK2 compared with normal control cells;

Figure 5L shows that BAF155 levels of BAF55 were significantly enhanced in heart tissue samples from SIRT2 knockout animals compared with WT animals;

Figure 5M-Figure 5P shows that overexpression of WT-SIRT2 reduced the exogenous acetylation level of BAF155 (Figure 5M), while transfection of an inactive mutant of SIRT2 (H187YQ167A) had no effect (Figure 5N); in addition, with Compared with WT animals, the acetylation level of BAF155 in heart tissue samples from SIRT2 knockout animals was significantly enhanced, whether induced by AngII or not (Fig. 5O); the acetylation level of exogenous BAF155 was reduced under AngII treatment, while exogenous The acetylation level of sexual BAF155 further decreased with AngII-induced exogenous SIRT2 overexpression (Figure 5P);

Figures 5Q-5U respectively show that K948 is found throughout evolution, from Mohave Drosophila to mammalian species (Figure 5Q); an antibody specifically recognizing acetylated K948 of BAF155 (5R); after administration of TSA and NAM , the acetylation level of BAF155-K948 increased (Figure 5S); in addition, after exogenous transfection of four acetyltransferases, only CBP increased the acetylation level of BAF155-K948 (Figure 5T); at the same time, exogenous transfection of WT -SIRT2 but not inactivated SIRT2 (H187YQ167A) reduced the acetylation level of BAF155-K948 (Figure 5U); in summary, the above data indicate that K948 is specifically regulated by CBP and SIRT2;

Figure 6 shows SIRT2 deacetylation by BAF155-K948 in vivo, where:

Figure 6A shows SIRT2-regulated mouse cardiac lysine acetylation changes in SIRT2 knockout mice (SIRT2-KO), SIRT2 overexpression mice (SIRT2-TG) and wild-type animals (SIRT2-WT);

Figure 6B and Figure 6C respectively show that compared with WT, the acetylation level of BAF155-K948 increased with or without AngII administration after SIRT2 knockout, while the acetylation level of BAF155-K948 increased in SIRT2-TG mice. Decreased in cardiac tissue;

Figure 7 shows that SIRT2 promotes BAF155-K948 and PARP1-K294 ubiquitination via WWP2, where:

Figure 7A shows that BAF155 abundance increases after SIRT2 downregulation; Applicants observed similar trends using three fragments of shSIRT2 (61965, 61966, and 61967), and used the 61966-shSIRT2 fragment for subsequent experiments;

Figure 7B shows that the rate and extent of BAF155 upregulation in the heart tissue of SIRT2-WT mice was increased compared with SIRT2-KO animals administered MG132;

Figure 7C shows that BAF155 expression in SIRT2-WT mouse heart tissue significantly decreased after CHX administration, while the SIRT2-KO mouse group maintained very high BAF155 expression over time;

Figure 7D shows that consistent with degradation through the ubiquitin-proteasome pathway, enhanced ubiquitination levels of BAF155 were detected after Myc-SIRT2 overexpression and MG132 treatment compared with the Flag-control plasmid group;

Figure 7E shows that the ubiquitination level of BAF155 increased after overexpression of WT-SIRT2-Flag, but not H187YQ167A-SIRT2-Flag (mutated SIRT2 without deacetylation activity);

Figures 7F and 7G respectively show that with the overexpression of four acetyltransferases, upregulation of BAF155 abundance (Figure 7F) and reduction in ubiquitination levels (7G) were only observed in cells overexpressing CBP;

Figure 7H shows that SIRT2 overexpression enhanced ubiquitination levels in BAF155-WT cells compared with the BAF155-K948R counterpart, indicating that BAF155 is deacetylated by SIRT2 at K948, leading to ubiquitination at the same site and promoting Degradation of BAF155;

Figure 7I-Figure 7O demonstrates that WWP2 is involved in SIRT2-mediated deacetylation-induced BAF155 degradation. HA-WWP2 is expressed in NC and shSIRT2H9c2 cell lines; among them, the abundance of BAF155 gradually decreased in NC cell lines, while in shSIRT2 cells maintained at high levels in NC cells (Fig. 7I); compared with NC cells, the level of BAF155 ubiquitination mediated by WWP2 was reduced in shSIRT2 treatment (Fig. 7J); in addition, Myc-SIRT2 overexpression resulted in a negative relationship between BAF155 and WWP2 Binding was elevated, but not associated with K948R-BAF155 overexpression (Figure 7K); the above findings further suggest that SIRT2 promotes ubiquitination of BAF155 via WWP2; furthermore, the applicants aimed to verify that the BAF155-PARP1 damage complex is regulated by SIRT2-WWP2 ; Applicants found that the ubiquitination level of PARP1 significantly increased after overexpression of Flag-SIRT2 and HA-WWP2 and decreased with further overexpression of Flag-BAF155 (Figure 7L); then, overexpression of K249R-PARP1 (mutated PARP1 has no ubiquitination site mediated by BAF155 and WWP2), and the level of ubiquitination observed on PARP1 was negligible (Figure 7L); the above results indicate that SIRT2 promotes BAF155 through WWP2-mediated ubiquitination of K948 Degradation, WWP2 mainly regulates the degradation of PARP1 through K249 ubiquitination; Applicants further examined the effect of SIRT2 on the PARP1-BAF155 complex; with the overexpression of Myc-SIRT2, the binding of PARP1 to BAF155 was reduced (Figure 7M); Consistent with previously reported results, PARP1 expression was decreased in shBAF155-H9C2 cell lines with or without AngII induction (Fig. 7N), but BAF155 expression was increased and PARP1 expression was decreased in shSIRT2-H9C2 cells ( Figure 7O); PARP1 expression was higher in shBAF155 and shSIRT2H9C2 cells compared with shBAF155H9C2 cells (Figure 7N), but lower than that in shSIRT2H9C2 cells (Figure 7O); these findings indicate that SIRT2 complexes BAF155-PARP1 by promoting the degradation of BAF155 Things are unstable;

Figure 8 shows proteomic analysis of differential proteins in SIRT2 knockout and transgenic mice indicating that SIRT2 promotes the ubiquitination of BAF155 and PARP1 through WWP2 in vivo, where:

Figure 8A shows that the binding of BAF155 to PARP1 was enhanced after treatment with AngII compared with SIRT2-WT mouse samples with or without AngII administration, and was significantly enhanced in the heart tissue of SIRT2-KO mice;

Figures 8B and 8C show that in SIRT2-WT mouse heart tissue, respectively, the ubiquitination levels of BAF155 and PARP1 were reduced after AngII treatment compared with WT mouse samples, and significantly in SIRT2-KO mouse heart tissue. reduce;

Figures 8D-8H show that compared with SIRT2-WT animals, the binding of WWP2 to BAF155 and PARP1 was reduced in the heart tissue of SIRT2-KO mice administered or not administered AngII (Fig. 8D); conversely, compared with SIRT2-WT animals, Or compared with the SIRT2-WT group without AngII administration, the binding of BAF155 to PARP1 was reduced in the heart tissue of SIRT2-TG mice (Figure 8E); compared with SIRT2-WT mice, BAF155 in the heart tissue of SIRT2-TG mice and PARP1 ubiquitination levels were significantly increased (Figures 8F and 8G); furthermore, compared with SIRT2-WT animals, WWP2 interacted with BAF155 and PARP1 in the heart tissue of SIRT2-TG mice administered or not administered AngII. Binding increased (Fig. 8H).

Detailed ways

The present application will be further described below with reference to the accompanying drawings and examples. It should be understood that the examples are only used to further illustrate and illustrate the present application, and are not intended to limit the present application.

Example 1

1. Materials and methods

1.1 BAF155, WWP2 and SIRT2 knockout and transgenic mice

Conditional cardiomyocyte-specific knockout (KO) mice, including Myh6Cre+, BAF155Fl/Fl (BAF155-cKO) and Myh6Cre-, BAF155Fl/Fl (BAF155-cWT), BAF155-WT and BAF155-TG mice (CAG-initiated Sub) obtained from Shanghai Southern Model Biotechnology Co., Ltd.;

Conditional cardiomyocyte-specific knockout mice, including Myh6Cre+, WWP2Fl/Fl (WWP2-cKO) and Myh6Cre-, WWP2Fl/Fl (WWP2-cWT) animals, and SIRT2-KO mice were obtained from DengCX, Faculty of Health Sciences, University of Macau .

SIRT2 transgenic (SIRT2-TG) mice (CAG promoter) were obtained from Shanghai Southern Model Biotechnology Co., Ltd.

In this study, 8- to 10-week-old specific pathogen-free (SPF) male mice were included. In the AngII and NaCl infusion mouse model, BAF155-cKO, BAF155-cWT, BAF155-WT, BAF155-TG, WWP2-cKO, WWP2-cWT, SIRT2-WT, SIRT2-KO and SIRT2-TG mice (per Group 6 (total n = 120) were randomly assigned to groups and anesthetized (2% isoflurane in oxygen; 1,500 ml/min). Cardiac remodeling was then induced by incision and subcutaneous implantation of an osmotic minipump (Alzet) in the midscapula according to the manufacturer's instructions. Over the next 14 days, the mice were euthanized by cervical dislocation. All animal studies were approved by the Animal Science Committee of China Medical University (Protocol No. 2019026).

1.2. Proteomics and acetylation, ubiquitination proteomics

1.2.1 Protein extraction

Specimens were pulverized in liquid nitrogen and placed in 5-mL tubes, supplemented with four volumes of lysis buffer (8 M urea, 1% protease inhibitor cocktail, 3 μM TSA, 50 mM NAM) and sonicated on ice with a Scientz ultrasonic homogenizer. Process 3 times. Subsequently clear by centrifugation at 12,000g and 4°C for 10 minutes. The protein concentration of the resulting supernatant was measured using a BCA kit.

1.2.2 Trypsin digestion

An equal amount of total protein per sample was enzymatically digested, and the volume was adjusted to be consistent across the entire sample set. TCA was added dropwise to a final concentration of 20%, then vortexed and allowed to settle at 4°C for 2 h. Centrifuge at 4500g for 5 minutes, and the resulting precipitate is washed twice with pre-cooled acetone. The pellet was then dried, resuspended in 200 mM TEAB by sonication, and trypsin was added to each sample at 1:50 (protease:protein, w/w) for overnight digestion. Dithiothreitol (DTT) was added at 5mM and incubated at 56°C for 30 minutes. Then, 11 mM iodoacetamide (IAA) was added and incubated in the dark at room temperature for 15 minutes.

1.2.3 Enrichment of post-translationally modified peptides

The peptides were dissolved in IP buffer (100mM NaCl, 1mM EDTA, 50mM Tris-HCl, 0.5% NP-40, pH 8.0) and mixed with prewashed anti-lysine acetylation and anti-ubiquitin residue antibody resin (PTM- 104 and PTM-1104; Hangzhou Jingjie PTM-Bio) and shake gently at 4°C overnight. Wash the antibody resin with IP buffer and deionized water respectively. Finally, the enriched peptides were eluted three times with 0.1% trifluoroacetic acid and C18ZipTips cleaning.

1.2.4 LC-MS/MS analysis

Tryptic peptides were dissolved in liquid chromatography mobile phase A and separated on the NanoElute Ultra High Performance Liquid System. Mobile phases A and B were 0.1% formic acid and 2% acetonitrile in water and 0.1% formic acid in acetonitrile, respectively. Peptides were eluted at a constant flow rate of 450 nL/min using a gradient set to XXX. The elution gradient settings were: 0-72 min, 7%-24% B; 72-84 min, 24%-32% B; 84-87 min, 32%-80% B; 87-90 min, 80% B. Ionization was performed with an injected capillary ion source and a TIMS-TOFPro mass spectrometer (ion source voltage, 1.6 kV; scan range, 100-1700 mA). Parallel accumulated serial fragmentation (PASEF) mode is enabled for data acquisition. Precursors with charge states 0 to 5 were selected for fragmentation, and 10 PASEFMS/MS scans were performed per cycle. MS/MS scans have a dynamic exclusion time of 30 seconds to prevent multiple scans of the same precursor ion.

1.2.5 Database search

Maxquant (v1.6.15.0) searches raw mass spectrometry data against the Swissprot protein sequence database (Mus_musculus_10090_SP_20201214.fasta), which contains reverse decoy entries and common contaminating proteins. Trypsin/P digestion allows up to 2 missing cleavages, requiring at least 7 amino acids per peptide. The mass error tolerance is 10 ppm for precursor ions and 20 ppm for product ions. Cysteine alkylation (carbamoylmethyl [C]) is considered a fixed modification. Variable modifications are methionine oxidation and N-terminal acetylation. Lysine acetylation and diglycine on lysine were also set as variable modifications for corresponding modification enrichment analysis. The FDR for both protein and PSM identification was 1%.

1.2.6 Gene Ontology (GO) analysis

UniProt-GOA database (www.http://www.ebi.ac.uk/GOA/) was used for GO annotation. First, the obtained protein identifications are mapped to GOIDs based on their single-port IDs. For proteins that are not annotated in UniProt-GOA, InterProScan is used to annotate GO functions based on protein sequence alignment. Proteins were assigned to biological processes, cellular components, and molecular functions as GO terms. Within each category, a two-tailed Fisher test was used to evaluate the enrichment of differentially expressed proteins against all detected proteins; a corrected p<0.05 indicates statistical significance.

1.2.7 Subcellular localization

Wolfpsort, the latest version of PSORT/PSORTII, is used to predict the subcellular localization of eukaryotic proteins.

1.3 Histopathological evaluation

Myocardial tissue samples were fixed in formalin (4%) for 4 hours, embedded in paraffin, and sectioned at 5 μm. After dewaxing in xylene, they were rehydrated with graded ethanol, and then stained with H&E and Masson's trichrome (G1340; Solarbio, China).

Frozen myocardial tissue sections were examined by immunofluorescence. The cross-sectional area of cardiomyocytes was evaluated in images obtained after staining with 5 μM MWGA (Thermo, USA). H9c2 cells were given 10-5 μM AngII or treated with Nacl for 48 hours. Then, cells were fixed with 4% formalin and treated with WGA (5 μM) for 10 min at room temperature before fluorescence microscopy analysis.

1.4. Echocardiography and left ventricular function (LVEF) assessment

The cardiac functions of Myh6Cre+, BAF155Fl/Fl, Myh6Cre-, BAF155Fl/Fl, BAF155-WT and BAF155-TG groups were measured on the VisualSonics Vevo2100 real-time high-resolution intravital microscopy system (Visualsonic, Canada). Anesthetize 24 mice with 1.5% isoflurane and then pass through the 40MHz transducer Cardiac function analysis was performed with continuous oxygen supply. Check LVEF by 2D M-mode recording. Cardiac function measurements were based on interventricular septal dimension (IVSd), left ventricular posterior wall dimension (PWTd), systolic LV internal dimension (LVD), diastolic LV internal dimension (LVDd), and LV mass measurements. In addition, left ventricular ejection fraction (EF%) and fractional shortening (FS%) were determined.

1.5. Cells and Treatment

HEK293T and H9c2 cells (ATCC) were cultured in high glucose Dulbecco's modified Eagle medium containing 10% FBS (HyClone) at 37°C in a humidified 5% CO2 incubator.

1.6. Plasmid construction, antibodies and reagents

Various commercially available plasmids are listed in Table 1

Table 1

Lipofectamine 3000 (Invitrogen, USA) was used for transfection. Lentivirus is used for shRNA transduction. Table 2 lists all antibodies used in the study.

Table 2

MG132 (A2585), a proteasome inhibitor, and cycloheximide (CHX, A8244) were purchased from Apexbio (USA) and dissolved with DMSO. AngII (A9525; Sigma, USA) in DMSO was used, The concentration is 10 μM. AGK2 is provided by Selleck (USA).

1.7. Quantification of PARP1 and BAF155 ubiquitination

Mouse myocardial tissue samples were lysed using 1% SDS buffer (TrispH7.5, 0.5mMEDTA and 1mMDTT), boiled for 10 minutes, and then saturated with Tris-HCL (pH8.0). Cells transfected with HA-tagged (HA)-ubiquitin, full-length human Myc-PARP1 and mutant Myc-PARP1 plasmids; or full-length human Flag-BAF155 and mutant Flag-BAF155 plasmids were also cleaved as described above. Cell lysates were sequentially incubated with anti-PARP1 or anti-BAF155 antibodies (1 μg/mg cell lysate; 4°C) and protein A/G (B23202) or anti-Myc (B26302) or anti-Flag immunoprecipitation magnetic beads (Biotool, USA) 12 Hour.

1.8. Co-immunoprecipitation

Mouse myocardial tissue samples and cells were lysed with Flag lysis buffer [50mM Tris, 137mM NaCl, 1mM EDTA, 10mM NaF, 0.1mM Na3VO4, 1% NP-40, 1mM dithiothreitol [DTT], and 10% glycerol, pH 7.8]. Protease inhibitor (Bimake). The resulting lysate was incubated with 30 μl of anti-Flag/Myc affinity gel (B23102/B26302, Biotool; 12 hours at 4°C or sufficient antibody (1 μg/mg cell lysate; 2-3 hours) and protein A/G). Immunoprecipitate (B23202; Biotool) in 30 μl for 12 hr at 4°C. Immunoprecipitated complexes were separated by SDS-PAGE and then electrotransferred to PVDF membrane. Membrane was blocked (5% bovine serum albumin) in ambient 1 hr, followed by sequential incubations with primary (4°C, overnight) and secondary (ambient, 1 hr) antibodies. Ubiquitinated BAF155 and PARP1 were incubated with anti-Myc, anti-Flag, anti-PARP1 or anti-BAF155 antibodies, respectively. HA antibodies were used for detection. ImageJv1.46 (National Institutes of Health) was used for signal quantification and then normalized to GAPDH and tubulin expression.

1.9. Statistical analysis

Data are shown as mean ± standard deviation (SD). Homogeneity of variances across two and multiple groups was assessed by F- and Brown-Forsythe tests, respectively. The Shapiro-Wilk test was performed to assess normality. Normally distributed and skewed distributed data of the two groups were compared by Student's t test and Welch's t test, respectively. One-way ANOVA and two-way ANOVA followed by post hoc Bonferroni test were performed for multiple group comparisons involving one and two parameters respectively. P values were appropriately adjusted for multiple comparisons. SPSS22.0 (SPSS, USA) was used for statistical analysis, and P<0.05 indicated statistical significance.

2. Results and Analysis

2.1. Myocardial-specific BAF155 knockout can significantly alleviate cardiac hypertrophy and heart failure in mouse models

To determine the function of BAF155 in mouse cardiac remodeling, BAF155-cWT and myocardial-specific BAF155 knockout (BAF155-cKO) mice were exposed to continuous 0.9% NaCl and AngII (2 mg/kg/day) for two weeks ( Figure 1A). Immunofluorescence and Western blotting showed that BAF155 was specifically knocked out in cardiac tissue (Fig. 1B-C). BAF155-cKO significantly attenuated AngII-induced cardiac dysfunction (Fig. 1D) compared with BAF155-cWT mice, which was reflected by increases in EF% (Fig. 1E) and FS% (Fig. 1F) in mice. H&E and WGA staining data showed that AngII increased the size of cardiomyocytes and the cross-sectional area of cardiomyocytes in BAF155-cWT mice, while this change was not significant in BAF155-cKO mice given AngII (Figure 1G) . Compared with BAF155-cWT mice, BAF155-cKO significantly inhibited the AngII-induced increase in HW/BW and HW/TL ratios (Figure 1H-I), indicating that cardiac-specific knockout of BAF155 alleviated cardiac hypertrophy in mice. . Furthermore, BAF155-cKO significantly reduced AngII-induced expression of ANP, BNP, cleavedcaspase-3, and PARP1 in mice compared with BAF155-cWT mice (Fig. 1J). Likewise, with BAF155-cWT Compared with mice, the level of AngII-induced myocardial fibrosis in BAF155-cKO mice was significantly reduced (Figure 1K), and the expression of myocardial fibrosis-related proteins α-SMA and collagen I was reduced (Figure 1L). Overall, these results indicate that cardiac-specific knockout of BAF155 alleviates cardiac remodeling in mice.

2.2. BAF155 overexpression significantly aggravates cardiac hypertrophy and heart failure in mouse models

Next, BAF155-WT and BAF155 transgenic mice (BAF155-TG) were exposed to continuous 0.9% NaCl and AngII (2 mg/kg/day) for two weeks (Fig. 2A). Western blotting showed that BAF155 was specifically overexpressed in cardiac tissue (Fig. 2B). BAF155-TG significantly exacerbated AngII-induced cardiac dysfunction (Fig. 2C), as reflected by increases in EF% (Fig. 2D) and FS% (Fig. 2E) in mice compared with BAF155-WT mice. H&E and WGA staining data showed that AngII administration resulted in an increase in cardiomyocyte size and cardiomyocyte cross-sectional area in BAF155-TG mice compared with BAF155-WT mice (Fig. 2F). Compared with BAF155-WT mice, BAF155-TG significantly exacerbated AngII-induced increases in HW/BW and HW/TL ratios (Fig. 2G-H), indicating that overexpression of BAF155 causes cardiac hypertrophy in mice. In addition, AngII-induced expression of ANP, BNP, cleavedcaspase-3, and PARP1 were all increased in BAF155-TG mice compared with BAF155-WT mice (Fig. 2I). Similarly, BAF155-TG significantly aggravated AngII-induced myocardial fibrosis in mice (Fig. 2J) and upregulated α-SMA and collagen I (Fig. 2K) compared with BAF155-WT mice. Overall, these results indicate that overexpression of BAF155 exacerbates cardiac remodeling in mice.

2.3.PARP1 acts as a key BAF155-binding protein under physiological conditions

The biological association of BAF155 and PARP1 was verified. First, the interaction of endogenous BAF155 with PARP1 was assessed by co-immunoprecipitation (Fig. 3A-B). Furthermore, the interaction of BAF155 with PARP1 was induced by AngII (Fig. 3C). Furthermore, PARP1 interacted with the 476-779 amino acid domain of PARP1, the PARP-A-helical domain (Fig. 3D). The above findings suggest that the BAF155-PARP1 axis may regulate cardiac remodeling.

2.4.BAF155 stabilizes PARP1 and reduces PARP1-K249 by inhibiting E3 ubiquitin ligase WWP2 ubiquitination

In order to explore the regulatory mechanism of BAF155 on PARP1, Applicants first examined whether BAF155 regulates the expression of PARP1 protein. As shown in Figure 4A , elevated expression of BAF155 resulted in synchronized expression of PARP1. Consistently, BAF155 silenced with 56438shBAF155RNA (SEQ ID NO: 2TGGGAAGCGTCGAAATCAGAA) significantly downregulated PARP1 expression (Figure 4B). Furthermore, the abundance of PARP1 gradually decreased in the Flag control group, while BAF155 overexpression maintained PARP1 expression in the presence of increased CHX, a transcriptional inhibitor used to inhibit PARP1 protein synthesis (Fig. 4C). The above findings indicate that BAF155 inhibits PARP1 degradation by blocking the proteasome pathway. Furthermore, after MG132 treatment, PARP1 expression was increased (rate and extent) in BAF155-overexpressing cells compared with Flag control cells (Fig. 4D). These data suggest that overexpression of BAF155 maintains PARP1 expression by inhibiting degradation by the proteasome pathway. Consistent with degradation through the ubiquitin-proteasome pathway, the ubiquitination level of PARP1 was reduced after transfection with Flag-BAF155 compared with the Flag-control plasmid group (Fig. 4E). At the same time, the ubiquitination level of PARP1 was increased by BAF155 knockdown (Fig. 4F).

Applicants' previous studies found that ubiquitination on K249 is one of the key modifications of PARP1. Therefore, to further demonstrate that ubiquitination of PARP1 is inhibited by BAF155, Applicants overexpressed PARP1-WT, PARP1-K249R as well as Flag-control and Flag-BAF155. As shown in Figure 4G, BAF155 reduced Ubiquitination levels in the PARP1-WT group, but not in PARP1-K249R cells, indicating that BAF155 inhibits PARP1 ubiquitination on K249.

Next, Applicants aimed to determine which E3 ubiquitination ligase mediates BAF155-inhibited PARP1 ubiquitination. In the applicant's previous work, the applicant discovered that WWP2 is a specific E3 ubiquitination ligase of PARP1 and ubiquitinates the PARP1-K249 site. At the same time, WWP2 is also the E3 ubiquitination ligase of BAF155. Under treatment of MG132, the degradation of PARP1 and BAF155 was blocked by exogenous immunoassay, resulting in enhanced interaction of BAF155 and PARP1 with WWP2 (Fig. 4H). Furthermore, the binding of PARP1 to WWP2 was increased after BAF155 knockdown (Fig. 4I), while overexpression of BAF155 led to a decrease in the binding of PARP1 to WWP2 (Fig. 4J). When WWP2 was overexpressed, the ubiquitination level of PARP1 decreased after overexpressing Flag-BAF155 compared with the Flag control group (Figure 4K).

Applicants' previous studies found that ubiquitination of PARP1-K249 is dependent on E3 ubiquitination of WWP2. Interestingly, modification of PARP1-K249 relies on upstream deacetylation of SIRT2 at the same site. Therefore, in order to verify the molecular regulatory mechanism of BAF155 on PARP1, immunoprecipitation was performed in mouse heart tissue. The binding of PARP1 to WWP2 and SIRT2 was enhanced upon treatment with AngII and significantly increased in heart tissue of BAF155-cKO mice compared with WT with or without AngII treatment (Fig. 4L). In terms of ubiquitination levels of PARP1, Applicants' data show that AngII induces ubiquitination in WT mouse heart tissue (Figure 4M). Furthermore, ubiquitination of PARP1 was significantly increased in heart tissue of BAF155-cKO mice compared with WT mice (Fig. 4M). In contrast, PARP1 binding to WWP2 and SIRT2 was reduced in heart tissue of BAF155-TG mice compared with WT mice (Fig. 4N). Ubiquitination of PARP1 was significantly reduced in heart tissue of BAF155-TG mice compared with WT mice (Fig. 4O).

2.5. Proteomic analysis identified K948 on BAF155 as specifically regulated by SIRT2

Endogenous and exogenous co-immunoprecipitation confirmed that SIRT2 interacts with BAF155 (Fig. 5A-C). Furthermore, the interaction between SIRT2 and BAF155 was enhanced upon induction by AngII (Fig. 5D and E). According to the UniProt database, BAF155 contains five functional domains, including Chromo, SWIRM, SANT, Glu-rich and Pro-rich domains. Using endogenous SIRT2 and either full-length Flag-tagged-BAF155 or various truncated Flag-BAF155 plasmids, Applicants demonstrated that the SWIRM domain of BAF155 is the binding site for SIRT2 (Figure 5F).

Next, the applicant focused on studying the regulatory mechanism of BAF155 acetylation. Acetylation levels of BAF155 are increased after treatment with trichostatin A (TSA) and nicotinamide (NAM), members of the histone deacetylase HDACI and III and deacetylase families of inhibitor (Figure 5G). To identify the specific acetyltransferase of BAF155, four acetyltransferases were transfected, including p300 (300-kDaE1A binding protein), CBP, PCAF (p300/CBP-related factor), and GCN5 (KAT2A). As shown in Figure 5H, overexpression of CBP, but not other acetyltransferases, significantly increased the acetylation level of BAF155. Furthermore, CBP interacted with BAF155 under both endogenous and exogenous conditions (Figures 5I and 5J). Therefore, BAF155 was shown to be a substrate for CBP lysine acetylation. Next, Applicants analyzed global acetylation changes in normal control and shSIRT2 cells treated with or without 20 μmol/LAGK2, a commonly used SIRT2-specific inhibitor. Consistent with previous results, the acetylation level of BAF155 was upregulated in shSIRT2 cells and cells treated with AGK2 compared with normal control cells (Fig. 5K). The above regulation was verified in the heart tissue of WT and SIRT2 knockout mice, which was comparable to that of WT animals. Compared with BAF55, BAF155 levels were significantly enhanced in heart tissue samples from SIRT2 knockout animals (Figure 5L). Furthermore, overexpression of WT-SIRT2 reduced the exogenous acetylation level of BAF155 (Fig. 5M), whereas transfection of an inactive mutant of SIRT2 (H187YQ167A) had no effect (Fig. 5N). Furthermore, acetylation levels of BAF155 were significantly enhanced in heart tissue samples from SIRT2 knockout animals compared with WT animals, regardless of whether induced by AngII (Fig. 5O). The acetylation level of exogenous BAF155 decreased under AngII treatment, and the acetylation level of exogenous BAF155 further decreased with AngII-induced overexpression of exogenous SIRT2 (Fig. 5P).

K948 may represent an important acetylation site for BAF155 regulated by SIRT2. K948 is found throughout evolution, from Drosophila melanogaster to mammalian species (Figure 5Q). To further investigate the critical role of acetylation on K948, an antibody specifically recognizing acetylated K948 of BAF155 was generated (Fig. 5R). The acetylation level of BAF155-K948 increased after administration of TSA and NAM (Fig. 5S). In addition, only CBP increased the acetylation level of BAF155-K948 after exogenous transfection of four acetyltransferases (Fig. 5T). At the same time, exogenous transfection of WT-SIRT2 but not inactivated SIRT2 (H187YQ167A) reduced the acetylation level of BAF155-K948 (Fig. 5U). Taken together, the above data indicate that K948 is specifically regulated by CBP and SIRT2.

2.6. Acetylation proteomic analysis of differential proteins in SIRT2 knockout and transgenic mice demonstrated SIRT2 deacetylation by BAF155-K948 in vivo

To comprehensively understand SIRT2-regulated changes in cardiac lysine acetylation in mice, SIRT2 knockout mice (SIRT2-KO), SIRT2 overexpression mice (SIRT2-TG), and wild-type animals (SIRT2-WT) (Figure 6A ).

Acetylation proteomic analysis of BAF155-K948 in SIRT2 knockout and transgenic mice was validated in biological experiments. Immunoprecipitation assay confirmed that the acetylation level of BAF155-K948 was increased after SIRT2 knockdown with or without AngII administration compared with WT (Fig. 6B), while the acetylation level of BAF155-K948 was smaller in SIRT2-TG. decreased in mouse heart tissue (Fig. 6C).

2.7.SIRT2 promotes BAF155-K948 and PARP1-K294 ubiquitination through WWP2

To investigate the regulatory effect of SIRT2 on the BAF155-PARP1 apoptotic complex, the abundance of BAF155 in SIRT2-WT and SIRT2-KO heart tissues as well as NC and shSIRT2H9c2 cells was analyzed. As shown in Figure 7A, BAF155 abundance increased after SIRT2 downregulation. Applicants observed similar trends using three fragments of shSIRT2 (61965-shSIRT2 SEQ ID NO: 3CTATGCAAACTTGGAGAAATA, 61966-shSIRT2 SEQ ID NO: 4GACCAAAGAGAAAGAGGAACA, 61967-shSIRT2 SEQ ID NO: 5GTGGAAAAGAGTACACGATGA) and followed up using the 61966-shSIRT2 fragment experiment (Figure 7A). Furthermore, the rate and extent of BAF155 upregulation in the heart tissue of SIRT2-WT mice was increased compared with SIRT2-KO animals administered MG132 (Fig. 7B). Meanwhile, BAF155 expression in SIRT2-WT mouse heart tissue significantly decreased after CHX administration, while the SIRT2-KO mouse group maintained very high BAF155 expression over time (Fig. 7C). Consistent with degradation through the ubiquitin-proteasome pathway, enhanced ubiquitination levels of BAF155 were detected after Myc-SIRT2 overexpression and MG132 treatment compared with the Flag-control plasmid group (Fig. 7D). The ubiquitination level of BAF155 increased after overexpression of WT-SIRT2-Flag but not H187YQ167A-SIRT2-Flag (mutated SIRT2 without deacetylation activity) (Fig. 7E). In contrast, with the overexpression of the four acetyltransferases, only when overexpressing Increased abundance of BAF155 (Figure 7F) and reduced ubiquitination levels (Figure 7G) were observed in CBP-treated cells.

To directly show that SIRT2 promotes ubiquitination of BAF155, Applicants identified deacetylation sites of BAF155 that are regulated by SIRT2. As shown in Figure 7H, SIRT2 overexpression enhanced ubiquitination levels in BAF155-WT cells compared with the BAF155-K948R counterpart, indicating that BAF155 is deacetylated by SIRT2 at K948, leading to ubiquitination at the same site And promote the degradation of BAF155. Briefly, K948 was identified by SIRT2 as the major deacetylation site of BAF155.

As applicants mentioned above, BAF155 shares the same E3 ubiquitin ligase WWP2 as PARP1. Next, to explore whether WWP2 is involved in SIRT2-mediated deacetylation-induced BAF155 degradation, HA-WWP2 was expressed in NC and shSIRT2H9c2 cell lines. Interestingly, the abundance of BAF155 gradually decreased in NC cell lines while remaining at high levels in shSIRT2 cells (Figure 7I). The level of BAF155 ubiquitination mediated by WWP2 was reduced in shSIRT2 treatment compared with NC cells (Fig. 7J). Furthermore, Myc-SIRT2 overexpression led to increased binding between BAF155 and WWP2, but not K948R-BAF155 overexpression (Fig. 7K). The above findings further indicate that SIRT2 promotes the ubiquitination of BAF155 through WWP2. Additionally, applicants aimed to verify that the BAF155-PARP1 damage complex is regulated by SIRT2-WWP2. Applicants found that the ubiquitination level of PARP1 increased significantly after overexpression of Flag-SIRT2 and HA-WWP2 and decreased with further overexpression of Flag-BAF155 (Figure 7L). Then, by overexpressing K249R-PARP1 (mutated PARP1 without ubiquitination sites mediated by BAF155 and WWP2), negligible levels of ubiquitination were observed on PARP1 (Fig. 7L). The above results indicate that SIRT2 promotes the degradation of BAF155 through WWP2-mediated K948 ubiquitination, and WWP2 mainly regulates the degradation of PARP1 through K249 ubiquitination. Applicants further examined the effect of SIRT2 on the PARP1-BAF155 complex. With overexpression of Myc-SIRT2, PARP1 binding to BAF155 was reduced (Fig. 7M). Consistent with previously reported results, PARP1 expression was decreased in shBAF155-H9C2 cell lines with or without AngII induction (Fig. 7N), but BAF155 expression was increased and PARP1 expression was decreased in shSIRT2-H9C2 cells ( Figure 7O). Compared with shBAF155H9C2 cells, PARP1 expression was higher in shBAF155 and shSIRT2H9C2 cells (Fig. 7N), but lower than that in shSIRT2H9C2 cells (Fig. 7O). These findings suggest that SIRT2 destabilizes the BAF155-PARP1 complex by promoting the degradation of BAF155.

3.8. Proteomic analysis of differential proteins in SIRT2 knockout and transgenic mice showed that SIRT2 Promotes ubiquitination of BAF155 and PARP1 via WWP2

Immunoprecipitation was performed in mouse heart tissue; BAF155 binding to PARP1 was enhanced after treatment with AngII and significantly enhanced in SIRT2-KO mouse heart tissue compared with samples from SIRT2-WT mice administered with or without AngII (Figure 8A). Furthermore, in SIRT2-WT mouse heart tissue, the ubiquitination levels of BAF155 and PARP1 were reduced after AngII treatment compared with WT mouse samples, and were significantly reduced in SIRT2-KO mouse heart tissue (Figure 8B, 8C). Furthermore, WWP2 binding to BAF155 and PARP1 was reduced in heart tissue of SIRT2-KO mice administered or not administered AngII compared with SIRT2-WT animals (Fig. 8D). In contrast, the binding of BAF155 to PARP1 was reduced in the heart tissue of SIRT2-TG mice compared with the SIRT2-WT group administered with or without AngII (Fig. 8E). Compared with SIRT2-WT mice, the ubiquitination levels of BAF155 and PARP1 were significantly increased in the heart tissue of SIRT2-TG mice (Figures 8F and 8G). Furthermore, WWP2 binding to BAF155 and PARP1 was increased in the heart tissue of SIRT2-TG mice administered or not administered AngII compared with SIRT2-WT animals (Fig. 8H).

Discussion and conclusion

Applicants identified BAF155 (SMARCC1), a subunit of the SWI/SNF chromatin remodeling complex, as an important in vivo interacting protein of PARP1. Applicants' work shows that BAF155 stabilizes PARP1 by interfering with the interaction between PARP1 and WWP2, E3 ubiquitin ligases, and the subsequent ubiquitination of PARP1. Therefore, the above evidence points to a possible new mechanism to maintain high local concentration and activation state of PARP1 through colocalization to stabilize its interacting proteins.

Based on the applicant's model mechanism, low-activity SIRT2 retains higher levels of acetylation on K948 of BAF155 and K249 of PARP1, thereby allowing BAF155 and PARP1 to maintain an interactive state and prevent ubiquitination by WWP2.

Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present application and are not limiting. Although the present application has been described in detail through the above preferred embodiments, those skilled in the art should understand that the technical solutions can be modified in form and Various changes can be made to the details without departing from the scope defined by the claims of this application.

Claims

A BAF155 mutant or an active fragment thereof, characterized in that, compared with wild-type BAF155, the BAF155 mutant or an active fragment thereof contains a mutation of K948R.
The BAF155 mutant or active fragment thereof according to claim 1, wherein the sequence of the BAF155 mutant is as shown in SEQ ID NO: 1.
An isolated nucleic acid molecule, characterized in that the nucleic acid molecule encodes the BAF155 mutant or active fragment thereof according to claim 1 or 2.
A vector, characterized in that the vector contains the isolated nucleic acid molecule as claimed in claim 3.
A host cell, characterized in that the host cell contains the vector according to claim 4.
A pharmaceutical composition, characterized in that the pharmaceutical composition contains the BAF155 mutant or active fragment thereof according to claim 1 or 2.
The pharmaceutical composition according to claim 6, characterized in that the pharmaceutical composition further comprises a pharmaceutically acceptable diluent, excipient and/or carrier.
Use of the BAF155 mutant or active fragment thereof as claimed in claim 1 or 2 or the pharmaceutical composition as claimed in claim 6 or 7 in the preparation of a medicament for preventing or treating cardiac remodeling.
The use according to claim 8, wherein the cardiac remodeling is AngII-induced cardiac remodeling.
The use according to claim 8, wherein the cardiac remodeling is selected from one or more of cardiac hypertrophy, cardiac fibrosis and/or heart failure.