CN114989287A - Deacetylated and modified BAF155 protein and pharmaceutical application thereof - Google Patents

Abstract

The invention provides a deacetylated modified BAF155 protein and a pharmaceutical application thereof. The invention provides a deacetylated modified BAF155 protein or an active fragment thereof, wherein the deacetylated modified BAF155 protein comprises an amino acid sequence as shown in SEQ ID NO:1, compared with a wild-type BAF155 protein, wherein lysine is deacetylated. The invention also provides application of the deacetylated and modified BAF155 protein or the active fragment thereof in preparing a medicament for preventing or treating cardiac remodeling. The applicant finds that BAF155 interacts with the BRCT domain of PARP1, and the deacetylation state of BAF155 activates E3 ubiquitin ligase WWP2, and then ubiquitination degrades the K948 site of PARP1, and acts synergistically with SIRT2 to prevent cardiac remodeling, thus providing a new idea and research direction for the treatment and prevention of cardiovascular diseases.

Description

Deacetylated and modified BAF155 protein and pharmaceutical application thereof

Technical Field

The present application relates to the field of medicaments for the prevention or treatment of cardiac remodeling. In particular, the application relates to a deacetylated modified BAF155 protein or an active fragment thereof, and the application also relates to a pharmaceutical application of the deacetylated modified BAF155 protein or the active fragment thereof.

Background

Non-infectious diseases (NCDs), which account for nearly half of cardiovascular diseases (CVD), have become a major pathology worldwide over infectious diseases. At the same time, cardiovascular disease remains the most fatal pathology worldwide. With the rapid increase of the Chinese living standard and the great change of the living style, the prevalence and the death rate of cardiovascular diseases are increased remarkably. With the advent of an aging society, heart disease has become one of the most important health problems worldwide. Ventricular remodeling, including myocardial hypertrophy and fibrosis, underlies the etiology of heart failure. Poly (ADP-ribose) polymerase 1(PARP1) is an important damaging factor for CVD, especially cardiac remodeling caused by a variety of factors. PARP1 up-regulation and enhanced PARP1 activity occurs in cardiac remodeling, resulting in the consumption of extremely high energy by damaged cardiomyocytes. However, it is currently unclear how PARP1 is regulated in cardiac remodeling.

SWI/SNF (mating type switch/sucrose non-fermentation) is a multi-subunit ATP-dependent chromatin remodeling complex, a basic epigenetic regulator of gene transcription. BAF155, also known as SMARCC1, represents the SWI/SNF subunit. As a helicase and atpase, BAF15 regulates gene transcription by altering chromatin structure around the gene. BAF155 has been reported to contribute to a variety of physiological and pathological events, including cancer, development, and the like.

However, although BAF155 is abundant in the heart, its role in the myocardium is not yet clear.

Disclosure of Invention

The technical scheme of the application is provided on the basis of the following research:

applicants found that AngII-induced cardiac remodeling (including cardiac hypertrophy, fibrosis and failure) was significantly reduced in BAF155 myocardial-specific knockout mice. In contrast, overexpression of BAF155 in mice significantly aggravates cardiac remodeling. BAF155 was found to bind PARP1 in the PARP1-BRCT domain and inhibit ubiquitination of PARP1 at K249 by interfering with WWP2, an important E3 ubiquitin ligase. Applicants found that BAF155 was identified under physiological conditions as a novel substrate for the acetyltransferase CBP and the deacetylase SIRT 2. CBP/SIRT2 interacts with BAF155 and is acetylated/deacetylated at K948 of BAF 155. The same lysine site of BAF155 is ubiquitinated by WWP2, thereby inducing downstream degradation of BAF155 by the proteasome. Cross-talk between acetylation and ubiquitination of BAF155 dynamically modulates the stability of the BAF155-PARP1 complex in a competitive manner. In summary, applicants' studies identify a novel role for BAF155 and its upstream and downstream regulatory mechanisms in cardiac remodeling. In particular, BAF155 interacts with PARP1, reducing degradation of PARP1 and exacerbating cardiac remodeling by inhibiting WWP 2.BAF155 is regulated by SIRT2 mediated deacetylation, which helps mobilize WWP2 to degrade BAF155 and dissociate BAF155-PARP1 cardiac remodeling injury complex. The discovery of the application provides a new research direction for the treatment and prevention of cardiac remodeling damage.

Therefore, the purpose of the application is realized by the following technical scheme:

the first aspect of the present invention provides a deacetylated modified BAF155 protein or an active fragment thereof, wherein the deacetylated modified BAF155 protein or an active fragment thereof comprises an amino acid sequence as set forth in SEQ ID NO:1, wherein lysine at position 948 is deacetylated, compared to a wild-type BAF155 protein.

SEQ ID NO:1

MAAAAGGGGPGTAVGATGSGIAAAAAGLAVYRRKDGGPATKFWESPETVSQLDSVRVWLGKHYKKYVHADAPTNKTLAGLVVQLLQFQEDAFGKHVTNPAFTKLPAKCFMDFKAGGALCHILGAAYKYKNEQGWRRFDLQNPSRMDRNVEMFMNIEKTLVQNNCLTRPNIYLIPDIDLKLANKLKDIIKRHQGTFTDEKSKASHHIYPYSSSQDDEEWLRPVMRKEKQVLVHWGFYPDSYDTWVHSNDVDAEIEDPPIPEKPWKVHVKWILDTDIFNEWMNEEDYEVDENRKPVSFRQRISTKNEEPVRSPERRDRKASANARKRKHSPSPPPPTPTESRKKSGKKGQASLYGKRRSQKEEDEQEDLTKDMEDPTPVPNIEEVVLPKNVNLKKDSENTPVKGGTVADLDEQDEETVTAGGKEDEDPAKGDQSRSVDLGEDNVTEQTNHIIIPSYASWFDYNCIHVIERRALPEFFNGKNKSKTPEIYLAYRNFMIDTYRLNPQEYLTSTACRRNLTGDVCAVMRVHAFLEQWGLVNYQVDPESRPMAMGPPPTPHFNVLADTPSGLVPLHLRSPQVPAAQQMLNFPEKNKEKPVDLQNFGLRTDIYSKKTLAKSKGASAGREWTEQETLLLLEALEMYKDDWNKVSEHVGSRTQDECILHFLRLPIEDPYLENSDASLGPLAYQPVPFSQSGNPVMSTVAFLASVVDPRVASAAAKAALEEFSRVREEVPLELVEAHVKKVQEAARASGKVDPTYGLESSCIAGTGPDEPEKLEGAEEEKMEADPDGQQPEKAENKVENETDEGDKAQDGENEKNSEKEQDSEVSEDTKSEEKETEENKELTDTCKERESDTGKKKVEHEISEGNVATAAAAALASAATKAKHLAAVEERKIKSLVALLVETQMKKLEIKLRHFEELETIMDREKEALEQQRQQLLTERQNFHMEQLKYAELRARQQMEQQQHGQNPQQAHQHSGGPGLAPLGAAGHPGMMPHQQPPPYPLMHHQMPPPHPPQPGQIPGPGSMMPGQHMPGRMIPTVAANIHPSGSGPTPPGMPPMPGNILGPRVPLTAPNGMYPPPPQQQPPPPPPADGVPPPPAPGPPASAAP

The deacetylation modified BAF155 protein or the active fragment thereof according to the present invention, wherein the deacetylation of lysine at position 948 is achieved by modification of lysine deacetylase (KDACs) deacetylation.

In a second aspect of the present invention, there is provided a pharmaceutical composition comprising said deacetylated modified BAF155 protein or an active fragment thereof.

The pharmaceutical composition according to the present invention, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable diluent, excipient and/or carrier.

In a third aspect the invention provides a formulation wherein said formulation deacetylates BAF155 protein, said deacetylated modified BAF155 protein or active fragment thereof comprising the amino acid sequence as shown in SEQ ID NO:1, wherein the lysine at position 948 is deacetylated.

The formulation according to the invention, wherein the formulation comprises lysine deacetylase.

In a fourth aspect, the present invention provides the use of a deacetylated modified BAF155 protein or an active fragment thereof in the manufacture of a medicament for the prevention or treatment of cardiac remodeling.

The cardiac remodeling is AngII-induced cardiac remodeling; and/or

The cardiac remodeling is selected from one or more of myocardial hypertrophy, cardiac fibrosis and/or heart failure.

The fifth aspect of the invention provides the pharmaceutical composition and the use of the preparation in the preparation of a medicament for preventing or treating cardiac remodeling.

According to the use of the invention, the cardiac remodeling is AngII-induced cardiac remodeling; and/or

The cardiac remodeling is selected from one or more of myocardial hypertrophy, cardiac fibrosis and/or heart failure.

Compared with the prior art, the method has the following beneficial effects:

BAF155 interacts with PARP1, reducing degradation of PARP1 and exacerbating cardiac remodeling by inhibiting WWP 2.BAF155 is regulated by SIRT2 mediated deacetylation, which helps mobilize WWP2 to degrade BAF155 and dissociate BAF155-PARP1 cardiac remodeling injury complex to prevent cardiac remodeling. Thereby providing a new idea and research direction for the treatment and prevention of cardiac remodeling damage.

Drawings

Embodiments of the present application are described in detail below with reference to the attached drawing figures, wherein:

figure 1 shows that heart-specific knockout of BAF155 reduces cardiac remodeling in mice, where:

wherein, FIG. 1A is a two week exposure of BAF155-cWT mice and myocardial specific BAF155 knockout (BAF155-cKO) mice to sustained 0.9% NaCl and AngII (2 mg/kg/day);

FIGS. 1B-C show results of immunofluorescence and Western blot, respectively, showing that BAF155 is specifically knocked out in cardiac tissue;

figure 1D shows BAF155-cKO significantly reduced AngII-induced cardiac insufficiency compared to BAF155-cWT mice;

fig. 1E and 1F show the increase in left ventricular Ejection Fraction (EF)% and Fractional Shortening (FS)% in mice, respectively;

FIG. 1G is H & E and WGA staining data showing that AngII increased cardiomyocyte size and cardiomyocyte cross-sectional area in BAF155-cWT mice, whereas this change was not significant in BAF155-cKO mice given AngII;

figures 1H-I show that BAF155-cKO significantly inhibited the AngII-induced increase in HW/BW and HW/TL ratios compared to BAF155-cWT mice, respectively, indicating that heart-specific knockout of BAF155 reduced cardiac hypertrophy in the mice;

FIG. 1J shows that BAF155-cKO significantly reduced AngII-induced expression of mouse ANP, BNP, clearveccaspase-3, and PARP1, as compared to BAF155-cWT mice;

figure 1K shows that the level of AngII-induced myocardial fibrosis was significantly reduced in BAF155-cKO mice compared to BAF155-cWT mice;

FIG. 1L shows decreased expression of myocardial fibrosis associated protein α -SMA and collagen I in BAF155-cKO mice compared to BAF155-cWT mice;

figure 2 shows that BAF155 overexpression significantly aggravates myocardial hypertrophy and heart failure in a mouse model, wherein:

FIG. 2A shows BAF155-WT and BAF155 transgenic mice (BAF155-TG) exposed to sustained 0.9% NaCl and AngII (2 mg/kg/day) for two weeks;

figure 2B shows western blot showing BAF155 was specifically overexpressed in cardiac tissue;

figure 2C shows that BAF155-TG significantly aggravates AngII-induced cardiac insufficiency compared to BAF155-WT mice;

fig. 2D and 2E show the increase in left ventricular Ejection Fraction (EF)% and Fractional Shortening (FS)% in mice, respectively;

FIG. 2F shows H & E and WGA staining data, and AngII administration results in increased cardiomyocyte size and cardiomyocyte cross-sectional area in BAF155-TG mice compared to BAF155-WT mice;

FIGS. 2G-H show that BAF155-TG significantly aggravates AngII-induced increases in HW/BW and HW/TL ratios compared to BAF155-WT mice, suggesting that overexpression of BAF155 results in cardiac hypertrophy in mice;

FIGS. 2I-2K show that the expression of AngII-induced ANP, BNP, clearcaspase-3 and PARP1 is elevated in BAF155-TG mice compared to BAF155-WT mice, respectively (FIG. 2I), and also that BAF155-TG significantly aggravates AngII-induced myocardial fibrosis in mice compared to BAF155-WT mice (FIG. 2J) and upregulates α -SMA and collagen I (FIG. 2K);

figure 3 shows that PARP1 acts as a key BAF155 binding protein under physiological conditions and suggests that the BAF155-PARP1 axis may regulate cardiac remodeling, where:

figures 3A and 3B are estimates of the interaction of endogenous BAF155 with PARP1 by co-immunoprecipitation;

figure 3C shows BAF155 interaction with PARP1 induced by AngII;

FIG. 3D shows BAF155 interacting with the 476-779 amino acid domains of PARP1, namely the PARP-A-helical domain;

fig. 4 shows the regulatory mechanism of BAF155 to PARP1, where:

figure 4A shows that elevated expression of BAF155 results in the simultaneous expression of PARP 1;

figure 4B shows BAF155 silenced with 56438shBAF155RNA significantly down-regulated PARP1 expression;

figure 4C shows that the abundance of PARP1 was gradually decreased in the Flag control group, while BAF155 overexpression maintained PARP1 expression with an increase in CHX, a transcriptional inhibitor for inhibiting PARP1 protein synthesis;

figure 4D shows that expression of PARP1 was increased (rate and extent) in BAF155 overexpressing cells after MG132 treatment compared to Flag control cells;

FIG. 4E shows a reduction in the level of ubiquitination of PARP1 following transfection with Flag-BAF155 compared to the Flag-control plasmid group;

figure 4F shows that the level of ubiquitination of PARP1 increased due to BAF155 knockdown;

figure 4G shows BAF155 decreased the level of ubiquitination in the PARP1-WT group, but not in PARP1-K249R cells, indicating that BAF155 inhibited PARP1 ubiquitination on K249;

figures 4H-4K show that the degradation of PARP1 and BAF155 was blocked by exogenous immunoassay under treatment with MG132, resulting in enhanced interaction of BAF155 and PARP1 with WWP2, respectively (4H); furthermore, upon BAF155 knockdown, PARP1 binding to WWP2 increased (fig. 4I), whereas BAF155 overexpression resulted in a decrease in PARP1 binding to WWP2 (fig. 4J); when WWP2 was overexpressed, the level of ubiquitination of PARP1 was reduced after overexpression of Flag-BAF155 compared to Flag control group (fig. 4K);

figures 4L to 4O show that binding of PARP1 to WWP2 and SIRT2, respectively, was enhanced after treatment with AngII and significantly increased in BAF155-cKO mouse heart tissue, compared to WT with or without AngII treatment (figure 4L); in terms of ubiquitination levels of PARP1, applicants' data showed that AngII induced ubiquitination in WT mouse heart tissue (fig. 4M); furthermore, compared to WT mice, ubiquitination of PARP1 was significantly increased in BAF155-cKO mouse heart tissue (fig. 4M); in contrast, PARP1 binding to WWP2 and SIRT2 was reduced compared to WT in BAF155-TG mouse heart tissue (fig. 4N); compared to WT mice, BAF155-TG mice had significantly reduced ubiquitination of PARP1 in heart tissue (fig. 4O);

figure 5 shows that K948 on BAF155 is specifically regulated by SIRT2, where:

FIGS. 5A-C demonstrate that endogenous and exogenous co-immunoprecipitation confirms that SIRT2 interacts with BAF 155;

FIGS. 5D and E show that the interaction between SIRT2 and BAF155 is enhanced under the induction of AngII;

FIG. 5F demonstrates that the SWIRM domain of BAF155 is the binding site for SIRT 2;

figure 5G shows increased acetylation levels of BAF155 following treatment with trichostatin a (tsa) and Nicotinamide (NAM);

figure 5H shows that overexpression of CBP significantly increased the acetylation level of BAF 155;

FIGS. 5I and 5J show that CBP interacts with BAF155 under both endogenous and exogenous conditions;

figure 5K shows that the acetylation level of BAF155 is up-regulated in shSIRT2 cells and cells treated with AGK2 compared to normal control cells;

figure 5L shows a significant enhancement in BAF155 levels of BAF55 in cardiac tissue samples from SIRT2 knockout animals compared to WT animals;

FIGS. 5M-5P show that overexpression of WT-SIRT2 reduced the exogenous acetylation level of BAF155 (FIG. 5M), while inactive mutants transfected with SIRT2(H187YQ167A) had no effect (FIG. 5N); furthermore, the level of acetylation of BAF155 in cardiac tissue samples from SIRT2 knock-out animals was significantly increased compared to WT animals, whether induced by AngII or not (fig. 5O); the acetylation level of exogenous BAF155 decreased under AngII treatment, while the acetylation level of exogenous BAF155 further decreased with AngII-induced overexpression of exogenous SIRT2 (fig. 5P);

FIGS. 5Q-5U show K948, respectively, found throughout evolution, from Drosophila moha to mammalian species (FIG. 5Q); an antibody (5R) that specifically recognizes acetylated K948 of BAF 155; increased acetylation levels of BAF155-K948 following administration of TSA and NAM (FIG. 5S); furthermore, only CBP increased the acetylation level of BAF155-K948 after exogenous transfection of four acetyltransferases (fig. 5T); meanwhile, exogenous transfection of WT-SIRT2 instead of inactivated SIRT2(H187YQ167A) reduced the acetylation level of BAF155-K948 (FIG. 5U); taken together, the above data indicate that K948 is specifically regulated by CBP and SIRT 2;

figure 6 shows SIRT2 deacetylation of BAF155-K948 in vivo, where:

FIG. 6A shows SIRT 2-regulated changes in mouse cardiac lysine acetylation in SIRT2 knockout mice (SIRT2-KO), SIRT2 overexpressing mice (SIRT2-TG), and wild type animals (SIRT 2-WT);

FIGS. 6B and 6C show that the level of acetylation of BAF155-K948 after SIRT2 knockout was increased with or without administration of AngII, while the level of acetylation of BAF155-K948 was decreased in SIRT2-TG mouse heart tissue, respectively, compared to WT;

FIG. 7 shows that SIRT2 promotes BAF155-K948 and PARP1-K294 ubiquitination through WWP2, where:

figure 7A shows BAF155 abundance increased following SIRT2 downregulation; the applicant observed similar trends using three fragments of shSIRT2 (61965, 61966 and 61967) and performed subsequent experiments using 61966-shSIRT2 fragment;

FIG. 7B shows an increase in the rate and extent of BAF155 upregulation in heart tissue of SIRT2-WT mice compared to SIRT2-KO animals given MG 132;

FIG. 7C shows that SIRT2-WT mouse heart tissue significantly decreased BAF155 expression after CHX administration, while the SIRT2-KO mouse group maintained very high BAF155 expression over time;

figure 7D shows that consistent with degradation via the ubiquitin-proteasome pathway, increased levels of BAF155 ubiquitination were detected following Myc-SIRT2 overexpression and MG132 treatment compared to the Flag-control plasmid group;

FIG. 7E shows that the level of ubiquitination of BAF155 increases after overexpression of WT-SIRT2-Flag, but H187YQ167A-SIRT2-Flag (mutant SIRT2 with no deacetylation activity);

fig. 7F and 7G show that with overexpression of the four acetyltransferases, respectively, BAF155 abundance up-regulation (fig. 7F) and a reduction in ubiquitination level (7G) were observed only in cells overexpressing CBP;

figure 7H shows that SIRT2 overexpression enhances the level of ubiquitination in BAF155-WT cells compared to BAF155-K948R counterpart, indicating that BAF155 is deacetylated by SIRT2 at K948, resulting in ubiquitination at the same site and promoting degradation of BAF 155;

fig. 7I-fig. 7O demonstrate that WWP2 is involved in SIRT 2-mediated deacetylation-induced BAF155 degradation, HA-WWP2 is expressed in NC and shSIRT2H9c2 cell lines; wherein BAF155 abundance was gradually decreased in NC cell lines, but remained at high levels in shSIRT2 cells (fig. 7I); BAF155 ubiquitination levels mediated by WWP2 were reduced in shSIRT2 treatment compared to NC cells (fig. 7J); furthermore, Myc-SIRT2 overexpression resulted in increased binding between BAF155 and WWP2, but not correlated with K948R-BAF155 overexpression (fig. 7K); the above findings further indicate that SIRT2 promotes ubiquitination of BAF155 by WWP 2; in addition, applicants aimed to verify that the BAF155-PARP1 injury complex is regulated by SIRT2-WWP 2; applicants found that the ubiquitination level of PARP1 increased significantly after Flag-SIRT2 and HA-WWP2 overexpression and decreased with further overexpression of Flag-BAF155 (fig. 7L); then, K249R-PARP1 was overexpressed (mutant PARP1 did not have ubiquitination sites mediated by BAF155 and WWP 2), and the observed level of ubiquitination on PARP1 was negligible (fig. 7L); the above results indicate that SIRT2 promotes BAF155 degradation through WWP2 mediated K948 ubiquitination, WWP2 regulates PARP1 degradation mainly through K249 ubiquitination; applicants further examined the effect of SIRT2 on the PARP1-BAF155 complex; with overexpression of Myc-SIRT2, binding of PARP1 to BAF155 decreased (FIG. 7M); consistent with previously reported results, expression of PARP1 was reduced in the shBAF155-H9C2 cell line (fig. 7N), but expression of BAF155 was increased and expression of PARP1 was reduced in shSIRT2-H9C2 cells (fig. 7O), with or without AngII induction; expression of PARP1 was higher in shBAF155 and shSIRT2H9C2 cells compared to shBAF155H9C2 cells (fig. 7N), but lower than shSIRT2H9C2 cells (fig. 7O); these findings indicate that SIRT2 destabilizes the BAF155-PARP1 complex by promoting the degradation of BAF 155;

figure 8 shows proteomic analysis of the differential proteins in SIRT2 knockout and transgenic mice indicates that SIRT2 promotes ubiquitination of BAF155 and PARP1 in vivo through WWP2, wherein:

figure 8A shows that BAF155 binding to PARP1 was enhanced after treatment with AngII and significantly enhanced in SIRT2-KO mouse heart tissue compared to SIRT2-WT mouse samples with or without AngII;

figures 8B and 8C show that in SIRT2-WT mouse heart tissue, compared to WT mouse samples, BAF155 and PARP1 levels of ubiquitination were reduced after AngII treatment and significantly reduced in SIRT2-KO mouse heart tissue, respectively;

figure 8D-figure 8H show that WWP2 binding to BAF155 and PARP1 was reduced in heart tissue of SIRT2-KO mice given or not given AngII compared to SIRT2-WT animals (figure 8D); in contrast, binding of BAF155 to PARP1 was reduced in SIRT2-TG mouse heart tissue compared to the SIRT2-WT group with or without AngII (fig. 8E); the ubiquitination levels of BAF155 and PARP1 were significantly increased in heart tissue of SIRT2-TG mice compared to SIRT2-WT mice (fig. 8F and 8G); furthermore, the binding of WWP2 to BAF155 and PARP1 was increased in cardiac tissue of SIRT2-TG mice with or without AngII administration compared to SIRT2-WT animals (fig. 8H).

Detailed Description

The present application is further described below in conjunction with the following figures and examples, which should be understood to be illustrative only and not limiting.

Example 1

Materials and methods

1.1BAF155, WWP2 and SIRT2 knockout and transgenic mice

Conditional cardiomyocyte-specific Knockout (KO) mice, including Myh6Cre +, BAF155Fl/Fl (BAF155-cKO) and Myh6Cre-, BAF155Fl/Fl (BAF155-cWT), BAF155-WT, and BAF155-TG mice (CAG promoter) were obtained from Moore's model Biotechnology, Inc., Shanghai;

conditional cardiomyocyte-specific knockout mice, including Myh6Cre +, WWP2Fl/Fl (WWP2-cKO) and Myh6Cre-, WWP2Fl/Fl (WWP2-cWT) animals, SIRT2-KO mice were obtained from DengCX, the college of health sciences of Australian university.

SIRT2 transgenic (SIRT2-TG) mice (CAG promoter) were obtained from the southern Shanghai model Biotech, Inc.

In this study, 8 to 10 week old pathogen free (SPF) male mice were included. In the AngII and NaCl infused mouse model, BAF155-cKO, BAF155-cWT, BAF155-WT, BAF155-TG, WWP2-cKO, WWP2-cWT, SIRT2-WT, SIRT2-KO and SIRT2-TG mice (6 total n-120 per group) were randomly assigned to each group and anesthetized (concentration of isoflurane in oxygen; 1,500 ml/min). Cardiac remodeling was then induced by incision in the midscapular region and subcutaneous implantation of an osmotic micropump (Alzet) as instructed by the manufacturer. In the next 14 days, mice were euthanized by cervical dislocation. All animal studies were approved by the animal subjects committee of chinese university of medicine (protocol No. 2019026).

1.2. Proteomics and acetylation, ubiquitination proteomics

1.2.1 protein extraction

The specimens were ground in liquid nitrogen and placed in 5-mL tubes, supplemented with four times the volume of lysis buffer (8M urea, 1% protease inhibitor cocktail, 3. mu. MTSA, 50mM NAM) and sonicated 3 times on ice with a Scientz sonicator followed by centrifugation at 12,000g and 4 ℃ for 10 minutes. The protein concentration of the resulting supernatant was measured using the BCA kit.

1.2.2 Trypsin digestion

Equal amounts of total protein in each sample were enzymatically digested and the volume was adjusted to remain consistent throughout the sample set. TCA was added dropwise to a final concentration of 20%, followed by vortex mixing and precipitation at 4 ℃ for 2 h. Centrifuge at 4500g for 5 minutes and wash the resulting precipitate twice with pre-cooled acetone. The pellet was then dried, resuspended in 200mM TEAB by sonication, and trypsin was added to each sample at 1:50 (protease: protein, w/w) for overnight digestion. Dithiothreitol (DTT) was added at 5mM, followed by incubation at 56 ℃ for 30 minutes. Then, 11mM Iodoacetamide (IAA) was added, followed by incubation in the dark for 15 minutes at room temperature.

1.2.3 enrichment of post-translationally modified peptides

The peptide was dissolved in IP buffer (100mM NaCl, 1mM EDTA, 50mM Tris-HCl, 0.5% NP-40, pH8.0), pre-washed anti-lysine acetylation and anti-ubiquitin residual antibody resin (PTM-104 and PTM-1104; Hangzhou Jingjie PTM-Bio) and gently shaken overnight at 4 ℃. The antibody resin was washed with IP buffer and deionized water, respectively. Finally, the enriched peptide was eluted 3 times with 0.1% trifluoroacetic acid and washed with C18 ZipTips.

1.2.4LC-MS/MS analysis

Tryptic peptide was dissolved in liquid chromatography mobile phase a and separated on a nanollute ultra high performance liquid system. Mobile phases a and B were 0.1% formic acid and 2% acetonitrile in water and 0.1% formic acid in acetonitrile, respectively. The peptide was eluted using a gradient set to XXX at a constant flow rate of 450 nL/min. The elution gradient was set as: 0-72min, 7% -24% B; 72-84 minutes, 24% -32% B; 84-87 minutes, 32% -80% B; ionization was performed at the injection capillary ion source for 87-90 minutes at 80% B and TIMS-TOFPro mass spectrometer (ion source voltage, 1.6 kV; scan range, 100-. A parallel accumulated serial fragmentation (PASEF) mode is enabled for data acquisition. Precursors with charge states 0 to 5 were selected for fragmentation with 10 PASEFMS/MS scans per cycle. The dynamic exclusion time for MS/MS scans was 30 seconds to prevent multiple scans of the same parent ion.

1.2.5 database search

Maxquant (v1.6.15.0) searches the Swissprot protein sequence database (Mus _ musculus _10090_ SP _20201214.fasta) for raw mass spectral data, including reverse bait entries and common contaminating proteins. Trypsin/P digestion allows cleavage of up to 2 deletions, requiring at least 7 amino acids per peptide. The mass error tolerance of the parent ion was 10ppm and the daughter ion was 20ppm, respectively. Cysteine alkylation (carbamoylmethyl [ C ]) is considered as a fixed modification. The variable modifications are methionine oxidation and n-terminal acetylation. Acetylation of lysine and diglycine on lysine were also set as variable modifications for corresponding modification enrichment assays. Both protein and PSM identified FDRs as 1%.

1.2.6 Gene Ontology (GO) analysis

The UniProt-GOA database (www.http:// www.ebi.ac.uk/GOA /) was used for GO annotation. First, the obtained protein identities are mapped to GOIDs according to their single port IDs. For proteins not annotated in UniProt-GOA, interpro scan was used to annotate GO function based on protein sequence alignment. Proteins are assigned to biological processes, cellular components and molecular functions as the GO term. Within each class, the two-tailed Fisher test was used to assess the enrichment of differentially expressed proteins with all detected proteins; corrected p <0.05 indicates statistical significance.

1.2.7 subcellular localization

Wolfpsort, the latest version of PSORT/PSORTII, was used to predict subcellular localization of eukaryotic proteins.

1.3 histopathological evaluation

Myocardial tissue samples were fixed in formalin (4%) for 4 hours, paraffin embedded and sectioned at 5 μm. After xylene dewaxing, rehydration was performed with fractionated ethanol followed by H & E and Masson trichrome (G1340; Solarbio, China) staining.

Frozen myocardial tissue sections were examined by immunofluorescence. The cross-sectional area of cardiomyocytes was evaluated in images obtained after staining with 5 μ MWGA (Thermo, USA). H9c2 cells were either given 10-5 μ M angII or received Nacl treatment for 48 hours. Then, the cells were fixed with 4% formalin and treated with WGA (5 μ M) at room temperature for 10 minutes, followed by fluorescence microscopy.

1.4. Echocardiogram and left ventricular function (LVEF) assessment

Cardiac function of Myh6Cre +, BAF155Fl/Fl, Myh6Cre-, BAF155Fl/Fl, BAF155-WT, and BAF155-TG groups in VisualSonicsVevo2100 real-time high resolution in vivo microscopic imaging System (Visualsonic, Canada). 24 mice were anesthetized with 1.5% isoflurane and then submitted for cardiac function analysis by continuous oxygen supply through a 40MHz sensor. The LVEF is checked by two-dimensional M-mode recording. Cardiac function determinations are based on ventricular septal dimension (IVSd), left ventricular posterior wall dimension (PWTd), systolic LV internal dimension (LVD), diastolic LV internal dimension (LVDd), and LV mass measurements. In addition, the left ventricular ejection fraction (EF%) and the fractional shortening (FS%) were determined.

1.5. Cells and treatments

HEK293T and H9c2 cells (ATCC) were cultured in high glucose Dulbecco's modified Eagle's Medium containing 10% FBS (HyClone) at 37 ℃ with a humidified 5% CO2 incubator.

1.6. Plasmid construction, antibodies and reagents

Table 1 lists various plasmids

TABLE 1

Lipofectamine3000(Invitrogen, USA) was used for transfection. Lentiviruses were used for shRNA transduction. Table 2 lists all antibodies used in the study.

TABLE 2

MG132(a2585), proteasome inhibitors, and cycloheximide (CHX, a8244) were purchased from apexbio (usa) and dissolved in DMSO. AngII (A9525; Sigma, USA) in DMSO was used at a concentration of 10. mu.M. AGK2 is supplied by Selleck (USA).

Quantification of PARP1 and BAF155 ubiquitination

Mouse myocardial tissue samples were lysed using 1% SDS buffer (TrispH7.5, 0.5mM EDTA and 1mM DTT), boiled for 10 minutes, and then saturated with Tris-HCl (pH 8.0). Cells transfected with HA-tagged (HA) -ubiquitin, full-length human Myc-PARP1, and mutant Myc-PARP1 plasmids; or the full-length human Flag-BAF155 and mutant Flag-BAF155 plasmids were also lysed as described above. The cell lysate was incubated continuously (Biotool, USA) with anti-PARP 1 or anti-BAF 155 antibody (1. mu.g/mg cell lysate; 4 ℃) and protein A/G (B23202) or anti-Myc (B26302) or anti-label immunoprecipitated magnetic beads for 12 hours.

1.8. Co-immunoprecipitation

Mouse myocardial tissue samples and cells were lysed with Flag lysis buffer [50mM Tris, 137mM NaCl, 1mM EDTA, 10mM Na F, 0.1mM Na3VO4, 1% NP-40, 1mM dithiothreitol [ DTT ], and 10% glycerol, pH7.8] containing protease inhibitors (Bimake). The resulting lysate was combined with 30 μ l of anti-Flag/Myc affinity gel (B23102/B26302, Biotool; 12 hours at 4 ℃ or enough antibody (1 μ G/mg cell lysate; 2-3 hours) and protein A/G for immunoprecipitation (B23202; Biotool) at 30 μ l for 12 hours at 4 ℃ the immunoprecipitated complexes were separated by SDS-PAGE and then electrotransferred onto PVDF membrane the membrane was blocked (5% bovine serum albumin) in the environment for 1 hour, then primary (4 ℃ overnight) and secondary (environment, 1 hour) antibodies were incubated continuously, ubiquitinated BAF155 and PARP1, detected with anti-Myc, anti-tag, anti-PARP 1 or anti-BAF 155 antibodies, respectively with anti-HA antibodies ImageJv1.46 (national institute of health) for signal quantification and then normalized to GAPDH and tubulin expression.

1.9. Statistical analysis

Data are shown as mean ± Standard Deviation (SD). Two and more groups were evaluated for homogeneity of variance by the F-and Brown-Forsythe tests, respectively. A xiapiro-wilk test was performed to assess normality. The normal distribution data and the skewed distribution data of the two groups are compared through a student t test and a Welch t test respectively. One-way and two-way anova were performed on sets of comparisons involving one and two parameters, respectively, followed by a post-hoc Bonferroni test. The P values were adjusted appropriately for multiple comparisons. Statistical analysis was performed using SPSS22.0(SPSS, USA), with P <0.05 indicating statistical significance.

Two results and analysis

2.1. Myocardial-specific BAF155 knockouts can significantly alleviate myocardial hypertrophy and heart failure in mouse models

To determine the function of BAF155 in mouse cardiac remodeling, BAF155-cWT and myocardial-specific BAF155 knock-out (BAF155-cKO) mice were exposed to sustained 0.9% NaCl and AngII (2 mg/kg/day) for two weeks (fig. 1A). Immunofluorescence and western blot showed that BAF155 was specifically knocked out in heart tissue (fig. 1B-C). BAF155-cKO significantly reduced AngII-induced cardiac insufficiency compared to BAF155-cWT mice (fig. 1D), which is reflected in an increase in EF% (fig. 1E) and FS% (fig. 1F) in mice. H & E and WGA staining data show that AngII increased cardiomyocyte size and cardiomyocyte cross-sectional area in BAF155-cWT mice, whereas this change was not significant in BAF155-cKO mice given AngII (fig. 1G). BAF155-cKO significantly inhibited ang ii-induced increases in HW/BW and HW/TL ratios compared to BAF155-cWT mice (fig. 1H-I), indicating that heart-specific knockdown of BAF155 reduces cardiac hypertrophy in mice. Furthermore, BAF155-cKO significantly reduced the expression of AngII-induced mouse ANP, BNP, clearveccaspase-3, and PARP1 compared to BAF155-cWT mice (fig. 1J). Also, the level of myocardial fibrosis induced by AngII was significantly reduced in BAF155-cKO mice (fig. 1K), and the expression of myocardial fibrosis-associated protein a-SMA and collagen I was reduced (fig. 1L) compared to BAF155-cWT mice. Overall, these results indicate that heart-specific knockdown of BAF155 reduces cardiac remodeling in mice.

BAF155 overexpression significantly aggravates myocardial hypertrophy and heart failure in mouse models

Next, BAF155-WT and BAF155 transgenic mice (BAF155-TG) were exposed to continuous 0.9% NaCl and AngII (2 mg/kg/day) for two weeks (FIG. 2A). Western blot showed BAF155 was specifically overexpressed in cardiac tissue (fig. 2B). BAF155-TG significantly aggravated AngII-induced cardiac insufficiency compared to BAF155-WT mice (fig. 2C), which is reflected by increases in EF% (fig. 2D) and FS% (fig. 2E) in mice. H & E and WGA staining data show that AngII administration results in an increase in cardiomyocyte size and cardiomyocyte cross-sectional area in BAF155-TG mice compared to BAF155-WT mice (fig. 2F). BAF155-TG significantly aggravated the AngII-induced increase in HW/BW and HW/TL ratios compared to BAF155-WT mice (fig. 2G-H), indicating that overexpression of BAF155 results in cardiac hypertrophy in mice. Furthermore, the AngII-induced expression of ANP, BNP, clearcaspase-3 and PARP1 was elevated in BAF155-TG mice compared to BAF155-WT mice (FIG. 2I). Also, BAF155-TG significantly aggravated AngII-induced myocardial fibrosis in mice compared to BAF155-WT mice (fig. 2J), and upregulated α -SMA and collagen I (fig. 2K). Overall, these results indicate that overexpression of BAF155 exacerbates cardiac remodeling in mice.

PARP1 acting as a key BAF155 binding protein under physiological conditions

The biological association of BAF155 and PARP1 was verified. First, the interaction of endogenous BAF155 with PARP1 was assessed by co-immunoprecipitation (fig. 3A-B). Furthermore, BAF155 interaction with PARP1 was induced by AngII (fig. 3C). In addition, PARP1 interacts with the 476-779 amino acid domain of PARP1, the PARP-A-helical domain (FIG. 3D). The above findings suggest that the BAF155-PARP1 axis may regulate cardiac remodeling.

BAF155 stabilizes PARP1 and reduces PARP1-K249 ubiquitination by inhibiting E3 ubiquitin ligase WWP2

To explore the mechanism of BAF155 regulation of PARP1, applicants first examined whether BAF155 modulates the expression of PARP1 protein. As shown in fig. 4A, elevated expression of BAF155 results in the simultaneous expression of PARP 1. Consistently, BAF155 silenced with 56438shBAF155RNA (SEQ ID NO: 2TGGGAAGCGTCGAAATCAGAA) significantly down-regulated PARP1 expression (fig. 4B). Furthermore, the abundance of PARP1 gradually decreased in the Flag control group, while BAF155 overexpression maintained PARP1 expression with an increase in CHX, a transcriptional inhibitor for inhibiting PARP1 protein synthesis (fig. 4C). The above findings indicate that BAF155 inhibits PARP1 degradation by blocking the proteasome pathway. Furthermore, expression of PARP1 was increased (rate and extent) in BAF155 overexpressing cells after MG132 treatment compared to Flag control cells (fig. 4D). These data indicate that BAF155 overexpression maintains PARP1 expression by inhibiting degradation of the proteasome pathway. Consistent with degradation via the ubiquitin-proteasome pathway, the level of ubiquitination of PARP1 was reduced after transfection with Flag-BAF155 compared to the Flag-control plasmid group (fig. 4E). Meanwhile, the level of ubiquitination of PARP1 increased due to BAF155 knockdown (fig. 4F).

Previous studies by the applicant found that ubiquitination on K249 is one of the key modifications of PARP 1. Thus, to further demonstrate that ubiquitination of PARP1 is inhibited by BAF155, applicants overexpress PARP1-WT, PARP1-K249R, as well as Flag-control and Flag-BAF 155. As shown in fig. 4G, BAF155 reduced the level of ubiquitination in the PARP1-WT group, but not in PARP1-K249R cells, indicating that BAF155 inhibited PARP1 ubiquitination on K249.

Next, applicants aimed to determine which E3 ubiquitination ligase mediated PARP1 ubiquitination of BAF155 inhibition. In applicants' previous work, applicants found that WWP2 is a specific E3 ubiquitinated ligase for PARP1 and ubiquitinates the PARP1-K249 site. Meanwhile, WWP2 is also the E3 ubiquitinated ligase of BAF 155. Degradation of PARP1 and BAF155 was blocked by exogenous immunoassay under treatment with MG132, resulting in enhanced interaction of BAF155 and PARP1 with WWP2 (fig. 4H). Furthermore, upon BAF155 knockdown, PARP1 binding to WWP2 increased (fig. 4I), whereas BAF155 overexpression resulted in a decrease in PARP1 binding to WWP2 (fig. 4J). When WWP2 was overexpressed, the level of ubiquitination of PARP1 was reduced after overexpression of Flag-BAF155 compared to the Flag control group (fig. 4K).

Previous studies by the applicant have found that ubiquitination of PARP1-K249 is dependent on E3 ubiquitinated WWP 2. Interestingly, modification of PARP1-K249 relies on deacetylation of SIRT2 upstream of the same site. Therefore, to validate the molecular regulatory mechanism of BAF155 on PARP1, immunoprecipitation was performed in mouse heart tissue. Binding of PARP1 to WWP2 and SIRT2 was enhanced after treatment with AngII and significantly increased in BAF155-cKO mouse heart tissue, compared to WT with or without AngII treatment (fig. 4L). With respect to the ubiquitination level of PARP1, applicants' data showed that AngII induced ubiquitination in WT mouse heart tissue (fig. 4M). Furthermore, compared to WT mice, ubiquitination of PARP1 was significantly increased in BAF155-cKO mouse heart tissue (fig. 4M). In contrast, PARP1 binding to WWP2 and SIRT2 was reduced compared to WT in BAF155-TG mouse heart tissue compared to WT mice (figure 4N). Compared to WT mice, BAF155-TG mice had significantly reduced ubiquitination of PARP1 in heart tissue (fig. 4O).

2.5. Proteomics analysis identified K948 on BAF155 as specifically regulated by SIRT2

Endogenous and exogenous co-immunoprecipitation confirmed that SIRT2 interacts with BAF155 (FIGS. 5A-C). Furthermore, the interaction between SIRT2 and BAF155 was enhanced under the induction of AngII (fig. 5D and E). According to the UniProt database, BAF155 contains five functional domains, including Chromo, SWIRM, SANT, Glu-rich, and Pro-rich domains. Using endogenous SIRT2 and full-length Flag-tagged-BAF155 or various truncated Flag-BAF155 plasmids, applicants demonstrated that the SWIRM domain of BAF155 is the binding site for SIRT2 (FIG. 5F).

Next, applicants focused on the regulatory mechanism of BAF155 acetylation. Following treatment with trichostatin a (tsa) and Nicotinamide (NAM), the level of acetylation of BAF155 increased, which are inhibitors of histone deacetylases HDACI and III and the deacetylase family of deacetylases (fig. 5G). To identify specific acetyltransferases for BAF155, four acetyltransferases were transfected, including p300(300-kDaE1A binding protein), CBP, PCAF (p300/CBP related factor) and GCN5(KAT2A), respectively. As shown in fig. 5H, overexpression of CBP, but not other acetyltransferases, significantly increased the acetylation level of BAF 155. In addition, CBP interacts with BAF155 under both endogenous and exogenous conditions (fig. 5I and 5J). Thus, BAF155 was shown to be a substrate for CBP lysine acetylation. Next, applicants analyzed the global acetylation changes of normal control and shSIRT2 cells treated with or without 20 μmol/lag 2(a commonly used SIRT2 specific inhibitor). Consistent with previous results, the acetylation level of BAF155 was up-regulated in shSIRT2 cells and cells treated with AGK2 compared to normal control cells (fig. 5K). The above regulation was demonstrated in heart tissue of WT and SIRT2 knockout mice, with BAF155 levels of BAF55 being significantly enhanced in heart tissue samples from SIRT2 knockout animals compared to WT animals (fig. 5L). Furthermore, overexpression of WT-SIRT2 reduced the exogenous acetylation level of BAF155 (fig. 5M), whereas an inactive mutant transfected with SIRT2(H187YQ167A) had no effect (fig. 5N). Furthermore, the level of acetylation of BAF155 was significantly increased in cardiac tissue samples from SIRT2 knock-out animals compared to WT animals, whether induced by AngII or not (fig. 5O). The acetylation level of exogenous BAF155 decreased under AngII treatment, while the acetylation level of exogenous BAF155 further decreased with AngII-induced overexpression of exogenous SIRT2 (fig. 5P).

K948 may represent an important acetylation site of BAF155 regulated by SIRT 2. K948 was found throughout evolution, from drosophila mohawensis to mammalian species (fig. 5Q). To further investigate the key role of acetylation on K948, antibodies specifically recognizing acetylated K948 of BAF155 were generated (fig. 5R). Following administration of TSA and NAM, the acetylation level of BAF155-K948 increased (FIG. 5S). Furthermore, only CBP increased the acetylation level of BAF155-K948 after exogenous transfection with four acetyltransferases (FIG. 5T). At the same time, exogenous transfection of WT-SIRT2 instead of inactivated SIRT2(H187YQ167A) reduced the acetylation level of BAF155-K948 (FIG. 5U). Taken together, the above data indicate that K948 is specifically regulated by CBP and SIRT 2.

2.6. Acetylated proteomics analysis of the differential proteins in SIRT2 knockout and transgenic mice demonstrated SIRT2 deacetylation of BAF155-K948 in vivo

To fully understand SIRT 2-regulated changes in mouse cardiac lysine acetylation, mice were knockout SIRT2 (SIRT2-KO), SIRT 2-overexpressing mice (SIRT2-TG), and wild type animals (SIRT2-WT) (fig. 6A).

Acetylation proteomic analysis of BAF155-K948 in SIRT2 knockout and transgenic mice was validated in biological experiments. Immunoprecipitation assays confirmed that acetylation levels of BAF155-K948 after SIRT2 knockout increased with or without AngII administration (fig. 6B), while acetylation levels of BAF155-K948 decreased in SIRT2-TG mouse heart tissue (fig. 6C), compared to WT.

Promotion of BAF155-K948 and PARP1-K294 ubiquitination by SIRT2 through WWP2

To investigate the modulating effect of SIRT2 on the BAF155-PARP1 apoptotic complex, the abundance of BAF155 in SIRT2-WT and SIRT2-KO heart tissues as well as NC and shSIRT2H9c2 cells was analyzed. As shown in figure 7A, BAF155 abundance increased after SIRT2 down-regulation. Applicants used three fragments of shSIRT2 (61965-shSIRT2 SEQ ID NO: 3CTATGCAAACTTGGAGAAATA,

61966-shSIRT2 SEQ ID NO：4GACCAAAGAGAAAGAGGAACA、

61967-shSIRT2 SEQ ID NO: 5GTGGAAAAGAGTACACGATGA) and subsequent experiments were performed using 61966-shSIRT2 fragment (FIG. 7A). In addition, the rate and extent of BAF155 upregulation was increased in heart tissue of SIRT2-WT mice compared to SIRT2-KO animals given MG132 (fig. 7B). Meanwhile, heart tissue of SIRT2-WT mice significantly decreased BAF155 expression after CHX administration, while the SIRT2-KO mouse group maintained very high BAF155 expression over time (fig. 7C). Consistent with degradation via the ubiquitin-proteasome pathway, increased ubiquitination levels of BAF155 were detected after Myc-SIRT2 overexpression and MG132 treatment compared to the Flag-control plasmid group (fig. 7D). The level of ubiquitination of BAF155 increased after overexpression of WT-SIRT2-Flag, but H187YQ167A-SIRT2-Flag (mutant SIRT2 with no deacetylation activity) (FIG. 7E). In contrast, with overexpression of the four acetyltransferases, BAF155 abundance upregulation (fig. 7F) and a reduction in ubiquitination levels (fig. 7G) were observed only in cells overexpressing CBP.

To directly show that SIRT2 promotes ubiquitination of BAF155, applicants identified the deacetylation site of BAF155 regulated by SIRT 2. As shown in figure 7H, SIRT2 overexpression enhanced the level of ubiquitination in BAF155-WT cells compared to BAF155-K948R counterpart, indicating that BAF155 was deacetylated by SIRT2 at K948, resulting in ubiquitination at the same site and promoting degradation of BAF 155. Briefly, K948 was identified by SIRT2 as the primary deacetylation site of BAF 155.

As applicants mention above, BAF155 shares the same E3 ubiquitin ligase WWP2 as PARP 1. Next, to explore whether WWP2 was involved in SIRT 2-mediated deacetylation-induced BAF155 degradation, HA-WWP2 was expressed in NC and shSIRT2H9c2 cell lines. Interestingly, BAF155 abundance gradually decreased in the NC cell line, while it remained at a high level in shSIRT2 cells (fig. 7I). BAF155 ubiquitination levels mediated by WWP2 were reduced in shSIRT2 treatment compared to NC cells (fig. 7J). Furthermore, Myc-SIRT2 overexpression resulted in increased binding between BAF155 and WWP2, but not in relation to K948R-BAF155 overexpression (fig. 7K). The above findings further suggest that SIRT2 promotes ubiquitination of BAF155 through WWP 2. In addition, applicants aimed to verify that the BAF155-PARP1 injury complex is regulated by SIRT2-WWP 2. Applicants found that the level of ubiquitination of PARP1 increased significantly after Flag-SIRT2 and HA-WWP2 overexpression and decreased with further overexpression of Flag-BAF155 (fig. 7L). Then, K249R-PARP1 was overexpressed (mutant PARP1 did not have ubiquitination sites mediated by BAF155 and WWP 2), and the observed level of ubiquitination on PARP1 was negligible (fig. 7L). The above results indicate that SIRT2 promotes BAF155 degradation through WWP2 mediated K948 ubiquitination, WWP2 regulates PARP1 degradation mainly through K249 ubiquitination. Applicants further examined the effect of SIRT2 on the PARP1-BAF155 complex. With overexpression of Myc-SIRT2, binding of PARP1 to BAF155 decreased (FIG. 7M). Consistent with previously reported results, expression of PARP1 was reduced in the shBAF155-H9C2 cell line (fig. 7N), but expression of BAF155 was increased and expression of PARP1 was reduced in shSIRT2-H9C2 cells (fig. 7O), with or without AngII induction. PARP1 was more highly expressed in shBAF155 and shSIRT2H9C2 cells (fig. 7N), but less expressed than shSIRT2H9C2 cells (fig. 7O) compared to shBAF155H9C2 cells. These findings indicate that SIRT2 destabilizes the BAF155-PARP1 complex by promoting the degradation of BAF 155.3.8. For SIRT2 knockout and conversionGene gene is little Proteomic analysis of differential proteins in mice showed that SIRT2 promotes ubiquitination of BAF155 and PARP1 in vivo by WWP2

Immunoprecipitation was performed in mouse heart tissue; BAF155 binding to PARP1 was enhanced after treatment with AngII, and significantly enhanced in SIRT2-KO mouse heart tissue, compared to SIRT2-WT mouse samples with or without AngII (fig. 8A). Furthermore, in SIRT2-WT mouse heart tissue, the ubiquitination levels of BAF155 and PARP1 were reduced after AngII treatment and significantly reduced in SIRT2-KO mouse heart tissue compared to WT mouse samples (fig. 8B, 8C). Furthermore, WWP2 binding to BAF155 and PARP1 was reduced in cardiac tissue of SIRT2-KO mice with or without AngII administration compared to SIRT2-WT animals (fig. 8D). In contrast, binding of BAF155 to PARP1 was reduced in SIRT2-TG mouse heart tissue compared to the SIRT2-WT group with or without AngII administration (fig. 8E). BAF155 and PARP1 were significantly elevated in heart tissue of SIRT2-TG mice compared to SIRT2-WT mice in their ubiquitination levels (FIGS. 8F and 8G). Furthermore, the binding of WWP2 to BAF155 and PARP1 was increased in heart tissue of SIRT2-TG mice given or not given AngII compared to SIRT2-WT animals (fig. 8H).

Discussion and conclusions

Applicants identified subunit BAF155(SMARCC1) of the SWI/SNF chromatin remodeling complex as an important in vivo interacting protein of PARP 1. Applicants' work shows that BAF155 stabilizes PARP1 by interfering with the interaction between PARP1 and WWP2, E3 ubiquitin ligase and PARP1 with the following ubiquitination. Thus, the above evidence points to a possible new mechanism to maintain high local concentrations and activation states of PARP1 by co-localization to stabilize their interacting proteins.

Based on applicants' model mechanism, low activity SIRT2 retained higher levels of acetylation on K948 of BAF155 and K249 of PARP1, thereby keeping BAF155 and PARP1 in an interactive state and preventing ubiquitination by WWP 2.

Finally, it is noted that the above-mentioned preferred embodiments illustrate rather than limit the invention, and that, although the present application has been described in detail with reference to the above-mentioned preferred embodiments, it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the scope of the invention as defined by the appended claims.

Sequence listing

<110> [ please provide ]

<120> deacetylation modified BAF155 protein and pharmaceutical application thereof

<141> 2022-05-31

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1105

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Ala Ala Ala Ala Gly Gly Gly Gly Pro Gly Thr Ala Val Gly Ala

1 5 10 15

Thr Gly Ser Gly Ile Ala Ala Ala Ala Ala Gly Leu Ala Val Tyr Arg

20 25 30

Arg Lys Asp Gly Gly Pro Ala Thr Lys Phe Trp Glu Ser Pro Glu Thr

35 40 45

Val Ser Gln Leu Asp Ser Val Arg Val Trp Leu Gly Lys His Tyr Lys

50 55 60

Lys Tyr Val His Ala Asp Ala Pro Thr Asn Lys Thr Leu Ala Gly Leu

65 70 75 80

Val Val Gln Leu Leu Gln Phe Gln Glu Asp Ala Phe Gly Lys His Val

85 90 95

Thr Asn Pro Ala Phe Thr Lys Leu Pro Ala Lys Cys Phe Met Asp Phe

100 105 110

Lys Ala Gly Gly Ala Leu Cys His Ile Leu Gly Ala Ala Tyr Lys Tyr

115 120 125

Lys Asn Glu Gln Gly Trp Arg Arg Phe Asp Leu Gln Asn Pro Ser Arg

130 135 140

Met Asp Arg Asn Val Glu Met Phe Met Asn Ile Glu Lys Thr Leu Val

145 150 155 160

Gln Asn Asn Cys Leu Thr Arg Pro Asn Ile Tyr Leu Ile Pro Asp Ile

165 170 175

Asp Leu Lys Leu Ala Asn Lys Leu Lys Asp Ile Ile Lys Arg His Gln

180 185 190

Gly Thr Phe Thr Asp Glu Lys Ser Lys Ala Ser His His Ile Tyr Pro

195 200 205

Tyr Ser Ser Ser Gln Asp Asp Glu Glu Trp Leu Arg Pro Val Met Arg

210 215 220

Lys Glu Lys Gln Val Leu Val His Trp Gly Phe Tyr Pro Asp Ser Tyr

225 230 235 240

Asp Thr Trp Val His Ser Asn Asp Val Asp Ala Glu Ile Glu Asp Pro

245 250 255

Pro Ile Pro Glu Lys Pro Trp Lys Val His Val Lys Trp Ile Leu Asp

260 265 270

Thr Asp Ile Phe Asn Glu Trp Met Asn Glu Glu Asp Tyr Glu Val Asp

275 280 285

Glu Asn Arg Lys Pro Val Ser Phe Arg Gln Arg Ile Ser Thr Lys Asn

290 295 300

Glu Glu Pro Val Arg Ser Pro Glu Arg Arg Asp Arg Lys Ala Ser Ala

305 310 315 320

Asn Ala Arg Lys Arg Lys His Ser Pro Ser Pro Pro Pro Pro Thr Pro

325 330 335

Thr Glu Ser Arg Lys Lys Ser Gly Lys Lys Gly Gln Ala Ser Leu Tyr

340 345 350

Gly Lys Arg Arg Ser Gln Lys Glu Glu Asp Glu Gln Glu Asp Leu Thr

355 360 365

Lys Asp Met Glu Asp Pro Thr Pro Val Pro Asn Ile Glu Glu Val Val

370 375 380

Leu Pro Lys Asn Val Asn Leu Lys Lys Asp Ser Glu Asn Thr Pro Val

385 390 395 400

Lys Gly Gly Thr Val Ala Asp Leu Asp Glu Gln Asp Glu Glu Thr Val

405 410 415

Thr Ala Gly Gly Lys Glu Asp Glu Asp Pro Ala Lys Gly Asp Gln Ser

420 425 430

Arg Ser Val Asp Leu Gly Glu Asp Asn Val Thr Glu Gln Thr Asn His

435 440 445

Ile Ile Ile Pro Ser Tyr Ala Ser Trp Phe Asp Tyr Asn Cys Ile His

450 455 460

Val Ile Glu Arg Arg Ala Leu Pro Glu Phe Phe Asn Gly Lys Asn Lys

465 470 475 480

Ser Lys Thr Pro Glu Ile Tyr Leu Ala Tyr Arg Asn Phe Met Ile Asp

485 490 495

Thr Tyr Arg Leu Asn Pro Gln Glu Tyr Leu Thr Ser Thr Ala Cys Arg

500 505 510

Arg Asn Leu Thr Gly Asp Val Cys Ala Val Met Arg Val His Ala Phe

515 520 525

Leu Glu Gln Trp Gly Leu Val Asn Tyr Gln Val Asp Pro Glu Ser Arg

530 535 540

Pro Met Ala Met Gly Pro Pro Pro Thr Pro His Phe Asn Val Leu Ala

545 550 555 560

Asp Thr Pro Ser Gly Leu Val Pro Leu His Leu Arg Ser Pro Gln Val

565 570 575

Pro Ala Ala Gln Gln Met Leu Asn Phe Pro Glu Lys Asn Lys Glu Lys

580 585 590

Pro Val Asp Leu Gln Asn Phe Gly Leu Arg Thr Asp Ile Tyr Ser Lys

595 600 605

Lys Thr Leu Ala Lys Ser Lys Gly Ala Ser Ala Gly Arg Glu Trp Thr

610 615 620

Glu Gln Glu Thr Leu Leu Leu Leu Glu Ala Leu Glu Met Tyr Lys Asp

625 630 635 640

Asp Trp Asn Lys Val Ser Glu His Val Gly Ser Arg Thr Gln Asp Glu

645 650 655

Cys Ile Leu His Phe Leu Arg Leu Pro Ile Glu Asp Pro Tyr Leu Glu

660 665 670

Asn Ser Asp Ala Ser Leu Gly Pro Leu Ala Tyr Gln Pro Val Pro Phe

675 680 685

Ser Gln Ser Gly Asn Pro Val Met Ser Thr Val Ala Phe Leu Ala Ser

690 695 700

Val Val Asp Pro Arg Val Ala Ser Ala Ala Ala Lys Ala Ala Leu Glu

705 710 715 720

Glu Phe Ser Arg Val Arg Glu Glu Val Pro Leu Glu Leu Val Glu Ala

725 730 735

His Val Lys Lys Val Gln Glu Ala Ala Arg Ala Ser Gly Lys Val Asp

740 745 750

Pro Thr Tyr Gly Leu Glu Ser Ser Cys Ile Ala Gly Thr Gly Pro Asp

755 760 765

Glu Pro Glu Lys Leu Glu Gly Ala Glu Glu Glu Lys Met Glu Ala Asp

770 775 780

Pro Asp Gly Gln Gln Pro Glu Lys Ala Glu Asn Lys Val Glu Asn Glu

785 790 795 800

Thr Asp Glu Gly Asp Lys Ala Gln Asp Gly Glu Asn Glu Lys Asn Ser

805 810 815

Glu Lys Glu Gln Asp Ser Glu Val Ser Glu Asp Thr Lys Ser Glu Glu

820 825 830

Lys Glu Thr Glu Glu Asn Lys Glu Leu Thr Asp Thr Cys Lys Glu Arg

835 840 845

Glu Ser Asp Thr Gly Lys Lys Lys Val Glu His Glu Ile Ser Glu Gly

850 855 860

Asn Val Ala Thr Ala Ala Ala Ala Ala Leu Ala Ser Ala Ala Thr Lys

865 870 875 880

Ala Lys His Leu Ala Ala Val Glu Glu Arg Lys Ile Lys Ser Leu Val

885 890 895

Ala Leu Leu Val Glu Thr Gln Met Lys Lys Leu Glu Ile Lys Leu Arg

900 905 910

His Phe Glu Glu Leu Glu Thr Ile Met Asp Arg Glu Lys Glu Ala Leu

915 920 925

Glu Gln Gln Arg Gln Gln Leu Leu Thr Glu Arg Gln Asn Phe His Met

930 935 940

Glu Gln Leu Lys Tyr Ala Glu Leu Arg Ala Arg Gln Gln Met Glu Gln

945 950 955 960

Gln Gln His Gly Gln Asn Pro Gln Gln Ala His Gln His Ser Gly Gly

965 970 975

Pro Gly Leu Ala Pro Leu Gly Ala Ala Gly His Pro Gly Met Met Pro

980 985 990

His Gln Gln Pro Pro Pro Tyr Pro Leu Met His His Gln Met Pro Pro

995 1000 1005

Pro His Pro Pro Gln Pro Gly Gln Ile Pro Gly Pro Gly Ser Met Met

1010 1015 1020

Pro Gly Gln His Met Pro Gly Arg Met Ile Pro Thr Val Ala Ala Asn

1025 1030 1035 1040

Ile His Pro Ser Gly Ser Gly Pro Thr Pro Pro Gly Met Pro Pro Met

1045 1050 1055

Pro Gly Asn Ile Leu Gly Pro Arg Val Pro Leu Thr Ala Pro Asn Gly

1060 1065 1070

Met Tyr Pro Pro Pro Pro Gln Gln Gln Pro Pro Pro Pro Pro Pro Ala

1075 1080 1085

Asp Gly Val Pro Pro Pro Pro Ala Pro Gly Pro Pro Ala Ser Ala Ala

1090 1095 1100

Pro

1105

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgggaagcgt cgaaatcaga a 21

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ctatgcaaac ttggagaaat a 21

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gaccaaagag aaagaggaac a 21

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gtggaaaaga gtacacgatg a 21

Claims (10)

1. Deacetylated modified BAF155 protein or an active fragment thereof, characterised in that the deacetylated modified BAF155 protein or active fragment thereof comprises an amino acid sequence as shown in SEQ ID NO:1, wherein the lysine at position 948 is deacetylated compared to wild type BAF155 protein.

2. Deacetylated modified BAF155 protein or an active fragment thereof according to claim 1, wherein deacetylation of the lysine at position 948 is achieved by a lysine deacetylase deacetylation modification.

3. A pharmaceutical composition comprising the deacetylated modified BAF155 protein or active fragment thereof according to claim 1.

4. The pharmaceutical composition of claim 3, further comprising a pharmaceutically acceptable diluent, excipient and/or carrier.

5. A formulation, characterized in that it deacetylates BAF155 protein, which deacetylated modified BAF155 protein or active fragment thereof comprises the amino acid sequence as shown in SEQ ID NO:1, wherein lysine at position 948 is deacetylated.

6. The formulation of claim 5, wherein the formulation comprises lysine deacetylase.

7. Use of a deacetylated modified BAF155 protein or an active fragment thereof according to claim 1 or 2, for the preparation of a medicament for the prevention or treatment of cardiac remodeling.

8. Use according to claim 7, wherein the cardiac remodeling is AngII-induced cardiac remodeling; and/or

The cardiac remodeling is selected from one or more of myocardial hypertrophy, cardiac fibrosis and/or heart failure

9. Use of the pharmaceutical composition of claim 3 or 4, the formulation of claim 5 or 6, in the manufacture of a medicament for preventing or treating cardiac remodeling.

10. The use of claim 9, wherein the cardiac remodeling is AngII-induced cardiac remodeling; and/or

The cardiac remodeling is selected from one or more of myocardial hypertrophy, cardiac fibrosis and/or heart failure.

Images